1

Anti-Cancer Activity of PAK4/NAMPT Inhibitor and Programmed Cell Death Protein-1

Antibody in Kidney Cancer

Josephine F. Trott*1, Omran Abu Aboud*1, Bridget McLaughlin2, Katie L. Anderson5,6,7,8‡, Jaime

F. Modiano5,6,7,8,9, Kyoungmi Kim3, Kuang-Yu Jen4, William Senapedis10, Hua Chang10, Yosef

Landesman10, Erkan Baloglu10, Roberto Pili11, and Robert H. Weiss1,2,12

1Division of Nephrology, Department of Internal Medicine, 2Comprehensive Cancer Center and 3Division

of Biostatistics, Department of Public Health Sciences and 4Department of Pathology and Laboratory

Medicine, University of California, Davis, CA, USA, 95616

5Animal Cancer Care and Research Program and 6Department of Veterinary Clinical Sciences, College of

Veterinary Medicine, University of Minnesota, St Paul, MN

7Masonic Cancer Center, 8Center for Immunology and 9Stem Cell Institute University of Minnesota,

Minneapolis, MN

10Research and Translational Development, Karyopharm Therapeutics, Inc, Newton, MA 02459

11Indiana University, School of Medicine, Simon Cancer Center, Indianapolis, IN

12Medical Service, VA Northern California Health Care System, Sacramento, CA, USA, 95655

*Equal contribution

‡Current address: North Carolina State University College of Veterinary Medicine. 1060 William Moore

Drive Raleigh, NC 27607

Please address editorial correspondence to:

Dr. Josephine F Trott Department of Animal Science 450 Bioletti Way University of California, Davis, CA. 95616 JFTROTT@UCDAVIS.EDU

Kidney360 Publish Ahead of Print, published on March 27, 2020 as doi:10.34067/KID.0000282019

Copyright 2020 by American Society of Nephrology.

2

ABSTRACT

Background

Kidney cancer (or renal cell carcinoma, RCC) is the sixth most common malignancy in the US

and is increasing in incidence. Despite new therapies, including targeted and immunotherapies,

most RCCs are resistant to treatment. Thus, several laboratories have been evaluating new

approaches to therapy, both with single agents as well as combinations. While we have

previously shown efficacy of the dual PAK4/NAMPT inhibitor KPT-9274, and the immune

checkpoint inhibitors (CPI) have shown utility in the clinic, there has been no evaluation of this

combination either clinically or in an immunocompetent animal model of kidney cancer.

Methods

In this study we utilize the RENCA model of spontaneous murine kidney cancer. Male BALB/cJ

mice were injected subcutaneously with RENCA cells and after tumors were palpable, they were

treated with KPT-9274 and/or anti-programmed cell death 1 (PDCD1; PD1) antibody for 21

days. Tumors were measured and then removed at animal sacrifice for subsequent studies.

Results

We demonstrate a significant decrease in allograft growth with the combination treatment of

KPT-9274 and anti-PD1 antibody without significant weight loss by the animals. This is

associated with decreased (MOUSE) Naprt expression, indicating dependence of these tumors

on NAMPT in parallel to what we have observed in human RCC. Histology of the tumors

showed substantial necrosis regardless of treatment condition, and flow cytometry of antibody

stained tumor cells revealed that the enhanced therapeutic effect of KPT-9274 and anti-PD1

antibody was not driven by infiltration of T cells into tumors.

Conclusion

3

This study highlights the potential of the RENCA model for evaluating immunological responses

to KPT-9274 and CPI and suggests that therapy with this combination could improve efficacy in

RCC beyond what is achievable with CPI alone.

KEYWORDS

Renal carcinoma, Immunology and Pathology, Lymphocytes, Metabolism

ABBREVIATIONS

RENCA, renal cell adenocarcinoma; CPI, checkpoint inhibitor; PD1, programmed cell death 1;

PD-L1, CD274 molecule

4

INTRODUCTION

Recent advances in immunotherapy have revolutionized the field of cancer treatment.

Using antibodies against programmed cell death 1 (PDCD1; PD1) and/or programmed cell death

1 ligand 1 (CD274; PD-L1) to block the inhibition on immune recognition of tumor cells (i.e.

immune checkpoint) results in clearance of a wide range of tumor types by T cells (1). Specifically,

immune checkpoint inhibitors (CPI) have shown promise in multiple clinical trials of patients with

renal cell carcinoma (RCC) with objective response rates of 12-31% (2). Unfortunately, in RCC

patients, complete responses to a single PD1/PD-L1 antibody in the absence of an accompanying

conventional or targeted therapeutic are rare (2). For this reason, many clinical researchers are

investigating the treatment of RCC using combinations of CPI, with angiogenesis inhibitors (2) or

with targeted agents.

KPT-9274 is an orally bioavailable small-molecule that modulates the activities of both p21

(RAC1) activated kinase 4 (PAK4) and nicotinamide phosphoribosyltransferase (NAMPT;3). KPT-

9274 reduces the steady-state level of PAK4 in breast cancer cells (4) and kidney cancer cell lines

(3). KPT-9274 has also been shown to have potent antitumor activity in murine xenograft models,

including RCC (3-10), and in trials of companion dogs with lymphoma (11). KPT-9274 is currently

in a phase I study (NCT02702492) to assess the safety, tolerability and preliminary efficacy in

patients with advanced solid malignancies or non-Hodgkin’s lymphoma (NCT02702492; 12).

NAMPT catalyzes the rate-limiting step in the main salvage pathway used to produce

NAD+, an essential co-enzyme in energy-producing catabolic reactions (13). In vertebrates,

NAD+ can be synthesized de novo from tryptophan or salvaged from nicotinamide (through

NAMPT), nicotinic acid (through nicotinate phosphoribosyltransferase or NAPRT) or nicotinamide

riboside (through nicotinamide riboside kinase; 3, 13). Cancer cells preferentially generate NAD

through nicotinamide and NAMPT, most likely because de novo NAD+ synthesis occurs

predominately in the liver and NAPRT is often epigenetically downregulated in cancer cells

5

through hypermethylation of the NAPRT promoter (found in 5 – 65% of samples tested, depending

on tumor type). This correlates with low NAPRT expression in these lines and tumor samples (14).

We have previously shown that two human renal cell carcinoma (RCC) cell lines have very low

levels of NAPRT expression, and treatment with KPT-9274 reduces proliferation and induces

apoptosis in these cells (3). Additionally, a selective inhibitor of NAMPT (FK866/APO866) was

found to have anti-tumorigenic, anti-metastasis and anti-angiogenic activity in a syngeneic mouse

model of renal adenocarcinoma (RENCA) (15).

The signaling molecule PAK4 is involved in multiple pathways, including WNT/β-catenin

signaling (16) whose target genes include cyclin D1 and c-Myc (17), both of which have key roles

in cell proliferation (18). PAK4 regulates the activity of CDKN1A (p21) and thereby regulates

normal progression of the cell cycle (19). PAK4 has also been implicated in the oncogenic

transformation of cells (20, 21). In a recent publication, the epithelial-to-mesenchymal transition

(EMT) of gastric cancer cell lines was correlated to loss of NAPRT expression (22). The authors

suggested that NAPRT expression destabilizes β-catenin and acts as a tumor suppressor protein

prior to cells undergoing the EMT phenotypic change. However, when NAPRT is lost through the

dynamic process of epigenetic silencing (possibly through selective pressure on cancer cells), β-

catenin is stabilized, resulting in EMT expression in these cell lines. At the same time the EMT

cells become sensitive to NAMPT inhibition (22). PAK4 also affects β-catenin stability by inhibiting

degradation of β-catenin (16, 23).

Recently, a correlation was reported between activation of the PAK4 and WNT/β-catenin

signaling pathway and T cell exclusion in melanoma patient samples (24, 25). The low immune

cell infiltration is also associated with resistance to PD-L1/CTLA-4 antibody therapy (24). This

correlation has been further validated in other cancer types including breast, colorectal, non-small

cell lung, and RCC (26), and these data suggested that combination therapies in which activated

β-catenin is inhibited simultaneously with targeting PD1, as we have investigated in this study,

6

may be particularly effective. Thus, PAK4/WNT/β-catenin, NAMPT, and the immune system seem

to converge making KPT-9274 and immune CPI combination a viable therapy for RCC patients.

In this study, we show that PD1 inhibition enhances the anti-tumor effect of the novel RCC

therapeutic KPT-9274, which specifically targets tumors because they have undergone metabolic

reprogramming of the NAD+ biosynthesis pathway. Thus, combination immunotherapies utilizing

dual PAK4/NAMPT inhibition as well as CPI antibodies are now primed to be studied in the

oncology clinic.

MATERIALS AND METHODS

Tissues and Cells

Mouse RENCA-luciferase (RENCA-luc) cells were derived from a spontaneous kidney

adenocarcinoma in BALB/cCr mice (27-29), and were authenticated by STR and species

analysis (IDEXX BioAnalytics, Colombia, MO). They were injected into mice at passage 4-6.

RCC cell lines (786-O, Caki-1 and ACHN) were purchased from and authenticated by ATCC

and passaged less than 20 times. All cells were confirmed mycoplasma-free, handled one-at-a-

time in the cell culture hood, each with their own media and trypsin bottle. Tissues from human

clear cell RCC (ccRCC) tumors and normal human kidney tissues (adjacent to a tumor) were

archived following IRB approval at the UC Davis Department of Pathology.

In vivo experiments

Animal experiments were performed in accordance with guidelines set forth by the

Institutional Animal Care and Use Committee at UC Davis. Six-week old male BALB/cJ mice

(Jackson Laboratories, Bar Harbor, ME) had ad libitum access to standard laboratory mouse

chow and water. RENCA-luc cells (2.5 x 105) were injected in 100 µl of OptiMEM with 33% BD

Matrigel Matrix (Corning, Tewksbury, MA) subcutaneously in the right flank of male mice when

they reached 8-weeks of age. Male mice were used because RCC is more severe and twice as

7

common in men than women (30). Treatments were started 10 days after injection. Four

separate batches of mice were injected with RENCA-luc cells and then treated. Treatments

were assigned randomly to mice within each batch. Anti-mouse PD1 or isotype control antibody

(250 µg/dose) was injected IP twice a week. KPT-9274 (200 mg/kg) or vehicle was administered

orally twice a day 5 days/week. Mice were weighed at the start of the treatment period and once

a week thereafter. Subcutaneous tumors were measured (length and width) in situ every 2-3

days using calipers and tumor volume was calculated using the formula ½*length*width2.

RENCA tumors were dissected from BALB/cJ mice after 21 days of treatments. The length,

width and depth of tumors were measured using a caliper, and tumor volume was calculated

using the formula 4/3*3.142*(length/2)*(width/2)*(depth/2). Tumors were dissected and a small

piece was frozen, a second small piece was fixed in 10% formalin for histology and

immunohistochemistry and the remainder was processed for flow cytometry. Spleens were also

harvested, either for flow cytometry or fixed in 10% formalin.

Immunohistochemistry

Formalin-fixed paraffin-embedded sections (5 μm) were cut from untreated BALB/cJ

mouse RENCA tumors. Immunohistochemistry was performed as previously described (31)

using the following antibodies, Ki67 (Cell Marque, 275R-18), PD-L1 (Cell Signaling Technology,

13684) and PD-L2 (Cell Signaling Technology, 82723).

Isolation of tumor-infiltrating cells and flow cytometry

Tumors and spleens were harvested, mashed against a size 60 mesh stainless steel

screen (Sigma-Aldrich) and passed through a 100-µm cell strainer (ThermoFisher Scientific).

Red blood cells were lysed using ammonium chloride potassium lysis buffer and cells

resuspended in PBS for staining with Aqua zombie (Biolegend Inc). Non-specific staining was

blocked using mouse gamma globulin (Jackson Immunoresearch Laboratories) and cells were

stained in staining buffer (PBS, 3.5% FBS, 1 mM EDTA) with a panel of antibodies purchased

8

from Biolegend Inc, except where indicated: anti-CD45-Alexa Fluor 700 (clone 30-F11), anti-

CD11b-APC/Fire 750 (clone M1/70), anti-CD4-PE (clone RM4-4), anti-CD19-FITC (clone 6D5),

anti-CD25-PE/Cy7 (clone PC61.5; eBiosciences), anti-CD3ε-Brilliant Violet 421 (clone 145-

2C11), anti-CD8a-Brilliant Violet 605 (clone 53-6.7). The stained cells were then fixed using

Foxp3/Transcription Factor Staining Buffer Set (eBioscience) and stained for intranuclear

staining with anti-FoxP3-APC (clone 3G3; ThermoFisher Scientific). Stained cells were analyzed

using a BD LSRII flow cytometer (BD Biosciences, San Jose, CA), and data processed using

Flowjo software (Treestar, Ashland, OR). The gating strategy for spleens and tumors is depicted

in Supp Fig. 1 and all populations of immune cells are expressed as a percentage of the total

number of single cell, live CD45+ lymphocytes.

RNA extraction, Reverse Transcription and Quantitative PCR (qPCR)

RNA extraction, reverse transcription and qPCR were performed as previously described

(32, 33). Primer sequences, annealing temperatures and efficiency of amplification for NAMPT,

NAPRT, Nampt and Naprt are in Table 1. The (HUMAN)NAMPT primers amplify 9 potential

transcripts including the full-length protein coding transcript. The (HUMAN)NAPRT primers

amplify 11 potential transcripts including the full-length protein coding transcript. The

(MOUSE)Nampt and Naprt primers amplify the single protein coding transcript in each case.

Immunoblotting

Immunoblotting was performed as previously described (34). Briefly, tumors and kidneys

were homogenized in T-PER buffer (ThermoFisher Scientific). PVDF membranes were blocked

in 5% milk and probed with appropriate primary and secondary antibodies. Signal was detected

with ECL using either a Fuji Imager, or x-ray film and ImageJ to quantify band intensity. Phospho-

β-catenin and PAK4 antibodies (Cell Signaling Technology, Danvers, MA) were probed at 1:1000.

Rabbit anti-NAMPT (Bethyl Laboratories Inc., Montgomery, TX) was probed at 1:2000. Rabbit

polyclonal anti-NAPRT (ThermoFisher Scientific PA5-70595) was probed at 1:500. Mouse anti-β-

9

actin (Sigma-Aldrich) was probed at 1:4000. Rabbit anti-β-actin (Cell Signaling Technology) was

probed at 1:2000.

Oxidized (NAD+) and Reduced ß-nicotinamide Adenine Dinucleotide (NADH) Assay

Total NAD+NADH was quantified in tumor extracts using the NAD/NADH Glo Assay kit

(Promega) following the manufacturer’s instructions. Briefly 10-30 mg of tumor tissue was

homogenized in 1-5 ml of a 50:50 mixture of PBS pH 7.4 and bicarbonate base buffer with

dodecyltrimethylammonium bromide (DTAB; Sigma-Aldrich) (1% DTAB, 100 mM sodium

carbonate, 20 mM sodium bicarbonate, 10 mM nicotinamide (Sigma-Aldrich), 0.05% Triton® X-

100). Four dilutions of the tumor homogenates were assayed against a standard curve of NAD+

(Sigma-Aldrich), prepared in a 50:50 mixture of PBS:bicarbonate base buffer with DTAB (0 - 400

nM). NAD+NADH values were normalized to protein concentrations that were measured using

the DC protein assay (Bio-Rad).

MTT Assay

Cells (1.4x103) were plated in 96-well plates and the next day KPT-9274 was added to

fresh media in a range of concentrations (0-10 µM). Three days later cells were stained with

Thiazolyl Blue Tetrazolium Bromide (MTT) as previously described (35).

Bisulfite Genomic DNA modification, Methylation Specific PCR and Quantitative Methylation

Specific PCR

Genomic DNA (gDNA) was extracted from ccRCC tumors, RENCA tumors (untreated

mice), normal kidneys (human and BALB/cJ mice) and the RCC cell lines Caki-1, 786-O and

ACHN. Each human gDNA sample (1 µg) was methylated using CpG Methyltransferase

(M.SssI) following the manufacturer’s instruction (New England Biolabs, Ipswich, MA). For each

human sample an equal mass of both 100% methylated gDNA and untreated gDNA (range of

376-826 ng) were bisulfite-converted along with mouse gDNA (500 ng) using the Zymo EZ DNA

Methylation kit (Zymo Research), and eluted in 20 μl. MethPrimer (36) predicted CpG islands in

10

the first exon of both (HUMAN)NAPRT and (MOUSE)Naprt and primers were designed for both

methylated and unmethylated (MOUSE)Naprt and for methylated (HUMAN)NAPRT (Table 2).

The (MOUSE)Naprt primers were located in exon 1, 26-27 bp upstream and 78-79 bp

downstream of the translation start site. The (HUMAN)NAPRT primers were located in exon 1,

56-123 bp downstream of the translation start site. The methylation specific PCR (MSP)

reactions were performed on mouse gDNA using EpiMark Hot Start Taq Polymerase (New

England Biolabs) on 2 μl of bisulfite-modified DNA with 200 nM of primers specific for

methylated (M) or unmethylated (U) (MOUSE)Naprt. PCR reactions were heated to 95oC for

30s, then 40 cycles of 95oC 15 s, annealing for 30s (U) or 60s (M) and 68oC for 30 s, followed

by a final extension of 68oC for 5 min. The Quantitative MSP (qMSP) reactions were performed

on 100% methylated and untreated human gDNA using Power SYBR Green Master Mix

(ThermoFisher) on 1 μl of bisulfite-converted gDNA with 400 nM of primers specific for

methylated (HUMAN)NAPRT or 250 nM of (HUMAN)ACTB primers. PCR reactions were heated

to 95oC for 10 min, then 40 cycles of 95oC 15 s, annealing/extension for 1 min. The %

methylation of each human gDNA sample was calculated using the 2-ΔΔCT method.

(HUMAN)NAPRT methylation (Ct) was corrected for (HUMAN)ACTB (Ct) and then the fraction

of methylation in untreated gDNA (if >0) was calculated relative to the 100% methylated gDNA

for each sample.

Statistics

Statistical analyses of data were performed with SAS software, version 9.3 (SAS

Institute, Cary, NC). Data were transformed to achieve normality and homogeneity of variance

prior to statistical analysis. Outliers in the flow cytometry data sets were assessed using Prism8

(GraphPad Software). Tumor growth and size data were analyzed using mixed-effects models

with repeated measures followed by a post-hoc Tukey test while controlling for multiple testing.

Treatment, day and batch were considered fixed effects, while cage was considered a random

11

effect. Similarly, data for in situ and ex vivo tumor sizes on individual days and flow cytometry

data were analyzed using a mixed-effects model followed by a post-hoc Tukey test.

Immunoblotting and NAD+NADH assay data was analyzed for main effects of PD1 antibody

(present/absent) and KPT-9274 treatment (present/absent) and its interaction using a two-way

factorial ANOVA (PROC GLM) and a post-hoc Tukey test. Two-tailed p-values less than 0.05

were considered statistically significant as appropriate.

RESULTS

NAMPT and NAPRT expression in human and murine kidney cancers

We have previously demonstrated growth attenuation of human ccRCC cell line murine

xenografts in response to KPT-9274 administration (3), however we did not assess NAMPT and

NAPRT expression. Herein, we evaluated these genes in archived human ccRCC tumors and

normal kidneys using qPCR. No significant differences were observed in either NAMPT (Fig.

1A) or NAPRT mRNA (Fig. 1B) expression between normal kidneys and ccRCC tumors of

grades 1-4. However, six out of nineteen (31%) ccRCC tumors ranging from grades 1 to 4 had

at least 25% lower NAPRT mRNA expression than the lowest expressing normal kidney sample

(Fig. 1B). These low expressing NAPRT tumors were found across all four grades of ccRCC.

We next examined the methylation status of the NAPRT promoter in normal kidney samples,

ccRCC tissue and cell lines. We used qMSP to measure the relative percent of methylation and

found that the NAPRT promoter was unmethylated in normal human kidneys. However NAPRT

was hypermethylated in all ccRCC tumors and cell lines with low expression of NAPRT mRNA

but only minimally methylated in ccRCC tumors with high expression of NAPRT (Fig. 1C).

We chose the RENCA mouse model of RCC (32) to test the effects of KPT-9274 in

combination with an immunotherapeutic since these cells represent a syngeneic tumor in an

immunocompetent mouse, whereas “standard” immunodeficient xenografted nude mice would

12

be ineffective for evaluating an immunotherapeutic. The RENCA tumors were found to be highly

proliferative in the mouse as evidenced by Ki67 staining, associated with a relatively high level

of PD-L1 expression with PD-L2 expression confined to stromal cells (Fig. 2). We next

examined the expression of both MOUSE Nampt and Naprt in RENCA tumors and normal

mouse kidneys and found that RENCA tumors expressed Nampt at a similar level to that in the

normal kidney, both at the protein and mRNA levels (Fig. 3A). However, RENCA tumors have

downregulated expression of NAPRT compared with normal kidney tissue (Fig. 3A) while Naprt

mRNA expression is >6-fold lower in RENCA tumors vs kidneys (Fig. 3B). These protein

expression data are consistent with what we previously observed in human RCC cell lines (3).

We next examined whether the observed downregulation of (MOUSE)NAPRT was due to

methylation of the promoter, as we have already demonstrated was present in the human

ccRCC tumors. A CpG island was found in exon 1 of the Naprt gene, in a similar location to the

NAPRT gene. The gDNA from RENCA cells was subjected to methylation-specific PCR analysis

and found to contain methylated Naprt promoter sequences (data not shown). When we

analyzed gDNA from three mouse kidneys using MSP we found they contained unmethylated

Naprt gDNA while three RENCA tumors were found to contain both unmethylated and

methylated Naprt gDNA (Fig. 3C). Thus, as with human ccRCC, in RENCA tumors the

downregulation of Naprt at the level of transcription is also associated with methylation of the

promoter.

We measured the effect of KPT-9274 on RENCA-luc cell growth in vitro and found that

the viability of RENCA-luc cells was attenuated by KPT-9274 in a concentration-dependent

manner (Supp Fig. 2). This is evidence that the loss of the NAPRT pathway through epigenetic

changes not only sensitizes human RCC to NAMPT inhibition but may be directly recapitulated

in this syngeneic mouse model of RCC. Based on our in vitro data as well as in vivo data on

subcapsular growth of RENCA in the syngeneic mouse previously described (15), we expected

13

that the subcutaneous RENCA tumor model would respond well to NAMPT inhibition with KPT-

9274 (3).

RENCA tumor growth is attenuated by KPT-9274

For the in vivo model, cultured RENCA-luc cells were injected subcutaneously in

BALB/cJ mice. After palpable tumors appeared (in 10 days), the mice were then treated for 21

days with either KPT-9274 or anti-PD1 antibody or a combination of both agents (see Materials

and Methods). The tumors were measured with calipers every two to three days (Supp Fig. 3;

Fig. 4A). An analysis of the tumor growth data using repeated measures over time

demonstrated that there were significant effects of day and treatment on tumor sizes

(p<0.0001), but no interaction between day and treatment (p=0.98). The combined treatment

with KPT-9274 and anti-PD1 gave significantly smaller tumors than KPT-9274 alone (p=0.001),

anti-PD1 alone (p<0.0001) or control treatments (p<0.0001). When tumor sizes were analyzed

at each day of measurement, there was an effect of KPT-9274 on tumor growth (p<0.03) on

days 14, 17, 19 and 21 and there was also an interaction between anti-PD1 and KPT-9274 to

reduce tumor growth on days 19 and 21 (p<0.05; Fig. 4A). No significant changes in weight

were observed due to treatment, suggesting a lack of general toxicity of the treatments (Fig.

4B).

The RENCA tumors were removed and measured at necropsy 21 days after starting

treatment. In this analysis, we found that there was an effect of KPT-9274 on tumor size

(p=0.0014) and evidence of a possible interaction between anti-PD1 and KPT-9274 (p=0.088).

The combination treatment (KPT-9274 and anti-PD1) was more effective at decreasing tumor

growth than either anti-PD1 alone (p=0.0012) or KPT-9274 alone (p=0.0164; Fig. 4C).

RENCA tumors were highly necrotic

Formalin-fixed, paraffin-embedded tissue sections stained with hematoxylin and eosin

were evaluated by a pathologist (K.-Y.J). All tumor samples showed pronounced areas of

14

geographic necrosis admixed with areas of viable tumor, which did not correlate with specific

treatments (Supp Fig. 4).

Effects of treatments on tumor infiltrating T cell populations

RENCA tumors were dispersed to single cells and stained to detect live CD45+

lymphocytes that were further gated on CD11b, CD19, CD3, CD4, CD8, CD25 and FoxP3

(Supp Figs 1A and B). Data are expressed as a % of live CD45+ lymphocytes. The gating is

described in Supp Fig. 1. The infiltration of CD3lo&CD3high cells into tumors was heterogenous

in all treatment groups (Fig. 5A). They had a bimodal distribution (either <20% CD3+ or >40%

CD3+) which was most accentuated in the tumors from KPT-9274 treated mice. The infiltration

of CD8+ cells was low in most tumors and heterogeneous with a bimodal distribution (either

<1% CD8+ or >2% CD8+). This bimodal distribution was accentuated by the addition of KPT-

9274 and anti-PD1, resulting in significantly more CD8+ cells in the combination treatment

group compared to KPT-9274 alone (Figs 5A and B). The infiltration of Treg cells was also very

low (<2% of all CD45+ tumor infiltrating lymphocytes), although they too had a bimodal

distribution in different tumors (<0.35% and >0.5%) which was accentuated somewhat in the

combination treatment group (Fig. 5A).

Tumor expression of Pak4 and phospho (P)-β-catenin was reduced by KPT-9274

KPT-9274 treatment of RCC cells is known to reduce PAK4 protein levels and interfere

with the WNT/β-catenin signaling pathways (3). Proteins from the RENCA tumors were

immunoblotted to examine levels of PAK4 and phospho (P)-β-catenin (Fig. 6 and Supp Fig. 5).

We measured PAK4 and (P)-β-catenin in the tumors from 24 mice in the four treatment groups

(n=6 per group; Supp Fig. 5). As expected, there was a effect of KPT-9274 causing a reduction

in Pak4 expression levels (p=0.04; Fig. 6A) as well as inhibiting the phosphorylation of β-catenin

(p=0.02; Fig. 6B).

Tumor levels of NAD+NADH were reduced by KPT-9274 and increased by PD1 antibody

15

In addition to reducing levels of PAK4, KPT-9274 also inhibits the enzymatic activity of

NAMPT and represses NAD biosynthesis. To confirm NAMPT inhibition in vivo, we examined

the NAD+NADH levels in RENCA tumors from mice. When we examined NAD+NADH levels in

response to each treatment individually, the NAD+NADH levels in RENCA tumors were lower in

mice treated with KPT-9274 compared to anti-PD1 (p=0.01; Fig. 7). We also found, as in other

models, that total NAD+NADH was decreased by a main effect of KPT-9274 treatment (p=0.02;

Fig. 7). Interestingly, the NAD+NADH levels in RENCA tumors were increased by a main effect

of the anti-PD1 antibody (p=0.02; Fig. 7).

DISCUSSION

In this study, we found a significant interaction between the dual PAK4 and NAMPT

inhibitor, KPT-9274, and an antibody against PD1 that slowed the growth of RENCA tumors in a

syngeneic mouse model of renal cancer. This is in line with a recent report describing mouse

models of melanoma and colon adenocarcinoma, where KPT-9274 improves the response to anti-

PD1 therapy to reduce tumor growth (24). This was accompanied by a KPT-9274-driven decrease

in PAK4 expression and β-catenin activation. Interestingly, while KPT-9274 reduced total

NAD+NADH as expected, there was not an overall decrease in total NAD+NADH in the

combination treatment (KPT-9274+anti-PD1), possibly due to the inhibitory effect of KPT-9274 on

energy metabolism being off-set by a stimulatory effect of anti-PD1. To our knowledge, this is the

first evidence that PD1 antibody therapy may be linked to increases in NAD+. Therefore, two

mechanisms may be occurring independently in these tumors: first, the inhibition of

(MOUSE)NAMPT activity by KPT-9274 which decreases NAD+NADH in the tumor cells (because

the RENCA cells are lacking NAPRT) and, second, the PD1 antibody may have re-engaged T cell

activation and possibly increased NAD+NADH levels even in the presence of KPT-9274, because

16

T cells have normal levels of NAPRT. Increased NAD+ may actually enhance the anti-tumor T

cell response (37), another salutary effect of this combination therapy.

Data from breast, colorectal, non-small cell lung, and RCC tumors (26), has suggested that

combination therapies in which activated β-catenin is inhibited simultaneously with targeting PD1

can be particularly efficacious. In the RENCA model we found the effects of PD1 blockade was

unpredictable with only ~25% of tumors responding (Fig. 4C). The effect of anti-PD1 on T cell

infiltrates was minimal but the combination of anti-PD1 and KPT-9274 increased CD8+ infiltration

in ~50% of animals (Fig. 5A). However, the tumors that responded to the anti-PD1+KPT-9274

treatment were not the tumors with increased T cell infiltration (data not shown). Similarly, the

tumor size response to treatment (Fig. 4A; Supp Fig. 3) did not display the same bimodal

distribution observed in the infiltrated T cells (Fig. 5). Thus the effectiveness of the combination

treatment is possibly associated with direct anti-tumor effects of KPT-9274 perhaps stimulating

more robust T cell activity which may be enhanced by anti-PD1. Further experiments would

greatly assist in exploring these possibilities.

NAMPT transfers a phosphoribosyl residue from 5-phosphoribosyl-1-pyrophosphate to

nicotinamide which produces nicotinamide mononucleotide. Nicotinomide mononucleotide

adenylyl transferase converts nicotinamide mononucleotide into NAD+ (38). An alternative NAD

biosynthesis pathway employs the three step Preiss-Handler pathway that starts with NAPRT

acting on nicotinic acid to generate nicotinic acid mononucleotide, which is then converted to

nicotinic acid adenine dinucleotide and subsequently to NAD+ (39, 40). This pathway can also

salvage NAD+ from nicotinamide by using a gut bacterial nicotinamidase to convert nicotinamide

to nicotinic acid (13). A subset of non-small cell lung carcinoma, small-cell lung carcinoma, breast

cancer, pancreatic cancer, glioma and fibrosarcoma cell lines have epigenetic downregulation of

the NAPRT promoter, which correlates with low NAPRT expression in these lines (14, 41), as we

found in a sub-set of human ccRCC patients (Fig. 1) and RENCA cells (Fig. 3). In these patients,

17

NAMPT inhibitors may be particularly efficacious at inhibiting tumor growth because one salvage

pathway for NAD biosynthesis is severely reduced. The supplementation of nicotinic acid to

patients can mitigate the potential toxic side effects of NAMPT inhibition in non-target tissues that

still express NAPRT while the tumor cells that have reduced NAPRT expression will still be

affected by the NAMPT inhibitor despite nicotinic acid supplementation (14). Low expression of

NAPRT (over 7.62 FPKM) in renal cancer is an unfavorable prognostic marker

(https://www.proteinatlas.org/ENSG00000147813-NAPRT/pathology/tissue/renal+cancer). This

has not been found in other malignancies and has not been reported elsewhere, and the data

suggest a personalized medicine approach in which those RCC patients identified to have low

expression of NAPRT mRNA associated with methylation of the NAPRT promoter (see Fig. 1)

would likely be particularly appropriate candidates for KPT-9274 therapy with nicotinic acid

supplementation.

A high level of variation in tumor growth rates was observed in the control mice despite

these being clonal tumors in syngeneic hosts. In all treatment groups there were mice whose

tumors grew very little over the 21-day treatment period (Supp Fig. 3) while in the anti-PD1 and

control groups only, some mice grew very large tumors. The innate immune system is capable of

both promoting tumor growth as well as inhibiting tumor growth (42). If the combination treatment

KPT-9274 + anti-PD1 is inhibiting tumor growth via recruitment of more tumor inhibitory than tumor

promoting elements of the immune system, this suggests there are stochastic events that control

the immune response to tumors that we may not be able to measure or easily control. However,

we can conclude that the combination treatment did not cooperate to recruit more T cells to the

tumors in our experiments.

In summary, we have extended our previous work on a dual PAK4/NAMPT inhibitor in

kidney cancer to show that therapy with this drug in combination with the anti-PD1 is more

effective at inhibiting growth of the tumors when compared to the single therapies. These data

18

indicate that this combination should be evaluated in patients who are unresponsive to immune

CPI alone; our work thus may broaden the populations that shows a robust response with these

novel antibody treatments.

ACKNOWLEDGEMENTS

We thank Lauren Hirao for assistance with planning the flow cytometry experiments.

AUTHOR CONTRIBUTIONS

Josephine Trott: Conceptualization; Formal analysis; Funding acquisition; Investigation;

Methodology; Writing – original draft; Writing - review and editing

Omran Abu Aboud: Conceptualization; Formal analysis; Investigation; Methodology; Writing -

original draft; Writing - review and editing

Bridget McLaughlin: Formal analysis; Investigation; Methodology; Writing - original draft; Writing

- review and editing

Katie Anderson: Conceptualization; Methodology; Writing - review and editing

Jaime Modiano: Conceptualization; Methodology; Writing – original draft; Writing - review and

editing

Kyoungmi Kim: Formal analysis; Writing - review and editing

Kuang-Yu Jen: Formal analysis; Writing – review and editing

William Senapedis: Conceptualization; Funding acquisition; Writing - review and editing

Hua Chang: Investigation; Writing - review and editing

Yosef Landesman: Funding acquisition; Writing - review and editing

Erkan Baloglu: Resources

19

Roberto Pili: Resources

Robert Weiss: Conceptualization; Funding acquisition; Resources; Supervision; Writing - original

draft; Writing - review and editing

DISCLOSURES

This work was in part supported by grants from Dialysis Clinics Incorporated (DCI), but DCI had

no influence on the experiments, data collection, or manuscript writing. Y Landesman, W

Senapedis, E Baloglu and H Chang were employees of Karyopharm Therapeutics while the

work was being carried out; and report a patent to WO 2017031213 issued. H Chang conducted

immunohistochemistry experiments. Y Landesman and W Senapedis provided advice. Y

Landesman, W Senapedis, E Baloglu and H Chang did not influence the experiments or

conclusions of the paper. Karyopharm provided KPT-9274 and an unrestricted gift for purchase

of some reagents. W Senapedis has stock and options in Karyopharm Therapeutics Inc.

FUNDING

This work was supported by NIH grants 1R03CA181837-01 and 1R01DK082690-01A1, the

Medical Service of the US Department of Veterans’ Affairs (all to R.H. Weiss), Dialysis Clinics

Inc. (DCI) (to R.H. Weiss and J.F. Trott) and K.L.A was supported by the Ruth L. Kirschstein

National Research Service Award from NCI (F30 CA195973). J.F.M was supported by the

Perlman Chair in Animal Oncology. This project was also supported by the University of

California Davis Flow Cytometry Shared Resource Laboratory with funding from the NCI P30

CA093373 (Cancer Center), and NIH NCRR C06-RR12088. A non-restricted gift for research

purposes was provided by Karyopharm Therapeutics, Inc.

20

REFERENCES

1. Gong J, Chehrazi-Raffle A, Reddi S, Salgia R: Development of PD-1 and PD-L1 inhibitors as

a form of cancer immunotherapy: a comprehensive review of registration trials and future

considerations. J Immunother Cancer, 6: 8, 2018.

2. Ross K, Jones RJ: Immune checkpoint inhibitors in renal cell carcinoma. Clin Sci (Lond), 131:

2627-2642, 2017.

3. Abu Aboud O, Chen CH, Senapedis W, Baloglu E, Argueta C, Weiss RH: Dual and Specific

Inhibition of NAMPT and PAK4 By KPT-9274 Decreases Kidney Cancer Growth. Mol

Cancer Ther, 15: 2119-2129, 2016.

4. Rane C, Senapedis W, Baloglu E, Landesman Y, Crochiere M, Das-Gupta S, Minden A: A

novel orally bioavailable compound KPT-9274 inhibits PAK4, and blocks triple negative

breast cancer tumor growth. Sci Rep, 7: 42555, 2017.

5. Mitchell SR, Larkin K, Grieselhuber NR, Lai TH, Cannon M, Orwick S, Sharma P, Asemelash

Y, Zhang P, Goettl VM, Beaver L, Mims A, Puduvalli VK, Blachly JS, Lehman A,

Harrington B, Henderson S, Breitbach JT, Williams KE, Dong S, Baloglu E, Senapedis W,

Kirschner K, Sampath D, Lapalombella R, Byrd JC: Selective targeting of NAMPT by

KPT-9274 in acute myeloid leukemia. Blood Adv, 3: 242-255, 2019.

6. Li N, Lopez MA, Linares M, Kumar S, Oliva S, Martinez-Lopez J, Xu L, Xu Y, Perini T,

Senapedis W, Baloglu E, Shammas MA, Hunter Z, Anderson KC, Treon SP, Munshi NC,

Fulciniti M: Dual PAK4-NAMPT Inhibition Impacts Growth and Survival, and Increases

Sensitivity to DNA-Damaging Agents in Waldenstrom Macroglobulinemia. Clin Cancer

Res, 25: 369-377, 2019.

7. Aboukameel A, Muqbil I, Senapedis W, Baloglu E, Landesman Y, Shacham S, Kauffman M,

Philip PA, Mohammad RM, Azmi AS: Novel p21-Activated Kinase 4 (PAK4) Allosteric

21

Modulators Overcome Drug Resistance and Stemness in Pancreatic Ductal

Adenocarcinoma. Mol Cancer Ther, 16: 76-87, 2017.

8. Fulciniti M, Martinez-Lopez J, Senapedis W, Oliva S, Lakshmi Bandi R, Amodio N, Xu Y,

Szalat R, Gulla A, Samur MK, Roccaro A, Linares M, Cea M, Baloglu E, Argueta C,

Landesman Y, Shacham S, Liu S, Schenone M, Wu SL, Karger B, Prabhala R, Anderson

KC, Munshi NC: Functional role and therapeutic targeting of p21-activated kinase 4 in

multiple myeloma. Blood, 129: 2233-2245, 2017.

9. Jiang YY, Lin DC, Mayakonda A, Hazawa M, Ding LW, Chien WW, Xu L, Chen Y, Xiao JF,

Senapedis W, Baloglu E, Kanojia D, Shang L, Xu X, Yang H, Tyner JW, Wang MR,

Koeffler HP: Targeting super-enhancer-associated oncogenes in oesophageal squamous

cell carcinoma. Gut, 66: 1358-1368, 2017.

10. Takao S, Chien W, Madan V, Lin DC, Ding LW, Sun QY, Mayakonda A, Sudo M, Xu L,

Chen Y, Jiang YY, Gery S, Lill M, Park E, Senapedis W, Baloglu E, Muschen M, Koeffler

HP: Targeting the vulnerability to NAD(+) depletion in B-cell acute lymphoblastic

leukemia. Leukemia, 32: 616-625, 2018.

11. London C, Brown M, Warry E, Schuh E, Senapedis WT, Argueta C, Kashyap T, Chang H,

Ellis J, Shacham S, Baloglu E: Abstract LB-308: KPT-9274 inhibits cellular NAD and

synergizes with doxorubicin to treat dogs with lymphoma. Cancer Res, 77: LB-308, 2017.

12. Naing A, Leong S, Pishvaian MJ, Razak ARA, Mahipal A, Berlin J, Cho D, Baloglu E, Ellis J,

Meade J, Kauffman M, Shacham S, Senapedis W: 374PDA first in human phase 1 study

of KPT-9274, a first in class dual inhibitor of PAK4 and NAMPT, in patients with

advanced solid malignancies or NHL. Ann Oncol, 28, 2017.

13. Bogan KL, Brenner C: Nicotinic acid, nicotinamide, and nicotinamide riboside: a molecular

evaluation of NAD+ precursor vitamins in human nutrition. Annu Rev Nutr, 28: 115-130,

2008.

22

14. Shames DS, Elkins K, Walter K, Holcomb T, Du P, Mohl D, Xiao Y, Pham T, Haverty PM,

Liederer B, Liang X, Yauch RL, O'Brien T, Bourgon R, Koeppen H, Belmont LD: Loss of

NAPRT1 expression by tumor-specific promoter methylation provides a novel predictive

biomarker for NAMPT inhibitors. Clin Cancer Res, 19: 6912-6923, 2013.

15. Drevs J, Loser R, Rattel B, Esser N: Antiangiogenic potency of FK866/K22.175, a new

inhibitor of intracellular NAD biosynthesis, in murine renal cell carcinoma. Anticancer

Res, 23: 4853-4858, 2003.

16. Li Y, Shao Y, Tong Y, Shen T, Zhang J, Li Y, Gu H, Li F: Nucleo-cytoplasmic shuttling of

PAK4 modulates beta-catenin intracellular translocation and signaling. Biochim Biophys

Acta, 1823: 465-475, 2012.

17. Clevers H: Wnt/beta-catenin signaling in development and disease. Cell, 127: 469-480,

2006.

18. Liao DJ, Thakur A, Wu J, Biliran H, Sarkar FH: Perspectives on c-Myc, Cyclin D1, and their

interaction in cancer formation, progression, and response to chemotherapy. Crit Rev

Oncog, 13: 93-158, 2007.

19. Nekrasova T, Minden A: PAK4 is required for regulation of the cell-cycle regulatory protein

p21, and for control of cell-cycle progression. J Cell Biochem, 112: 1795-1806, 2011.

20. Callow MG, Clairvoyant F, Zhu S, Schryver B, Whyte DB, Bischoff JR, Jallal B, Smeal T:

Requirement for PAK4 in the anchorage-independent growth of human cancer cell lines.

J Biol Chem, 277: 550-558, 2002.

21. Kimmelman AC, Hezel AF, Aguirre AJ, Zheng H, Paik JH, Ying H, Chu GC, Zhang JX, Sahin

E, Yeo G, Ponugoti A, Nabioullin R, Deroo S, Yang S, Wang X, McGrath JP,

Protopopova M, Ivanova E, Zhang J, Feng B, Tsao MS, Redston M, Protopopov A, Xiao

Y, Futreal PA, Hahn WC, Klimstra DS, Chin L, DePinho RA: Genomic alterations link Rho

23

family of GTPases to the highly invasive phenotype of pancreas cancer. Proc Natl Acad

Sci U S A, 105: 19372-19377, 2008.

22. Lee J, Kim H, Lee JE, Shin SJ, Oh S, Kwon G, Kim H, Choi YY, White MA, Paik S, Cheong

JH, Kim HS: Selective Cytotoxicity of the NAMPT Inhibitor FK866 Toward Gastric Cancer

Cells With Markers of the Epithelial-Mesenchymal Transition, Due to Loss of NAPRT.

Gastroenterology, 155: 799-814 e713, 2018.

23. Dart AE, Wells CM: P21-activated kinase 4--not just one of the PAK. Eur J Cell Biol, 92:

129-138, 2013.

24. Abril-Rodriguez G, Torrejon DY, Liu W, Zaretsky JM, Nowicki TS, Tsoi J, Puig-Saus C,

Baselga-Carretero I, Medina E, Quist MJ, Garcia AJ, Senapedis W, Baloglu E, Kalbasi A,

Cheung-Lau G, Berent-Maoz B, Comin-Anduix B, Hu-Lieskovan S, Wang C-Y, Grasso

CS, Ribas A: PAK4 inhibition improves PD-1 blockade immunotherapy. Nature Cancer,

1: 46-58, 2020.

25. Spranger S, Bao R, Gajewski TF: Melanoma-intrinsic beta-catenin signalling prevents anti-

tumour immunity. Nature, 523: 231-235, 2015.

26. Luke JJ, Bao R, Sweis RF, Spranger S, Gajewski TF: WNT/beta-catenin Pathway Activation

Correlates with Immune Exclusion across Human Cancers. Clin Cancer Res, 25: 3074-

3083, 2019.

27. Murphy GP, Hrushesky WJ: A murine renal cell carcinoma. J Natl Cancer Inst, 50: 1013-

1025, 1973.

28. Salup RR, Herberman RB, Wiltrout RH: Role of natural killer activity in development of

spontaneous metastases in murine renal cancer. J Urol, 134: 1236-1241, 1985.

29. Tracz A, Mastri M, Lee CR, Pili R, Ebos JM: Modeling Spontaneous Metastatic Renal Cell

Carcinoma (mCC) in Mice following Nephrectomy. Journal of Visual Experiments, 86:

e51485, 2014.

24

30. Escudier B, Porta C, Schmidinger M, Rioux-Leclercq N, Bex A, Khoo V, Grunwald V,

Gillessen S, Horwich A, ESMO Guidelines Committee: Renal cell carcinoma: ESMO

Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol, 30: 706-

720, 2019.

31. Wang AY, Weiner H, Green M, Chang H, Fulton N, Larson RA, Odenike O, Artz AS, Bishop

MR, Godley LA, Thirman MJ, Kosuri S, Churpek JE, Curran E, Pettit K, Stock W, Liu H: A

phase I study of selinexor in combination with high-dose cytarabine and mitoxantrone for

remission induction in patients with acute myeloid leukemia. J Hematol Oncol, 11: 4,

2018.

32. Trott JF, Kim J, Abu Aboud O, Wettersten H, Stewart B, Berryhill G, Uzal F, Hovey RC,

Chen CH, Anderson K, Graef A, Sarver AL, Modiano JF, Weiss RH: Inhibiting tryptophan

metabolism enhances interferon therapy in kidney cancer. Oncotarget, 7: 66540-66557,

2016.

33. Trott JF, Hwang VJ, Ishimaru T, Chmiel KJ, Zhou JX, Shim K, Stewart BJ, Mahjoub MR, Jen

KY, Barupal DK, Li X, Weiss RH: Arginine reprogramming in ADPKD results in arginine-

dependent cystogenesis. Am J Physiol Renal Physiol, 315: F1855-F1868, 2018.

34. Inoue H, Hwang SH, Wecksler AT, Hammock BD, Weiss RH: Sorafenib attenuates p21 in

kidney cancer cells and augments cell death in combination with DNA-damaging

chemotherapy. Cancer Biol Ther, 12: 827-836, 2011.

35. Hwang VJ, Zhou X, Chen X, Trott J, Abu Aboud O, Shim K, Dionne LK, Chmiel KJ,

Senapedis W, Baloglu E, Mahjoub MR, Li X, Weiss RH: Anticystogenic activity of a small

molecule PAK4 inhibitor may be a novel treatment for autosomal dominant polycystic

kidney disease. Kidney Int, 92: 922-933, 2017.

36. Li LC, Dahiya R: MethPrimer: designing primers for methylation PCRs. Bioinformatics, 18:

1427-1431, 2002.

25

37. Chatterjee S, Daenthanasanmak A, Chakraborty P, Wyatt MW, Dhar P, Selvam SP, Fu J,

Zhang J, Nguyen H, Kang I, Toth K, Al-Homrani M, Husain M, Beeson G, Ball L, Helke K,

Husain S, Garrett-Mayer E, Hardiman G, Mehrotra M, Nishimura MI, Beeson CC, Bupp

MG, Wu J, Ogretmen B, Paulos CM, Rathmell J, Yu XZ, Mehrotra S: CD38-NAD(+)Axis

Regulates Immunotherapeutic Anti-Tumor T Cell Response. Cell Metab, 27: 85-100

e108, 2018.

38. Jayaram HN, Kusumanchi P, Yalowitz JA: NMNAT expression and its relation to NAD

metabolism. Curr Med Chem, 18: 1962-1972, 2011.

39. Preiss J, Handler P: Biosynthesis of diphosphopyridine nucleotide. II. Enzymatic aspects. J

Biol Chem, 233: 493-500, 1958.

40. Preiss J, Handler P: Biosynthesis of diphosphopyridine nucleotide. I. Identification of

intermediates. J Biol Chem, 233: 488-492, 1958.

41. Tateishi K, Wakimoto H, Iafrate AJ, Tanaka S, Loebel F, Lelic N, Wiederschain D, Bedel O,

Deng G, Zhang B, He T, Shi X, Gerszten RE, Zhang Y, Yeh JJ, Curry WT, Zhao D,

Sundaram S, Nigim F, Koerner MVA, Ho Q, Fisher DE, Roider EM, Kemeny LV, Samuels

Y, Flaherty KT, Batchelor TT, Chi AS, Cahill DP: Extreme Vulnerability of IDH1 Mutant

Cancers to NAD+ Depletion. Cancer Cell, 28: 773-784, 2015.

42. Hagerling C, Casbon AJ, Werb Z: Balancing the innate immune system in tumor

development. Trends Cell Biol, 25: 214-220, 2015.

26

Table 1. PCR primers used for quantitative PCR.

Accession Number Gene Forward and Reverse Primers (5’-3’) Tm2

(oC) E3 (%)

(HUMAN) NAMPT4

GCAGAAGCCGAGTTCAACATC TGCTTGTGTTGGGTGGATATTG 64 98

NM_145201.5 (HUMAN) NAPRT1

TCCCTGGGTGGCGTCTATAA ATGAGTGGAGACCCGTCAGA 64 96

(MOUSE) Nampt5

TCGGTTCTGGTGGCGCTTTGCTAC AAGTTCCCCGCTGGTGTCCTATGT 66 81

NM_172607.3 (MOUSE) Naprt1

AGAAGGGCAGTGAGGTGAATG TCCAGTAGCAAAGACCCATCG 60 86

Rpl13a6 GACCTCCTCCTTTCCCAGGCG GCCTCGGCCATCCAATACCAGAA 66 92

Eef26 TCTGAGAATCCGTCGCCATCCG TCAGAGAGCTCGTAGAAGAGGGA 66 80

RNA18S5&Rn18S7

ACGGCTACCACATCCAAGGA CCAATTACAGGGCCTCGAAA 60 70

PPIA8 ACCGCCGAGGAAAACCGTGTA TGCTGTCTTTGGGACCTTGTCTGC 64 82

RPS138 TCGGCTTTACCCTATCGACGCAG ACGTACTTGTGCAACACCATGTGA 64 83

1PCR products confirmed by sequencing

2Annealing temperature

3Efficiency of amplification

4Schuster, S., Penke, M., Gorski, T., Petzold-Quinque, S., Damm, G., Gebhardt, R., Kiess, W.,

and Garten, A. (2014) Resveratrol differentially regulates NAMPT and SIRT1 in

Hepatocarcinoma cells and primary human hepatocytes. PLoS One 9, e91045.

5Wang, L. F., Wang, X. N., Huang, C. C., Hu, L., Xiao, Y. F., Guan, X. H., Qian, Y. S., Deng, K.

Y., and Xin, H. B. (2017) Inhibition of NAMPT aggravates high fat diet-induced hepatic

steatosis in mice through regulating Sirt1/AMPKalpha/SREBP1 signaling pathway. Lipids

Health Dis. 16, 82.

6Trott, J. F., Hwang, V. J., Ishimaru, T., Chmiel, K., Zhou, X., Shim, K., Stewart, B., Mahjoub, M.

R., Jen, K. Y., Barupal, D., et al. (2018) Arginine reprogramming in ADPKD results in

arginine-dependent cystogenesis. Am. J. Physiol. Renal Physiol. 315, F1855-F1868.

27

7Rowson-Hodel, A. R., Manjarin, R., Trott, J. F., Cardiff, R. D., Borowsky, A. D., and Hovey, R.

C. (2015) Neoplastic transformation of porcine mammary epithelial cells in vitro and

tumor formation in vivo. BMC Cancer 15, 562.

8Dupasquier, S., Delmarcelle, A. S., Marbaix, E., Cosyns, J. P., Courtoy, P. J., and Pierreux, C.

E. (2014) Validation of housekeeping gene and impact on normalized gene expression in

clear cell renal cell carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression.

BMC Mol. Biol. 15, 9

28

Table 2. Methylation specific primers for (HUMAN)NAPRT and (MOUSE)Naprt used on bisulfite

converted gDNA.

Accession Number Gene M or U1 Forward and Reverse Primers (5’-3’) Tm2

(oC)

NM_145201.5 (HUMAN) NAPRT3 M ACCTCTACCAAACCACCATAACG

GAATTCGGCGGCGTTTC 65

(HUMAN) ACTB4 M GGGTGGTGATGGAGGAGGTT

TAACCACCACCCAACACACAAT 66

NM_172607.3 (MOUSE) Naprt5 U AGTTGGGAGTTTGTGTATTTTGTGG

CACCATAATAACCTAATAAAAATCAAT 59

NM_172607.3 (MOUSE) Naprt5 M TAGTCGGGAGTTTGTGTATTTCGC

ACGCCATAATAACCTAATAAAAATCGAT 64

1M=methylated sequence, U=unmethylated sequence

2Annealing temperature

3Primers amplify a region 56-123bp downstream of the translation start site in exon 1

4Liloglou, T. and Nikolaidis, G. (2013) Quantitative Methylation Specific PCR (qMSP). Bio-

protocol 3: e871.

5Primers amplify a region 26-27 bp upstream to 78-79 bp of the translation start site in exon 1

29

Figure 1

30

Figure 1. (HUMAN)NAPRT is downregulated at the level of transcription, which in some RCC

tumors is associated with high levels of promoter methylation.

RNA was extracted from normal kidneys and RCC tumors of grades 1-4.

A) Extracted RNA was reverse-transcribed and subjected to qPCR for (HUMAN)NAMPT

mRNA (corrected for PPIA, RPS13 and RNA18S5 mRNA levels). Data are means ± SD (n=3-9).

B) Extracted RNA was reverse transcribed and subjected to qPCR for (HUMAN)NAPRT

mRNA as in A). The red line is located below the lowest NAPRT mRNA value for normal

kidneys. Data are means ± SD (n=3-9).

C) The relative % of methylation of the (HUMAN)NAPRT promoter. Bisulfite-converted

untreated gDNA and bisulfite-converted 100% methylated gDNA from human kidneys (NHK;

n=3), RCC tumors (n=8) and RCC cell lines (ACHN, Caki-1, 786-O) was analyzed by qMSP

using primers specific for methylated (M) NAPRT sequences 56-123 bp downstream of the

NAPRT translation start site, and normalized against ACTB. Samples were divided into low

(blue bars) and high NAPRT expression (red bars) based on the data in B) and from Abu Aboud

et al. (3).

31

Figure 2

Figure 2. RENCA tumors express both PD-L1 and PD-L2 and are highly proliferative. Subcutanous RENCA tumors from

untreated Balb/cJ mice were fixed, paraffin-embedded, sectioned and stained with hematoxylin and eosin or subjected to

immunohistochemistry for Ki67, PD-L1 and PD-L2 using DAB as the chromagen and a hematoxylin counterstain.

32

Figure 3

Figure 3. (MOUSE)NAPRT is downregulated at the level of transcription in RENCA tumors

where the Naprt promoter is methylated.

Protein and RNA were extracted from kidneys and subcutanous RENCA tumors from

untreated Balb/cJ mice.

A) Proteins were immunoblotted for NAMPT, NAPRT and β-actin. Immunoblots are

representative of at least two repeats.

B) RNA was extracted, reverse transcribed and subjected to qPCR for Nampt or Naprt

33

mRNA (corrected for Eef2, Rpl13a and Rn18S mRNA levels). a,b,cindicate a significant difference

(p<0.05). Data are means ± SEM (n=3 kidneys; n=4 tumors).

C) Bisulfite-converted gDNA from Balb/cJ mouse kidneys or RENCA tumors was

amplified by PCR using primers specific for either unmethylated (U) or methylated (M)

sequences to amplify sequences between 26-27 bp upstream and 78-79 bp downstream of the

Naprt translation start site. Data are representative of two independent PCR reactions. Neg =

mouse gDNA.

34

Figure 4

35

Figure 4. The combination of KPT-9274 and anti-PD1 had a significant inhibitory effect on tumor

growth.

A) Subcutaneous measurements of RENCA tumor growth in 10 week old male Balb/cJ

mice over the 21 days of treatment. RENCA-luc cells (250,000) were injected subcutaneously in

30% matrigel and treatments started 10 days after injection. Data are mean ± SEM (n=8-

10/treatment). a,bindicate significant differences within one day’s measurements (p<0.05).

*p<0.05, **p<0.005 for main effect of KPT-9274. PD1 = anti-mouse PD1 antibody. Control =

isotype control.

B) The anti-tumor treatments did not affect mouse health as determined by body weights.

Male Balb/cJ mice bearing RENCA tumors were 10 weeks old when treatments were started.

Mice were weighed at the start of the treatment period and once a week thereafter. Data are

means ± SEM (n=9-10/treatment). *p<0.05 compared to control at that time point.

C) Volume of RENCA tumors measured ex vivo at sacrifice following 21 days of

treatment with either KPT-9274, anti-PD1 antibody (PD1) or a combination of both. a,bindicate a

significant difference (p<0.05). Data are mean ± SD (n=8-10/treatment).

36

Figure 5

37

Figure 5. Bimodal tumor cell T cell infiltration response in mice treated with combination of KPT-

9274 and anti-PD1.

A) CD3+, CD4+, CD8+ and T-reg T cell infiltration into syngeneic RENCA tumors. Data

are individual tumor data points with mean ± SD. Statistically determined outliers for CD8+ cells

in the KPT-9274 treated mice (3.8%, 8.1%) and in the anti-PD1 treated mice (31.2%) were

omitted to enable clarity of presentation.

B) Representative 2D contour plots (with outliers) for CD4+ and CD8+ T cells in one

tumor from each treatment group.

38

Figure 6

39

Figure 6. KPT-9274 decreased phosphorylation of β-catenin and total PAK4 expression.

Protein was extracted from RENCA tumors in mice treated with PD1 antibody (Anti-PD1),

KPT-9274 or a combination of both, and was immunoblotted for phospho (P)-β-catenin, Pak4

and β-actin. ImageJ quantification of P-β-catenin and PAK4 expression, each corrected for β-

actin, are underneath a representative immunoblot from one tumor/mouse. a,bIndicate a

significant difference (p<0.05). Data are means ± SEM (n=6).

40

Figure 7

Figure 7. KPT-9274 reduces and anti-PD1 increases NAD+NADH concentrations in tumors.

RENCA tumors from Balb/cJ mice were harvested 12-18 h after the last dose of either

KPT-9274 or vehicle and subjected to assays of total NAD+NADH as described in Materials and

Methods. Mice treated with KPT-9274 had lower total NAD+NADH in RENCA tumors than mice

treated with anti-PD1. Data are means ± SD (n=7). a,bindicate a significant difference (p<0.05).