immunoglobulins d and m multiple myeloma variants are ... · immunoglobulins d and m multiple...
Post on 17-Aug-2020
10 Views
Preview:
TRANSCRIPT
Vol. 3. 2501-2506. Deee,nher 1997 Clinical Cancer Research 2501
Immunoglobulins D and M Multiple Myeloma Variants Are Heavily
Mutated1
Nadine Juge-Morineau, Carlo Heirman,
Marleen Bakkus, Benjamin Van Camp,
Ronald Malfait, Jean-Luc Harousseau,
Kris Thielemans, and Regis Bataille2Department of Hematology and Immunology. Free University
Brussels (VUB). Brussels, Belgium N. J-M.. C. H.. M. B.. B. V. C..
K. TI: Service d’H#{233}matologie. Hotel Dieu. Nantes. France IN. J-M..J-L. HI: AZ-Middeiheim. Antwerpen. Belgium [R. Ml: andLaboratoire dH#{233}matologie. Institut de Biologic. 44093 Nantes.
France [R. B.J
ABSTRACT
Multiple myeloma (MM) is a B-cell malignancy char-
acterized by the expansion of malignant plasma cells within
the bone marrow. Previous studies that have examined the
Ig V� genes of IgG and IgA MMs have shown the presence
of somatic mutations, suggesting that in these cases, the
myeloma precursor cell passed through the phase of anti-
genie selection within the germinal center but is no longer
exposed to the somatic mutation process. However, no in-
formation about this matter is available in the rare IgD and
1gM MM variants. Therefore, we have analyzed the Ig V�
genes of three IgD, one 1gM, and one biclonal (IgG and 1gM)
MM for the presence of somatic mutations. Our study dem-
onstrates that all of these myeloma clones have accumulated
a high number of somatic mutations within their Ig VH
genes but show no intraclonai variation. Moreover, proof
that the clone sustained a strong antigenic selection pressure
could be provided in three cases (one IgD and two IgMs).
Therefore, this study strongly implies that IgD and 1gM
MMs emerge from a postgerminal center preswitched B cell
that is no longer exposed to the somatic mutation process or
able to undergo further isotype switching in vivo.
INTRODUCTIONMM3 is a B-cell malignancy characterized by the slow
proliferation of malignant plasma cells within the bone marrow.
Received 7/3/97: accepted 9/i 8/97.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefire be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
t This work was supported by the Concerted Action. N. J-M. is a
research fellow of the Human Capital and Mobility Program CHRX-
CT94-()437.
2 To whom requests for reprints should be addressed. at Laboratoired’H#{233}matologie. Institut de Biologic. 9 Quai Moncousu. 44093 Nantes
cedex 01 . France. E-mail: frb@sante.univ.nantes.fr.
3 The abbreviations used are: MM, multiple myeioma: FR. framework:CDR. complementary determining regions: S. silent mutation: aa. amino
acid: R, replacement.
Since our pioneering work ( 1 ). several studies have confirmed
the presence of numerous somatic mutations within the Ig heavy
chain variable region (VH) gene of the myeioma clone (2-6).
Moreover. four of these studies have demonstrated a lack of
intraclonal diversity ( 1 . 3. S. 6) and the stability of these somatic
mutations during disease progression (2). These findings sug-
gest that the process of somatic mutation has stopped in my-
eloma cells in contrast to the ongoing somatic mutation process
observed in follicular lymphomas (7. 8), and that the myeloma
precursor cell is thus no longer exposed to this somatic mutation
process. Taken together. these data imply that the putative
rnyeloma stem cell has already passed through the antigenic
selection within germinal centers and is either a memory B cell
or. more likely. a migrating piasmablast. These conclusions
have been established on the study of the V11 genes of MM of
the IgG and IgA subtypes. These MM cases are characterized by
the expansion of postswitched Ig-secreting B cells within the
bone marrow, but the actual origin of the niyeloma precursor
cell in these MMs remains an enigma. Indeed, in which cell, i.e..
pre- (IgM+ ) or postswitched (IgG+ or IgA+ ) secreting B cell
does the neoplastic transformation occur? The existence of
preswitched but somatically mutated IgM+ B cells clonally
related to the malignant plasma cells has been demonstrated in
these IgG and IgA MMs (9-I 1 ). However, the malignant po-
tential of these cells has not yet been elucidated. Indeed. they
could only represent normal 1gM-producing precursor cells that
have existed at some timepoint. given the normal B-cell differ-
entiation pathway.
IgD and 1gM MMs represent exceptional variants. In a
recent study of 201 1 consecutive patients with MM. IgD and
1gM MM represented I .5 and 0.2% of the cases, respectively
(12). In the same study. 0.15% of IgG MMs presented with a
minor 1gM monoclonal component of the same light chain
isotype. These variants are characterized by the expansion of B
cells that have been frozen by one or several oncogenic events
in a stage of B-cell evolution earlier than that defining the IgG
and IgA malignant plasma cells. The examination of the V11
genes of such myeloma variants in terms of somatic mutations
should allow us to trace the clonal history in these exceptional
MM cases and may be informative for a more general under-
standing of the biology of MM. We thus investigated this point
in three IgD MMs. one 1gM MM. and one MM with a double
monoclonal (IgG and 1gM) component. This study demonstrates
that the heavy chain V region sequences of lgD and 1gM MM
are also heavily mutated and present no intracional diversity.
These findings are discussed with regard to current views on
normal B-cell development.
PATIENTS AND METHODSPatients. Samples of 1 1 cases of MM were obtained
during standard diagnostic procedures. Three patients had an
IgD (Eij. Dej. and Bou). one had an 1gM (Bar). and one had a
Research. on November 24, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Table 1 Nucleotide sequence of primers used in PCR amplification
Primer’�
VH.L1
VH.L2+4
VH.L3
VH.L5VH.L6
VH.DIVH.D2
VH.D3VH.D4a
VH.D4b
VH.D5
VH.D6CaC�yC�
C1i.
Sequence (5 ‘ to 3’)
CATGGACTGGACCTGGAGG
ATGAAACACCTGTGGTTCTT
GGGCTGAGCCTGGGTTTTCCTT
GGGGTCAACCGCCATCCT
TCTGTCTCCTTCCTCATCTTC
CTCAGTGAAGGTCTCCTGCAAGG
CTGCGCTGGTGAAAGCCACACA
GGTCCCTGAGACTCTCCTGTGCA
GGAGACCCTGTCCCTCACCTGCA
GCTGTCTCTGGTTACTCCATCAG
GAAAAAGCCCGGGGAGTCTCTGAA
CTGTGCCATCTCCGGGGACAGTG
GCTCAGCGGGAAGACCTT
CAGGGGGAAGACCGATGG
CAGTTATCAAGCATGCCAG
AAAAGGGTTGGGGCGGATGC
2502 Somatic Mutations in IgD and 1gM Myeloma
a VH.LI toVH.L6, primers derived from the leader region of the
six VH families; VHDl to VH.D6, primers derived from the first FR
region of the six VH families.
double IgG and 1gM monoclonal protein (Del). Five IgG and
one IgA MM patients were also included in the study as a
control panel. Tumor samples were provided by bone marrow
aspirates (nine patients), from blood (one patient), or from a
biopsy of an extramedullary localization (cervical mass; one
patient). Mononuclear cells were obtained by Ficoli-Hypaque
(1.077 kg/liter; Pharmacia, Uppsala, Sweden) density centrifu-
gation.
Amplification of the Expressed Myeloma V� Gene.Total RNA was extracted by a guanidine isothyocyanate/acid-
phenol modified method with TRizol reagent (Life Technolo-
gies, Inc.) and reverse-transcribed in first-strand eDNA using
random hexamers and the SuperScript preamplification system
(Life Technologies, Inc.) according to manufacturer’ s recom-
mendations. A first set of primers, actin 1 (5’-TGCTATCCAG-
GCTGTGCTAT-3’) and actin 2 (5’-GATGGAGUGAAGG-
TAG1TI’-3’), was used as a control for the first-strand cDNA
synthesis. The Ig VH gene sequences were then amplified using
a consensus primer to the leader or the first FR region of the six
VH gene families (VH1-6) together with a constant region
primer, depending on the isotype of the myeioma clone (Table
1). The amplification reaction was performed with 1 p.1 of
first-strand cDNA in a 50-pA volume containing 1 mr�i Tris-HC1
(pH 8.3), 50 mM KCI, 2 mt�.i MgCl2, 200 mr�i deoxynucleotide
triphosphate, 15 pmoi of each primer, and 1.25 unit of Taq
polymerase (Life Technologies, Inc.). Each PCR cycle consisted
of 94#{176}Cheat denaturation for 30 s and primer annealing at 60#{176}C
for 30 5, followed by primer extension at 72#{176}Cfor 1 mm. The
first cycle was preceded by a 2-mm denaturation step at 94#{176}C,
and the last elongation step was prolonged to 10 mmto ensure
full-length products. Forty cycles were performed in a Perkin
Elmer GeneAmp PCR system (Perkin Elmer Corp., Zaventem,
Belgium). Ten p.1 of the PCR product were then electrophoresed
through an ethidium bromide-impregnated agarose gel and as-
sayed by exposure to UV light.
Cloning and Sequencing of the Expressed Myeloma VH
Gene. Gel-purified products of predicted size were blunt
end-ligated into pCR 2. 1 vector (Invitrogen Corp., San Di-
ego, CA) according to the manufacturer’s protocol. One-fifth
of the ligation mixture was used to transform One Shot
competent cells (Invitrogen), which were then plated onto
agar plates impregnated with ampicillin, kanamycin, and
X-Gal. Clones were purified using the Wizard plus Minipreps
DNA purification system (Promega, Madison, WI), and those
containing an insert of appropriate size by restriction analysis
of plasmid DNA were selected and sequenced using the
dideoxy chain termination sequencing procedure with a-35S-
labeled dATP (Amersham, Arlington Heights, IL) and the
Sequenase Version 2.0 DNA sequencing kit (United States
Biochemical Corp., Cleveland, OH) according to the manu-
facturer’ 5 instructions.
Statistical Analysis of Somatic Mutations within the
Expressed Ig VH Gene. The number of expected R mutations
in the CDRs and FRs was calculated according to the method of
Chang and Casali (13). The binomial distribution model was
applied to calculate whether the excess of R mutations in CDRs
and FRs resulted from chance or not.
RESULTSMyeloma Ig VH Gene Sequences. The expressed Ig VH
genes of three IgD, one 1gM, and one biclonal IgG and 1gM MM
were amplified by PCR using consensus primers to the leader or
the first FR of the six VH families together with consensus
primers to the constant heavy chain, depending on the isotype of
the myeloma clone (Table 2). In parallel, five IgG and one IgA
myeloma patients were studied as a control panel. For each
patient, only one V� family PCR product gave rise to a clonal
band of the appropriate size (450 bp) with PCR. Successful
amplification of the VH gene was achieved with the use of the
primers derived from the leader region of the six VH families in
nine cases but required the use of those derived from the first FR
in two cases (Dej and Zar). The PCR product was then purified
and cloned according to above-mentioned procedures. Twelve
independent clones were sequenced in each case. We first com-
pared the position ofthe thymidine nucleotides in the 12 isolates
(so-called T tracks). When at least three T tracks were found to
be identical, they were considered to have been derived from the
monoclonal population. Moreover, the nonidentical T tracks
were all different among them, representing residual normal B
cells. Among the IgD and 1gM MMs, the representation of the
VH family gene used by the myeloma clones was: VH2, 1 ; VH3,
2; and VH4, 1 . In the control panel, this representation was:
VH3, 3; VH4, 2; and VH6, 1 (Table 2). Concerning the biclonal
gammopathy (Del), the IgG clone belonged to the VH3 family,
whereas the 1gM clone belonged to the VH4 family, and the
CDR3 regions of the two clones were completely distinct,
demonstrating that the two clones originated from two different
myeloma precursor cells (Table 2). Thus, to facilitate and clarify
the following results, the biclonal gammopathy (Del) will be
referred to as one case included in the panel of IgG and IgA MM
and as another case included in the panel of IgD and 1gM MM.
except for particular observations.
Quantitation of Somatic Mutations and Lack of Intra-
clonal Diversity The sequences obtained from the 1 1 MM
patients were submitted to the European Molecular Biology
Research. on November 24, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Clinical Cancer Research 2503
Table 2 Comparative analysis of the V11 gene between th e cohort of IgD and Ig M and the cohort of IgG and IgA MM patients
SM (%)�
Patient Ig type V1� family MM seq” Total FR CDR
EijDejBouBarDelMeanDelVanChaVpi
MonZahLai
Mean
IgDIgDIgD1gM1gM
IgGIgGIgGIgG
IgGIgGIgA
VH4
V112V113VH3V04
V113V114V1�3VH6
VH4V03V1�3
10
768983333
333
9.46.2
17.768.69.65.48.16.56.3
5.89.7
10.97.5
8.33.2
1 13.45.76.33.55.73.15.3
5.36.775.2
131340.915.91920.412.115.918.29.3
7.918.224.215.1
(I MM seq. the number of myeioma clones sequenced.I, SM (%), the percentage of nucleotides with mutation in comparison with the most homologous germ-line genes.
Laboratory database.4 When the myeloma V� gene sequences
were compared with currently known best-matching germ-line
sequences. a significant number of bp substitutions were noted.
In the IgD and 1gM MM cohort, the somatic mutation rate was
9.6% of the nucleotides, ranging from 6-17.7%, whereas this
rate was 7.5% in the IgG and IgA cohort (ranging from 5.4-
10.9%: Table 2). A particularly high number (17.7%) of somatic
mutations were found in patient Bou (1gM). Moreover, in the
case of the biclonal gammopathy (Del), the 1gM V11 gene
presented a nucleotide mutation rate higher than that of the IgG
VH gene (8.6 versus 5.4%). The high mutation frequencies of
the VH genes of the IgD and 1gM MMs thus matched that noted
in IgG and IgA MMs (i-6).� When analyzing the percentage of
nucleotide changes within the FRs and the CDRs, the nucleotide
mutation rates were 6.3 (3.2-1 1%) and 20.4% (13-40.9%),
respectively. and were similar to those observed in the cohort of
IgG and IgA MMs (Table 2). In the particular case of the
biclonal gammopathy, the IgG and the 1gM VH genes showed a
nucleotide substitution rate of 3.5 and 5.7% in the FRs and 12.1
and 19% in the CDRs, respectively (Table 2). Absence of
intraclonal diversity has already been extensively demonstrated
for the IgG and IgA MMs (1, 5, 6). Thus we did not repeat the
experiments for our own cohort. On the other hand, we se-
quenced an average of 8 clones (6-10) per patient of the IgD
and 1gM MM panel (Table 2) and did not identify intraclonal
diversity in any subtype (data not shown).
Evidence for Prior Antigenic Selection. To find out
whether the myeloma clones have undergone antigenic selection
or not, we then analyzed the type (R or S) and location (FR and
CDR) of the nucleotide substitutions. We only considered nu-
cleotide exchanges that had occurred in the region of the cDNA
molecule encoded by the VH gene itself (the FRI to FR3
region). The rationale for this is that at the VH-D-JH junction, it
4 Accession numbers Y08259, Y0840l to Y08408, Y08428, Y08429.
and Y08732.5 N. Juge-Morineau, unpublished observations.
is difficult to accurately distinguish between nucleotide varia-
tions introduced by the recombination process and those intro-
duced by somatic mutations. The ratios aa-R versus aa-S
(aa-R:S) in both FRs and CDRs were then calculated in each
case. Moreover, we calculated the probability that the observed
R and S mutations could have occurred at random (see “Patients
and Methods”). This kind of analysis performed on our cohort of
IgG and IgA MM patients provided results similar (data not
shown) to those previously reported by Veschio ci al. (5), i.e.,
the myeloma clone sustained strong antigenic selection pressure
in these subtypes. Moreover, we excluded patient Dej from this
latter analysis, because we did not have the complete sequence
of the VH gene in this case (i.e. , failure of the V11 leader family
PCR). Although it was not expected that the missing part of the
FR1 contained a number of mutations that might significantly
change the results of calculation, we preferred to exclude this
case from the analysis. Therefore, the mean FR and CDR R:S
ratios were 1 .67 and 2.57, respectively. The difference did not
reach a statistical significance, given the small number of pa-
tients. Only one 1gM patient (Bar) presented a CDR R:S ratio of
4, whereas this value remained below 2.9 in the three other cases
(data not shown). In three of the sequences, the number of R
mutations seen in the CDRs was larger than that expected by
chance, and the values were statistically significant in two cases
(Table 3 and Fig. 1 ). These findings strongly suggest that the
myeioma clone has sustained strong antigenic selection pressure
in IgD and 1gM MM. Considering the FR regions, the number of
R mutations was always lower than that expected by chance,
with a significant P value in three of four cases (Table 3 and
Fig. 1).
DISCUSSIONThe detection of somatic mutations within the Ig VH genes
of B-cell tumors turned out to be a very elegant and reliable
method to answer the question of whether these tumors derived
from naive pregerminal B-cells or from germinal center-derived
memory B-cells. With this approach, somatic mutations in the Ig
VH gene have been detected in follicular lymphomas (7, 8),
Research. on November 24, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Table 3 Analysis of R mutations in the VH gene sequence of MM patients
Expected R values were calculated as described in “Patients and Methods.”
randomly.
2504 Somatic Mutations in IgD and 1gM Myeloma
FR CDR
Obs Exp PCObs” Exp” PC
El Jatt 12 15.8 0.052 6 7.04 0.15
Bou 17 30.8 0.000063 20 12.17 0.000216
Bar 5 10.8 0.00410 8 3.67 0.00323
Del 7 14.12 0.00273 7 6.108 0.098
a Obs, observed.b Exp, expected.C For each patient, P represents the likelihood that the observed R mutations within the FRs and the CDRs of the Ig VH gene have occurred
FRi CDR1 FR2 CDR2 FR3
DP-64 QLQLQESGSGLVKP�FLSL’FCAVSGGSIS SGGYSWS WIRQPPGKGLEWIG YIY}ISGSTYYNPSLKS RVTISVDRSKNQFSLKLSSVTAAU�AVYYCAR
ELI . .R A. .T D. . . .DA.s.N g g .iS.G. . N . .s L. ‘114 N1K.At v.. .5
DP-46 �.TQLVmGGGWQPGRSLRLSCAASGF’FFS SYIiMH t’NRQAPCKGLE’.4VA VISYDGSNXYYADSVKG RF’rISRDNSKNTLYLQMNSLRAEtYI’AVYYCAR
Bo*.i . .g. . ag. .I.SgT. . . .T N.N YFV.V p a S.sS. .DR.t.tyaN. .G. .V.L. .V.FR. MS. . .D. .GPD. ..v.. . .r
YAC9 EVQLVESGGGLVQPOGSLKLSCAASGVFFS GSAMH WVRQSSGKGLEWVG RIRSKANSYATAThAS VKGRrrISRDDSK�TrAYL�t.1NSLKTEUrAVYYCTR
BAR A D.TL. ST. . .N. . .T.G 1TA. . . .v. . .F.
DP71 Q5TQLQ�GPGLVKPSETLSLTCIVSGGSIS SYYWS WIRQPPCKGLEWIG YIYYSGS’IWYNPSLKS RVTISVUJ’SKNQFSLKLSSVTAAIYrAVYYCAR
DEL . .H S MN sF’y.N .V g .iFy.gI R a n. . . ks. . .T. .t.L
Fig. 1 Deduced aa sequences of the VH regions of IgD and 1gM MM. A comparison was made with the most homologous germ-line VH gene. Thesingle-letter aa code is used. Homology is indicated by points. Uppercase letter, replacement mutation; lowercase letter, silent mutation.
Hodgkin’s disease of B-cell phenotype (14) and WaldenstrOm
disease (15). On the other hand, few or no mutations have been
detected in B-acute lymphoblastic leukemia (16), common
B-chronic lymphocytic leukemia (16, 17), large cell lymphoma
(18), and mantle cell lymphoma (19). MM is a B-cell malig-
nancy characterized by the accumulation of malignant plasma
cells inside the bone marrow. In this cancer, there is a contro-
versy about the nature of the myeloma stem cell, i.e. , the normal
counterpart in which the neoplastic transformation does occur: a
naive B cell (or even pre-B cell) or a memory B cell (or
migrating plasmablast). To solve this question, several studies
have been devoted to the search of somatic mutations within the
Ig VH genes of malignant plasma cells (1-6). Because IgG and
IgA MMs represent up to 84% of the patients ( 12), only these
usual types have been investigated. From these studies, evidence
has been obtained that myeloma Ig VH genes contain somatic
mutations but show no intraclonal variation. The amount of
somatic mutations does not differ between IgG and IgA MM (5).Taken together, these findings thus prove that the myeloma stem
cell has passed through the germinal center and is no longer
exposed to the somatic mutation process. Moreover, the analysis
of the number of mutations accumulated in the Ig VH gene and
of the type (R or 5) and location (FR or CDR) of these mutations
has provided evidence that the myeloma clone passed through a
stage of secondary or tertiary positive antigenic selection on the
basis of production of a functional Ig with high antigenic bind-
ing affinity (5, 20). Until now, the status of IgD and 1gM rare
variants has never been studied in terms of the presence (or
absence) of somatic mutations in the Ig VH genes. In the current
study, we show that three IgD MMs and two 1gM cases have
accumulated somatic mutations within their Ig genes at a rate
similar to that observed in our cohort of IgG and IgA cases, and
no intraclonal diversity could be identified. Moreover, proof that
the myeloma clone has sustained antigen selection pressure has
been provided in two cases. Taken together, these data suggest
that also in IgD and 1gM MM, the oncogenic event takes place
in a germinal center-derived B cell that is no longer exposed to
the somatic mutation process or able to undergo further isotype
switching in vivo. Our data are reminiscent of those obtained in
patients with Waidenstrdm’s macroglobulinemia (i.e. , 1gM
types), in whom the presence and the pattern of mutations
suggest that in this disease, tumor cells are also derived from B
cells that have been selected by antigen (15). Our findings are
not in disagreement with what is presently known about the
switch of Ig genes and the pooi of memory B cells (21, 22).
Indeed, it is now clear that the isotype switch and the somatic
mutation process are two independent events that are triggered
sequentially during germinal center reaction (23, 24), with the
isotype switch taking place during the transition from IgD+ B
cells to IgD- germinal center centrobiasts (25, 26). Moreover,
Research. on November 24, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Clinical Cancer Research 2505
the isotype switch does not terminate the somatic mutation
process (26-28). Although B cells carrying 1gM or IgD con-
tribute little to the memory pool (in comparison with those
carrying IgG or IgA; Ref. 21), highly mutated IgD+ or IgM+
normal B cells exist (21, 24, 28-31). Mutated 1gM-bearing B
cells may represent a population of memory B cells that, perhaps
because of the nature of the antigenic stimulus and/or T-cell
help, have not received the signal to undergo isotype switching
(23) or could undergo further mutation and isotype switching on
antigenic restimulation (28). Therefore, the oncogenic event
leading to the emergence of 1gM MM is likely to take place in
this normal counterpart and may also contribute to prevent the
cells from undergoing further isotype switching. Until recently,
IgD was shown to only be expressed together with 1gM on the
surface of naive mature B cells. Now, a novel subset of germinal
center B cells defined by a sIgM-IgD+CD38+ phenotype has
been described that has accumulated a high number of mutations
within its Ig VH genes (29). Therefore, these cells could repre-
sent the normal counterpart of IgD MM. Because the isotype
switch does not terminate the somatic mutation process (28), it
was of interest to compare the amount of somatic mutations
among the IgD, 1gM, IgG, and IgA cases. However, no differ-
ences in terms of the number of somatic mutations accumulated
within the Ig VH genes have been detected in IgD and 1gM MM
when compared with the IgG and IgA subtypes. Again, these
findings are not in disagreement with our current knowledge on
the somatic mutation process in normal B cells, including mu-
tated IgD and 1gM normal B lymphocytes. Finally, another point
addressed by this study is the accurate definition of biclonal
MM. Indeed, this term is usually used to define rare MM cases
in which a double component with the same light chain is
identified by immunoelectrophoresis and therefore covers two
different entities. Indeed, whereas in some cases, the two clones
will share the same VDJ sequence, thus reflecting the same
precursor cell origin, other cases, such as the one described in
this study, represent a disease in which both clones evolved
from two different precursor cells. Molecular analysis of bi-
clonal MM as defined by the electrophoresis profile would
allow us to discriminate between these two possibilities and
should provide precious information for a better understanding
of MM biology.
In conclusion, this study illustrates that IgD and 1gM rare
variants derive from a preswitched memory B cell that has
passed through a stage of positive antigenic selection and is no
longer exposed to the somatic mutation process or able to
undergo further isotype switching in vivo.
ACKNOWLEDGMENTSWe thank the participants of BIOMED program No. PL931407 for
fruitful discussion and critical reading of the manuscript.
REFERENCES
I. Bakkus, M. H. C., Heirman, C., Van Riet, I., Van Camp, B., andThielemans, K. Evidence that multiple myeloma Ig heavy chain VDJ
genes contain somatic mutations but show no intraclonal variation.
Blood, 80: 2326-2335, 1992.
2. Ralph. Q. M., Brisco, M. J., Joshua, D. E., Brown, R., Gibson, J., andMorley. A. A. Advancement of multiple myeioma from diagnosis
through plateau phase to progression does not involve a new B-cell
clone: evidence from the Ig heavy chain gene. Blood, 82: 202-206,
1993.
3. Sahota, S., Hamblin, T., Oscier, D. 0., and Stevenson, F. K. Assess-ment of the role of clonogenic B lymphocytes in the pathogenesis ofmultiple myeloma. Leukemia (Baltimore), 8: 1285-1289. 1994.
4. Takishita, M., Kosaka, M., Goto, T., and Saito, S. Cellular origin and
extent of cional involvement in multiple myeioma: genetic and pheno-typic studies. Br. J. Haematoi., 87: 735-742, 1994.
5. Vescio, R. A.. Cao, J., Hong, C. H., Lee, J. C., Wu, C. H., Der
Danielian, M., Wu, V., Newman, R., Lichtenstein, A. K., and Berenson,
J. R. Myeloma Ig heavy chain V region sequences reveal prior antigenicselection and marked somatic mutation but no intraclonal diversity.
J. Immunoi., 155: 2487-2497, 1995.
6. Sahota, S. S., Leo, R., Hamblin, T. J., and Stevenson, F. K. Ig VH
gene mutational patterns indicate different tumor cell status in human
myeloma and monoclonal gammopathy of undetermined significance.
Blood, 87: 746-755, 1996.
7. Meeker, T., Lowder, J., Cleary, M. L., Stewart, S., Wamke, R., SkIar,J., and Levy, R. Emergence of idiotype variants during treatment ofB-cell lymphoma with anti-idiotype antibodies. N. EngI. J. Med., 312:
1658-1665. 1985.
8. Bahier, D. W., and Levy, R. Clonal evolution of a foilicular lym-
phoma: evidence for antigen selection. Proc. Nail Acad. Sci. USA, 89:
6770-6774, 1992.
9. Biliadeau, D., Ahmann, G., Greipp, P., and Van Ness, B. The bone
marrow of multiple myeioma patients contains B cell populations at
different stages of differentiation that are clonaily related to the malig-
nant plasma cell. J. Exp. Med., 178: 1023-1031, 1993.
10. Corradini, P., Boccadoro, M., Voena, C., and Pileri, A. Evidence fora bone marrow B cell transcribing malignant plasma cell VDJ joined to
Cii. sequence in immunoglobulin (IgG-) and IgA-secreting multiple
myelomas. J. Exp. Med.. 178: 1091-1096, 1993.
I I . Bakkus, M. H. C., Van Riet, I., Van Camp, B.. and Thielemans, K.Evidence that the cionogenic cell in multiple myeloma originates froma pre-switched but somatically mutated B cell. Br. J. Haematol., 87:
68-74, 1994.
12. MacLennan, I. C. M. In which cells does neopiastic transformation
occur in myeiomatosis? Curr. Top. Microbiol. Immunol., 182: 209-213,
1992.
13. Chang. B., and Casali, P. The CDRI sequences of major proportion
of human germline Ig VH genes are inherently susceptible to aminoacidreplacement. Immunol. Today, 15: 367-373, 1994.
14. Tamaru, J. I., Hummel, M., Zemlin, M., Kalvelage, B., and Stein,
H. Hodgkin’s disease with a B-cell phenotype often shows a VDJrearrangement and somatic mutations in the VH genes. Blood, 84:
708-715. 1994.
15. Aoki, H.. Takishita, M., Kosaka, M., and Saito, S. Frequent somatic
mutations in D and/or �H segments of Ig gene in Waldenstrdm’s mac-rogiobulinemia and chronic lymphocytic leukemia (CLL) with Richter’s
syndrome but not in common CLL. Blood, 85: 1913-1919. 1995.
16. Bird, J., Galili, N., Link, M., Stites, D., and Skiar, J. Continuingrearrangement but absence of somatic hypermutation in immunoglobu-
lin genes of human B cell precursor leukemia. J. Exp. Med., 168:229-245, 1988.
17. Rassenti, L. Z., and Kipps, T. J. Lack of extensive mutations in the
VHS genes used in common B cell chronic lymphocytic leukemia. J.Exp. Med., 177: 1039-1046, 1993.
18. Stiernhoim, N., Kuzniar, B., and Bernstein, N. L. Absence ofimmunogiobulin variable region hypermutation in a large cell lym-phoma after in vito and in vitro propagation. Blood, 80: 738-743, 1992.
19. Hummel, M., Tamaru, J., Kalvelage, B., and Stein, H. Mantle cell(previously centrocytic) lymphomas express VH genes with no or very
little somatic mutations like the physiologic cells of the follicle mantle.Blood, 84: 403-407, 1994.
20. Bye. J. M.. Carter. C.. Cui. Y.. Gorick, B. D., Songsiviiai. S..Winter, G., Hughes-Jones, N. C., and Marks, J. D. Germline variable
Research. on November 24, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
2506 Somatic Mutations in IgD and 1gM Myeloma
region gene segment derivation of human monocional anti-Rh (D)antibodies. J. Clin. Invest., 90: 2481-2490, 1992.
21. Gray, D. Immunological memory. Annu. Rev. Immunol., 11. 49-77, 1993.
22. MacLennan, I. C. M. Germinal centers. Annu. Rev. Immunol., 12:
117-139, 1994.
23. Van Es, J. H., Gmelig Meyling, F. H. J., and Logtenberg, T. Highfrequency of somatically mutated 1gM molecules in the human adultblood B cell repertoire. Eur. J. Immunol., 22: 2761-2764, 1992.
24. Liu, Y. J., Malisan, F., de Bouteiller, 0., Guret, C., Lebecque, S.,Banchereau, J., Mills, F. C., Max, E. E., and Martinez-Valdez, H.Within germinal centers, isotype switching of immunoglobulin genesoccurs after the onset of somatic mutation. Immunity. 4: 241-250. 1996.
25. Berek, C., Berger, A., and Apel, M. Maturation of the immune
response in germinal centers. Cell, 67: 1 121-i 129, 1991.
26. Pascual, V., Liu, Y. J., Magalski, A., de Bouteiller, 0., Banchereau,J., and Capra, J. D. Analysis of somatic mutation in five B cell subsetsof human tonsil. J. Exp. Med., 180: 329-339, 1994.
27. Shan, H., Shlomchik, M., and Weigert, M. Heavy-chain classswitch does not terminate somatic mutation. J. Exp. Med., 172: 531-
536, 1990.
28. Varade, W. S., and Insel, R. A. Isolation of germinal centerlike
events from human spleen RNA. Somatic hypermutation of a clonallyrelated VHDJH rearrangement expressed with 1gM, IgG. and IgA. J.
Clin. Invest., 91: 1838-1842, 1993.
29. Liu, Y. J., de Bouteiiler, 0., Arpin, C., Briere, F., Galibert, L., Ho,S., Martinez-Valdez, H., Banchereau, J., and Lebecque, S. Normalhuman IgD�IgM germinal center B cells can express up to 80 muta-tions in the variable region of their IgD transcripts. Immunity, 4:
603-613, 1996.
30. Insel, R. A., Varade, W. S., and Mann, E. Human splenic 1gMimmunoglobulin transcripts are mutated at high frequency. Mol. Immu-
nol., 31: 383-392, 1994.
31. Klein, U., KUppers, R., and Rajewsky, K. Evidence for a largecompartment of 1gM-expressing memory B cells in humans. Blood, 89:
1288-1298, 1997.
Research. on November 24, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
1997;3:2501-2506. Clin Cancer Res N Juge-Morineau, C Heirman, M Bakkus, et al. heavily mutated.Immunoglobulins D and M multiple myeloma variants are
Updated version
http://clincancerres.aacrjournals.org/content/3/12/2501
Access the most recent version of this article at:
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://clincancerres.aacrjournals.org/content/3/12/2501To request permission to re-use all or part of this article, use this link
Research. on November 24, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
top related