what can your dog teach you about genetics?

What can your Dog teach you about Molecular Genetics?

April 16 2009

Intended to supplement Genetics Class lectures Posted with additional information and ppt on

website: http://sites.google.com/site/

eleaningmodulesinbiology/ Material was assembled for a project for Harvard

Extension “The Cognitive Dog” Class

This is what I want you to know Why are geneticists interested in dogs? What is a QTL? What is the relationship between QTL’s and

phenotypic change? Why is a SNP an effective Genetic Marker? Explain how a gene pool becomes bottlenecked. What is the effect of inbreeding on SNP

differences between individual breeds? Why does both a pedigree family chart and

genetic markers combine for a powerful tool for gene investigation?

Why have dogs become very interesting to molecular geneticists?

Dogs on the cutting edge of genetic research

Dog breeds represent a genetic bottleneck that decrease recombinant variability

Genetic diseases are problematic with inbred dogs. (At least 350 that are found in humans have been

identified in different breeds)

Many breeds have many generations of breeding documentation

Canine Genetic Screening Progressive Retinal Atrophy (

PRA) Hypothyroidism with Goiter  (

HTG)(Congenital Hypothyroidism)

Cystinuria (CYST) Globoid Cell Leucodystrophy (

GCL) Neuronal Ceroid

Lipofuscinosis (NCL) Phosphofructosokinase

Deficiency (PFK) Von Willebrand Disease (vWD

) Narcolepsy (NARC) Cone degeneration (CD)

Canine Leucocyte Adhesion Deficiency (CLAD)

Hemophilia B (HmB) Muscular Dystrophy (MD) Myotonia Congenita (MC) GMI Gangliosidosis (GMIG) Retinal Dystrophy (prad) SCID (DNA-PKc & DNA

PKc2) Mucopolysaccharidosis Type

VII (GUSB_NOSVVIII) Thrombasthenic

Thrombopathia ( THROM) Congenital Cardiac Defects OFA Elbow & Hip Dysplasia

High quality map of Dog Genome Tasha the boxer 2005 map of her genome at the

Broad Institute.

Map of 2,400 million bases

ATTTACGGATTACACGGAGG

representing 18,846 genes

http://www.biologycorner.com/bio1/DNA.htmlhttp://www.broad.mit.edu/media/2004/doggenome_0714.html

Quick Review of Genetic Terms and Principles

Review of Genetics Terms and Principles

Review - Big Ideas in Genetics

One gene – One phenotypic trait

Recessive genes can hide under Dominant

Dominant phenotype

One phenotype – different genotypes!

orBB Bb

Review - Big Ideas in Genetics

* http://en.wikipedia.org/wiki/Qtl

QTL – Quantitative Trait Loci1908 Nilson-Ehle

Many genes +

environmentOne quantitative trait =

Review - Big Ideas in GeneticsSingle Nucleotide Polymorphism

* http://en.wikipedia.org/wiki/Qtl

Animation http://www.dnai.org/text/mediashowcase/index2.html?id=1083

only P1 and P4 have the DNA from grandparents G1 and G4 and thus, it is possible that the disease gene might be somewhere near ?. ~85% probability of finding a simple recessive trait.

Review - Gene Markers for Beginners

Now imagine that grandparents G1 and G4 and puppies P1 and P4 have the disease and we're looking at a recessive mode of inheritance. We would then look at the DNA markers we have and see that at position ?

Let’s go to the Movies

Look for the following Perfect Population Bottleneck Regulatory Gene

Describe the 3 sets of data necessary for this experimental design?

http://watch.discoverychannel.ca/daily-planet/february-2009/daily-planet-february-26-2009/#clip144136

Original Population Survivors are selected for

breeding

New Population

Founders Effect

PopulationBottleNeck

Bottlenecked Gene Pool

Wolf Dog

AKC Breeds

Wade “The Dog Genome:Sequence, Evolution, and Haplotype Structure” Broad Institute MIT

The Georgie Project

Karl G Lark University of Utah Biology Depart

Georgie 1986-1996

Why is PWD population perfect for a genetics study?

Inbreeding results in less recombination Less recombination results in fewer SNPs Fewer SNPS make it easier to identify

genetic locations Documented phenotype of size, disease,

hair, color in pedigree charts from breeders

Easier to uncover loci for base sequences responsible for phenotype

Documented PWD breeding lines

Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm

Who’s your Daddy’s Daddy’s Daddy?

With high level of inbreeding all dog would look the same?

Polymorphic

Genetic Resource

“Analyzing the genotypes of dogs in the PWD population is the most important aspect of the Georgie Project. By this we mean defining a set of 500 to 1000 DNA markers for each of the dogs in the population we are analyzing. These genotypes, when combined with diff erent phenotypes allow us to analyze the genetics of each phenotype. Thus the genotyping of the population provides an UMBRELLA under which a number of specific genetic projects can be carried out.”

Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm

Zero Correlation

00.10.20.30.40.50.60.70.80.9

1

0 20 40 60 80 100

Pedigree

Markers

Is there a correlation between genetic markers in PWD and breeding lineage?

Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm

Results - QTL linking the skull, legs ,hip

Courtesy Sanger Inst

http://www.georgieproject.com/x-ray/x-ray.htm

Results - QTL Size IGF1

Chrom 15

http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid=9615&build=current&advsrch=off&query=igf1

Elegance of the Georgie experiment

Free living population of animalsversus a colony of laboratory dogsthat are inbred.

Georgie and my dog

Are there similar DNA sequences in my dog that willmake him susceptible to autoimmune disease?

Georgie McGyver

If you can find a population

If you can build a database of BioMarkers

Sample Preparation

Biomarker ResearchBiomarker Research

DataInterpretation

& Storage

Sample Analysis

Robotics

Centrifuges Concentrators

Liquid Chromatography/Mass Spectrometry

Protein Identification

Protein Digest Sample Handling

Data Analysis

Peptide Separation

Data Storage

LabInformation

ManagementSystem

Microplate Readers

SoftwareXcaliburXcalibur

ProteinFractionation Freezers

Cells or Tissue

BiomarkerIdentified

Thermo Scientific Laboratory Workflow

You can crack the code of life’s form and function

Genetic regulation of osteoarthritis: A QTL regulating cranial and caudal acetabular osteophyte formation in the hip joint of the dog (Canis familiaris). Amer. J. Med. Genet. 135A(3):334-335. http://www3.interscience.wiley.com/cgi-bin/jtoc/33129/ Carrier DR, Chase K, Lark KG.

Genetics of canid skeletal variation: size and shape of the pelvis. Genome Res. 2005 Dec;15(12):1825-30. PMID: 16339381 [PubMed - indexed for

MEDLINE] Chase K, Carrier DR, Adler FR, Ostrander EA, Lark KG. Interaction between the X chromosome and an autosome

regulates size sexual dimorphism in Portuguese Water Dogs. Genome Res. 2005 Dec;15(12):1820-4. PMID: 16339380 [PubMed - indexed for MEDLINE] Lark, K.G., Chase, K., Carrier, D.R. and F.R. Adler (2005)

Wealth of research Genetic analysis of the canid skeleton: Analysis of

morphological loci (QTLs) in the Portuguese Water Dog population. In: "The Genome of the Domestic Dog" (Cold Spring Harbor Monograph Series 44). pp. 67-80. Editors: E.A. Ostrander, U.

Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Trut, L.N., Kharlamova, A.V., Carrier, D.R., Chase, K., Kukekova, A.V., Acland, G.M. and K.G. Lark (2005)

Morphology and behavior: Are they coupled at the genome level? In: "The Genome of the Domestic Dog² (Cold Spring Harbor Monograph Series 44). pp. 81-93. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Lark KG, Chase K, Sutter

NB. Genetic architecture of the dog: sexual size dimorphism

and functional morphology. Trends Genet. 2006 Oct;22(10):537-44.

Epub 2006 Aug 24 PMID: 16934357 [PubMed - in process

Wealth of research Chase K, Lawler DF, Adler FR, Ostrander EA, Lark KG.Bilaterally

asymmetric effects of quantitative trait loci (QTLs): QTLs that affect laxity in the right versus left coxofemoral (hip) joints of the dog (Canis familiaris).Am J Med Genet A. 2004 Jan 30;124(3):239-47. PMID: 14708095 [PubMed - indexed for MEDLINE]Chase K, Carrier DR, Adler FR, Jarvik T, Ostrander EA, Lorentzen TD, Lark KG.

Inherited infantile dilated cardiomyopathy in dogs: genetic, clinical, biochemical, and morphologic findings.Am J Med Genet. 2000 Nov 6;95(1):57-66. PMID: 11074496 [PubMed - indexed for MEDLINE]Chase K, Adler FR, Miller-Stebbings K, Lark KG.

Teaching a new dog old tricks: identifying quantitative trait loci using lessons from plants.J Hered. 1999 Jan-Feb;90(1):43-51. PMID: 9987902 [PubMed - indexed for MEDLINE]