1. MOZHIARASU.S 313012 M.Tech I year FSQM

2. 2 Bacteria Fungi Protozoa Virus Outline: Introduction to PCR Sample Preparation Primer designing Factors involved PCR Types of PCR methods Review of PCR methods in Food Visualization Conclusion GM Foods 3. INTRODUCTION TO PCR 3 (L)- H.G Khorana (R)- K.Kleppe (L) K.Mullis (R) M.Smith Replication Of DNA 1993 4. 4 CONTd. DENATURATION OF DNA : 95oC ANNELING OF PRIMERS : 55-63oC ELONGATION OF NEW DNA : 72oC SAMPLE Preparation PCR in Thermocycler VISUALIZATION Primer F1 Primer R1 DNA Polymerase Template DNA dNTPs Mg2+ KCl 5. 5 SAMPLE PREPARATION COLLECTION OF FOOD SAMPLE PROCESS OF SAMPLE (Homogenization, Washing) CONCENTRATION OF PATHOGEN (Enrichment, Immunocapture, Buyont densitycentrifucation) TEMPLATE EXTRACTION (Heat, Detergent, Chemical, Solvent) CONCENTRATE TEMPLATE (Alcohol Precipitation, Binding Matrices) 6. 6 Ref: John Maurer,2009, PCR Methods in food 7. 7 Food Item PCR Inhibitor Method to Concentrate DNA Extraction method Pathogen with reference Diary Fat,Protein,Calciu m,Chelators Differential centrifugation Solvent based nucleic acid method Listeria (Koo.K et. al., 2013) Enrichment and centrifugation Commercial Kit Salmonella (Chen S et.al., ,1997) Meat and Poultry Fat, Proteins, Collagen, Blood Enrichment and centrifugation, Buoyant density centrifugation Guanidium isothiocynate and detergent extraction Listeria, Salmonella, E.Coli (Bhaduri S et.al., 2001, Chen S et.al.,1997) Camplylobacter (Uyttendaele. M et.al., 1999) Seafood (Phenolics, Cresols, aldehydes, Proteins, fats) Homogenization of food) Detergent extraction and Tween 20 Facilitator, Phenolics removed by solvent extraction Listeria (Simon K.C et.al., 1997) Grains (Proteins, Fats, Polysaccharides, Phenolics) Enrichment,Pulverisat ion Solvent based nucleic acid method Aspergillus Flavus (Shapira R, 1996) Vegetables (proteins, fats) Enrichment, Bath sonication Solvent Extraction Cryptosporodium (Robertson L.J, 2001) GM Soya (Proteins, Fats, Phenolics) N/A Kit Based method (DNeasy Plant mini kit, Qiagen) GM Soya and GM maize (Volenhaufer, 1999) 8. 8 PRIMER DESIGNING Important Parameter for PCR Length 17-30 nucleotides Stable duplex between Oligo and Template target region but not other primer or other target site DUPLEX GC/AT Ratio Free Energy for duplex formation G Tm (Tm = 81.5C + 16.6C x (log10[Na+] + [K+]) + 0.41C x (%GC) 675/N) Less dimer between Forward and Reverse primers Less Self complementarity GC clamp (G or C at 3 terminus) Unique primer PROGRAMS:Primer3(http://primer3.wi.mit.edu/) 9. 9 Procuring sequencing from database NucleotideBLAST Enter Parameter Primer 3 Picking the right Primer 10. 10 Factors involved the PCR: Primer Temperature profile DNA polymerase (1- 4 U) MgCl2 concentration (1mM - 4mM) Amount of DNA template (10pg - 1 g) PCR enhancer (Glycerol, DMSO) PCR inhibitors Ref: Current Protocols in Molecular Biology,2001 11. 11 TYPES OF PCR METHODS Hot Start PCR: At normal room temperature, mismatched primer and will be extended. DNA Polymerase will be added after the first denaturation. Nested PCR: Second Primer (F2,R2) specific to the first PCR product will be designed. Multiplex PCR: Simultaneous amplification of many targets of interest in one reaction by using more than one pair of primers. Reverse Transcriptase PCR: Based on the process of reverse transcription, which reverse transcribes RNA into DNA and was initially isolated from retroviruses. first strand reaction (Synthesis of cDNA) Second Strand reaction(Digestion of hybrid nucleic acid RNaseH, PCR) 12. 12 Quantitative PCR: Both identification and quantification of DNA synthesis 1. double-stranded DNA-binding dyes as reporters SYBR Green- Blue light (max = 488 nm) and emits green light (max = 522 nm) 2. Fluorescent reporter probe method TAQMAN ASSAY MOLECULAR BEACON RFLP PCR: PCR Restriction enzymes Profiling 13. 13 Pathogen Target Gene Primer Sequence Reference Bacillus cereus 16S rRNA F: TCGAAATTGAAAGCGGC R: GGTGCCAGCTTATCAAC Hensen 2001 cerAB F: GAGTTAGAGAACGGATTTATGCTGC R: GCATCCCAAGTCGCGTATGTCCAG Schart 1995 Clostridium perfringens (Mashed Pork) pls Cpe F1: AAGTTACCTTTGCTGCATAATCCC R1: ATAGATACTCCATATCATCCTGCT R1: ATAGATACTCCATATCATCCTGCT F2: GAAAGATCTGTATCTACAACTGCTGGTCC Fach 1997 Salmonella random sequence fliC(S.typhimu rium) SefA (S. enteritidis) F1:GCCAACCATTGCTAAATTGGCGCA R1:GGTAGAAATTCCCAGCGGGTACTGG F2:CGGTGTTGCCCAGGTTGGTAAT R2:ACTCTTGCTGGCGGTGCGACTT F3:AGGTTCAGGCAGCGGTTACT R3:GGGACATTTAGCGTTTCTTG Soumet, 1999 REVIEW OF PCR METHODS IN FOOD 14. 14 GM Food Soya Bean Maize Soybean lectin Maize invertase CaMV 35S Promotor A.tumefaciens NOS terminator NPTII BT Cry 1 A F1: GTG CTA CTG ACC AGC AAG GCA AAC TCA GCG R1: GAG GGT TTG GGG C7G CCC TTF TCG TCA AC F1: GGC CGG ATC TC ATG CTC TAC A R1: TTG GCG TCC GAC TTG ACC CAC T F2: CCG ACA GTG GTT CCA AAG ATG GAC R2: ATA TAG AGC AAG GCT CTT GCG AAG G F1: ACC TOT CGO GTG CCC TGA ATO AAC TGC R2: GCC ATO ATC CAT ACT TTC TCC GCA GGA CC F1:CCG TGA CCC ATC TTC TGA TTT GTC GCC AT R2: CAG TGC GAC CCC TTC CTG GTG CAC ATC Vollenhoffer, 1999 White Spot Syndrome(Bacul o) Virus (Shrimp) SalI DNA fragment in recombinant plasmid (pms146) Unknown sequence F1: ACT ACT AAC TTC AGC CTA TCT AG R1:TAA TGC GGG TGT AAT GTT CTT ACG F2: GTA ACT GCC CCT TCC ATC TCC R2: TAC GGG AGC TGC TGC ACC TTG T Lo et.a.,l 1996 15. 15 Aspergillus flavus and A.parasiticus (Maize) Ver 1 apa 2 omt 1 F1- ATGTCGGATAATCACCGTTTAGATGGC R1:CGAAAAGCGCCACCATCCACCCCAAT G F2: TATCTCCCCCCGGGCATCTCCCGG R2: CCGTCAGACAGCCACTGGACACGG F3: GGCCCGGTTCCTTGGCTCCTAAGC R3: CGCCCCAGTGAGACCCTTCCTCG Shapira R, 1996 Cyclospora cayetanensis& Cryptosporidiu m parvum (Rasberries) F1: TACCCAATGAAAACAGTTT R1: CAGGAGAAGCCAAGGTAGG F2: AGCTCGTAGTTGGATTTCTG R2: TAAGGTGCTGAAGGAGTAAGG Orlandi, 2000 Hepatitis A (Shell fish) F1: TATTTGTCTGTCACAGAACAATCAG R1: AGGAGGTGGAAGCACTTCATTTGA Kinsley, 2001 16. Agarose Gel Electrophoresis PCR-ELISA Real time PCR TRFLP-PCR (Automated Sequencer) MICRO ARRAY 16 Visualization 17. Conclusion 17 PCR vs General Microbiological method Conventional PCR vs Real Time PCR Validation False-Positives and Dead vs. Live Bacterial Cell Debate (McKillp J.L,1999,1998)- EMA PCR Setting Up of laboratory 18. 18