an anther-specific gene encoded by an s of brassica produces

The Plant Cell, Vol. 7, 1283-1294, August 1995 O 1995 American Society of Plant Physiologists

An Anther-Specific Gene Encoded by an S of Brassica Produces Complementary and Regulated Transcripts

Locus Haplotype Differentially

Douglas C. Boyes’ and June B. Nasrallah2 Section of Plant Biology, Division of Biological Sciences, Cornell University, Ithaca, New York 14853-5908

The self-incompatibility locus of Brassica consists of a coadapted gene complex that contains at least two genes required for the recognition and inhibition of pollen by the stigma when self-pollinated. Here, we report the identification of a third S locus-linked gene from the Sz haplotype of Brassica oleracea. This gene, which we designated SLA (for S Locus Anther), is a nove1 gene with an unusual structure. SLA is transcribed from two promoters to produce two complementary anther-specific transcripts, one spliced and the other unspliced, that accumulate in an antiparallel manner in developing microspores and anthers. The sequence of the spliced transcript showed the presence of two open reading frames that predict proteins of 10 and 7.5 kD. Neither transcript was produced in a self-compatible 8. napus strain carrying an Srlike haplotype, indicating that the SLA gene in this strain is nonfunctional. Interestingly, sequences related to SLA were not detected in DNA or RNA from plants carrying S haplotypes other than Sz. The haplotype specificity of SLA, its anther-specific expression, and its physical linkage to the S locus are properties expected for a gene that encodes a determinant of S2 specificity in pollen.

INTRODUCTION

Many angiosperm families have evolved genetically controlled self-incompatibility (SI) systems that prevent or substantially reduce the level of self-fertilization. In the genus Brassica, which includes cabbage, kale, cauliflower, broccoli, and oilseed rape, this phenomenon is controlled by the highly polymorphic S locus, for which more than 50 allelic specifici- ties have been identified (for a review, see Nasrallah and Nasrallah, 1993). An incompatible pollination, characterized by the failure of pollen germination or the production of an ab- normal pollen tube that fails to invade the stigma surface, results when a stigma and interacting pollen grain share an identical S specificity. Molecular analysis of the S locus has demonstrated that this Mendelian locus encompasses more than 200 kb of DNA (Boyes and Nasrallah, 1993) and contains at least two highly polymorphic genes that are required for the recognition of self-pollen by the stigma (Nasrallah et al., 1992, 1994a). In light of the physical complexity of the S locus, the term “S haplotype” is used instead of “S allele” to designate the genotype across the entire S locus region required to es- tablish a given S specificity (Boyes and Nasrallah, 1993).

The two S locus gmes that have been characterized to date are the SRK and SLG genes, which encode, respectively, a receptor-like protein kinase and a secreted glycoprotein that

shares a high degree of sequence identity with the extracellu- lar domain of the receptor protein kinase (Stein et al., 1991). Expression of SLG and SRK in the papillar cells that consti- tute the differentiated epidermis of the stigma surface has been well established by analyzing transgenic plants expressing con- structs consisting of either the SLG or SRK promoter region fused to a reporter gene (Sato et al., 1991; Kandasamy et al., 1993; Nasrallah et al., 1994b). The peak expression level of both genes in papillar cells is strictly correlated with the onset in the stigma of the ability to mount an SI response. In addition, the SLG gene product has been identified and shown to accumulate specifically in the wall of papillar cells (Kandasamy et al., 1989). The promoters of both genes have been demonstrated to be active in the anther as well, although at a level lower than that observed in the stigma (Sato et al., 1991; Kandasamy et al., 1993; Stein, 1994). Accordingly, the transcripts of both genes have been detected in anthers (Guilluy et al., 1991; Sato et al., 1991; Stein et al., 1991). However, neither the SLG nor the SRK protein has been identified in anthers, suggesting that the products of genes other than SLG and SRK may be responsible for establishing S specificity in pollen (Nasrallah and Nasrallah, 1993).

A current model of SI in Brassica is that SLG and SRK function cooperatively in stigmas in the perception and transduction

1 Current address: Department of Biology, University of North Caro- Of an as-yet-unidentified locus-encoded signal emanating lina, Chapel Hill. NC 27599-3280. * To whom correspondence should be addressed.

from self-pollen (Nasrallah and Nasrallah, 1993; Nasrallah et al., 1994b). Based on the specificity of the interaction between

1284 The Plant Cell

H XhSRI B Xb RI B E RI B Xb Hi in i

SIC.

B EcoRI

PROBE

Hindm

1kb

2 5 6 13 22 2 5 6 13 22

kb

93 -6.8 -

43 -

3.5 -

23 -

1.9 -

1.6 - **

1.4 -

Figure 1. Identification of an S2 Haplotype-Specific Single-CopyDNA Sequence Downstream of SLG2.

(A) Restriction map of the SLG2 genomic region. The arrow definesthe direction of SLG2 transcription, and the position of the SLGp in-tron is indicated by the dip in the line. The bracketed region of themap is shown in more detail in Figures 3 and 6. B, BamHI; E, Eagl;H, Hindlll; RI, EcoRI; S, Sacl; Xb, Xbal; Xh, Xhol.(B) Gel blot hybridization analysis of B. oleracea genomic DNA digestedwith EcoRI and Hindlll. The 1.5-kb Eagl-BamHI fragment defined bythe box in (A) was used as a probe. Numbers above the lanes denotethe homozygous S genotype represented in each lane. Numbers atleft represent molecular length markers in kilobases.

self-pollen and the stigma and on the single-locus genetic con-trol of SI, which requires that the complementary stigma andpollen recognition functions be encoded within the same lo-cus, the molecular determinant of the pollen SI phenotypewould have to be highly polymorphic and encoded within theS haplotype.

In this study, we describe the cloning of a novel gene fromthe S2 haplotype of B. oleracea. Transcripts encoded by thisgene, which we designated SLA2 (for S Locus Anther), weredetected specifically in anther and microspore RNA. SLA2 isunusual in that its transcription is driven by at least twopromoters to produce complementary species of RNA that are

differentially regulated during anther development. Sequencesrelated to SLA2 were not detected in plants carrying S haplo-types other than S2, and a defective SLA2 gene was identifiedin a self-compatible strain of B. napus.

RESULTS

Identification of an S Locus-Linked Gene That IsExpressed Specifically in Anthers

As an initial step to identify additional S locus-linked transcrip-tional units, restriction fragments were isolated from clonedDNA flanking SLG and SRK and used as probes on genomicDNA blots. The resulting hybridization patterns were assessedfor the presence of polymorphism among different S haplo-types. As shown in Figure 1, one such polymorphic sequencewas identified as a 1.5-kb Eagl-BamHI fragment located down-stream of SLG2, the SLG gene isolated from the S2 haplotype(Figure 1A). When used as a probe against blots of genomicDNA representing five distinct homozygous S haplotypes, the1.5-kb fragment hybridized only with DNA isolated from theS2 haplotype (Figure 1B) even under conditions of reducedstringency (data not shown). In addition, the only fragmentsidentified on the blot were those expected from the restrictionmap of the region, indicating that the sequence was presentonly in the fragment used as the probe and not elsewhere inthe genome.

The S haplotype specificity and single-copy nature of the1.5-kb Eagl-BamHI sequence prompted us to examine the pos-sibility that this region contained a gene encoding a componentof SI specificity. The 1.5-kb probe was used on blots of RNAextracted from leaf and mature floral tissues isolated from plantshomozygous for the S2 haplotype. As shown in Figure 2, atranscript of ~2.2 kb was detected in RNA extracted from an-ther, but not in any of the other tissues tested. The single-copynature of the probe on genomic DNA blots suggested that thetranscript is encoded by a gene within the 1.5-kb Eagl-BamHIfragment. This transcriptional unit has been designated theSLA gene. SLA sequences isolated from the S2 haplotype de-scribed here are designated SLA2.

SLA2 Is Transcribed from Both DNA Strands ToProduce Complementary RNAs

Figure 3 shows a restriction map of the SLA? region of the S2

haplotype. The nucleotide sequence of the entire regiondepicted in the figure was determined for comparison with thecDNA sequences described later. Because the initial RNA blotanalysis indicated the presence of SLA2 transcripts in matureanther tissue (Figure 2), the 1.5-kb probe was used to screena cDNA library constructed from mRNA isolated from antherscollected 1 day before anthesis from plants homozygous forthe S2 haplotype. Five positively hybridizing clones were

An Anther-Specific Gene at the Brassica S Locus 1285

L S Pe A Pi L S Pe A Pi

kb

7.5 -4.4 -

2.4 _

1.4 - m**•

BFigure 2. RNA Gel Blot Hybridization Analysis.

RNA was extracted from leaf (L), sepal (S), petal (Pe), anthers pre-dominantly at the trinucleate microspore stage (A), and pistil (Pi) tissuethat was isolated from plants homozygous for the S2 haplotype.(A) Gel blot hybridized with the single-copy 1.5-kbEagl-BamHI probe(see Figure 1). Note that a 2.2-kb transcript can be detected only inthe anther RNA lane. The nature of the weak signal detected in petalsis not known.(B) Gel blot hybridized with an actin cDNA probe as a control.Numbers at left indicate molecular length markers in kilobases.

purified from ~106 recombinant phage. Each clone wasassigned to one of two classes based on the site of poly-adenylation as assessed by comparing the sequence derivedfrom the ends of the clones with the genomic sequence. Oneclass is represented by four clones that have 3' polyadenyla-tion sites within 70 bp of each other, and the other class isrepresented by one clone that is substantially shorter at the3' end. The longest clone representing the former class, desig-nated p2c3, was completely sequenced and found to be 1604bp in length. The clone representing the latter class, desig-nated p2c7, was 521 bp in length. Figure 3 depicts thepositioning of p2c3 (line a) and p2c7 (line b) in relation to thegenomic sequence. Clone p2c7 is contained completely withinp2c3 such that the 5' ends of the two clones are separatedby 28 bp, with the remainder of the length difference occur-ring at the 3' ends, which are separated by 1055 bp. Polymerasechain reaction (PCR) amplification of an additional aliquot ofthe same cONA library with primers directed against the ap-propriate vector and p2c3/p2c7 sequences (see Methods)extended the cDNA sequence by an additional 509 bp at the5' end (Figure 3, line c) to give a total length of 2179 bp forthe longest composite cDNA. The sequence of this compos-ite cDNA shown in Figure 4A was colinear with thecorresponding genomic sequence. Transcripts correspondingto this cDNA are collectively referred to as the unspliced SLA2

transcripts.A second class of SLA2 transcripts was identified using

PCR amplification of anther cDNA. Primers designed to amplify

a 1365-bp fragment of the p2c3 cDNA were found to generatea shorter product of 820 bp as well. The 820-bp product (Fig-ure 3, line d) is identical to the genomic sequence, except thatit lacks a 545-bp intron. Intriguingly, the orientation of con-sensus intron splice donor and acceptor sites (Brown, 1986)suggests that the mRNA giving rise to the 820-bp product wastranscribed from the DMA strand complementary to that usedto produce the unspliced transcripts. This hypothesis was con-firmed by extending the 820-bp product in the 3' and 5'directions using the rapid amplification of cDNA ends (RACE)technique (Frohman et al., 1988), which generated, respec-tively, the products depicted on lines e and f in Figure 3. Asshown in Figure 4B, sequence analysis of several productsobtained using the 3' RACE procedure revealed the presenceof potential polyadenylation signals that loosely conformed tothe AATAAA consensus and several alternative polyadenyla-tion sites clustered within ~150 bp of each other. The 5' RACEamplifications extended the sequence to a total length of 1402to 1557 bp, depending on the polyadenylation site used (Fig-ure 4B). A search of the DNA data bases revealed no significanthomology between the sequences presented here and previ-ously characterized sequences.

Analysis of the SLA2 cDNAs for Putative ProteinCoding Regions

Neither class of SLA2 transcript exhibited a structure typicalof eukaryotic mRNAs known to encode proteins. Accordingto the scanning model of translation initiation (Kozak, 1989),translation is most often initiated from the 5' proximal methio-nine codon. The predicted first methionine codon in the

200 bp

Xb RI B A B Xb Xbi I I -

f -

Figure 3. Restriction Map of the SLA2 Genomic Region Depicting theCloning Strategy and Position of the Spliced and Unspliced SLA2Transcripts.cDNA clones representing the unspliced transcript are (a) the p2c3cDNA clone, (b) the p2c7 cDNA clone, and (c) the 509-bp product iso-lated from the library by PCR amplification. cDNA clones representingthe spliced transcript are (d) the 820-bp spliced RNA-PCR product,(e) the longest 3' RACE product, and (f) the composite 5' RACE prod-uct. The position of the intron is indicated for the 820-bp RNA-PCRproduct by the dip in the line. Arrowheads indicate the presence ofpoly(A) tails and define the direction of transcription. A, Accl; B, BamHI;E, Eagl; H, Hindlll; RI, EcoRI; RV, EcoRV; S, Sacl; Xb, Xbal.

A 1 4 1 8 1

1 2 1 1 6 1 201 241 2 8 1 3 2 1 3 6 1 4 0 1 441 481 521 5 6 1 6 0 1 6 4 1 681 7 2 1 7 6 1 8 0 1 8 4 1 8 8 1 9 2 1 961

1 0 0 1 1 0 4 1 1 0 8 1 1 1 2 1 1 1 6 1 1 2 0 1 1 2 4 1 1 2 8 1 1 3 2 1 1 3 6 1 1 4 0 1 1 4 4 1 1 4 8 1 1 5 2 1 1 5 6 1 1 6 0 1 1 6 4 1 1 6 8 1 1 7 2 1 1 7 6 1 1 8 0 1 1 8 4 1 1 8 8 1 1 9 2 1 1 9 6 1 2001 2041 2081 2121 2161

AAACAWTCATGTCCGAAATAAGTTTGCTGAAACATTTGT GTCTAGACGTATGTAACTTGAATGATTGTTAGmAGCC CC~TTGAATATTAATATCTTAAATGAAAGTCTTGC CCATGGATCCATACCTTAACCTMGATTAAGGAAAAGGTTGTTA TTGTTCTTAAGTTTGTTTGAGTTPCAGATCATTAAGm AATCTTGTTPAGTTTATGmAATTTATTCAC AAAAC TTATATTGCTTAATTATATTTGGTAATTATTTPCATTCTC TTPGCTTAGAGTCATATTAGGTTCTGATTGACAACTCTTA TAWACAACAACATTAGAGCTTGTAACTAGAGTTATACA GATTAATTAAACTGATTTCTTATTGAGTTTTGATACCGTT GCAAATCCTAAGATTGATTTTGACA'MGGAATTCAGTCAT TGC'ITGAGACTAAATCTTATTTTCTATTTGGTTACTAACT TACTTPCTTPATCTATATTTGTCAATGAAACXTGAAATGT CTTTGAGGAGTAAAAGTATTGAGTTATAATATAAAAGAAT AGAGAACTTTGGTGAAGGATGGAGCGTTCATCAAGGGCT AGATTATGCAGGGCCCTCACCATGAATTCAGAAAGGAGAC TTTGTTGAGACCCTTCTACAGAGGAGTCTTGCCCAAATTP AAGAACATGCTTGACACTGTAAGCAGTGGGCATCTCT GATGATTPCAAACAAGGGGATGCAGTTGGTAGAGAATCTT GCTCAAAGTGACTATCTATTGTGATGATTATGACAGAACC AACAATAGAGGTGGAGCTCAAGATGAGCACACAAGAAGGG AGCGAAAGCAGTACATGACCAAATCGACATCCTMTTGAA

TAGCAAGGCTACAATGAATCTCAACAGAATCATGAGCAAG ACAGAATCA'TGAGCAAGAGGGTCAAGAAGATGWAACTAT GTCAGTAGGTAAGGCTAC$TCAACAACAACTATAACAACT ACTACAACTATAACCTCTCAAACATAAGCACAATGTAGAC WGATCAAAACTATCCACCTTTCAAACCAAATGAGCA GAACACTCTATAAGGAATCTAAGAAAACCTCAGTAC CAAGGAGACTACCAACAAAAGCCATCTTACAACAACCAC AAGGAGGCTATCAACCCAAACTCAACAACTATCCACCCAG TTTCTGTCCTTACAAAGACAATACACCAAACCAAAGAAAA GGAAGTTCTTCAAACCCTCAACCAAAGGAGATTAGTACTG ATCTTCTTCTCAACCAGCTCTTGGAAATTAATGCAAGCCA AGCAAATCAATTAGGAGCATAGTTCAAGGATATCCATAAA AAGTTGATGGGACGTACAATTGTCTAAAAGTGAG'MGGAG GTGCCGTTPTCCTTTGGGTCGGTG'FWCCGAGTCTCCAAA AAGG'FWCGCTGAATCTAAGCGGTCAACTCGATGGGTATG CGCCCAACATTPCGGGTCGTCTCTCCTCCTCCAGCAG'M AWTGGAGTCGGCATCTAGGTTPAGGTCGCTGGTTCTTCG CTTCCTCGGCAAGTGAGTTCATCTACTTTTTCGACTAGTG TGTGTAGTACGGCCGTAACGTCAGTATTTGGGCATCTWT TTAGCCGCGTGn;GGTTGGGTTCGGCAGTTCCATCGGGTG ATCAGGGGTTGCGCCGGGCTGGTCATGATTPCATGAGGGT GGTTCGTCTGTGCCGTAGATGGTGTCGTGGTAGAAGCGT CCTGGCGTTTGAGAGCAAGGCGTCGAEGCGGACGAGGAT GGGTGGCGCATATTTCCGGGGTTAATCTGGCTGCTCTTTC CTGACTCCACCCCACTTTGTCGCGGTGCTAWTTTGTCG GTCACTTGCTTTAGTCGTGGGTTGWCGGTGGATGAWTA GACATPT"CCTGCTTTGCGGGCGCTTGCGAACTT'IY;C GTAGGAATCCTTAAGGCTCCACTGTYXXXGCCAATATTGT TGAATCCTAAGGAAAACCTGTAACCAAGTTTAAGGATTTATAC AATAATAAATAGAGmAGGGGCCAA4GGTCTTGT'TTATP GAAGTG'ITAAGCTGTTTGCCGAACAGAAAGATACAAAAGA AAGTGAACTCGTTGTCAATAAAAAAAAAAA 2190

AAGGC AGAAAAATGTAAATTGAATTTGATCAA

I -

40 80 120 160 200 240 280 320 360 400 440 480 520 560 600 640 680 720 760 800 840 880 920 960 1000 1040 1080 1120 1160 1200 1240 1280 1320 1360 1400 1440 1480 1520 1560 1600 1640 1680 1720 1760 1800 1840 1880 1920 1960 2000 2040 2080 2120 2160

B l 4 1 8 1

1 2 1 1 6 1 201 241 281 321 361 401 441 481

521

561

601

641

681

7 2 1

7 6 1

801 8 4 1

8 8 1

9 2 1

961

1 0 0 1

1 0 4 1

1 0 8 1 1121 1161 1 2 0 1 1 2 4 1 1 2 8 1 1 3 2 1 1361 1 4 0 1 1 4 4 1 1 4 8 1 1 5 2 1 1 5 6 1

GTTGGAGGATGGACCTTCAGCCTGTTCGCGAGTTGAACAT ATTTGAATAAGGCCCAGTACGGGGAAGCCGACCCGTTTGG AATGATAACCCTCGCTCTTCACGCAAACAACXACAACGAG GAACAGTGGCCTAGACCGTAGGCTGCACTCWCGCCGATC ATAGCCAAACACGAACCGATTCTCTGACACAACCACCGCT AGACGGAAGGAGAAAGGGAAATAGGTCTTTATATACAGGA GAGAATPCAATGAGAAAGGGGGATCCAGAACGAGAGAGAG AGAGAGAGAGCTATTGACAACGAGTTCACWTCTTTTG TCTTPCTGTTCGGCAAACAGC TTAACACTTCAATmCAA GACCTTTGGCCCCTAAACTCTATTPATTA'ITGTATAAGAT CCTTAAAC'MGGTTAC AGGT'FWACXATTCAACAATATE GCCCCCACAGTGGAGCCTTAAGGATTCCTACGCACAAAGT TCGCAAGCGCCCGCAAAGCAGGAAAAATGTCTACATCATC

M S T S S CACCGGACAACCCACGACTAAAGCAAGTGACCGACAAACC T G Q P T T K A S D R Q T

CTAGCACCGCGACAAAGTGGGGTGGAGTCAGGAAAGAGCA L A P R Q S G V E S G K S

GCCAGATTAACCCCGGAAATATGCGCCACCCATCCTCGTC S Q I N P G N M R H P S S S CGCCATCGACGCCTTGCTCTCAAACGCCACXACCGCTTCT

A I D A L L S N A R T A S ACCACGACACCATCTACGGCACAGACGAACCACCCTCATG

AAATCATGACCAGCCCGGCGCAACCCCTGATCACCCGATG E I M T S P A Q P L I ' T R W GAACTGCCGAACCCAACCCACACGCCXCTMAAAAGATCC

CCAAATACTGACGTTACGGCCGTACTACACACACTAGTCG AAAAAGTAGATGAACTCACTTGCCGAGGAAGCGAAGAACC

AGCGACCTAAACCTAGATGCCGACTCCACATAACTGCTGG Q R P K P R C R L H I T A G AGGAGGAGCAGACGACCCGAAATGTTGGGCGCATACCCAT

G G A D D P K C W A H T H CGAGTTGACCGCTTAGATTCAGCGAAACCTTTTTXAGAC R V D R L D S A K P F W R

TCGGAAACACCGACCCAAAGGAAGGAAAACGGCACCTCCAACTC L G N T D v P K E N G T S N S ACWTTAGACAATTGATGTCGATTTGGTCATGTACTGCTT

TCGCTCCCTTCTTGTGTGCTC ATC'ITGAGCTCCACCTCTA TTGTTGGTTCTGTCATAATCATCACAATAGATAGTCACTT TGAGCAAGATTCTCTACCAACTGCATCCCCTTGTXYXAA TCATCCCAAGAGATGCCCACTGCTTACAGTGTCAAGCATG TTCWAAA'TTKCXCAAGACTCCTCTGTAGGGTCTCA ACAAAGTCTCCTTTCTGAATTCATGGTGAGGGCCCTGCAT AATCTAGCCCTTGATGAACCGCTCCATCCTTCACCAAAGT TCTCTATTCTTTPATATTATAACTCAATAC?TTTACTCCTCCT CAAAGACATTT$ACChTTPCATTGACAAATATAGATAAAGA AAGTAAGTTAGTAACCAAATAGAAGGAAAAWGATTTAGTCTC AAGCAATGACTGAA'MCC A T C AAAATC AATCTTAGGA "KCAACGGTATCAAAACTC-GAAATCAGTTTAAA RARAAAAAAA 1570

T T T P S T A Q T N H P H

N C R T Q P T R G '

M N S L A E E A K N

L L D N *

40 80 1 2 0 1 6 0 200 240 280 320 360 400 440 480 520

560

600

640

680

7 2 0

7 6 0

800

840 880

9 2 0

960

1 0 0 0

1 0 4 0

1 0 8 0

1 1 2 0 1 1 6 0 1 2 0 0 1 2 4 0 1 2 8 0 1 3 2 0 1 3 6 0 1 4 0 0 1 4 4 0 1 4 8 0 1 5 2 0 1 5 6 0

C

SPLICE

GAC AAU UGA UGU CGA ASP ASN END CYS ARG

. . . . . . . . . . . . .

Figure 4. Sequences of the Composite SLA2 cDNAs.

(A) and (B) The unspliced and spliced cDNA sequences, respectively. In each case, the sequence of the clone utilizing the 3'most polyadenylation site is represented. Potential polyadenylation signals are underlined. A caret over a base indicates the position of an alternative polyadenylation site. In (B), the position of the intron splice site is indicated by a vertical arrowhead. The sequences of ORFl (ATG at position 507) and ORF2 (ATG at position 850) are given in the single-letter amino acid code. The asterisk indicates the TGA termination codon. (C) Generation of the ORF2 translation termination codon by the intron splicing event. Only the nucleotides constituting and immediately flanking the splice donor and acceptor sites are shown. The nucleotides that generate the stop codon as a result of the splicing event are underlined.


unspliced SLA2 cDNA sequence occurs at position 10; however, no open reading frame (ORF) follows. Furthermore, translation termination codons are present at frequent inter- vals in all three reading frames, precluding the existence of an appreciable ORF anywhere within the sequence. The longest ORF begins with the methionine codon at position 1826 and would encode a 62-amino acid protein; however, the extensive 5' leader sequence (-1.8 kb) upstream of this ORF suggests that it is not translated. Comparison of codon usage in the ORFs within the unspliced cDNA with codon usage data compiled for Brassica nuclear genes that are known to be translated indicated that many of the ORFs contain codons that are rarely used in Brassica and are therefore unlikely to be translated. Thus, the overall structure of the cDNA suggests that the unspliced SLA2 transcript does not encode a protein product.

The cDNA representing the spliced SLA2 transcript was similar to that representing the unspliced transcript in that the first methionine codon was not followed by an ORF, and frequent translation termination codons were present throughout the sequence in all three reading frames. The spliced cDNA does contain the two ORFs of interest, however, as shown in Figure 48. The longest ORF present in the sequence, ORF1, would produce a 94-amino acid protein beginning with the methionine codon at position 507 and terminating at position 788. The amino acid composition of ORFl suggests a hydrophilic molecule with a predicted pl of 12 and molecular m a s of 10 kD. ORF2 begins with the methionine codon at position 850 and extends for 68 amino acids (Figure 48) before terminating at a translation termination codon introduced by the intron splicing event, as shown in Figure 4C. Were it not for the creation of this stop codon, the splicing event would extend ORF2 by 126 codons to position 1434. Similar to ORF1, ORF2 predicts a small hydrophilic molecule with a pl of 9 and a molecular mass of 7.5 kD. Neither ORF in the SLA2 spliced transcript is predicted to encode an N-terminal hydrophobic signal sequence typical of secreted proteins, and a search of the DNA and protein data bases revealed no significant homology between the ORFs and any previously characterized sequence.

One factor important in determining the site of translation initiation is the context in which the putative initiating methionine codon is presented. Therefore, the sequences immediately flanking the methionine codon at the beginning of ORFl and ORF2 were compared with the plant consensus sequence for translation initiation (Lütcke et al., 1987). The results of the comparison given in Table 1 suggest that neither of the AUG codons is contained within the ideal context for use as a translation initiator. Although variation from the consensus sequence has been associated with a marked reduction in the efficiency of translation initiation in vitro (Lütcke et al., 1987), identity with the consensus sequence is clearly not the sole determinant of whether a methionine codon is used for translation initiation (Kozak, 1990). This is evident when examining the context of the AUG translation initiation codon of SLG2. It fails to

conform to the consensus sequence (Table 1) but retains the ability to initiate translation effectively (Tantikanjana et al., 1993).

SLAz Transcripts Are Differentially Regulated during Anther Development

Figure 5A shows the result obtained when a blot of poly(A)+ RNA prepared from whole anthers and isolated microspores collected at various developmental stages was hybridized with the 1.5-kb Eagl-BamHI probe initially used to identify the SLA2 transcripts (see Figures 1 and 2). The probe clearly identified two transcripts that were differentially regulated in anther and microspore development. The larger, more abundant transcript is -2.2 kb in length, whereas the smaller transcript is -1.5 kb. As shown in Figures 58 and 5C, respectively, the 2.2-kb transcript also hybridized to a probe derived from the SLA intron, which is not contained in the spliced transcript (see Figure 6), whereas the spliced transcript hybridized to a probe containing the 5'end of the spliced transcript that did not overlap the unspliced transcript (see Figure 6). These results, in con- junction with the fact that the cDNA corresponding to the unspliced transcript is -2.1 kb in length and most abundant in mature anther tissue as is the 2.2-kb transcript, support the conclusion that the larger band identified on RNA blots corresponds to the unspliced transcript and the smaller band corresponds to the spliced transcript.

The hybridization pattern of RNA isolated from microspores at severa1 developmental stages was similar to that obtained with RNA from whole anthers at the corresponding stages. As shown in Figure 5 and summarized in Table 2, the two SLA2 transcripts were found to be differentially regulated and to accumulate in an antiparallel manner during the c o m e of anther maturation. The spliced transcript could be observed in anther and microspore RNA isolated from 4- to 5-mm buds that had an intact tapetum and contained primarily postmeiotic uninucleate microspores. Maximal levels of this transcript were detected in 7- to 9mm buds that either still had an intacttapetum

Table 1. Analysis of SLAz ORFs and SLGz for ldentity with the Translation lnitiation Consensus Sequence

ConsensusC Designation Positiona Lengthb AACAAUGGC

ORFl 507 94 AAaAAUGuC ORF2 850 68 guagAUGaa SLGz AAagAUGaa

a The position of each ORF is given as the residue number of the initiating methionine codon relative to the composite spliced SLA2 cDNA sequence (Figure 48).

Given in amino acids. The predicted initiating methionine codon is given in bold type.

ldentities with the consensus sequence (Lütcke et al., 1987) are indicated by uppercase letters; mismatches are indicated in lowercase.

1288 The Plant Cell

MICROSTORES ANTHERS5-7 7-9 >9 PO 3-5 5-7 7-9 >9 OF

BMICROSTORES ANTHERS

5-7 7-9 >9 PO 3-5 5-7 7-9 >9 OF

ANTHERSMICROSPORES5-7 7-9 >9 PO 3-5 5-7 7-9 >9 OF

DMICROSTORES

5-7 7-9 >9 PO 3-5 5-7 7-9 >9 OF

kb

7.5 -4.4 -

2.4 -

0.24-

!?

Figure 5. RNA Gel Blot Analysis of SLA2 Transcript Accumulation during Anther and Microspore Development.The same blot hybridized with different probes is shown in (A) to (D).(A) The 1.5-kb Eagl-BamHI probe.(B) A probe specific for the unspliced SLA2 cDNA.(C) A probe specific for the spliced SLA2 cDNA.(D) An actin cDNA probe used as a control.Numbers above the lanes refer to bud length in millimeters. Numbers at left indicate molecular length markers in kilobases. PO, mature pollen;OF, open flowers.

(7-mm buds) or lacked a tapetum (9-mm buds) and that con-tained a mixure of binucleate and trinucleate microspores. Thelevel of this spliced transcript then decreased to a barely de-tectable level in mature pollen (Figure 5C). In contrast, theunspliced transcript became evident only at the 7- to 9-mmbud stage and attained maximal levels late in anther/microsporematuration after the degeneration of the tapetal cells in budsbefore flowering (>9-mm bud stage), with slightly lower lev-els present in mature trinucleate pollen grains. Throughoutanther development and even at their maximum, the levelsof the two SLA2 transcripts were very low, and 10 ng of poly(A)+

RNA was required for their visualization. In addition, the max-imal steady state level of the spliced transcript was less thanhalf that of the unspliced transcript. This low abundance isconsistent with our cDNA library screening data: cDNAsrepresenting the unspliced transcript were recovered at a fre-quency of only ~0.0005°/o from a mature anther library,whereas no cDNA clones representing the spliced transcriptwere recovered from this library or by screening ~9 x 105

recombinants in a second cDNA library prepared from imma-ture anthers at the uninucleate and binucleate microsporestages.

Characterization of Putative SLA2 Promoter Sequences

Mapping the 5' ends of the SLA? transcripts has been ham-pered by their low abundance. It is likely, however, that thecDNAs corresponding to both the spliced and unspliced tran-scripts are nearly full length. The lengths of the longestcomposite unspliced cDNA (2179 bp; Figure 4A) and of the

longest composite spliced cDNA (1401 to 1557 bp; Figure 4B)are in agreement, respectively, with the lengths of the 2.2- and1.5-kb transcripts observed on RNA gel blots (Figures 5B and5C). Accordingly, as shown in Figure 7, an analysis of the DNAwithin the putative promoter regions identified consensus TATAelements (Joshi, 1987) within 100 bp of the 5'end of each cDNA.In addition, each putative promoter region was found to con-tain a sequence upstream of the TATA element that fits aconsensus of sequences involved in transcriptional initiation.In the putative promoter for the spliced transcript, this sequenceis CCAAT (Figure 7A), which has been observed in a similarlocation in a number of eukaryotic genes (Lewin, 1990). The

200 bp

Figure 6. Restriction Map of the SLA2 Genomic Region Depicting theProbes Used in the RNA Blot Analysis.Restriction enzyme abbreviations are as given in Figure 3. The hatchedbox represents the 1.5-kb Eagl-BamHI probe; the filled box representsthe probe specific for the unspliced transcript; the open box representsthe probe specific for the spliced transcript. The dip in the linerepresents the intron, and the arrowheads indicate the direction of tran-scription. The triangle indicates the location of the retroelement insertionin the Westar SLA allele.

An Anther-Specific Gene at the 6rassica S Locus 1289

Table 2. Summary of SLAp RNA Gel Blot Analysis

Bud Lengtha Stagea Unsplicedb Splicedb

3-5 Uninucleate - + + + 5-7 Binucleate - + + + + 7-9 Biltrinucleate + + + + + >9 Trinucleate + + + + + + + + f + Flower Trinucleate + + + + + + + + - a Bud length, given in millimeters, is correlated with the developmental stage as defined by the nuclear content of developing microspores.

Relative levels of unspliced and spliced SLAz transcript accumulation are indicated. - , no transcript detected; + , transcript detected (the number of + symbols is qualitatively proportional to the leve1 of transcript accumulation).

putative promoter region of the unspliced transcript contains the sequence AGGA in asimilar position (Figure 76). Although the role this sequence may play in transcriptional initiation is not well characterized, it has been identified in a similar location in a number of plant genes (Heidecker and Messing, 1986).

In addition to the TATA elements, only one sequence, TTAGTGA, could be identified that was conserved between the two putative promoter regions. Significantly, the distance between this conserved element and the TATA sequence in each promoter was roughly equivalent, being 79 bp in the putative promoter for the spliced transcript (Figure 7A) and 66 bp in the putative promoter for the unspliced transcript (Figure 7B). The latter promoter contains an additional copy of this conserved motif between the AGGA element and the TATA sequence as well as a degenerate copy (TTAGTGT) beginning 137 bp upstream of the TATA. Intriguingly, neither the conserved motif nor any other sequence in either promoter region was found to exhibit recognizable similarity with elements previously suggested to direct anther- or pollen-specific transcription.

Characterization of a Nonfunctional SLA Allele from a Self-Compatible Line of 8. napus

As suggested by the result in Figure 1, the identification of new SLA alleles in other 6. oleracea S haplotypes through hybridization analysis was largely unsuccessful. However, one B. napus line was identified that contained a sequence hybridizing very strongly with the SLAz genomic probe. Figure 8A depicts the result of gel blot hybridization analysis of Hindlll- digested DNA isolated from the B. oleracea Sz haplotype described previously and three isolates of the commercially available 6. napus variety Westar. The 4.1-kb Hindlll fragment identified in the Westar DNA differed in length from the expected 7.0-kb fragment identified in the Sz DNA. However, the intensity of the hybridization signal for Westar and Sz DNA was roughly equivalent following extensive washing under high- stringency conditions, suggesting that the two sequences are highly similar.

Figure 8B shows the result obtained when whole antherand mature pollen poly(A)+ RNAs isolated from B. olefacea SZ and from Westar were hybridized with the same probe used in Fig- ure 8A. Although the expected band of 2.2 kb corresponding to the unspliced SLA2 transcript was identified in Sz RNA, no signal was observed in Westar RNA. Likewise, similar gel blot analysis of RNA isolated from immature anthers failed to identify the spliced SLA transcript in Westar (data not shown). We concluded that in Westar, transcription of SLA is not initiated or the RNA is unstable and does not accumulate to detect- able levels.

To identify the molecular basis of the defect in the Westar SLA gene, the corresponding region was isolated from a total genomic library, restriction mapped, and sequenced. The Westar SLA sequence is nearly identical to the 6. oleracea SLAz sequence, with the exception of a 4827-bp insertion. The position of this insertion is shown relative to the SLAz sequence in Figure 6. The sequence of the insertion exhibits many hallmarks of retrotransposons and is described elsewhere (D.C. Boyes and J.B. Nasrallah, manuscript in preparation). The SLA sequence flanking the insertion is >99% identical to the SLAP sequence, including the intron for which

A 430

-380

~330

-280

-230

-180

-130

-80

-30

B -463

~ 4 1 3

-363

~ 3 1 3

-263

-213

-163

-113

-63

-13

Xba I - TCTAGATAATTTTATGAAAATATATAGATTTTTATTTTAAAGAGATGGAA

GACTTCTTTAGAACTTATGTTAAATATGGACCAACACATGATTTGTGAAT

TGTTATCCCAATAATATAACCCAAATCGTTGCCAAAAAAAAAAAAAAAATA

TATATATATATATATATATATAACCCAAATCAAGTTTTCTTTTCAACACC

TTTCCCTAAACTTGATTTGCTTATTCTGAGTAACCTCAGCATTTTGATAT

TGTCTTTCCGTTTGAGTGG+Z~E~$+GATATTAGCTACTTGATAATTT G T C T T C A C A T A C T E T G C A C G T T C A T A T T G G T A A C C C A T ' S T T C T A A L

ATAATGATAACGAATATTTATG'I'GCTTACTCCAATGA'rGAAAGACTGGAT

TTCACCAATGCTATTGTTGATI'TGTTATCT

- -

Hindlll - AAGCTTTCACCAFAATTTTACCCAGTTTCTAI'I'GGGTCAATCTAGGGTTG

ATGAGTCGATCAAGTCCGACTTTGGAGGCCTATATATCTGI'TTTTTAGGC

CAAATTTTTTAATTATCTTATT'II'ATCTATTAAGACAATTGATTCTGATG

AAAAGTTATTCATTTATCATC'I'TTTAAGCAAT'rTCTCTTCTTTTTCrGAC

AAAAAAACAATAATGCAATA'rCTCTTATAAGTCTTATGd-%T rT

ATCTTGTCTTCTAACATGATTATTCTTAAACGTTACAI'GGTTTAAGGTCI'

T [email protected] S I'ACGTAGATT

- AGGATGA.li-$3ACTTGGGTG-GCTAGATCCTTCATATCT

TGTTCTATGCTTCTTTACTGATCCTAATACTGAATTAGI'CTTGATCTCrC

TATATCTAGATCC

-381

-331

-281

-23 I

~ 1 8 1

~131

-81

-3 I

1

-414

-364

-314

-264

-214

-164

-114

-64

~ 1 4

I

Figure 7. Analysis of the Putative SLA2 Promoters.

(A) The putative promoter of the spliced transcript. (e) The putative promoter of the unspliced transcript. Numbering is relative to the 5'end of the cloned cDNAs. Putative TATA elements are underlined, and consensus transcriptional enhancer elements are double underlined. The motif conserved between the two promoters is indicated by a box. Restriction sites are indicated for posi- tioning relative to the restriction map given in Figure 6.

1290 The Plant Cell

Hindrn BS2 Westar

kb

7.0 -

4.1 -

g 5

O I- B HO. .2 a rt

kb

of SLA in that probes derived from that region of the S2 haplotype hybridized to a corresponding location in the Westarhaplotype (data not shown). Because this Westar haplotype andthe B. oleracea S2 haplotype are clearly similar in their struc-ture and DNA sequence, we have designated this Westarhaplotype S2w.

DISCUSSION

2.2 -

Figure 8. Analysis of the SLA Gene Encoded by the Westar S?vvHaplotype.(A) Gel blot analysis of Hindlll-digested DNA extracted from a B. oler-acea plant homozygous for the S2 haplotype and three differentB. napus plants of the variety Westar.(B) Gel blot analysis of RNA extracted from B. oleracea plants homozy-gous for the S2 haplotype and B. napus plants of the variety Westar.RNA was isolated from either early trinucleate stage anthers or ma-ture pollen.The probe was the 1.5-kb Eagl-BamHI SLA2 genomic fragment. Num-bers to the left of the gel blots indicate the lengths of the hybridizingbands in kilobases.

the placement of the splice donor and acceptor sites was con-served. Furthermore, the position and predicted amino acidsequence of the ORFs are highly conserved, the only differ-ence being the replacement of the arginine residue at position88 of ORF1 in the SLA2 sequence (Figure 4B) by glutaminein the Westar sequence.

The similarity between the B. oleracea S2 and Westar se-quences extends beyond the SLA gene into the flanking DNA.In the S2 haplotype, the SLG gene is transcribed to producetwo transcripts that differ only in their 3' ends (Tantikanjanaet al., 1993), and the 3' end of the longer transcript is ~500bp upstream of the site corresponding to the 5' end of thespliced SLA cDNA (Figure 1A). Preliminary restriction map-ping suggested that this physical organization was conservedin the Westar haplotype as well (data not shown). Indeed, se-quence analysis of the Westar DNA extending ~2 kb upstreamfrom the site corresponding to the 5' end of the spliced SLAcDNA revealed ~99% identity with the corresponding regionof the S2 sequence. The sequenced region included 462 bpat the 3' end of SLG exon 1, the SLG intron, SLG exon 2, andthe 500-bp interval between the 3' end of the SLG transcriptand the 5'end of the spliced SLA cDNA (data not shown). Themost striking difference between the Westar and S2 se-quences in this region is a 59-bp deletion in the Westar SLGintron. Structural similarity between the S2 and Westar haplo-types is also likely to exist in the genome on the other side

In this study, we describe the molecular cloning and initial char-acterization of the SLA2 locus from B. oleracea. SLA2 hasseveral salient features. First, SLA2 is encoded within DNAimmediately downstream of SLG2 and is therefore physicallylinked to the S locus. Second, DNA fragments derived fromthe SLA2 gene hybridize to blots of genomic DNA repre-senting a number of homozygous S haplotypes in an S2

haplotype-specific pattern. Third, SLX\2 transcripts are de-tected exclusively in anther and microspore RNA. Thesefeatures are particularly tantalizing in the context of SI in Bras-sica, and of genetic and molecular evidence that the S locusis a multifunctional gene complex that encodes the function(s)required for the papillar cells to distinguish between self- andnon-self-pollen as well as the molecular determinants that markthe pollen as self or non-self.

In Brassica, the SI phenotype of pollen is determinedsporophytically. It is therefore relevant to consider the site andtiming of expression for any S locus-linked gene that is ex-pressed in anthers, even though the pollen SI phenotype mayrequire the action of more than one gene, just as the stigmaSI phenotype requires the action of at least two genes, SLGand SRK. Two models of sporophytic control have beenproposed. In one model, the determinants of the pollen SIphenotype are postulated to be expressed premeioticallywithin the diploid meiocytes (Pandey, 1958). An alternativemodel postulates the expression of factors governing pollenspecificity in the sporophytically derived cells of the tapetumand their subsequent transfer to the pollen coat following tape-tal cell degeneration (Heslop-Harrison, 1968). Our RNA gelblot analysis has shown that the spliced SLA2 transcript,which has protein coding capacity and is thus more relevantto a discussion of sporophytic control of the pollen SI pheno-type, is present in uninucleate microspores. This expressionat the earliest developmental stage for which analysis is prac-tical suggests that the spliced transcript may be expressedeven earlier in premeiotic pollen mother cells. In addition, be-cause this spliced transcript was also detected in RNA fromanthers containing an intact tapetum, the possibility remainsthat it is expressed not only in microspores but also in tapetalcells. This issue may be resolved by an analysis of gene activ-ity in situ through the application of in situ hybridization orreporter gene methods, although such an analysis is likely tobe complicated by the very low abundance of SLA2 tran-scripts. A dual pattern of gametophytic and sporophyticexpression would not be unique to the spliced SLA2 transcript:


a similar expression pattern has been described for other plant genes, as exemplified by the anther-specific Brassica Bcpl gene (Theerakulpisut et al., 1991) and, interestingly, by the Brassica SLG gene, which, although expressed primarily in stigmatic papillar cells, is also active in the tapetum and in microspores (Sato et al., 1991).

Although not directly related to the phenomenon of SI, the differential regulation of the two complementary SLAz transcripts in developing microspores is noteworthy. Whereas the spliced transcript was detected at early stages of microspore development and did not occur in mature pollen grains, the unspliced SLAz transcript was first detected at the late binucleate stage of microspore development, and its maximal levels were attained in mature pollen. This antiparallel accumulation pattern of the two SLAz transcripts suggests, but does not prove, that the unspliced transcript functions as a natu- rally occurring antisense transcript that modulates the leve1 of the spliced transcript in developing microspores. The modu- lation of gene expression via antisense RNA, a strategy well documented in prokaryotes (Inouye, 1988; Simons, 1988), has also been used in eukaryotes, as demonstrated by recent work in animal systems (Kimelman and Kirschner, 1989; Krystal et al., 1990; Hildebrandt and Nellen, 1992; Nellen and Lichtenstein, 1993).

Recent reports in animal studies have demonstrated that some genes produce RNAs that are processed and poly- adenylated, and yet function without being translated (Brannan et al., 1990; Brockdorf et al., 1992; Brown et al., 1992). In some cases, these RNAs have dramatic effects on cell growth (Koromilas et al., 1992; Rastinejad et al., 1993). Untranslated RNAs have been reported in plants as well. For example, Turcich and Mascarenhas (1994) have described a family of repetitive sequences related to retroelement repeat sequences that produce transcripts of heterogeneous lengths in a variety of plant organs, but it is not known whether these transcripts have a biological function. There are also reports of a gene with an unusual structure, the early nodulin fNOD40 gene from soybean (Yang et al., 1993), pea (Matvienko et al., 1994), alfalfa (Asad et al., 1994), and Medicago (Crespi et al., 1994), which has been proposed by some to function in nodule development as an RNA because it has limited protein-coding capacity and can potentially encode only a short peptide. Al- though it is formally possible that any function performed by the SLAz gene is mediated by its RNA transcripts, our work- ing hypothesis is that one of the ORFs contained within the spliced SLA2 transcript is translated to produce a highly ba- sic pollen coat protein of 7.5 or 10 kD. This protein would function as a recognition molecule in pollen-stigma interactions.

In view of the lack of a notable hydrophobic signal sequence at the N terminus of the two ORFs, targeting of those molecules encoded by SLAz transcripts expressed in the diploid meiocytes and in microspores to the pollen coat would have to proceed by a nonclassic pathway similar to that invoked for a number of secreted eukaryotic proteins that lack signal sequences (Kuchler, 1993). Alternatively, the possibility remains that the SLAz peptide is expressed in the tapetal layer, which

would allow for its deposition on the pollen surface following tapetal degeneration. In either case, the SLA2 peptide would subsequently be delivered to the stigma by pollen and, in self- pollinations, would interact directly or indirectly with S locus- encoded stigmatic proteins, such as SLG and SRK, to precipi- tate the SI response. Precedents exist for the occurrence of low molecular mass proteins on the surface of Brassica pollen. One example is an abundant 7-kD pollen coat protein (Doughty et al., 1993) that was shown to interact at least in vitro with the stigmatic SLG and SLRl (S locus related; Umbach et al., 1990) proteins, albeit in a non-S haplotype-specific manner. More generally, small proteinaceous molecules are known to act as signals not only in animals but also in plants and fungi. Among the most notable examples of such molecules are the 18-amino acid peptide systemin (Pearce et al., 1993) and the 28-amino acid Cladosporium fulvum avirulence gene avr9 peptide elicitor (van Kan et al., 1991), both of which are processed from larger preproteins, and the mating pheromones of Ustilago maydis, which are synthesized as small 38- and 40-amino acid peptides (Bolker et al., 1992).

The discovery of a nonfunctional SLA sequence in the self- compatible B. napus var Westar provides an opportunity to assess the role of SLAz in the SI response. Except for the occurrence of a large insertion that interrupted its SLA gene, the B. napus S2, haplotype was found to be very similar to the B. oleracea Sz haplotype, not only in the sequence of its SLA gene but also in its overall organization. This finding is not unexpected in view of evolutionary studies showing 8. napus to be an amphidiploid containing the B. oleracea and B. campestris genomes (Prakash and Hinata, 1980) and of molecular evidence indicating that the diversification of S haplotypes predated speciation in the genus Brassica (Dwyer et al., 1991). Because the possibility cannot be excluded that other lesions exist within the Westar genome, further analysis is required to determine whether the absence of a functional SLA locus is correlated with self-compatibility in this strain.

If SLAz is truly a determinant of Sz specificity in pollen, one would expect each S haplotype to encode a corresponding SLA allele. However, the Sz haplotype-specific hybridization patterns obtained with the SLAz probe on DNA gel blots (Fig- ure 1) and RNA gel blots (data not shown) indicate that SLA alleles from haplotypes other than Sz must be divergent enough to escape detection by standard hybridization methods, even under conditions of reduced stringency. Such extensive sequence divergence would exceed the polymorphism reported for SLG and SRKalleles that diverge at most by -33% (Chen and Nasrallah, 1990; Stein et al., 1991) and would be consistent with the polymorphic nature of the S locus. Although such a degree of sequence divergence is unusual for allelic forms of a gene, it is not unique. Similarly high levels of sequence divergence have been observed at the mating-type loci of single-celled eukaryotes. In Chlamydomonas reinhardtii, regions that exhibit mating-type-specific hybridization have been found within the mating-type locus complex (Ferris and Goodenough, 1994). In addition, in a number of fungi, mating- type specificity is controlled by a single locus that exists in

1292 The Plant Cell

two allelic forms or idiomorphs that share very little if any sequence similarity (Glass et al., 1988). The a mating-type 10- cus of u. maydjs in particular provides interesting parallel to the Brassica locus: each of the two a locus variants is a gene complex that encodes a mating-type-specific pheromone and the receptor for the pheromone Of Opposite ’pecificity @oiker et lgg2). The degree Of se- quente divergente expected for SLA alieles jS thus One Of

Severa1 featUreS Of the BfaSSiCa s IOCUS that liken it to lOCi COn-

determined by nuclear staining according to published methods (Detchepare et al., 1989). Fresh anthers were squashed in 0.05 M Tris-HCI, pH 7.0, 0.5% (vk) Triton X-100 containing 1 mg/mL 4’,bdiami- dino-Fphenylindole and incubated for 20 min at room temperature; the microspores were obsewed by fluorescence microscopy. For RNA extraction, microspores were isolated by extensively washing finely diced buds in TE (10 mM Tris-HCI, pH 8.0, 1 mM EDTA). Cell debris was removed by passage through a nylon mesh filter, and microspores were pelleted by centrifugation at 40009 for 5 min. The microspore pellet was resuspended in 1 mL of TE and layered on a solution of

trolling specific celt-cell recognition processes in other 50% Percoll in TE (vhr) and centrifuged at 16,OOOg for 10 min. Con- organisms.

METHODS

taminating chloroplasts failed to enter the Percoll solution, whereas the yellow microspores could be found throughout the Percoll layer. The yellow fraction was collected, diluted by the addition of 2 volumes of TE, and centrifuged at 40009 for 5 min. The pellet contained intact microspores with minimal chloroplast contamination.

Plant Material

Chinese kale (Brassica oleracea var alboglobra ) plants homozygous for the Sz haplotype and marrow-stem kale (6. oleracea var acephala) plants homozygous for the S5, S6, Sr3, and SZZ haplotypes were derived from lines obtained from the GeneBank Facility at Wellesbourne, UK, courtesy of D.J. Ockendon. The self-compatible oilseed rape (13. napus) plants were selections from the commercial variety Westar.

FINA lsolation and Gel Blot Analysis

Poly(A)+ RNA was isolated using the FastTrack RNA isolatidn kit pro- toco1 (Invitrogen, San Diego, CA). lsolated RNA was resolved on 1% (wlv) agarose gels in the presence of glyoxal and transferred to nylon membranes for hybridization with radioactively labeled DNA probes as described by Boyes et al. (1991). The tissue survey blot shown in

DNA lsolation and Analysis

lsolation and purification of plant DNA by CsCl gradient centrifugation were performed as described previously (Boyes et al., 1991). Approximately 7 pg of restriction enzyme-digested DNA was loaded in each lane of a lO/o agarose gel. After size fractionation, the DNA was transferred to a nylon membrane and hybridized with the radioactively labeled 1.5-kb Eagl-BamHI single-copy fragment described in the text. Hybridization and washing of blots were conducted at 65OC as described previously (Boyes et al., 1991). Blots were washed to a final stringency of 0.1 x SSC (1 x SSC is 0.15 M NaCI, 0.015 M sodium citrate), 0.1% (w/v) SDS at 65OC. Hybridization to detect sequences similar to SLAz (for S Locus Anther) in S haplotypes other than Sz was conducted at 55OC with washes at 2 x SSC, 0.5% (w/v) SDS. The re-

Figure 2 contained 5 pg of RNA in each lane. For analysis of RNA from anthers and microspores at different stages of development (Figure 5), 10 )rg of RNA was loaded in each lane.

The probes used in the RNA gel blot analysis are as follows (see Figure 7): (1) a 1.5-kb Eagl-BamHI genomic fragment from the SLAz gene; (2) a 451-bp DNA product generated by the polymerase chain reaction (PCR) using oligonucleotide primers 5‘-ATCCTlGAACTATGC- TCC-3‘ and 5’-CTCAACAGAATCATGAGC-3’ that were specific for the unspliced SLAz transcript; (3) a 362-bp DNA probe specific for the spliced SLA2 transcript defined at one end by an oligonucleotide primer 5‘-CTCCAATTGCACGTTCATA-3‘that annealed to the genomic sequence upstream of the predicted 5’ end of the spliced SLAz transcript and at the other end by an EcoRl site at position 243 oí the spliced SLAz cDNA sequence.

sult of this hybridization was essentially identical to that obtained from the high-stringency hybridization, with the exception of a diffuse back- ground in each lane (data not shown).

The B. oleracea genomic clone containing SLGz (for S Locus Gly-

lsolation of cDNAs Corresponding to the Unspliced SLAz Transcripts

coprotein) and SLA2 was previously described by Chen and Nasrallah (1990). Genomic clones containing the Westar SLA locus were isolated from a library containing 4 2 haploid genome equivalents that was constructed in the vector &GEMI1 (Promega) according to standard protocols (Sambrook et al., 1989). The library was screened with the 1.5-kb Eagl-BamHI single-copy SLAz probe depicted in Figure 1A. For detailed analysis, restriction fragments were subcloned into the plasmid vector pBluescript SK+ (Stratagene) according to standard protocols (Sambrook et al., 1989).

RNA was isolated from anthers collected -1 day before anthesis and used to construct an oligo(dT)-primed cDNA library in the 1 UniZap XR vector (Stratagene). Approximately 106 recombinant clones were screened with the 1.5-kb Eagl-BamHI single-copy SLAZ probe. Posi- tively hybridizing clones were purified and converted to plasmids by in vivo excision (Stratagene) for further analysis. The longest of these clones was designated p2c3. PCR amplification of the cDNA library to extend the 5’end of the p2c3 sequences was performed using the DNA GeneAmp kit (Perkin-ElmerlCetus, Norwalk, CT). The amplification was primed with an oligonucleotide (SAGGGTCTCAACAAACTCT-3’J corresponding to sequences at the 5’end of p2c3 and an oligonucleotide (5’-ATTAACCCTCACTAAAG-3’) corresponding to the T3 RNA polymerase promoter contained in the vector. PCR amplification products were cloned in the vector pCRll using the TAcloning kit (Invitrogen) for further analysis.

Anther Staging and Microspore lsolation

Buds were collected from vigorously flmering plants, and their lengths were measured. The developmental stage of each size bud was


lsolation of the cDNA Corresponding to the Spliced SLAp Transcript

RNA-PCR was performed with the GeneAmp RNA-PCR kit (Perkin- Elmer/Cetus). First-strand cDNA synthesis was primed with oligo(dT),s. The oligonucleotide primer pair used to amplify the 820-bp in- terna1 fragment of the spliced transcript was 5'-TACATCATCCACCGG- ACA-3' and 5'-AGGGCTAGATTATGCAG-3'. ldentification of the 3' and 5' ends of the spliced transcript was accomplished using the rapid amplification of cDNAends(RACE) procedure (Frohman et al., 1988). The primer used in the 3' RACE procedure was 5'-AGGTCTCAACAA- ACTCT-3: We were unable to generate 5 RACE products that were longer than 400 bp. Therefore, amplification of the 5'end of the spliced transcript was accomplished in a "walk" consisting of three separate amplification steps. After each step, the longest products were cloned and sequenced to facilitate the design of primers for use in the following step. This procedure was continued until the expected total transcript length of 4 . 5 kb had been isolated. The following primers were used in the 5' RACE procedure for reverse transcription and amplification: step 1, 5'-GTCAACTCGATGGGTATG-3' and 5'-AACATTTCGGGTCGT- CTG-3'; step 2,5'-GCTTGCGAACTTTGTGCG-3' and 5'-GAATCCTTA- AGGCTCCAC-3'; and step 3,5'-GTCTAGCGGTGGTT-3' and 5'-CGT- GTTTGGCTATGATCG-3'. All PCR amplification products were cloned into the vector pCRll using the TA cloning kit (Invitrogen) for further analysis.

Sequence Analysis

Dideoxynucleotide sequence analysis was performed on double- stranded plasmid templates with the Sequenase kit (U.S. Biochemi- cal Corp.) as described by De1 Sal e1 al. (1989). Nested deletions were constructed using the Erase-A-Base kit (Promega). Sequences were analyzed using the IBI Pustell (International Biotechnologies/Kodak, New Haven, CT) and Genetics Computer Group (Madison, WI) soft- ware packages. EMBL and GenBank data bases were searched for nucleic acid and protein homology using the FASTA algorithm (Pearson and Lipman, 1988). The GenBankEMBUDDBJ accession number for the sequence reported in this paper is L43495.

ACKNOWLEDGMENTS

This work was supported by Grant No. 92-37301-7828 from the U.S. Department of Agriculture to J.B.N. D.C.B. was the recipient of aone- year predoctoral fellowship from the Cornell National Science Foun- dation Plant Science Center, a unit in the U.S. Department of Agriculture-Department of Energy-National Science Foundation Plant Science Centers Program.

Received March 21, 1995; accepted June 21, 1995.

REFERENCES

Asad, S., Fang, Y., Wycoff, K.L., and Hirsch, A.M. (1994). lsolation and characterization of cDNA and genomic clones of Ms€NOD40:

Transcripts are detected in meristematic cells of alfalfa. Protoplasma

Bolker, M., Urban, M., and Kahmann, R. (1992). The a mating type locus of U. maydis specifies cell signaling components. Cell 68, 441-450.

Boyes, D.C., and Nasrallah, J.B. (1993). Physical linkage of the SLG and SRK genes at the self-incompatibility locus of Brassica oleracea. MOI. Gen. Genet. 236, 369-373.

Boyes, D.C., Chen, C-H., Tantikanjana, T., Esch, J.J., and Nasrallah, J.B. (1991). lsolation of a second S-locus-related cDNA from Bras- sica oleracea: Genetic relationships between the S locus and two related loci. Genetics 127, 221-228.

Brannan, C.I., Dees, E.C., Ingram, R.S., and Tilghman, S.M. (1990). The product of the H79 gene may function as an RNA. MOI. Cell. Biol. 10, 28-36.

BrocMorff, N., Ashworth, A., Kay, G.F., McCabe, V.M., Norris, D.P., Cooper, P.J., Swift, S., and Rastan, S. (1992). The product of the mouse XlSTgene is a 15 kb inactive X-specific transcript containing no conserved ORF and located in the nucleus. Cell71,515-526.

Brown, C.J., Hendrich, B.D., Rupert, J.L., Lafrenihre, R.G., Xing, Y., Lawrence, J., and Willard, H.F. (1992). The human XlSTgene: Analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell 71, 527-542.

Brown, J.W.S. (1986). A catalogue of splicejunction and putative branch point sequences from plant introns. Nucleic Acids Res. 14, 9549- 9559.

Chen, C.-H., and Nasrallah, J.B. (1990). A new class of S sequences defined by a pollen recessive self-incompatibility allele of Brassica oleracea. MOI. Gen. Genet. 222, 241-248.

Crespi, M.D., Jurkevitch, E., Poiret, M., dAubenton-Carafa, Y., Petrovics, G., Kondorosi, E., and Kondorosi, A. (1994). ENOD40, a gene expressed during nodule organogenesis, codes for a non- translatable RNA involved in plant growth. EMBO J. 13,5099-5112.

De1 Sal, G., Manfioletti, G., and Schneider, C. (1989). The CTAB- DNA precipitation method: A common mini-scale preparation of tem- plate DNA from phagemids, phages, or plasmids suitable for sequencing. Biotechniques 7, 514-519.

Detchepare, S., Heizmann, P., and Dumas, C. (1989). Changes in protein patterns and protein synthesis during anther development in Brassica oleracea. J. Plant Physiol. 135, 129-137.

Doughty, J., Hedderson, F., McCubbin, A., and Dickinson, H. (1993). lnteraction between a coating-borne peptide of the Brassica pollen grain and stigmatic S (self-incompatibi1ity)-locus-specific glycoproteins. Proc. Natl. Acad. Sci. USA 90, 467-471.

Dwyer, K.G., Balent, M.A., Nasrallah, J.B., and Nasrallah, M.E. (1991). DNA sequences of self-incompatibilty genes from Brassica campestris and Brassica oleracea: Polymorphism predating speciation. Plant MOI. Biol. 16, 481-486.

Ferris, P.J., and Goodenough, U.W. (1994). The mating-type locus of Chlamydomonas reinhardtii contains highly rearranged DNA sequences. Cell 76, 1135-1145.

Frohman, M.A., Dush, M.K., and Martin, G.R. (1988). Rapid production of full-length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci.

Glass, N.L., Vollmer, S.J., Staben, C, Gmtelueschen, J., Metzenberg, R.L., and Yanofsky, C. (1988). DNAs of the two mating-type alleles of Neurospora crassa are highly dissimilar. Science 241, 570-573.

183, 10-23.

USA 85, 8998-9002.

1294 The Plant Cell

Guilluy, C., Trick, M., Heizmann, P., and Dumas, C. (1991). PCR detection of transcripts homologous to the self-incompatibility gene in anthers of Brassica. Theor. Appl. Genet. 82, 466-472.

Heidecker, G., and Messing, J. (1986). Structural analysis of plant genes. Annu. Rev. Plant Physiol. 37, 439-466.

Heslop-Harrison, J. (1968). Ribosome sites and S gene action. Na- ture 218, 90-91.

Hildebrandt, M., and Nellen, W. (1992). Differential antisense transcription from the Dictyostelium EB4 gene locus: lmplications of anti-sense mediated regulation of RNA stability. Cell 69, 197-204.

Inouye, M. (1988). Antisense RNA: Its functions and applications in gene regulation-A review. Gene 72, 25-34.

Joshi, C.P. (1987). An inspection of the domain between putative TATA box and translation start site in 79 plant genes. Nucleic Acids Res.

Kandasamy, M.K., Paolillo, D.J., Faraday, C.J., Nasrallah, J.B., and Nasrallah, M.E. (1989). The S locus specific glycoproteins accumulate in the cell wall of developing stigma papillae. Dev. Biol. 134,

Kandasamy, M.K., Thorsness, M.K., Rundle, S.J., Goldberg, M.L., Nasrallah, J.B., and Nasrallah, M.E. (1993). Ablation of papillar cell function in Brassica fiowers results in the loss of stigma recep- tivity to pollination. Plant Cell 5, 263-275.

Kimelman, D., and Kirschner, M.W. (1989). An antisense mRNAdirects the covalent modification of the transcript encoding fibroblast growth factor in Xenopus oocytes. Cell 59, 687-696.

Koromilas, A.E., Roy, S., Barber, G.N., Katze, M.G., and Sonenberg, N. (1992). Malignant transformation by a mutant of the IFN-inducible dsRNA-dependent protein kinase. Science 257, 1685-1689.

Kozak, M. (1989). The scanning model for translation: An update. J. Cell Biol. 108, 229-244.

Kozak, M. (1990). Downstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomes. Proc. Natl. Acad. Sci. USA 87, 8301-8305.

Krystal, G.W., Armstrong, B.C., and Battey, J.F. (1990). N-myc mRNA forms an RNA-RNA duplex with endogenous antisense transcripts. MOI. Cell. Biol. 10, 4180-4191.

Kuchler, K. (1993). Unusual routesof protein secretion: The easy way out. Trends Cell Biol. 3, 421-426.

Lewin, B. (1990). Genes IV. (Cambridge, MA: Cell Press).

Liitcke, H.A.,Chow, K.C., Mickel, F.S., Moss, K.A., Kern, H.F., and Scheele, G.A. (1987). Selection of AUG initiation codons differs in plants and animals. EMBO J. 6, 43-48.

Matvienko, M., van de Sande, K., Yang, W.-C., van Lammen, A., Bisseling, T., and Franssen, H. (1994). Comparison of soybean and pea ENOD40 cDNA clones representing genes expressed during both early and late stages of nodule development. Plant MOI. Biol. 26, 487-493.

Nasrallah, J.B., and Nasrallah, M.E. (1993). Pollen-stigma signaling in the sporophytic self-incompatibility response. Plant Cell 5,

Nasrallah, J.B., Rundle, S.J., and Nasrallah, M.E. (1994a). Genetic evidence for the requirement of the Brassica S-locus receptor kinase gene in the self-incompatibility response. Plant J. 5,373-384.

Nasrallah, J.B., Stein, J.C., Kandasamy, M.K., and Nasrallah, M.E. (1994b). Signaling the arrest of pollen tube development in self- incompatible plants. Science 266, 1505-1508.

15, 6643-6651.

462-472.

1325-1 335.

Nasrallah, M.E., Kandasamy, M.K., and Nasrallah, J.B. (1992). A genetically defined trans-acting locus regulates S-locus function in Brassica. Plant J. 2, 497-506.

Nellen, W., and Lichtenstein, C. (1993). What makes mRNA anti- sensitive? Trends Biochem. Sci. 18, 419-423.

Pandey, K.K. (1958). Time of S allele action. Nature 181, 1220-1221.

Pearce, G., Johnson, S., and Ryan, C.A. (1993). Structure-activity of deleted and substituted systemin, an 18-amino acid polypeptide inducer of plant defensive genes. J. Biol. Chem. 268, 212-216.

Pearson, W.R., and Lipman, D.J. (1988). lmproved tools for biologi- cai sequence comparison. Proc. Natl. Acad. Sci. USA85,2444-2448.

Prakash, A.H., and Hinata, K. (1980). Taxonomy, cytogenetics and origin of crop Brassica, a review. Opera Bot. 55, 1-59.

Rastinejad, F., Conboy, M.J., Rando, T.A., and Blau, H.M. (1993). Tumor suppression by RNA from the 3’ untranslated region of a-tropomyosin. Cell 75, 1107-1117.

Sambrook, J., Fritsch, E.F., and Maniatis, 1. (1989). Molecular Clon- ing: A Laboratory Manual. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press).

Sato, T., Thorsness, M.K., Kandasamy, M.K., Nishio, T., Hirai, M., Nasrallah, J.B., and Nasrallah, M.E. (1991). Activity of an S locus gene promoter in pistils and anthers of transgenic Brassica. Plant Cell 3, 867-876.

Simons, R.W. (1988). Naturaily occurring antisense RNA control-A brief review. Gene 72, 35-44.

Staben, C., and Yanofsky, C. (1990). Meurospora crassa a mating- type region. Proc. Natl. Acad. Sci. USA 87, 4917-4921.

Stein, J.C. (1994). Studies on the Structure, Function, and Expres- sion of the S-Locus Receptor Kinase Gene of Brassica. PhD Dissertation (Ithaca, NY: Cornell University).

Stein, J.C., Howlett, B.H., Boyes, D.C., Nasrallah, M.E., and Nasrallah, J.B. (1991). Moiecular cloning of a putative receptor protein kinase gene encoded at the self-incompatibility locus of Brassica oleracea. Proc. Natl. Acad. Sci. USA 88, 8816-8820.

Tantikanjana, T., Nasrallah, M.E., Stein, J.C., Chen, C.-H., and Nasrallah, J.B. (1993). An alternative transcript of the S locus glycoprotein gene in a class I I pollen-recessive self-incompatibility haplotype of Brassica oleracea encodes a membraneanchored pre tein. Plant Cell 5, 657-666.

Theerakulpisut, P., Xu, H., Slngh, M.B., Pettitt, J.M., and Knox, R.B. (1991). lsolation and developmental expression of Bcpl, an anther-specific cDNA clone in Brassica campestris. Plant Cell 3,

Turcich, M.P., and Mascarenhas, J.P. (1994). PREM-1, a putative maize retroelement has TR (long terminal repeats) sequences that are pref- erentially transcribed in pollen. Sex. Plant Reprod. 7, 2-11.

Umbach, A.L., Lalonde, B.A., Kandasamy, M.K., Nasrallah, J.B., and Nasrallah, M.E. (1990). lmmunodetection of protein glycoforms encoded by two independent genes of the self-incompatibility multi- gene family of Brassica. Plant Physiol. 93, 739-747.

van Kan, J.A.L., van der Ackerveken, G.F. J.M., and de Wit, P. J.G.M. (1991). Cloning and characterization of cDNA of avirulence gene avr9 of the funga1 pathogen Cladosporium fulvum, causal agent of tomato leaf mold. MOI. Plant-Microbe Interact. 4, 52-59.

Yang, W.-C., Katinakis, P., Hendriks, P., Smolders, A., de Vries, F., Spee, J., van Kammen, A., Blsseling, T., and Franssen, H. (1993). Characterization of GmENOD40, a gene showing nove1 patterns of cell-specific expression during soybean development. Plant J. 3, 573-585.

1073-1084.

an anther-specific gene encoded by an s of brassica produces

Documents