stearoyl-coa desaturase (scd) gene polymorphism in goat breeds

Stearoyl-CoA Desaturase (SCD) Gene Polymorphismin Goat Breeds

Chun-Lei Zhang • Xue-Yuan Gao • Ru-Ying Shao •

Yan-Hong Wang • Xing-Tang Fang • Hong Chen

Received: 7 December 2009 / Accepted: 23 April 2010 / Published online: 14 July 2010

� Springer Science+Business Media, LLC 2010

Abstract There is evidence that stearoyl-CoA desaturase (SCD) is a key enzyme

for lipid metabolism. Changes in enzyme activity that depends on SCD gene

polymorphism and regulation could cause variations of fatty acid composition of

meat and milk. We investigated genetic variability in caprine SCD, analyzing 335

animals belonging to three goat breeds by single-strand conformation polymor-

phism and DNA sequencing. Six single nucleotide polymorphism were identified,

in intron 3 (585T?A and 601A?G; Ref. AF422168), intron 4 (719T?A;

AF422169), and exon 6 (690 A?G, 718 C?G, and 802 A?C; AF422171). The

less polymorphic SNP 601A?G displayed variability only in Xuhuai and Boer

breeds. Across breeds, the average frequency for the least frequent alleles ranged

from 0.1158 to 0.2532. The three SNPs in exon 6 resulted in variations of amino

acids 313 tyr ? cys, 322 phe ? leu, and 350 arg ? ser. The allelic distribution in

exon 6 of Xuhuai was significantly different from Boer and Haimen.

Keywords Stearoyl CoA desaturase gene � Lipid metabolism, SNPs �Meat quality � SSCP

Introduction

Fatty acid profile is important to meat quality, because it has an impact on the visual

manifestation of marbling during processing, the softness of the fat, and the flavor of

the meat (Taniguchi et al. 2004b). Stearoyl-CoA desaturase (SCD) is an integral

membrane protein of the endoplasmic reticulum that catalyzes the rate-limiting step

in the biosynthesis of monounsaturated fatty acids from saturated fatty acids

C.-L. Zhang � X.-Y. Gao � R.-Y. Shao � Y.-H. Wang � X.-T. Fang � H. Chen (&)

Institute of Cellular and Molecular Biology, Xuzhou Normal University, Xuzhou,

Jiangsu 221116, China

e-mail: [email protected]

123

Biochem Genet (2010) 48:822–828

DOI 10.1007/s10528-010-9363-y

(Heineman and Ozols 2003; Miyazaki and Ntambi 2003). SCD has some isoforms,

and SCD1 is a key control point in the neurohormonal effector system of the adipose-

specific control of thermogenesis through lipid partitioning between lipogenesis and

oxidation (Mainieri et al. 2006). SCD1-deficient mice (SCD1-/-) were found to

reduce body adiposity despite increased feed intake, increased insulin sensitivity, and

resistance to diet-induced weight gain (Ntambi et al. 2002). SCD1 is required for the

fully developed obese phenotype of leptin-deficient ob/ob mice, which suggests that

a significant proportion of leptin’s metabolic effect results from SCD1 enzyme

inhibition (Cohen et al. 2002). It is well known that peroxisome proliferator-

activated receptor-a (PPARa) is a key transcription factor that induces the tran-

scription of fatty acid b-oxidation and thermogenic genes. SCD1 deficiency can

attenuate over accumulation of lipids in liver of PPARa-deficient mice (Miyazaki

et al. 2004).

SCD is an important component in the regulation of skeletal muscle metabolism.

Eight nucleotide substitutions in the bovine SCD gene have been detected, and

significant associations have been reported between the polymorphisms in exon 5 of

the SCD locus and fatty acid composition and melting point in intramuscular fat of

Japanese Black steers (Taniguchi et al. 2004b). The high stearoyl-CoA desaturase

activities/alleles (g.7534G/G, g.7864C/C) were positively correlated with beef

marbling score, amount of monounsaturated fatty acids, and conjugated linoleic acid

content, but negatively with the amount of saturated fatty acids (Jiang et al. 2008).

Moreover, the differences in SCD gene expression contribute to the fatty acid

compositional differences between subcutaneous adipose tissue of Japanese Black

cattle and Holstein (Taniguchi et al. 2004a). This evidence suggests that SCD is a

key enzyme for lipid metabolism and partition and thus a prime candidate gene for

meat quality.

The caprine SCD gene was shown to span a 12–15 kb region, consisting of six

exons, varying in size from 131 (third exon) to 4047 bp (sixth exon), and five introns,

varying in size from 600 to 3700 bp (Bernard et al. 2001; Yahyaoui et al. 2002). Two

polymorphisms had been detected in exon 5 and the 3’ noncoding region, and a

synonymous SNP in exon 5 of the caprine SCD gene was used to map the gene on

goat chromosome 26 (Yahyaoui 2003; Yahyaoui et al. 2003). To examine

polymorphism of the caprine SCD gene in Chinese goat breeds and to assess the

possible use of this gene as a marker related to goat meat quality (marbling and fatty

acid composition), the genetic variability of this gene was investigated.

Materials and Methods

Blood samples were collected in China from 335 goats belonging to three genetic

types: Boer goat (83 samples), Xuhuai white goat (151), and Haimen goat (101).

The selected experimental animals were unrelated within their breed. DNA was

extracted from blood following a standard phenol–chloroform extraction protocol

(Sambrook et al. 1989).

Nine amplicons, including the coding regions and partial sequences of introns,

were investigated for single nucleotide polymorphisms (SNP). Primers were

Biochem Genet (2010) 48:822–828 823

123

designed based on the reference sequences for the caprine SCD gene (Table 1). All

335 samples were scanned by the nine amplified regions for mutations.

A 25 ll volume contained 50 ng genomic DNA, 0.5 lM of each primer,

1 9 buffer (including 1.5 mM MgCl2), 200 lM dNTPs (dATP, dTTP, dCTP, and

dGTP), and 0.5 U Taq DNA polymerase (Dingguo, Beijing). The cycling protocol

was 4 min at 95�C, 35 cycles of denaturing at 94�C for 30 s, annealing temperature

(Table 1) for 30 s, extension at 72�C for 40 s, with a final extension at 72�C for

10 min. The expected sizes of the amplicons (Table 1) were confirmed by agarose

gel electrophoresis.

The SSCP method was used to scan mutations within the amplified regions.

Aliquots of 5 ll PCR products were mixed with 5 ll denaturing solution (95%

formamide, 25 mM EDTA, 0.025% xylene cyanole, and 0.025% bromophenol

blue), heated for 10 min at 98�C, and chilled in ice immediately. Denatured DNA

was subjected to 10% PAGE in 1 9 TBE buffer and constant voltage (150 V) for

15 h at a constant temperature of 4�C, and then gels were stained with 0.1% silver

nitrate. After the polymorphisms were detected, the PCR products of different

electrophoresis patterns were sequenced in both directions in an ABI 377 DNA

analyzer (Applied Biosystems). Sequences were aligned using the Web-based

Clustal W program (http://www.ebi.ac.uk/clustalw/index.html).

Allele frequencies were obtained through direct count, and contrasts were carried

out to test Hardy–Weinberg equilibrium using the Fisher exact test as proposed by

Wigginton et al. (2005).

Table 1 Primers used for amplification of the caprine stearoyl-CoA desaturase (SCD) gene

Primer Sequence SCD region Reference

Sequence

Annealing

temp. (�C)

Fragment

size (bp)

P1 F: AAAAGCAGGCTCAGGAACT

R: GCCCGCATACCTACATACA

Partial exon 1 AF422166 61 377

P2 F: CCAGGTCTATGCCTATCC

R: GAGGGTCTGGTGTTTGTAC

Complete exon 2 AF422167 55 491

P3 F: TCACCGAACCTACAAAGC Partial exon 3 AF422168 64 352

R: AAGACCACAACAGCCAGA

P4 F: GTGCCCTGTCTTATCCTG

R: CATCTCCTTCTTGCCTCT


P5 F: GCTACGCTAGATTTATCCG

R: GCTTATCCTTCCACTCCC


P6 F: GGTGCCGTGGTATCTATG

R: TTCTGGCTCGTAACCTAAT


P7 F: AGAGCCTTTAGGGTCTTA

R:GTGGTGGTAGTTGTGGAA

Partial intron 5 AF422171 53 385

P8 F:TGAGGGCTTCCACAACTA

R:GCATCATAAAGGCAGAGT


P9 F:TCTTCTGTTCCCATTATCT

R:TTCAACTCACCCTATTTATC


824 Biochem Genet (2010) 48:822–828

123

http://www.ebi.ac.uk/clustalw/index.html

Results

SSCP polymorphisms were detected in four of nine fragments of SCD. The PCR

products of P2, P4, P5, and P8 all showed three banding patterns on the

polyacrylamide gel. The number of bands and their positions in the gel clearly

showed the occurrence of DNA sequence variations (Fig. 1).

The PCR products of the electrophoresis patterns were sequenced. Based on the

reference sequences, six novel SNPs were found: 585T?A and 601A?G (Ref.

AF422168) located in intron 3, 719T?A (Ref. AF422169) located in intron 4, and

690 A?G, 718 C?G, and 802 A?C (Ref. AF422171) located in exon 6. The three

SNPs in exon 6 resulted in the variations 313 tyr ? cys, 322 phe ? leu, and 350

arg ? ser.

For the six identified SNPs, across the three breeds, the average frequency for the

least frequent alleles ranged from 0.1158 to 0.2532 (Table 2). The SNP 601A?G

was detected only in the Xuhuai and Boer breeds. The allelic distribution of the

SNPs in exon 6 of Xuhuai was significantly different from Boer (v2 = 5.612,

P = 0.018) and Haimen (v2 = 11.785, P = 0.001).

Considering within-population variability, the Xuhuai breed showed the highest

average frequency for the least frequent alleles across SNPs (0.1688), followed by

Haimen (0.1439) and Boer (0.1350). Based on the Fisher exact test, only the allele

frequencies at the 601A?G and 719T?A loci were in Hardy–Weinberg

equilibrium for all populations (Table 3).

Fig. 1 The SSCP banding patterns of four polymorphic fragments (P2, P4, P5, and P8) of caprine SCD

Biochem Genet (2010) 48:822–828 825

123

Discussion

Three of the six caprine SCD gene SNPs detected in the present study were located

in the coding region, resulting in amino acid variations. A recent study of the ovine

SCD, however, found no SNPs in the coding region (Garcıa-Fernandez et al. 2009).

In cattle, in addition to some polymorphisms identified in the noncoding region of

the bovine SCD gene, four SNPs have been found in exons, one of which causes an

amino acid substitution (Val/Ala) in residue 293 of the protein (Taniguchi et al.

2004b; Kgwatalala et al. 2007). The polymorphism that causes the Ala/Val

substitution in the SCD protein has shown significant associations with variations in

beef (Taniguchi et al. 2004b; Jiang et al. 2008), milk fatty acid composition (Mele

et al. 2007), and milk and protein yields (Macciotta et al. 2008). There are

indications that the variations in fatty acid composition between breeds may be

somewhat due to the difference in the mRNA abundance of the SCD gene

(Taniguchi et al. 2004a), and the stearoyl-CoA desaturase-1 expression in skeletal

muscle contributes to fatty acid partitioning (Hulver et al. 2005). Amino acid

variations in the caprine SCD gene may also be functional, which may affect the

expression or the enzyme activity of SCD. Association studies are needed to

evaluate the role of these polymorphisms in fatty acid composition in goat-derived

food products.

Table 2 Frequency of the least frequent alleles of the SCD gene across three goat breeds

Breed (N) Gene region and position of SNP

Intron 3 Intron 4 Exon 6

585T?A 601A?G 719T?A 690A?G 718C?G 802A?C

Xuhuai (151) 0.2598 0.1923 0.1815 0.1325 0.1325 0.1325

Boer (83) 0.2000 0.1176 0.0706 0.2169 0.2169 0.2169

Haimen (101) 0.2871 0.0000 0.1792 0.2525 0.2525 0.2525

Average frequency 0.2532 0.1158 0.1533 0.1896 0.1896 0.1896

N Number of samples evaluated

Table 3 Hardy–Weinberg equilibriuma of allele frequencies for SNPs detected in the caprine SCD gene

of three goat breeds

Breed (N) Gene Region and Position of SNP

Intron 3 Intron 4 Exon 6

585T?A 601A?G 719T?A 690 A?G 718 C?G 802 A?C

Xuhuai (151) 28.3956 2.9419 0.363735 27.9701 27.9701 27.9701

Boer (83) 20.7903 1.4282 0.4470 16.1499 16.1499 16.1499

Haimen (101) 3.3849 – 3.1455 8.9531 8.9531 8.9531

N Number of samples evaluateda v2 values: va

2 = 0.05(1) = 3.841

826 Biochem Genet (2010) 48:822–828

123

Some SNPs of SCD were breed-specific in ruminant breeds. The SNP g.31C?A

in the sheep SCD gene appeared at intermediate frequencies in dairy breeds, such as

Lacaune, Assaff, and Churra, but was less frequent in two Egyptian breeds and

absent in the meat-specialized French breed Brinton du Cher (Garcıa-Fernandez

et al. 2009). One haplotype characterizing specifically indigenous beef breeds was

detected, and a significant partition of the haplotype variability between dairy and

beef breeds has been found (Milanesi et al. 2008). Moreover, one SNP (435G?A)

is unique to Holsteins and not found in Jersey cows (Kgwatalala et al. 2007). In the

present study, the allelic distribution of the SNPs in the coding region of the Xuhuai

breed was significantly different from the Boer and Haimen breeds. The Xuhuai

goat is a Chinese indigenous breed, and the Boer goat is considered one of the most

desirable goat breeds for meat production. Whether the SNP variation between

breeds is due to the selection of economic traits needs to be investigated further.

Acknowledgments This study was supported by the Natural Science Foundation of Jiangsu Province

(BK2008120), the National ‘‘863’’ Program of the P.R. China (No. 2008AA10Z138), the ‘‘13115’’ Sci-

Tech innovation program of Shaanxi province (2008ZDKG-11), Research Fund for the Doctor Program

of Higher Education of China (No. 20080712001), Talents Foundation of Northwest A&F University

(No. 01140411), The Young Topnotch Researcher Support Project of Northwest A&F University (No.

QNGG-2009-007), the Natural Science Fund for Colleges and Universities in Jiangsu Province

(09KJD180002), and the Natural Science Foundation of Xuzhou Normal University (KY2007019).

References

Bernard L, Leroux C, Hayes H, Gautier M, Chilliard Y, Martin P (2001) Characterization of the caprine

Stearoyl-CoA desaturase gene and its mRNA showing an unusually long 3’-UTR sequence arising

from a single exon. Gene 281(1–2):53–61

Cohen P, Miyazaki M, Socci ND, Hagge-Greenberg A, Liedtke W, Soukas AA, Sharma R, Hudgins LC,

Ntambi JM, Friedman JM (2002) Role for stearoyl-CoA desaturase-1 in leptin-mediated weight loss.

Science 297(5579):240–243

Garcıa-Fernandez M, Gutierrez-Gil B, Garcıa-Gamez E, Arranz JJ (2009) Genetic variability of the

Stearoyl-CoA desaturase gene in sheep. Mol Cell Probe 23(2):107–111

Heineman FS, Ozols J (2003) Stearoyl-CoA desaturase, a short lived protein of endoplasmic reticulum

with multiple control mechanisms. Prostag Leukotr Ess 68(2):122–133

Hulver MW, Berggren JR, Carper MJ (2005) Elevated stearoyl-CoA desaturase-1 expression in skeletal

muscle contributes to abnormal fatty acid partitioning in obese humans. Cell Metab 2(4):251–261

Jiang Z, Michal JJ, Tobey DJ, Daniels TF, Rule DC, Macneil MD (2008) Significant associations of

stearoyl-CoA desaturase (SCD1) gene with fat deposition and composition in skeletal muscle. Int J

Biol Sci 4(6):345–351

Kgwatalala PM, Ibeagha-Awemu EM, Hayes JF, Zhao X (2007) Single nucleotide polymorphisms in the

open reading frame of the stearoyl-CoA desaturase gene and resulting genetic variants in Canadian

Holstein and Jersey cows. DNA Seq 18(5):357–362

Macciotta NP, Mele M, Conte G, Serra A, Cassandro M, Dal Zotto R (2008) Association between a

polymorphism at the stearoyl CoA desaturase locus and milk production traits in Italian Holsteins.

J Dairy Sci 91(8):3184–3189

Mainieri D, Summermatter S, Seydoux J, Montani JP, Rusconi S, Russell AP, Boss O, Buchala AJ,

Dulloo AG (2006) A role for skeletal muscle stearoyl-CoA desaturase 1 in control of thermogenesis.

FASEB J 20(10):E1157–E1170

Mele M, Conte G, Castiglioni B, Chessa S, Macciotta NP, Serra A (2007) Stearoyl-coenzyme A

desaturase gene polymorphism and milk fatty acid composition in Italian Holsteins. J Dairy Sci

90(9):4458–4465

Milanesi E, Nicoloso L, Crepaldi P (2008) Stearoyl CoA desaturase (SCD) gene polymorphisms in Italian

cattle breeds. J Anim Breed Genet 125(1):63–67

Biochem Genet (2010) 48:822–828 827

123

Miyazaki M, Ntambi JM (2003) Role of stearoyl-coenzyme A desaturase in lipid metabolism. Prostag

Leukotr Ess 68(2):113–121

Miyazaki M, Dobrzyn A, Sampath H (2004) Reduced adiposity and liver steatosis by stearoyl-CoA

desaturase deficiency are independent of peroxisome proliferator activated receptor-alpha. J Biol

Chem 279(33):35017–35024

Ntambi JM, Miyazaki M, Stoehr JP, Lan H, Kendziorski CM, Yandell BS, Song Y, Cohen P, Friedman

JM, Attie AD (2002) Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity.

Pro Natl Acad Sci USA 99(17):11482–11486

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. In: A laboratory manual, 2nd edn, vol 1–3.

Cold Spring Harbor Laboratory Press, New York

Taniguchi M, Mannen H, Oyama K, Shimakura Y, Oka A, Watanabe H, Kojima T, Komatsu M, Harper

GS, Tsuji S (2004a) Differences in stearoyl-CoA desaturase mRNA levels between Japanese and

Holstein cattle. Livest Prod Sci 87(2–3):215–220

Taniguchi M, Utsugi T, Oyama K, Mannen H, Kobayashi M, Tanabe Y, Ogino A, Tsuji S (2004b)

Genotype of stearoyl-CoA desaturase is associated with fatty acids composition in Japanese Black

cattle. Mamm Genome 15(2):142–148

Wigginton JE, Cutler DJ, Abecasis GR (2005) A note on exact tests of Hardy-Weinberg equilibrium. Am

J Hum Genet 76(5):887–893

Yahyaoui MH (2003) Genetic polymorphism in goat. Ph.D. Thesis. Universidad Autonoma de Barcelona,

Facultad de Veterinaria, Spain

Yahyaoui MH, Sanchez A, Folch JM (2002) Rapid communication: partial nucleotide sequence of the

goat stearoyl coenzyme A desaturase cDNA and gene structure. J Anim Sci 80(3):866–867

Yahyaoui MH, Vaiman D, Sanchez A, Folch JM (2003) Mapping of the goat stearoyl coenzyme A

desaturase gene to chromosome 26. Anim Genet 34(6):474–475

828 Biochem Genet (2010) 48:822–828

123

stearoyl-coa desaturase (scd) gene polymorphism in goat breeds

Documents