stearoyl-coa desaturase (scd) gene polymorphism in goat breeds
Post on 14-Jul-2016
230 Views
Preview:
TRANSCRIPT
Stearoyl-CoA Desaturase (SCD) Gene Polymorphismin Goat Breeds
Chun-Lei Zhang • Xue-Yuan Gao • Ru-Ying Shao •
Yan-Hong Wang • Xing-Tang Fang • Hong Chen
Received: 7 December 2009 / Accepted: 23 April 2010 / Published online: 14 July 2010
� Springer Science+Business Media, LLC 2010
Abstract There is evidence that stearoyl-CoA desaturase (SCD) is a key enzyme
for lipid metabolism. Changes in enzyme activity that depends on SCD gene
polymorphism and regulation could cause variations of fatty acid composition of
meat and milk. We investigated genetic variability in caprine SCD, analyzing 335
animals belonging to three goat breeds by single-strand conformation polymor-
phism and DNA sequencing. Six single nucleotide polymorphism were identified,
in intron 3 (585T?A and 601A?G; Ref. AF422168), intron 4 (719T?A;
AF422169), and exon 6 (690 A?G, 718 C?G, and 802 A?C; AF422171). The
less polymorphic SNP 601A?G displayed variability only in Xuhuai and Boer
breeds. Across breeds, the average frequency for the least frequent alleles ranged
from 0.1158 to 0.2532. The three SNPs in exon 6 resulted in variations of amino
acids 313 tyr ? cys, 322 phe ? leu, and 350 arg ? ser. The allelic distribution in
exon 6 of Xuhuai was significantly different from Boer and Haimen.
Keywords Stearoyl CoA desaturase gene � Lipid metabolism, SNPs �Meat quality � SSCP
Introduction
Fatty acid profile is important to meat quality, because it has an impact on the visual
manifestation of marbling during processing, the softness of the fat, and the flavor of
the meat (Taniguchi et al. 2004b). Stearoyl-CoA desaturase (SCD) is an integral
membrane protein of the endoplasmic reticulum that catalyzes the rate-limiting step
in the biosynthesis of monounsaturated fatty acids from saturated fatty acids
C.-L. Zhang � X.-Y. Gao � R.-Y. Shao � Y.-H. Wang � X.-T. Fang � H. Chen (&)
Institute of Cellular and Molecular Biology, Xuzhou Normal University, Xuzhou,
Jiangsu 221116, China
e-mail: chenhong1212@263.net
123
Biochem Genet (2010) 48:822–828
DOI 10.1007/s10528-010-9363-y
(Heineman and Ozols 2003; Miyazaki and Ntambi 2003). SCD has some isoforms,
and SCD1 is a key control point in the neurohormonal effector system of the adipose-
specific control of thermogenesis through lipid partitioning between lipogenesis and
oxidation (Mainieri et al. 2006). SCD1-deficient mice (SCD1-/-) were found to
reduce body adiposity despite increased feed intake, increased insulin sensitivity, and
resistance to diet-induced weight gain (Ntambi et al. 2002). SCD1 is required for the
fully developed obese phenotype of leptin-deficient ob/ob mice, which suggests that
a significant proportion of leptin’s metabolic effect results from SCD1 enzyme
inhibition (Cohen et al. 2002). It is well known that peroxisome proliferator-
activated receptor-a (PPARa) is a key transcription factor that induces the tran-
scription of fatty acid b-oxidation and thermogenic genes. SCD1 deficiency can
attenuate over accumulation of lipids in liver of PPARa-deficient mice (Miyazaki
et al. 2004).
SCD is an important component in the regulation of skeletal muscle metabolism.
Eight nucleotide substitutions in the bovine SCD gene have been detected, and
significant associations have been reported between the polymorphisms in exon 5 of
the SCD locus and fatty acid composition and melting point in intramuscular fat of
Japanese Black steers (Taniguchi et al. 2004b). The high stearoyl-CoA desaturase
activities/alleles (g.7534G/G, g.7864C/C) were positively correlated with beef
marbling score, amount of monounsaturated fatty acids, and conjugated linoleic acid
content, but negatively with the amount of saturated fatty acids (Jiang et al. 2008).
Moreover, the differences in SCD gene expression contribute to the fatty acid
compositional differences between subcutaneous adipose tissue of Japanese Black
cattle and Holstein (Taniguchi et al. 2004a). This evidence suggests that SCD is a
key enzyme for lipid metabolism and partition and thus a prime candidate gene for
meat quality.
The caprine SCD gene was shown to span a 12–15 kb region, consisting of six
exons, varying in size from 131 (third exon) to 4047 bp (sixth exon), and five introns,
varying in size from 600 to 3700 bp (Bernard et al. 2001; Yahyaoui et al. 2002). Two
polymorphisms had been detected in exon 5 and the 3’ noncoding region, and a
synonymous SNP in exon 5 of the caprine SCD gene was used to map the gene on
goat chromosome 26 (Yahyaoui 2003; Yahyaoui et al. 2003). To examine
polymorphism of the caprine SCD gene in Chinese goat breeds and to assess the
possible use of this gene as a marker related to goat meat quality (marbling and fatty
acid composition), the genetic variability of this gene was investigated.
Materials and Methods
Blood samples were collected in China from 335 goats belonging to three genetic
types: Boer goat (83 samples), Xuhuai white goat (151), and Haimen goat (101).
The selected experimental animals were unrelated within their breed. DNA was
extracted from blood following a standard phenol–chloroform extraction protocol
(Sambrook et al. 1989).
Nine amplicons, including the coding regions and partial sequences of introns,
were investigated for single nucleotide polymorphisms (SNP). Primers were
Biochem Genet (2010) 48:822–828 823
123
designed based on the reference sequences for the caprine SCD gene (Table 1). All
335 samples were scanned by the nine amplified regions for mutations.
A 25 ll volume contained 50 ng genomic DNA, 0.5 lM of each primer,
1 9 buffer (including 1.5 mM MgCl2), 200 lM dNTPs (dATP, dTTP, dCTP, and
dGTP), and 0.5 U Taq DNA polymerase (Dingguo, Beijing). The cycling protocol
was 4 min at 95�C, 35 cycles of denaturing at 94�C for 30 s, annealing temperature
(Table 1) for 30 s, extension at 72�C for 40 s, with a final extension at 72�C for
10 min. The expected sizes of the amplicons (Table 1) were confirmed by agarose
gel electrophoresis.
The SSCP method was used to scan mutations within the amplified regions.
Aliquots of 5 ll PCR products were mixed with 5 ll denaturing solution (95%
formamide, 25 mM EDTA, 0.025% xylene cyanole, and 0.025% bromophenol
blue), heated for 10 min at 98�C, and chilled in ice immediately. Denatured DNA
was subjected to 10% PAGE in 1 9 TBE buffer and constant voltage (150 V) for
15 h at a constant temperature of 4�C, and then gels were stained with 0.1% silver
nitrate. After the polymorphisms were detected, the PCR products of different
electrophoresis patterns were sequenced in both directions in an ABI 377 DNA
analyzer (Applied Biosystems). Sequences were aligned using the Web-based
Clustal W program (http://www.ebi.ac.uk/clustalw/index.html).
Allele frequencies were obtained through direct count, and contrasts were carried
out to test Hardy–Weinberg equilibrium using the Fisher exact test as proposed by
Wigginton et al. (2005).
Table 1 Primers used for amplification of the caprine stearoyl-CoA desaturase (SCD) gene
Primer Sequence SCD region Reference
Sequence
Annealing
temp. (�C)
Fragment
size (bp)
P1 F: AAAAGCAGGCTCAGGAACT
R: GCCCGCATACCTACATACA
Partial exon 1 AF422166 61 377
P2 F: CCAGGTCTATGCCTATCC
R: GAGGGTCTGGTGTTTGTAC
Complete exon 2 AF422167 55 491
P3 F: TCACCGAACCTACAAAGC Partial exon 3 AF422168 64 352
R: AAGACCACAACAGCCAGA
P4 F: GTGCCCTGTCTTATCCTG
R: CATCTCCTTCTTGCCTCT
Partial exon 3 AF422168 62 362
P5 F: GCTACGCTAGATTTATCCG
R: GCTTATCCTTCCACTCCC
Complete exon 4 AF422169 63 365
P6 F: GGTGCCGTGGTATCTATG
R: TTCTGGCTCGTAACCTAAT
Complete exon 5 AF422170 62 256
P7 F: AGAGCCTTTAGGGTCTTA
R:GTGGTGGTAGTTGTGGAA
Partial intron 5 AF422171 53 385
P8 F:TGAGGGCTTCCACAACTA
R:GCATCATAAAGGCAGAGT
Partial exon 6 AF422171 58 377
P9 F:TCTTCTGTTCCCATTATCT
R:TTCAACTCACCCTATTTATC
Partial exon 6 AF422171 55 272
824 Biochem Genet (2010) 48:822–828
123
Results
SSCP polymorphisms were detected in four of nine fragments of SCD. The PCR
products of P2, P4, P5, and P8 all showed three banding patterns on the
polyacrylamide gel. The number of bands and their positions in the gel clearly
showed the occurrence of DNA sequence variations (Fig. 1).
The PCR products of the electrophoresis patterns were sequenced. Based on the
reference sequences, six novel SNPs were found: 585T?A and 601A?G (Ref.
AF422168) located in intron 3, 719T?A (Ref. AF422169) located in intron 4, and
690 A?G, 718 C?G, and 802 A?C (Ref. AF422171) located in exon 6. The three
SNPs in exon 6 resulted in the variations 313 tyr ? cys, 322 phe ? leu, and 350
arg ? ser.
For the six identified SNPs, across the three breeds, the average frequency for the
least frequent alleles ranged from 0.1158 to 0.2532 (Table 2). The SNP 601A?G
was detected only in the Xuhuai and Boer breeds. The allelic distribution of the
SNPs in exon 6 of Xuhuai was significantly different from Boer (v2 = 5.612,
P = 0.018) and Haimen (v2 = 11.785, P = 0.001).
Considering within-population variability, the Xuhuai breed showed the highest
average frequency for the least frequent alleles across SNPs (0.1688), followed by
Haimen (0.1439) and Boer (0.1350). Based on the Fisher exact test, only the allele
frequencies at the 601A?G and 719T?A loci were in Hardy–Weinberg
equilibrium for all populations (Table 3).
Fig. 1 The SSCP banding patterns of four polymorphic fragments (P2, P4, P5, and P8) of caprine SCD
Biochem Genet (2010) 48:822–828 825
123
Discussion
Three of the six caprine SCD gene SNPs detected in the present study were located
in the coding region, resulting in amino acid variations. A recent study of the ovine
SCD, however, found no SNPs in the coding region (Garcıa-Fernandez et al. 2009).
In cattle, in addition to some polymorphisms identified in the noncoding region of
the bovine SCD gene, four SNPs have been found in exons, one of which causes an
amino acid substitution (Val/Ala) in residue 293 of the protein (Taniguchi et al.
2004b; Kgwatalala et al. 2007). The polymorphism that causes the Ala/Val
substitution in the SCD protein has shown significant associations with variations in
beef (Taniguchi et al. 2004b; Jiang et al. 2008), milk fatty acid composition (Mele
et al. 2007), and milk and protein yields (Macciotta et al. 2008). There are
indications that the variations in fatty acid composition between breeds may be
somewhat due to the difference in the mRNA abundance of the SCD gene
(Taniguchi et al. 2004a), and the stearoyl-CoA desaturase-1 expression in skeletal
muscle contributes to fatty acid partitioning (Hulver et al. 2005). Amino acid
variations in the caprine SCD gene may also be functional, which may affect the
expression or the enzyme activity of SCD. Association studies are needed to
evaluate the role of these polymorphisms in fatty acid composition in goat-derived
food products.
Table 2 Frequency of the least frequent alleles of the SCD gene across three goat breeds
Breed (N) Gene region and position of SNP
Intron 3 Intron 4 Exon 6
585T?A 601A?G 719T?A 690A?G 718C?G 802A?C
Xuhuai (151) 0.2598 0.1923 0.1815 0.1325 0.1325 0.1325
Boer (83) 0.2000 0.1176 0.0706 0.2169 0.2169 0.2169
Haimen (101) 0.2871 0.0000 0.1792 0.2525 0.2525 0.2525
Average frequency 0.2532 0.1158 0.1533 0.1896 0.1896 0.1896
N Number of samples evaluated
Table 3 Hardy–Weinberg equilibriuma of allele frequencies for SNPs detected in the caprine SCD gene
of three goat breeds
Breed (N) Gene Region and Position of SNP
Intron 3 Intron 4 Exon 6
585T?A 601A?G 719T?A 690 A?G 718 C?G 802 A?C
Xuhuai (151) 28.3956 2.9419 0.363735 27.9701 27.9701 27.9701
Boer (83) 20.7903 1.4282 0.4470 16.1499 16.1499 16.1499
Haimen (101) 3.3849 – 3.1455 8.9531 8.9531 8.9531
N Number of samples evaluateda v2 values: va
2 = 0.05(1) = 3.841
826 Biochem Genet (2010) 48:822–828
123
Some SNPs of SCD were breed-specific in ruminant breeds. The SNP g.31C?A
in the sheep SCD gene appeared at intermediate frequencies in dairy breeds, such as
Lacaune, Assaff, and Churra, but was less frequent in two Egyptian breeds and
absent in the meat-specialized French breed Brinton du Cher (Garcıa-Fernandez
et al. 2009). One haplotype characterizing specifically indigenous beef breeds was
detected, and a significant partition of the haplotype variability between dairy and
beef breeds has been found (Milanesi et al. 2008). Moreover, one SNP (435G?A)
is unique to Holsteins and not found in Jersey cows (Kgwatalala et al. 2007). In the
present study, the allelic distribution of the SNPs in the coding region of the Xuhuai
breed was significantly different from the Boer and Haimen breeds. The Xuhuai
goat is a Chinese indigenous breed, and the Boer goat is considered one of the most
desirable goat breeds for meat production. Whether the SNP variation between
breeds is due to the selection of economic traits needs to be investigated further.
Acknowledgments This study was supported by the Natural Science Foundation of Jiangsu Province
(BK2008120), the National ‘‘863’’ Program of the P.R. China (No. 2008AA10Z138), the ‘‘13115’’ Sci-
Tech innovation program of Shaanxi province (2008ZDKG-11), Research Fund for the Doctor Program
of Higher Education of China (No. 20080712001), Talents Foundation of Northwest A&F University
(No. 01140411), The Young Topnotch Researcher Support Project of Northwest A&F University (No.
QNGG-2009-007), the Natural Science Fund for Colleges and Universities in Jiangsu Province
(09KJD180002), and the Natural Science Foundation of Xuzhou Normal University (KY2007019).
References
Bernard L, Leroux C, Hayes H, Gautier M, Chilliard Y, Martin P (2001) Characterization of the caprine
Stearoyl-CoA desaturase gene and its mRNA showing an unusually long 3’-UTR sequence arising
from a single exon. Gene 281(1–2):53–61
Cohen P, Miyazaki M, Socci ND, Hagge-Greenberg A, Liedtke W, Soukas AA, Sharma R, Hudgins LC,
Ntambi JM, Friedman JM (2002) Role for stearoyl-CoA desaturase-1 in leptin-mediated weight loss.
Science 297(5579):240–243
Garcıa-Fernandez M, Gutierrez-Gil B, Garcıa-Gamez E, Arranz JJ (2009) Genetic variability of the
Stearoyl-CoA desaturase gene in sheep. Mol Cell Probe 23(2):107–111
Heineman FS, Ozols J (2003) Stearoyl-CoA desaturase, a short lived protein of endoplasmic reticulum
with multiple control mechanisms. Prostag Leukotr Ess 68(2):122–133
Hulver MW, Berggren JR, Carper MJ (2005) Elevated stearoyl-CoA desaturase-1 expression in skeletal
muscle contributes to abnormal fatty acid partitioning in obese humans. Cell Metab 2(4):251–261
Jiang Z, Michal JJ, Tobey DJ, Daniels TF, Rule DC, Macneil MD (2008) Significant associations of
stearoyl-CoA desaturase (SCD1) gene with fat deposition and composition in skeletal muscle. Int J
Biol Sci 4(6):345–351
Kgwatalala PM, Ibeagha-Awemu EM, Hayes JF, Zhao X (2007) Single nucleotide polymorphisms in the
open reading frame of the stearoyl-CoA desaturase gene and resulting genetic variants in Canadian
Holstein and Jersey cows. DNA Seq 18(5):357–362
Macciotta NP, Mele M, Conte G, Serra A, Cassandro M, Dal Zotto R (2008) Association between a
polymorphism at the stearoyl CoA desaturase locus and milk production traits in Italian Holsteins.
J Dairy Sci 91(8):3184–3189
Mainieri D, Summermatter S, Seydoux J, Montani JP, Rusconi S, Russell AP, Boss O, Buchala AJ,
Dulloo AG (2006) A role for skeletal muscle stearoyl-CoA desaturase 1 in control of thermogenesis.
FASEB J 20(10):E1157–E1170
Mele M, Conte G, Castiglioni B, Chessa S, Macciotta NP, Serra A (2007) Stearoyl-coenzyme A
desaturase gene polymorphism and milk fatty acid composition in Italian Holsteins. J Dairy Sci
90(9):4458–4465
Milanesi E, Nicoloso L, Crepaldi P (2008) Stearoyl CoA desaturase (SCD) gene polymorphisms in Italian
cattle breeds. J Anim Breed Genet 125(1):63–67
Biochem Genet (2010) 48:822–828 827
123
Miyazaki M, Ntambi JM (2003) Role of stearoyl-coenzyme A desaturase in lipid metabolism. Prostag
Leukotr Ess 68(2):113–121
Miyazaki M, Dobrzyn A, Sampath H (2004) Reduced adiposity and liver steatosis by stearoyl-CoA
desaturase deficiency are independent of peroxisome proliferator activated receptor-alpha. J Biol
Chem 279(33):35017–35024
Ntambi JM, Miyazaki M, Stoehr JP, Lan H, Kendziorski CM, Yandell BS, Song Y, Cohen P, Friedman
JM, Attie AD (2002) Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity.
Pro Natl Acad Sci USA 99(17):11482–11486
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. In: A laboratory manual, 2nd edn, vol 1–3.
Cold Spring Harbor Laboratory Press, New York
Taniguchi M, Mannen H, Oyama K, Shimakura Y, Oka A, Watanabe H, Kojima T, Komatsu M, Harper
GS, Tsuji S (2004a) Differences in stearoyl-CoA desaturase mRNA levels between Japanese and
Holstein cattle. Livest Prod Sci 87(2–3):215–220
Taniguchi M, Utsugi T, Oyama K, Mannen H, Kobayashi M, Tanabe Y, Ogino A, Tsuji S (2004b)
Genotype of stearoyl-CoA desaturase is associated with fatty acids composition in Japanese Black
cattle. Mamm Genome 15(2):142–148
Wigginton JE, Cutler DJ, Abecasis GR (2005) A note on exact tests of Hardy-Weinberg equilibrium. Am
J Hum Genet 76(5):887–893
Yahyaoui MH (2003) Genetic polymorphism in goat. Ph.D. Thesis. Universidad Autonoma de Barcelona,
Facultad de Veterinaria, Spain
Yahyaoui MH, Sanchez A, Folch JM (2002) Rapid communication: partial nucleotide sequence of the
goat stearoyl coenzyme A desaturase cDNA and gene structure. J Anim Sci 80(3):866–867
Yahyaoui MH, Vaiman D, Sanchez A, Folch JM (2003) Mapping of the goat stearoyl coenzyme A
desaturase gene to chromosome 26. Anim Genet 34(6):474–475
828 Biochem Genet (2010) 48:822–828
123
top related