ANSWER KEY

Biology 1: Unit 2 (A DNA Mastery Unit) – Worksheet 1: DNA Structure

1. Deoxyribonucleic acid

2. A. James Watson

B. Francis Crick

3. nucleotides

4. sugar (deoxyribose) and phosphates (phosphodiester bonds)

5. thymine (T), adenine (A), guanine (G), cytosine (C)

6. purines: 2 rings; pyrimidines: 1 ring

7. adenine and guanine

8. thymine and cytosine

9. adenine and thymine; cytosine and guanine

10. A pairs with T; C pairs with G

11. hydrogen

12. X-ray crystallography; double helix

13. your drawing should have a phosphate, deoxyribose sugar with the carbons numbered, and a

nitrogenous base

14. TTAAGCGGCCATAATCTGCAA (this questions is missing the 5’ and 3’ designations!! Not a perfect

worksheet!!)

15. the nucleotide contains three parts: you should have circled a black circle (the phosphate), a

pentagon (the sugar), and a rectangle puzzle piece (the base)

Labeling Bases:

left hand column, going down: ATGCAC

Right hand column, going down: TACGTG