immunoglobulins d and m multiple myeloma variants are ... · immunoglobulins d and m multiple...

Vol. 3. 2501-2506. Deee,nher 1997 Clinical Cancer Research 2501

Immunoglobulins D and M Multiple Myeloma Variants Are Heavily

Mutated1

Nadine Juge-Morineau, Carlo Heirman,

Marleen Bakkus, Benjamin Van Camp,

Ronald Malfait, Jean-Luc Harousseau,

Kris Thielemans, and Regis Bataille2Department of Hematology and Immunology. Free University

Brussels (VUB). Brussels, Belgium N. J-M.. C. H.. M. B.. B. V. C..

K. TI: Service d’H#{233}matologie. Hotel Dieu. Nantes. France IN. J-M..J-L. HI: AZ-Middeiheim. Antwerpen. Belgium [R. Ml: andLaboratoire dH#{233}matologie. Institut de Biologic. 44093 Nantes.

France [R. B.J

ABSTRACT

Multiple myeloma (MM) is a B-cell malignancy char-

acterized by the expansion of malignant plasma cells within

the bone marrow. Previous studies that have examined the

Ig V� genes of IgG and IgA MMs have shown the presence

of somatic mutations, suggesting that in these cases, the

myeloma precursor cell passed through the phase of anti-

genie selection within the germinal center but is no longer

exposed to the somatic mutation process. However, no in-

formation about this matter is available in the rare IgD and

1gM MM variants. Therefore, we have analyzed the Ig V�

genes of three IgD, one 1gM, and one biclonal (IgG and 1gM)

MM for the presence of somatic mutations. Our study dem-

onstrates that all of these myeloma clones have accumulated

a high number of somatic mutations within their Ig VH

genes but show no intraclonai variation. Moreover, proof

that the clone sustained a strong antigenic selection pressure

could be provided in three cases (one IgD and two IgMs).

Therefore, this study strongly implies that IgD and 1gM

MMs emerge from a postgerminal center preswitched B cell

that is no longer exposed to the somatic mutation process or

able to undergo further isotype switching in vivo.

INTRODUCTIONMM3 is a B-cell malignancy characterized by the slow

proliferation of malignant plasma cells within the bone marrow.

Received 7/3/97: accepted 9/i 8/97.

The costs of publication of this article were defrayed in part by the

payment of page charges. This article must therefire be hereby marked

advertisement in accordance with 18 U.S.C. Section 1734 solely to

indicate this fact.

t This work was supported by the Concerted Action. N. J-M. is a

research fellow of the Human Capital and Mobility Program CHRX-

CT94-()437.

2 To whom requests for reprints should be addressed. at Laboratoired’H#{233}matologie. Institut de Biologic. 9 Quai Moncousu. 44093 Nantes

cedex 01 . France. E-mail: [email protected].

3 The abbreviations used are: MM, multiple myeioma: FR. framework:CDR. complementary determining regions: S. silent mutation: aa. amino

acid: R, replacement.

Since our pioneering work ( 1 ). several studies have confirmed

the presence of numerous somatic mutations within the Ig heavy

chain variable region (VH) gene of the myeioma clone (2-6).

Moreover. four of these studies have demonstrated a lack of

intraclonal diversity ( 1 . 3. S. 6) and the stability of these somatic

mutations during disease progression (2). These findings sug-

gest that the process of somatic mutation has stopped in my-

eloma cells in contrast to the ongoing somatic mutation process

observed in follicular lymphomas (7. 8), and that the myeloma

precursor cell is thus no longer exposed to this somatic mutation

process. Taken together. these data imply that the putative

rnyeloma stem cell has already passed through the antigenic

selection within germinal centers and is either a memory B cell

or. more likely. a migrating piasmablast. These conclusions

have been established on the study of the V11 genes of MM of

the IgG and IgA subtypes. These MM cases are characterized by

the expansion of postswitched Ig-secreting B cells within the

bone marrow, but the actual origin of the niyeloma precursor

cell in these MMs remains an enigma. Indeed, in which cell, i.e..

pre- (IgM+ ) or postswitched (IgG+ or IgA+ ) secreting B cell

does the neoplastic transformation occur? The existence of

preswitched but somatically mutated IgM+ B cells clonally

related to the malignant plasma cells has been demonstrated in

these IgG and IgA MMs (9-I 1 ). However, the malignant po-

tential of these cells has not yet been elucidated. Indeed. they

could only represent normal 1gM-producing precursor cells that

have existed at some timepoint. given the normal B-cell differ-

entiation pathway.

IgD and 1gM MMs represent exceptional variants. In a

recent study of 201 1 consecutive patients with MM. IgD and

1gM MM represented I .5 and 0.2% of the cases, respectively

(12). In the same study. 0.15% of IgG MMs presented with a

minor 1gM monoclonal component of the same light chain

isotype. These variants are characterized by the expansion of B

cells that have been frozen by one or several oncogenic events

in a stage of B-cell evolution earlier than that defining the IgG

and IgA malignant plasma cells. The examination of the V11

genes of such myeloma variants in terms of somatic mutations

should allow us to trace the clonal history in these exceptional

MM cases and may be informative for a more general under-

standing of the biology of MM. We thus investigated this point

in three IgD MMs. one 1gM MM. and one MM with a double

monoclonal (IgG and 1gM) component. This study demonstrates

that the heavy chain V region sequences of lgD and 1gM MM

are also heavily mutated and present no intracional diversity.

These findings are discussed with regard to current views on

normal B-cell development.

PATIENTS AND METHODSPatients. Samples of 1 1 cases of MM were obtained

during standard diagnostic procedures. Three patients had an

IgD (Eij. Dej. and Bou). one had an 1gM (Bar). and one had a

Research. on November 24, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

Table 1 Nucleotide sequence of primers used in PCR amplification

Primer’�

VH.L1

VH.L2+4

VH.L3

VH.L5VH.L6

VH.DIVH.D2

VH.D3VH.D4a

VH.D4b

VH.D5

VH.D6CaC�yC�

C1i.

Sequence (5 ‘ to 3’)

CATGGACTGGACCTGGAGG

ATGAAACACCTGTGGTTCTT

GGGCTGAGCCTGGGTTTTCCTT

GGGGTCAACCGCCATCCT

TCTGTCTCCTTCCTCATCTTC

CTCAGTGAAGGTCTCCTGCAAGG

CTGCGCTGGTGAAAGCCACACA

GGTCCCTGAGACTCTCCTGTGCA

GGAGACCCTGTCCCTCACCTGCA

GCTGTCTCTGGTTACTCCATCAG

GAAAAAGCCCGGGGAGTCTCTGAA

CTGTGCCATCTCCGGGGACAGTG

GCTCAGCGGGAAGACCTT

CAGGGGGAAGACCGATGG

CAGTTATCAAGCATGCCAG

AAAAGGGTTGGGGCGGATGC

2502 Somatic Mutations in IgD and 1gM Myeloma

a VH.LI toVH.L6, primers derived from the leader region of the

six VH families; VHDl to VH.D6, primers derived from the first FR

region of the six VH families.

double IgG and 1gM monoclonal protein (Del). Five IgG and

one IgA MM patients were also included in the study as a

control panel. Tumor samples were provided by bone marrow

aspirates (nine patients), from blood (one patient), or from a

biopsy of an extramedullary localization (cervical mass; one

patient). Mononuclear cells were obtained by Ficoli-Hypaque

(1.077 kg/liter; Pharmacia, Uppsala, Sweden) density centrifu-

gation.

Amplification of the Expressed Myeloma V� Gene.Total RNA was extracted by a guanidine isothyocyanate/acid-

phenol modified method with TRizol reagent (Life Technolo-

gies, Inc.) and reverse-transcribed in first-strand eDNA using

random hexamers and the SuperScript preamplification system

(Life Technologies, Inc.) according to manufacturer’ s recom-

mendations. A first set of primers, actin 1 (5’-TGCTATCCAG-

GCTGTGCTAT-3’) and actin 2 (5’-GATGGAGUGAAGG-

TAG1TI’-3’), was used as a control for the first-strand cDNA

synthesis. The Ig VH gene sequences were then amplified using

a consensus primer to the leader or the first FR region of the six

VH gene families (VH1-6) together with a constant region

primer, depending on the isotype of the myeioma clone (Table

1). The amplification reaction was performed with 1 p.1 of

first-strand cDNA in a 50-pA volume containing 1 mr�i Tris-HC1

(pH 8.3), 50 mM KCI, 2 mt�.i MgCl2, 200 mr�i deoxynucleotide

triphosphate, 15 pmoi of each primer, and 1.25 unit of Taq

polymerase (Life Technologies, Inc.). Each PCR cycle consisted

of 94#{176}Cheat denaturation for 30 s and primer annealing at 60#{176}C

for 30 5, followed by primer extension at 72#{176}Cfor 1 mm. The

first cycle was preceded by a 2-mm denaturation step at 94#{176}C,

and the last elongation step was prolonged to 10 mmto ensure

full-length products. Forty cycles were performed in a Perkin

Elmer GeneAmp PCR system (Perkin Elmer Corp., Zaventem,

Belgium). Ten p.1 of the PCR product were then electrophoresed

through an ethidium bromide-impregnated agarose gel and as-

sayed by exposure to UV light.

Cloning and Sequencing of the Expressed Myeloma VH

Gene. Gel-purified products of predicted size were blunt

end-ligated into pCR 2. 1 vector (Invitrogen Corp., San Di-

ego, CA) according to the manufacturer’s protocol. One-fifth

of the ligation mixture was used to transform One Shot

competent cells (Invitrogen), which were then plated onto

agar plates impregnated with ampicillin, kanamycin, and

X-Gal. Clones were purified using the Wizard plus Minipreps

DNA purification system (Promega, Madison, WI), and those

containing an insert of appropriate size by restriction analysis

of plasmid DNA were selected and sequenced using the

dideoxy chain termination sequencing procedure with a-35S-

labeled dATP (Amersham, Arlington Heights, IL) and the

Sequenase Version 2.0 DNA sequencing kit (United States

Biochemical Corp., Cleveland, OH) according to the manu-

facturer’ 5 instructions.

Statistical Analysis of Somatic Mutations within the

Expressed Ig VH Gene. The number of expected R mutations

in the CDRs and FRs was calculated according to the method of

Chang and Casali (13). The binomial distribution model was

applied to calculate whether the excess of R mutations in CDRs

and FRs resulted from chance or not.

RESULTSMyeloma Ig VH Gene Sequences. The expressed Ig VH

genes of three IgD, one 1gM, and one biclonal IgG and 1gM MM

were amplified by PCR using consensus primers to the leader or

the first FR of the six VH families together with consensus

primers to the constant heavy chain, depending on the isotype of

the myeloma clone (Table 2). In parallel, five IgG and one IgA

myeloma patients were studied as a control panel. For each

patient, only one V� family PCR product gave rise to a clonal

band of the appropriate size (450 bp) with PCR. Successful

amplification of the VH gene was achieved with the use of the

primers derived from the leader region of the six VH families in

nine cases but required the use of those derived from the first FR

in two cases (Dej and Zar). The PCR product was then purified

and cloned according to above-mentioned procedures. Twelve

independent clones were sequenced in each case. We first com-

pared the position ofthe thymidine nucleotides in the 12 isolates

(so-called T tracks). When at least three T tracks were found to

be identical, they were considered to have been derived from the

monoclonal population. Moreover, the nonidentical T tracks

were all different among them, representing residual normal B

cells. Among the IgD and 1gM MMs, the representation of the

VH family gene used by the myeloma clones was: VH2, 1 ; VH3,

2; and VH4, 1 . In the control panel, this representation was:

VH3, 3; VH4, 2; and VH6, 1 (Table 2). Concerning the biclonal

gammopathy (Del), the IgG clone belonged to the VH3 family,

whereas the 1gM clone belonged to the VH4 family, and the

CDR3 regions of the two clones were completely distinct,

demonstrating that the two clones originated from two different

myeloma precursor cells (Table 2). Thus, to facilitate and clarify

the following results, the biclonal gammopathy (Del) will be

referred to as one case included in the panel of IgG and IgA MM

and as another case included in the panel of IgD and 1gM MM.

except for particular observations.

Quantitation of Somatic Mutations and Lack of Intra-

clonal Diversity The sequences obtained from the 1 1 MM

patients were submitted to the European Molecular Biology



Clinical Cancer Research 2503

Table 2 Comparative analysis of the V11 gene between th e cohort of IgD and Ig M and the cohort of IgG and IgA MM patients

SM (%)�

Patient Ig type V1� family MM seq” Total FR CDR

EijDejBouBarDelMeanDelVanChaVpi

MonZahLai

Mean

IgDIgDIgD1gM1gM

IgGIgGIgGIgG

IgGIgGIgA

VH4

V112V113VH3V04

V113V114V1�3VH6

VH4V03V1�3

10

768983333

333

9.46.2

17.768.69.65.48.16.56.3

5.89.7

10.97.5

8.33.2

1 13.45.76.33.55.73.15.3

5.36.775.2

131340.915.91920.412.115.918.29.3

7.918.224.215.1

(I MM seq. the number of myeioma clones sequenced.I, SM (%), the percentage of nucleotides with mutation in comparison with the most homologous germ-line genes.

Laboratory database.4 When the myeloma V� gene sequences

were compared with currently known best-matching germ-line

sequences. a significant number of bp substitutions were noted.

In the IgD and 1gM MM cohort, the somatic mutation rate was

9.6% of the nucleotides, ranging from 6-17.7%, whereas this

rate was 7.5% in the IgG and IgA cohort (ranging from 5.4-

10.9%: Table 2). A particularly high number (17.7%) of somatic

mutations were found in patient Bou (1gM). Moreover, in the

case of the biclonal gammopathy (Del), the 1gM V11 gene

presented a nucleotide mutation rate higher than that of the IgG

VH gene (8.6 versus 5.4%). The high mutation frequencies of

the VH genes of the IgD and 1gM MMs thus matched that noted

in IgG and IgA MMs (i-6).� When analyzing the percentage of

nucleotide changes within the FRs and the CDRs, the nucleotide

mutation rates were 6.3 (3.2-1 1%) and 20.4% (13-40.9%),

respectively. and were similar to those observed in the cohort of

IgG and IgA MMs (Table 2). In the particular case of the

biclonal gammopathy, the IgG and the 1gM VH genes showed a

nucleotide substitution rate of 3.5 and 5.7% in the FRs and 12.1

and 19% in the CDRs, respectively (Table 2). Absence of

intraclonal diversity has already been extensively demonstrated

for the IgG and IgA MMs (1, 5, 6). Thus we did not repeat the

experiments for our own cohort. On the other hand, we se-

quenced an average of 8 clones (6-10) per patient of the IgD

and 1gM MM panel (Table 2) and did not identify intraclonal

diversity in any subtype (data not shown).

Evidence for Prior Antigenic Selection. To find out

whether the myeloma clones have undergone antigenic selection

or not, we then analyzed the type (R or S) and location (FR and

CDR) of the nucleotide substitutions. We only considered nu-

cleotide exchanges that had occurred in the region of the cDNA

molecule encoded by the VH gene itself (the FRI to FR3

region). The rationale for this is that at the VH-D-JH junction, it

4 Accession numbers Y08259, Y0840l to Y08408, Y08428, Y08429.

and Y08732.5 N. Juge-Morineau, unpublished observations.

is difficult to accurately distinguish between nucleotide varia-

tions introduced by the recombination process and those intro-

duced by somatic mutations. The ratios aa-R versus aa-S

(aa-R:S) in both FRs and CDRs were then calculated in each

case. Moreover, we calculated the probability that the observed

R and S mutations could have occurred at random (see “Patients

and Methods”). This kind of analysis performed on our cohort of

IgG and IgA MM patients provided results similar (data not

shown) to those previously reported by Veschio ci al. (5), i.e.,

the myeloma clone sustained strong antigenic selection pressure

in these subtypes. Moreover, we excluded patient Dej from this

latter analysis, because we did not have the complete sequence

of the VH gene in this case (i.e. , failure of the V11 leader family

PCR). Although it was not expected that the missing part of the

FR1 contained a number of mutations that might significantly

change the results of calculation, we preferred to exclude this

case from the analysis. Therefore, the mean FR and CDR R:S

ratios were 1 .67 and 2.57, respectively. The difference did not

reach a statistical significance, given the small number of pa-

tients. Only one 1gM patient (Bar) presented a CDR R:S ratio of

4, whereas this value remained below 2.9 in the three other cases

(data not shown). In three of the sequences, the number of R

mutations seen in the CDRs was larger than that expected by

chance, and the values were statistically significant in two cases

(Table 3 and Fig. 1 ). These findings strongly suggest that the

myeioma clone has sustained strong antigenic selection pressure

in IgD and 1gM MM. Considering the FR regions, the number of

R mutations was always lower than that expected by chance,

with a significant P value in three of four cases (Table 3 and

Fig. 1).

DISCUSSIONThe detection of somatic mutations within the Ig VH genes

of B-cell tumors turned out to be a very elegant and reliable

method to answer the question of whether these tumors derived

from naive pregerminal B-cells or from germinal center-derived

memory B-cells. With this approach, somatic mutations in the Ig

VH gene have been detected in follicular lymphomas (7, 8),



Table 3 Analysis of R mutations in the VH gene sequence of MM patients

Expected R values were calculated as described in “Patients and Methods.”

randomly.


FR CDR

Obs Exp PCObs” Exp” PC

El Jatt 12 15.8 0.052 6 7.04 0.15

Bou 17 30.8 0.000063 20 12.17 0.000216

Bar 5 10.8 0.00410 8 3.67 0.00323

Del 7 14.12 0.00273 7 6.108 0.098

a Obs, observed.b Exp, expected.C For each patient, P represents the likelihood that the observed R mutations within the FRs and the CDRs of the Ig VH gene have occurred

FRi CDR1 FR2 CDR2 FR3

DP-64 QLQLQESGSGLVKP�FLSL’FCAVSGGSIS SGGYSWS WIRQPPGKGLEWIG YIY}ISGSTYYNPSLKS RVTISVDRSKNQFSLKLSSVTAAU�AVYYCAR

ELI . .R A. .T D. . . .DA.s.N g g .iS.G. . N . .s L. ‘114 N1K.At v.. .5

DP-46 �.TQLVmGGGWQPGRSLRLSCAASGF’FFS SYIiMH t’NRQAPCKGLE’.4VA VISYDGSNXYYADSVKG RF’rISRDNSKNTLYLQMNSLRAEtYI’AVYYCAR

Bo*.i . .g. . ag. .I.SgT. . . .T N.N YFV.V p a S.sS. .DR.t.tyaN. .G. .V.L. .V.FR. MS. . .D. .GPD. ..v.. . .r

YAC9 EVQLVESGGGLVQPOGSLKLSCAASGVFFS GSAMH WVRQSSGKGLEWVG RIRSKANSYATAThAS VKGRrrISRDDSK�TrAYL�t.1NSLKTEUrAVYYCTR

BAR A D.TL. ST. . .N. . .T.G 1TA. . . .v. . .F.

DP71 Q5TQLQ�GPGLVKPSETLSLTCIVSGGSIS SYYWS WIRQPPCKGLEWIG YIYYSGS’IWYNPSLKS RVTISVUJ’SKNQFSLKLSSVTAAIYrAVYYCAR

DEL . .H S MN sF’y.N .V g .iFy.gI R a n. . . ks. . .T. .t.L

Fig. 1 Deduced aa sequences of the VH regions of IgD and 1gM MM. A comparison was made with the most homologous germ-line VH gene. Thesingle-letter aa code is used. Homology is indicated by points. Uppercase letter, replacement mutation; lowercase letter, silent mutation.

Hodgkin’s disease of B-cell phenotype (14) and WaldenstrOm

disease (15). On the other hand, few or no mutations have been

detected in B-acute lymphoblastic leukemia (16), common

B-chronic lymphocytic leukemia (16, 17), large cell lymphoma

(18), and mantle cell lymphoma (19). MM is a B-cell malig-

nancy characterized by the accumulation of malignant plasma

cells inside the bone marrow. In this cancer, there is a contro-

versy about the nature of the myeloma stem cell, i.e. , the normal

counterpart in which the neoplastic transformation does occur: a

naive B cell (or even pre-B cell) or a memory B cell (or

migrating plasmablast). To solve this question, several studies

have been devoted to the search of somatic mutations within the

Ig VH genes of malignant plasma cells (1-6). Because IgG and

IgA MMs represent up to 84% of the patients ( 12), only these

usual types have been investigated. From these studies, evidence

has been obtained that myeloma Ig VH genes contain somatic

mutations but show no intraclonal variation. The amount of

somatic mutations does not differ between IgG and IgA MM (5).Taken together, these findings thus prove that the myeloma stem

cell has passed through the germinal center and is no longer

exposed to the somatic mutation process. Moreover, the analysis

of the number of mutations accumulated in the Ig VH gene and

of the type (R or 5) and location (FR or CDR) of these mutations

has provided evidence that the myeloma clone passed through a

stage of secondary or tertiary positive antigenic selection on the

basis of production of a functional Ig with high antigenic bind-

ing affinity (5, 20). Until now, the status of IgD and 1gM rare

variants has never been studied in terms of the presence (or

absence) of somatic mutations in the Ig VH genes. In the current

study, we show that three IgD MMs and two 1gM cases have

accumulated somatic mutations within their Ig genes at a rate

similar to that observed in our cohort of IgG and IgA cases, and

no intraclonal diversity could be identified. Moreover, proof that

the myeloma clone has sustained antigen selection pressure has

been provided in two cases. Taken together, these data suggest

that also in IgD and 1gM MM, the oncogenic event takes place

in a germinal center-derived B cell that is no longer exposed to

the somatic mutation process or able to undergo further isotype

switching in vivo. Our data are reminiscent of those obtained in

patients with Waidenstrdm’s macroglobulinemia (i.e. , 1gM

types), in whom the presence and the pattern of mutations

suggest that in this disease, tumor cells are also derived from B

cells that have been selected by antigen (15). Our findings are

not in disagreement with what is presently known about the

switch of Ig genes and the pooi of memory B cells (21, 22).

Indeed, it is now clear that the isotype switch and the somatic

mutation process are two independent events that are triggered

sequentially during germinal center reaction (23, 24), with the

isotype switch taking place during the transition from IgD+ B

cells to IgD- germinal center centrobiasts (25, 26). Moreover,



Clinical Cancer Research 2505

the isotype switch does not terminate the somatic mutation

process (26-28). Although B cells carrying 1gM or IgD con-

tribute little to the memory pool (in comparison with those

carrying IgG or IgA; Ref. 21), highly mutated IgD+ or IgM+

normal B cells exist (21, 24, 28-31). Mutated 1gM-bearing B

cells may represent a population of memory B cells that, perhaps

because of the nature of the antigenic stimulus and/or T-cell

help, have not received the signal to undergo isotype switching

(23) or could undergo further mutation and isotype switching on

antigenic restimulation (28). Therefore, the oncogenic event

leading to the emergence of 1gM MM is likely to take place in

this normal counterpart and may also contribute to prevent the

cells from undergoing further isotype switching. Until recently,

IgD was shown to only be expressed together with 1gM on the

surface of naive mature B cells. Now, a novel subset of germinal

center B cells defined by a sIgM-IgD+CD38+ phenotype has

been described that has accumulated a high number of mutations

within its Ig VH genes (29). Therefore, these cells could repre-

sent the normal counterpart of IgD MM. Because the isotype

switch does not terminate the somatic mutation process (28), it

was of interest to compare the amount of somatic mutations

among the IgD, 1gM, IgG, and IgA cases. However, no differ-

ences in terms of the number of somatic mutations accumulated

within the Ig VH genes have been detected in IgD and 1gM MM

when compared with the IgG and IgA subtypes. Again, these

findings are not in disagreement with our current knowledge on

the somatic mutation process in normal B cells, including mu-

tated IgD and 1gM normal B lymphocytes. Finally, another point

addressed by this study is the accurate definition of biclonal

MM. Indeed, this term is usually used to define rare MM cases

in which a double component with the same light chain is

identified by immunoelectrophoresis and therefore covers two

different entities. Indeed, whereas in some cases, the two clones

will share the same VDJ sequence, thus reflecting the same

precursor cell origin, other cases, such as the one described in

this study, represent a disease in which both clones evolved

from two different precursor cells. Molecular analysis of bi-

clonal MM as defined by the electrophoresis profile would

allow us to discriminate between these two possibilities and

should provide precious information for a better understanding

of MM biology.

In conclusion, this study illustrates that IgD and 1gM rare

variants derive from a preswitched memory B cell that has

passed through a stage of positive antigenic selection and is no

longer exposed to the somatic mutation process or able to

undergo further isotype switching in vivo.

ACKNOWLEDGMENTSWe thank the participants of BIOMED program No. PL931407 for

fruitful discussion and critical reading of the manuscript.

REFERENCES

I. Bakkus, M. H. C., Heirman, C., Van Riet, I., Van Camp, B., andThielemans, K. Evidence that multiple myeloma Ig heavy chain VDJ

genes contain somatic mutations but show no intraclonal variation.

Blood, 80: 2326-2335, 1992.

2. Ralph. Q. M., Brisco, M. J., Joshua, D. E., Brown, R., Gibson, J., andMorley. A. A. Advancement of multiple myeioma from diagnosis

through plateau phase to progression does not involve a new B-cell

clone: evidence from the Ig heavy chain gene. Blood, 82: 202-206,

1993.

3. Sahota, S., Hamblin, T., Oscier, D. 0., and Stevenson, F. K. Assess-ment of the role of clonogenic B lymphocytes in the pathogenesis ofmultiple myeloma. Leukemia (Baltimore), 8: 1285-1289. 1994.

4. Takishita, M., Kosaka, M., Goto, T., and Saito, S. Cellular origin and

extent of cional involvement in multiple myeioma: genetic and pheno-typic studies. Br. J. Haematoi., 87: 735-742, 1994.

5. Vescio, R. A.. Cao, J., Hong, C. H., Lee, J. C., Wu, C. H., Der

Danielian, M., Wu, V., Newman, R., Lichtenstein, A. K., and Berenson,

J. R. Myeloma Ig heavy chain V region sequences reveal prior antigenicselection and marked somatic mutation but no intraclonal diversity.

J. Immunoi., 155: 2487-2497, 1995.

6. Sahota, S. S., Leo, R., Hamblin, T. J., and Stevenson, F. K. Ig VH

gene mutational patterns indicate different tumor cell status in human

myeloma and monoclonal gammopathy of undetermined significance.

Blood, 87: 746-755, 1996.

7. Meeker, T., Lowder, J., Cleary, M. L., Stewart, S., Wamke, R., SkIar,J., and Levy, R. Emergence of idiotype variants during treatment ofB-cell lymphoma with anti-idiotype antibodies. N. EngI. J. Med., 312:

1658-1665. 1985.

8. Bahier, D. W., and Levy, R. Clonal evolution of a foilicular lym-

phoma: evidence for antigen selection. Proc. Nail Acad. Sci. USA, 89:

6770-6774, 1992.

9. Biliadeau, D., Ahmann, G., Greipp, P., and Van Ness, B. The bone

marrow of multiple myeioma patients contains B cell populations at

different stages of differentiation that are clonaily related to the malig-

nant plasma cell. J. Exp. Med., 178: 1023-1031, 1993.

10. Corradini, P., Boccadoro, M., Voena, C., and Pileri, A. Evidence fora bone marrow B cell transcribing malignant plasma cell VDJ joined to

Cii. sequence in immunoglobulin (IgG-) and IgA-secreting multiple

myelomas. J. Exp. Med.. 178: 1091-1096, 1993.

I I . Bakkus, M. H. C., Van Riet, I., Van Camp, B.. and Thielemans, K.Evidence that the cionogenic cell in multiple myeloma originates froma pre-switched but somatically mutated B cell. Br. J. Haematol., 87:

68-74, 1994.

12. MacLennan, I. C. M. In which cells does neopiastic transformation

occur in myeiomatosis? Curr. Top. Microbiol. Immunol., 182: 209-213,

1992.

13. Chang. B., and Casali, P. The CDRI sequences of major proportion

of human germline Ig VH genes are inherently susceptible to aminoacidreplacement. Immunol. Today, 15: 367-373, 1994.

14. Tamaru, J. I., Hummel, M., Zemlin, M., Kalvelage, B., and Stein,

H. Hodgkin’s disease with a B-cell phenotype often shows a VDJrearrangement and somatic mutations in the VH genes. Blood, 84:

708-715. 1994.

15. Aoki, H.. Takishita, M., Kosaka, M., and Saito, S. Frequent somatic

mutations in D and/or �H segments of Ig gene in Waldenstrdm’s mac-rogiobulinemia and chronic lymphocytic leukemia (CLL) with Richter’s

syndrome but not in common CLL. Blood, 85: 1913-1919. 1995.

16. Bird, J., Galili, N., Link, M., Stites, D., and Skiar, J. Continuingrearrangement but absence of somatic hypermutation in immunoglobu-

lin genes of human B cell precursor leukemia. J. Exp. Med., 168:229-245, 1988.

17. Rassenti, L. Z., and Kipps, T. J. Lack of extensive mutations in the

VHS genes used in common B cell chronic lymphocytic leukemia. J.Exp. Med., 177: 1039-1046, 1993.

18. Stiernhoim, N., Kuzniar, B., and Bernstein, N. L. Absence ofimmunogiobulin variable region hypermutation in a large cell lym-phoma after in vito and in vitro propagation. Blood, 80: 738-743, 1992.

19. Hummel, M., Tamaru, J., Kalvelage, B., and Stein, H. Mantle cell(previously centrocytic) lymphomas express VH genes with no or very

little somatic mutations like the physiologic cells of the follicle mantle.Blood, 84: 403-407, 1994.

20. Bye. J. M.. Carter. C.. Cui. Y.. Gorick, B. D., Songsiviiai. S..Winter, G., Hughes-Jones, N. C., and Marks, J. D. Germline variable




region gene segment derivation of human monocional anti-Rh (D)antibodies. J. Clin. Invest., 90: 2481-2490, 1992.

21. Gray, D. Immunological memory. Annu. Rev. Immunol., 11. 49-77, 1993.

22. MacLennan, I. C. M. Germinal centers. Annu. Rev. Immunol., 12:

117-139, 1994.

23. Van Es, J. H., Gmelig Meyling, F. H. J., and Logtenberg, T. Highfrequency of somatically mutated 1gM molecules in the human adultblood B cell repertoire. Eur. J. Immunol., 22: 2761-2764, 1992.

24. Liu, Y. J., Malisan, F., de Bouteiller, 0., Guret, C., Lebecque, S.,Banchereau, J., Mills, F. C., Max, E. E., and Martinez-Valdez, H.Within germinal centers, isotype switching of immunoglobulin genesoccurs after the onset of somatic mutation. Immunity. 4: 241-250. 1996.

25. Berek, C., Berger, A., and Apel, M. Maturation of the immune

response in germinal centers. Cell, 67: 1 121-i 129, 1991.

26. Pascual, V., Liu, Y. J., Magalski, A., de Bouteiller, 0., Banchereau,J., and Capra, J. D. Analysis of somatic mutation in five B cell subsetsof human tonsil. J. Exp. Med., 180: 329-339, 1994.

27. Shan, H., Shlomchik, M., and Weigert, M. Heavy-chain classswitch does not terminate somatic mutation. J. Exp. Med., 172: 531-

536, 1990.

28. Varade, W. S., and Insel, R. A. Isolation of germinal centerlike

events from human spleen RNA. Somatic hypermutation of a clonallyrelated VHDJH rearrangement expressed with 1gM, IgG. and IgA. J.

Clin. Invest., 91: 1838-1842, 1993.

29. Liu, Y. J., de Bouteiiler, 0., Arpin, C., Briere, F., Galibert, L., Ho,S., Martinez-Valdez, H., Banchereau, J., and Lebecque, S. Normalhuman IgD�IgM germinal center B cells can express up to 80 muta-tions in the variable region of their IgD transcripts. Immunity, 4:

603-613, 1996.

30. Insel, R. A., Varade, W. S., and Mann, E. Human splenic 1gMimmunoglobulin transcripts are mutated at high frequency. Mol. Immu-

nol., 31: 383-392, 1994.

31. Klein, U., KUppers, R., and Rajewsky, K. Evidence for a largecompartment of 1gM-expressing memory B cells in humans. Blood, 89:

1288-1298, 1997.



1997;3:2501-2506. Clin Cancer Res N Juge-Morineau, C Heirman, M Bakkus, et al. heavily mutated.Immunoglobulins D and M multiple myeloma variants are

Updated version

http://clincancerres.aacrjournals.org/content/3/12/2501

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/3/12/2501To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



immunoglobulins d and m multiple myeloma variants are ... · immunoglobulins d and m multiple...

Documents