Fig. S1 (A) To investigate the hydrophilic of PGS after copolymerizing with different amount PEG, static

contact angle measurements using ultrapure water were conducted. Crosslinking polymer slices (1.0-

1.5 mm thickness) were prepared for analyzed by a contact angle measure instrument Phoenix 300

(Korea). Contact angle measurements indicate an increase in surface wettability due to the addition of

PEG as determined by the decrease in contact angle of water on PEGS. (B) Gel content in PGS, PEGS20

and PEGS40 respectively, indicating crosslink density of copolymer with different PEG content. Here,

samples (1.0-1.5 mm thickness and initial weight W0) were allowed to swell in THF for 7 days to elute

out the sol contents. The remaining gel contents were weighed after drying (Wd) the sample

overnight. The percentage of sol contents was calculated by Eq. (1): Sol (%) = (W0 − Wd)/ W0 × 100%.

(C) XRD patterns of crosslinked PGS and PEGS20 and PEGS40. (D) For PGS、PEGS20 and PEGS40, the

degradation study were carried out by immersing polymer slices in a Tris-HCl（pH = 8.0）solution. To

better mimic and predict the degradation behavior in vivo, enzymatic degradation of slices was

conducted under the presence of esterase according to a previous report [1]. The samples, after

recording their initial weight (W1), were soaked in buffer solution with/without the addition of

esterase at the concentration of 0.625 unit/mg PGS and PEGS. The buffer solution was renewed every

second day and esterase was added every day. The degradation study was carried out for 35 days

where the samples were taken out at specific time intervals, vacuum-dried overnight and weighed

(W2). The mass loss was calculated using Eq. (2): Mass Loss (%) = (W1 − W2)/ W1× 100% Comparison of

enzymatic/non-enzymatic degradation rate curves of PGS, PEGS20 and PEGS40 slices (1.0-1.5 mm

thickness) were shown and calculated to be about 1.46, 1.49 and 1.57 times compared to non-

enzymatic degradation. (The values represent the mean ± standard deviations (n=3); *p < 0.05, **p <

0.01, ***p < 0.001)

Fig. S2 (A) 3D topology of the porous CPC scaffold observed by micro-CT. (B-C) The surface

morphology of the porous CPC scaffolds by SEM with different magnitude (B × 40,C × 3000).

Homogeneous macropores with about 300-500 μm were distributed in the scaffold. And, many

micropores (2-5 μm) occurred on the struts of scaffold, which may be attributable to the

recrystallinity and leaching of the NaCl in the process of solidation. (D) XRD patterns of CPC scaffolds

from uncured to cured CPC (* for peaks of HA).

Fig. S3 Mechanical strength of CPC scaffold and CPX/Y scaffolds measured in different precondition.

(*P < 0.05)

Fig. S4 (A-C) Concentration-dependent ultraviolet absorption spectra of pre-PGS, pre-PEGS20 and pre-

PEGS40 solution and (D) corresponding linear fitting equation. The UV adsorption around 204-214 nm

came from carboxyl group and was irrelevant to polymer molecular weight. The dissolved polymer

concentrations of degradation liquor at different times were calculated by measuring 208 nm OD

value in PGS and 210 nm in PEGS20, PEGS40 respectively, and converted to the mass of degraded

polymer coating.

Fig. S5 (A) (A-B) PGS, PEGS40 degradation curves in CPX/Y hybrids scaffolds; (C-D) Mass loss weight

curves of CPC and CPX/Y scaffolds with inset of total CPC mass loss weight for 35 days. (*p < 0.05, vs.

the corresponding CPC group)

Fig. S6 (A-C) ALP activity was measured at 7 & 14 days after cell seeding on CPX/Y scaffolds. The

expression of osteogenic marker gene (D) Col I, (E) Runx2 and (F) OCN determined by real-time RT-PCR

analysis. The values represent the mean ± standard deviation (n = 4)

Fig. S7 Western blotting results for detection of Col I, Runx2 and OCN in cells cultured for 14 days. The

intensities of Col I, Runx2 and OCN protein were measured and normalized by GAPDH. Similar results

were obtained from three independent experiments (n = 3). Representative result is shown.

Fig. S8 Percentage of new bone area in histological analysis. The PEGS/CPC groups showed higher new

bone area than the other groups, and there were significant differences between the CP20/18 group

and the other three groups. (*P < 0.05, **P < 0.01, ***P < 0.001.)

Table Table S1 Primer sequences used in real-time quantitative reserve transcription-polymerase chain reaction (RT-qPCR).

Gene Direction Sequence(5'to3')

Collagen IForward TGGATGGCTGCACGAGT

Reverse TTGGGATGGAGGGAGTTTA

OsteocalcinForward GCCCTGACTGCATTCTGCCTCT

Reverse TCACCACCTTACTGCCCTCCTG

Runx2Forward ATCCAGCCACCTTCACTTACACC

Reverse GGGACCATTGGGAACTGATAGG

β-actinForward CACCCGCGAGTACAACCTTC

Reverse CCCATACCCACCATCACACC

Table S2 Summary of actual pre-polymer impregnated amount, scaffolds porosity, macropore parameters and mechanical strength.

Prepolymer Coating Solution

Ratio (Prepolymer mass/EtOH

volume, g/ml)

Coating Mass Percentage (%)

Mentioned in the article

as

Average Porosity

after coating

(%)

Average Mechanical

Strength (MPa) in as-prepared

scaffold

Average Fracture

Strain(%) in as-

prepared scaffold

Average Mechanical Strength (MPa) in hydrated scaffold

Average Fracture

Strain(%)in Hydrated scaffold

CPC N/A N/A CPC 72.29 0.78±0.02 5.47±1.13 0.37±0.22 2.19±1.32

0

0.1 5.86 CP0/6 71.03 1.86±0.06 5.58±1.24 1.63±0.12 4.07±0.51

0.2 12.33 CP0/12 69.54 2.52±0.11 6.21±1.71 2.17±0.21 3.82±0.23

0.4 18.77 CP0/18 66.70 3.39±0.18 7.62±1.34 2.91±0.18 5.19±2.63

0.8 24.01 CP0/24 58.32 3.82±0.12 6.75±1.09 2.71±0.23 6.53±1.28

20

0.1 5.52 CP20/6 70.58 1.63±0.07 7.69±0.73 1.25±0.17 4.76±0.27

0.2 11.53 CP20/12 67.38 2.49±0.12 11.50±2.54 1.85±0.12 5.63±1.92

0.4 18.23 CP20/18 65.87 2.90±0.10 10.73±1.53 2.14±0.40 5.28±1.67

0.8 25.75 CP20/24 60.72 3.40±0.15 11.25±2.09 1.88±0.10 8.40±3.53

40

0.1 5.27 CP40/6 71.93 1.30±0.14 7.75±1.82 0.90±0.19 3.81±1.58

0.2 11.62 CP40/12 69.15 2.29±0.29 9.33±3.56 1.15±0.26 3.07±0.86

0.4 18.48 CP40/18 64.71 2.51±0.15 11.60±2.74 1.70±0.35 5.12±1.46

0.8 24.93 CP40/24 62.98 2.57±0.28 13.20±3.20 1.25±0.38 8.12±2.42

Table S3 Mechanical behavior of the as-prepared CPC and CPX/24 scaffolds in large size (Ø10 × 6 mm)

CPC CP0/24 CP20/24 CP40/24

Average Mechanical Strength (MPa)

2.24±0.27 6.86±0.11 6.35±0.29 4.97±0.50

Average Fracture Strain (%)

19.33±2.08 30.33±4.20 39.29±6.06 43.86±6.32

Reference

[1] Liang SL, Yang XY, Fang XY, Cook WD, Thouas GA, Chen QZ. In Vitro enzymatic degradation of poly (glycerol sebacate)-based materials. Biomaterials. 2011;32:8486-96.