functional analysis of two prunus dulcis cbfs by...
Post on 06-Dec-2020
6 Views
Preview:
TRANSCRIPT
UNIVERSIDADE DE LISBOA
FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA VEGETAL
FUNCTIONAL ANALYSIS OF TWO PRUNUS DULCIS CBFS
BY OVEREXPRESSION IN A. THALIANA AND ANALYSIS OF
SEASONAL EXPRESSION IN FIELD PLANTS
Nuno Miguel Loureiro Gonçalves
Mestrado em Biologia Celular e Biotecnologia
2011
b
UNIVERSIDADE DE LISBOA
FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA VEGETAL
FUNCTIONAL ANALYSIS OF TWO PRUNUS DULCIS CBFS
BY OVEREXPRESSION IN A. THALIANA AND ANALYSIS OF
SEASONAL EXPRESSION IN FIELD PLANTS
Nuno Miguel Loureiro Gonçalves
Orientador Externo: Prof. Doutora Maria Margarida Oliveira (Laboratório de Genómica de
Plantas em Stress - GPlantS, Instituto de Tecnologia Química e Biológica - ITQB).
Orientador Interno: Prof. Doutora Helena Trindade (Centro de Biotecnologia Vegetal - IBB,
Faculdade de Ciências da Universidade de Lisboa).
Mestrado em Biologia Celular e Biotecnologia
2011
i
Agradecimentos
Os últimos anos têm sido de revoltas mudanças no meu percurso profissional, incluindo
uma desistência forçada e depois revogada, e o trabalho efectuado durante a duração deste
estágio foi crucial para o delineamento de novos caminhos a seguir. Com a convicção,
conhecimento e humildade que ele me proporcionou para meu futuro no conturbado e aliciante
mundo da investigação científica.
Em primeiro lugar tenho de agradecer profundamente à Professora Margarida Oliveira
por me ter recebido no seu laboratório, mesmo numa altura em que não estavam a ser aceites
alunos de mestrado. Durante o ano curricular defini para mim próprio que esta seria a área que
mais prazer me daria em ser integrado e dificilmente encontraria em Portugal um melhor
laboratório para tal. Por isso um muito obrigado pela confiança depositada e por permitir que
eu, absolutamente inexperiente, me fosse desenvolvendo gradualmente até chegar agora a um
ponto em que me sinto preparado para enfrentar todos os desafios que aí virão.
Em segundo lugar, quero fazer uma vénia de duração embaraçosa ao Pedro Barros, o
meu mentor absoluto durante este quase ano e meio. Por tudo. Pela paciência demonstrada
desde o início, quando até os problemas mais básicos eram inultrapassáveis, até à elaboração
desta tese, processo longo e também ele minado de inseguranças e falhas. Por confiar sempre
em mim num trabalho que também era dele, mesmo quando eu próprio tinha duvidas das
minhas capacidades. Por me informar cada dia de coisas que nunca soube descobrir
anteriormente. Finalizando, por me acompanhar com rigor e amizade em todos os passos que
fui dando e ter sido imensurávelmente determinante no desenvolvimento do discernimento
científico.
A todos os restantes membros do GPlantS outro agradecimento crucial. Todos
conhecemos histórias de terror sobre picardias entre colegas de laboratório, mas se fosse este
o meu único exemplo juraria que tal era impensável. O ambiente de companheirismo e entre-
ajuda criado foi essencial para que eu cometesse erros e soubesse lidar com eles, para
ultrapassar os problemas que inevitavelmente surgiam com uma perspectiva não auto-
destrutiva. Porque sempre que precisava havia alguém disposto a socorrer-me de imediato,
actos de raro altruísmo neste meio. E para além disso a amizade e galhofa nos tempos devidos
que mantiveram sempre a vontade do regresso no dia seguinte. Um abraço e beijo particulares
ao Duarte e à Mafalda por me ajudarem até antes do início.
ii
Uma 'beijufa' gargantuana à Inês Trindade, fada-madrinha e orientadora muito
responsável pelo meu caminho académico desde o relvado do C8 em 2003 até agora. 8 anos.
Nem dá para acreditar Obrigado a ela, pelos cafés, jantares e muitas outras ocasiões de
aconselhamento profissional e psicológico, e também à Mara Alves, por me ajudarem em
tempos de indecisões, sempre em estado de profundo pânico.
Na FCUL um obrigado à Professora Helena Trindade, que me acompanhou desde o
inicio da licenciatura, por ter aceite ser a minha orientadora interna e por sempre se mostrar
interessada pelo trabalho que estava a desenvolver. Um grande abraço a todos os meus
colegas de mestrado da FCUL com particular ênfase ao André, ao Nuno e à Susana, e, ainda
mais forte, à Ana Margarida, outro inesgotável exemplo de bondade e amizade. E à Twig
também, não me posso esquecer dela, especialmente a escorregar de botas de salto alto por
essas ruas de Lisboa abaixo. Um beijo enorme.
To PJ. Tudo o que eu possa escrever é insignificante e insuficiente. Ajudaste a definir
quem sou hoje de formas inimagináveis e indescritíveis e sei que me tornei numa pessoa
completa, confiante e esperançosa, totalmente graças a isso. Obrigado. Muito obrigado. Agora.
E até ao fim. 'In my dreams it feels like we are forty stories tall, when you're around we're
untouchable'.
E finalmente, e sempre em primeiro, aos meus pais. Por sempre me amarem
incondicionalmente, apoiarem-me nos piores momentos e se orgulharem de mim nos melhores.
Nem nos anos perdidos de deambulação perderam a esperança nas minhas capacidades, que
me fez a mim acreditar nelas também. Amo-vos mais do que alguma vez vos conseguirei dizer.
iii
List of abbreviations
#1, #2, #3 Almond field trees + Positive control 5AC 5-aza-2'-deoxycytidine bp Base pairs CBF CRT-binding factor cDNA Complementary DNA CEF Cefotaxime Col-0 Arabidopsis thaliana Columbia ecotype COR Cold-regulated CRT C-repeat responsive element DAG Days after germination DAM Dormancy-associated MADS-box DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid DRE Dehydration responsive element DREB DRE-binding factor g, mg, μg, ng Gram, miligram, microgram, nanogram GA Bioactive gibberellins GA3 Gibberellic acid HA Hemaglutinin tag L, mL, μL Liter, mililitre, microlitre M, mM, μM Molar, milimolar, micromolar MA Arabidopsis thaliana growth medium mA Miliamper MG132 Z-Leu-Leu-Leu-al min Minutes NaCl Sodium Chloride ºC degree Celsius ox Oxidase PCR Polymerase chain reaction PEB Protein extraction buffer PPT Phosphinothricin PVDF Polyvinylidene fluoride QTL Quantitative Trait Loci RdDM RNA-directed DNA methylation RNA Ribonucleic acid RT Room temperature RT-PCR Semi-quantitative reverse transcriptase PCR SD Short-day photoperiod SI Gametophytic self-incompatibility siRNA Small interference RNA T0, T1, T2, T3 Generations of transgenic lines Taq Thermus aquaticus DNA polymerase TF Transcription factor TGS Transgene silencing V Volts vol Volume WT Wild-type
iv
ABSTRACT
Flowering in woody perennials, in opposition to annual/biennial plants, are heavily
dependent on cold acclimation, acquired during the dormancy stage of their seasonal
development. The ability to endure low temperatures is essential to the chilling requirements
required for dormancy break and to resume growth. In temperate fruit trees of the Rosaceae
family, the blooming time is crucial for breeders, as premature anthesis exposes flowers to
winter frosts thus affecting fruit production. Almond (Prunus dulcis) belongs to the Prunoideae
subfamily and is a good model for studies regarding these aspects of dormancy break and
blooming as it is the tree of this family that flower earlier. Its close homology to the recently
sequenced genome of peach (Prunus persica) also facilitates molecular research focused on
these traits, still largely based on the annual plant model Arabidopsis. In this thesis we have
investigated the putative involvement of two novel almond genes in the regulation of flowering
time. These genes, PrdCBF1 and PrdCBF2, are known to be regulated by low temperatures
during dormancy and they belong to a large family of transcription factors known as
CBF/DREB1 (C-REPEAT (CRT)/DEHYDRATION RESPONSIVE ELEMENT (DRE)-BINDING
FACTORS). They are activated during periods of low temperature induced stress and bind to
CRT domains of promoters of cold-regulated (COR) genes, which provide protection against
freezing damage.
Functional studies were conducted through overexpression of PrdCBF1 and PrdCBF2 in
Arabidopsis thaliana, to investigate protein variation and stability under several different
treatments, as well as analyzing transcript accumulation of transgenes and endogenous genes
involved in cold response (AtCBF1, AtXero2 and AtCOR15a (both COR genes), as well as
AtRD29A) or related to the gibberellin growth-induction pathway (AtGA20ox1 and AtGA2ox3).
We were able to prove that constitutively expressed PrdCBF2 activates Arabidopsis genes
related to cold acclimation and provides enhanced protection against freezing damage in
transgenic plants in comparison to non-acclimated plants. Some difficulties encountered when
handling the transgenic lines also allowed characterization of the dwarf phenotype obtained and
the growth retardation pattern induced by CBF overexpression, as well as the transgene
silencing triggered by DNA methylation.
Additionally, we studied PrdCBFs expression during seasonal development in field trees,
and analyzed the downstream gene PrdDHN1, a COR gene that belongs to the dehydrin protein
family, as well as several genes related to flowering and growth induction, such as genes
v
encoding MADS-box proteins (PrdMADS1 and PrdMADS3) and gibberellin pathway enzymes
(PrdGA20ox and PrdGA2ox). The results obtained provided evidence of the PrdCBFs
upregulation during early to mid-winter periods of dormancy and cold acclimation and their
downregulation relating to deacclimation after dormancy break. New putative markers
(PrdMADS3, PrdGA2ox and PrdGlyc) for dormancy break and transitioning to blooming time
also emerged, which may become novel players in a model of regulation of perennial dormancy.
Additionally, these markers may further be applied in detection of differential blooming time
cultivars in breeding programs as well as to serve as indicators of dormancy break in more
mature trees.
vi
RESUMO
As árvores perenes, ao contrário das plantas anuais ou bienais, dependem da
aclimatação ao frio adquirida durante a fase de dormência do desenvolvimento sazonal. A
capacidade de resistir a temperaturas baixas é essencial para atingir os requisitos de frio da
planta, ou seja, o total de horas de exposição a baixas temperaturas necessário para a quebra
da dormência e a re-activação do crescimento. Em árvores de fruto de climas temperados da
familia Rosaceae, o tempo de floração é crucial para os agricultores já que a ântese prematura
aumenta a probabilidade de exposição à geada, o que naturalmente compromete a viabilidade
das flores e a produção final do fruto. A amendoeira (Prunus dulcis), pertencente à subfamilia
Prunoideae, é um bom modelo para estudos que se debruçam sobre aspectos relacionados
com a quebra da dormência e com a floração, visto ser a primeira árvore fruteira desta família a
florir. A homologia com o pessegueiro (Prunus persica), cujo genoma foi recentemente
sequenciado, permite o desenvolvimento de estudos a nível molecular focados nestas
características, até à data ainda fundamentados num modelo herbáceo e de ciclo de vida
anual, a Arabidopsis. Desta forma investigamos a possível ligação entre dois genes de
amendoeira e a dormência e o tempo de floração. Estes genes, PrdCBF1 e PrdCBF2
(reconhecidos pela sua regulação por baixas temperaturas), pertencem a uma vasta família de
factores de transcrição conhecida como CBF/DREB1 (C-REPEAT (CRT)/DEHYDRATION
RESPONSIVE ELEMENT (DRE)-BINDING FACTORS). Estes genes são activados durante
periodos de stress de frio e ligam-se a domínios CRT dos promotores de genes regulados pelo
frio (COR), que protegem a planta contra danos fisiológicos relacionados com a congelação
intercelular.
Foram efectuados estudos funcionais pela sobrexpressão de PrdCBF1 e PrdCBF2 em
Arabidopsis thaliana para investigar possíveis variações de expressão das proteínas e da sua
estabilidade sob diferentes tratamentos. Também se procedeu à análise da acumulação de
transcrito destes transgenes e de genes endógenos envolvidos na resposta ao frio (AtCBF1,
AtXero2 e AtCOR15a - ambos genes COR, bem como o AtRD29A) ou relacionados com a via
de sinalização de crescimento mediada por giberelinas (AtGA20ox1 d AtGA2ox3). Foi provado
que a expressão constitutiva em Arabidopsis de PrdCBF2 activa genes relacionados com a
aclimatação ao frio, os quais promovem a protecção contra os danos de congelação em plantas
transgénicas comparativamente a plantas não aclimatadas. Algumas dificuldades que surgiram
durante a selecção de linhas transgénicas levou também à caracterização do fenótipo anão
vii
obtido, bem como da repressão do crescimento devidos à sobrexpressão de genes CBF. Foi
igualmente estudado o silenciamento de transgenes desencadeado por metilação de DNA.
Simultaneamente foi feito o estudo de expressão dos PrdCBFs durante o
desenvolvimento sazonal de plantas de campo. Também analizámos a expressão de
PrdDHN1, um gene COR a jusante dos CBFs e pertencente à família proteica das desidrinas,
assim como outros genes relacionados com a floração e indução de crescimento, tais como
genes codificantes de proteínas MADS-box (PrdMADS1 e PrdMADS3) e de enzimas da via das
giberelinas (PrdGA20ox and PrdGA2ox). Os resultados obtidos demonstraram um aumento de
expressão dos PrdCBFs durante os períodos de dormência e aclimatação ao frio nos primeiros
meses de Inverno, bem como uma diminuição após a quebra de dormência. Neste trabalho são
sugeridos para os genes PrdMADS3, PrdGA2ox e PrdGlyc como novos marcadores putativos
das fases de quebra de dormência e transição para a ântese para a formulação de um modelo
de dormência em plantas perenes. Estes marcadores podem também ser aplicados na
detecção de cultivares com diferentes tempos de floração em programas de melhoramento,
bem como servir de indicadores de quebra de dormência em árvores maduras.
1
TABLE OF CONTENTS
Agradecimentos ........................................................................................................................ i
List of abbreviations ................................................................................................................iii
ABSTRACT ...............................................................................................................................iv
RESUMO ...................................................................................................................................vi
TABLE OF CONTENTS .............................................................................................................1
GENERAL INTRODUCTION ......................................................................................................3
Almond ...................................................................................................................................5
Botanical description ................................................................................................................................... 5
Origin and evolution ..................................................................................................................................... 6
Economic importance .................................................................................................................................. 7
Flowering and its molecular basis ............................................................................................................... 8
Seasonal development in perennials .................................................................................10
Molecular basis of cold acclimation...................................................................................11
CHAPTER ONE: Functional analysis through overexpression in A. thaliana ....................13
Introduction .........................................................................................................................15
Cold stress and induction of CBF transcription factors ............................................................................ 15
CBF overexpression and connection to the gibberellin pathway .............................................................. 17
Circadian clock and light regulation .......................................................................................................... 18
Transcriptional regulation .......................................................................................................................... 18
Post-transcriptional and post-translational regulation .............................................................................. 19
Material and Methods ..........................................................................................................23
Results .................................................................................................................................31
Discussion ...........................................................................................................................51
CHAPTER TWO: Seasonal Expression in Field Plants ........................................................57
Introduction .........................................................................................................................59
Dormancy ................................................................................................................................................... 59
Chilling Requirements and Cold Acclimation ............................................................................................ 60
Flowering .................................................................................................................................................... 62
Material and Methods ..........................................................................................................65
Results .................................................................................................................................69
Discussion ...........................................................................................................................79
FINAL CONCLUSIONS ............................................................................................................87
REFERENCES .........................................................................................................................89
APPENDIX ................................................................................................................................. I
2
3
GENERAL INTRODUCTION
4
5
Almond
Botanical description
The cultivated almond tree, Prunus dulcis (Miller) D. A. Webb, grows up to about 5 to 12
meters high, possessing a strong root system. Leaves are oval with a pointed apex and 1 year
old shoots vary from light green to a more brownish tone, coinciding with vegetative and flower
bud development. Generally, fruit trees have a considerable juvenile phase that lasts several
years, in which there is no flower development. In almond, the juvenile period lasts three or four
years after germination and upon reaching the reproductive phase they start developing fruits
(Silva, 2005). In adult trees, flower buds are born laterally along leaf axils on long and spur
shoots. Floral meristems are usually distinguished from vegetative meristems by their larger
fuller size and are responsible for the initiation of four whorls of floral organs - sepals, petals,
stamens and carpels (Coen et al., 1993). Flowers are white or pink with entomophilous
pollination. Flower initiation beings around July or August and flower buds enclose a single spur,
being the flower hermaphrodite with five fused sepals, five petals, one carpel with two ovules
and a variable number of stamens. The fruit is a drupe with a green velvety non-edible exocarp
covering the plump mesocarp which encloses the endocarp or shell (Oliveira et al., 2008).
Although there are two ovules in each carpel, only one develops correctly following anthesis and
the other is arrested and remains immature (Rodrigo and Herrero, 1998). Nevertheless double
kernels formation still happens under genotypic and environmental cues such as low
temperatures surrounding blooming time, being the early bloomers the ones connected to this
trait (Socias i Company et al., 1977).
Almond has a gametophytic self-incompatibility (SI) system, also present in other
Rosaceae as well as Solanaceae, controlled by a multiallelic S-locus (De Nettancourt, 1997).
The SI locus encodes a ribonuclease (S-RNase) linked to an S-locus expressed in the pistil and
also to F-box proteins, which are expressed in pollen (Ushijima et al., 2003). As SI excludes
crossings between trees of the same variety or cross-incompatible ones, breeding programs
and genetic improvement of cultivars are sometimes hindered (Oliveira et al., 2008). Controlled
hybridizations and genetic analysis were only established in the past 50 years and
onlyproperties they have started replacing seedling selections (because of the long generation
time and large size of the breeding populations) (Arús et al., 2009).
Almond has a very small diploid genome (around 300 Mbp) which makes it a good
candidate as a model species for the Prunoideae family (Arumuganathan and Earle, 1991). The
6
SI makes the almond species highly polymorphic and a huge source of variability useful for the
improvement of other Prunus fruit tree crops, such as peach, whose genome was recently fully
sequenced. Beneficial alleles for genes with agronomical interest, such as disease resistance
and fruit yield and quality, can be introduced into peach for improvement, as they are
genomically very similar and easily hybridized. This, along with the recent full sequencing of the
peach genome (GRD, 2008), allows for the advancement of breeding programs amongst fruit
trees (Arús et al., 2009).
Origin and evolution
As early as 3300 B.C. Prunus domestication stared in China. Almond is a Prunus species and
the cultivated varieties (cultivars) were first selected from open-pollinated natural populations. It
is believed to be disseminated in Central Asia by 2000 B.C. and in Europe by 30 B.C.
(Srinivasan et al., 2005), but the details of its exact origin are still unknown. Nevertheless it was
hypothesized that the commonly cultivated almond resulted from a selection that happened
between two populations of a species known as Prunus communis L., one located between
Turkmenistan and Iran and the other one around Kyrgyzstan and Western China (Watkins,
1979). Another hypothesis is that the first cultivated trees could have originated from
spontaneous crossings occurring in coexisting habitats amongst wild variants, such as Prunus
fenziliana, Prunus bucharica and Prunus kumarica (Grasselly et al., 1980). Another possible
contribution of may have originated from a common ancestor named Prunus webbii, still found
in some regions around the Balkans and the Mediterranean (Socias i Company et al., 1998). In
the Portuguese region of Foz Côa, almond trees with phenotypic similarities to Prunus webbii
were found, although further analysis revealed that they belonged to either non-described
Prunus dulcis cultivars or a cultivated hybrid between Prunus dulcis and Prunus webbii that
went into an undomesticated wild state (Martins, 2003).
In the breeding and dissemination of cultivated almond trees, since the edible part is
also the propagation vector, it is certain that man was involved. Due to the ancient commercial
routes almond easily spread to Persia, Mesopotamia and Asia (Kester et al., 1991). Almond
introduction in the Mediterranean area is supposed to have been linked to the Phoenicians, the
Hebrews and most notably the Greek, directing its propagation to Western Europe, namely
Portugal, Spain, France and Italy and also Northern Africa (Kester et al., 1996), where it still
grows.
7
Before the 19th century cultivation was very rudimentary and trees were dispersed only
by seed sowing. The practice of grafting only started 150 years ago, allowing the propagation of
many diverse local cultivars (Oliveira et al., 2008).
Economic importance
Interspecific hybridization occurs spontaneously in nature and has, along the centuries,
been used as a tool to develop new cultivars for commercial fruit types (Srinivasan et al., 2005).
Nowadays, and especially after the emergence of the practice of grafting, there are thousands
of different cultivars scattered around the world. For example, Portugal and Spain have around
150 and 200 cultivars, respectively, while Turkestan possesses 2000 (Oliveira et al., 2008).
Almond is adapted to the Mediterranean climate, with mild winters and hot dry summers, since it
has low chilling requirements for blooming, rapid early shoot growth and high tolerance to
summer conditions (Arús et al., 2009). However, according to the Food and Agriculture
Organization (FAO 2005) the biggest almond producer is by far the United States. In California,
high yielding, completely mechanized almond orchards occupy an area near to 180 000
hectares, mostly with only one high producing cultivar. It is responsible for 42% of world‟s
production, followed by Spain with 13% and then Syria and Italy. Production in Australia has
recently been rising and is expected to grow to be the second leader worldwide. Like in
California, Australian orchards are highly automated and with a sophisticated irrigation system.
In Mediterranean areas, like Spain and Portugal, crops are usually cultivated with the traditional
unirrigated method (Arús et al., 2009).
Almond harvesting is made when fruits are completely mature and dry, about 6 to 8
months after full bloom. Most of the times only the kernel is consumed, but the whole fruit is
consumed in some countries and its hull has risen to be an important commercial by-product as
animal feed (Aguilar and Smith, 1984). Almond kernel, which defines horticultural quality
amongst the cultivars, disregarding other features such as divergent photosynthetic strategies
(Rouhi et al., 2007), has high nutritional value, which may vary amongst cultivars. It contains a
considerable amount of lipids, proteins, mineral salts and vitamins, being a good source for
vitamin E, dietary fiber and monounsaturated fats, associated with decreased risk of heart
diseases (Spiller et al., 1998). It can be consumed by humans in a variety of ways, either raw or
roasted. Almond oils are also valued by the pharmaceutical and cosmetic industries (Oliveira et
al., 2008).
8
Flowering and its molecular basis
Flowering is an essential step in plant development to guarantee sexual reproduction.
The transition from a vegetative to a reproductive stage is influenced by a diverse group of
environmental and endogenous promoting signals such as light, photoperiod, temperature and
hormones like gibberellins (GA), all of which are involved in a complex network of different
pathways, both inductive and repressive (Silva, 2005).
In almond, as in other fruit trees, the reproductive stage follows a seasonal two-year
cycle pattern. Flower initiation in almond begins around July or August in the Northern
hemisphere. Variations have been documented within the same cultivar, as it is a process
regulated by both endogenous and environmental factors (Lamp et al., 2001). Floral buds then
undergo organogenesis, which is arrested, although not fully stopped, around October when
dormancy settles in preparation for winter. This dormant state is only released after the winter
chilling requirements are met, and growth resumption leading to anthesis generally occurs in the
following year, around January or February (Egea, 2003). These chilling requirements are
generally the cumulative hours of exposure to chilling temperatures which need to be met to
break dormancy and vary immensely between varieties and cultivars. The number of hours
between 0º and 7ºC necessary for half bud break is environmental and most widespread model
for calculation plant specific chilling requirements, although other mathematical models can be
used (Yamane et al., 2006; Egea, 2003). Between November and January microsporogenesis
occurs, followed by ovary maturation, which is succeeded by blooming (Rugini, 1986).
Blooming time is an important trait for breeding programs and although is considered to
be quantitatively inherited by modifier genes, one major gene allele – LATEBLOOMING (Lb) -
was described in the „Tardy Nonpareil‟, (a late-blooming variety) that confers a delay of
approximately 15 days (Kester, 1965) (Grassely, 1978). Lb mapping was done using a cross
between „Felisia‟ and „Bertina‟ and collocated in the middle portion of linkage group 4 (G4)
(Ballester, 2001). Several QTLs - Quantitative Trait Loci – for blooming time have been
identified over the past decades: two in G2 and G7 in an intraspecific F2 peach population
(Dirlewanger et al., 1999), one in G4 in an interspecific (Prunus persica x Prunus ferganensis)
backcross (Verde, et al., 2002) and four in G1, G4, G6 in a cross between peach „Texas‟
variety and almond „Earlygold‟ – TxE (Joobeur et al., 2000); the fact that most of these genes
are located in similar linkage map positions may indicate a conserved region affecting bloom
time in other species (Silva et al., 2005).
Much of the research which has been done over the past decades on model herbaceous
9
have identified several genes involved in flower induction and development, revealing a multiple
input network that is responsible for transition to flowering. In Arabidopsis a model was
proposed where both endogenous – bioactive GAs - and exogenous – photoperiod and light
quality – signals are mediators of floral pathway integrators (Simpson et al., 2002). These
include the circadian clock regulated CONSTANS (CO)-activated FLOWERING LOCUS T (FT),
AGAMOUS-LIKE20 (AGL20), GA-responsive LEAFY (LFY) and SUPPRESSOR OF
OVEREXPRESSION OF CO 1 (SOC1). Through this pathway floral meristem identity genes are
expressed and also downregulated by action of the main repressor FLOWERING LOCUS C
(FLC). FLC is suppressed by vernalization, which then enables flowering after winter (Silva,
2005).
Molecular and genetic studies related to organogenesis led to the identification of
specific classes of MADS-box genes composing the general ABC model of floral development.
This model is ruled by the overlapping activities of these three classes of regulatory genes (A, B
and C), which specify the four concentric floral whorls (sepals, petals, stamens and carpels).
Further research has led to the realization that the model previously described was incomplete,
leading to the insurgence of two complementary classes D and E (Henryk et al., 2007). Floral
MADS proteins assemble into quaternary structures formed by two dimers, whose interaction
determines DNA binding, localization and function (Immink et al., 2010).
Mechanisms related to floral induction and development are more complex in temperate
perennial trees like Prunus, whose juvenile phase lasts several years and active growth is
precluded by seasonal dormancy. Blossom clusters enclose not only flower buds but also
vegetative buds, impervious to floral induction, which will ensure the growth and cyclic
development of the plant in the following year. Several homologue genes related to floral
induction and development in almond were previously identified using a candidate gene
approach, such as LEAFY homologue PrdFL and CONSTANS-like PrdCOL, both expressed in
early bud development (Silva, 2005). Three cDNA sequences encoding MADS-box homeotic
proteins (PrdMADS1, 2 and 3) were also identified (Silva, 2005). PrdMADS1 is related to apple
MdMADS10 (Henryk et al., 2007), itself an homologue of Arabidopsis thaliana AGAMOUS-LIKE
11 (AGL11), which in almond is expressed in carpels during the final stages of organogenesis
(Silva, 2005). Another homologue was also identified in peach, PPERSTK, which is also
expressed in carpels, embryo and fruit tissues but not in stamens (Tani et al., 2009). Gene
expression analysis of PrdMADS2 (homologous to apple MdMADS2) in several tissues revealed
it to be quite ubiquitous amongst them, while expression of PrdMADS3 (homologue of apple
MdMADS8 and 9) was found only in flower parts of mature flower buds harvested in late
10
February and not found at all in the earlier stages of development (Silva, 2005). Additionally, a
homolog of an Arabidopis belonging to a family of GA20oxidase enzymes, which is related to
GA biosynthetic pathways, was also identified in almond. Its expression in almond was detected
only in the months prior to the winter dormancy period, which could correlate to dormancy
regulation observed in some perennial species (Oliveira et al., 2008).
Seasonal development in perennials
One major difference that distinguishes perennial from annual/biennial plants is the
former‟s ability to maintain their meristems in a dormant state until growth can be resumed after
winter months (Bangerth, 2009). Although it has been given many definitions it was recently
proposed that dormancy consists on the inability to initiate growth from meristems under
favorable conditions (Rohde and Bhalerao, 2007). It is seen as a survival mechanism for these
plants to avoid injury from winter frosts before regaining the ability to grow, which interestingly
only happens after the appropriate long exposure to chilling requirements has been met. As
individual tree buds have different chilling requirements to initiate regrowth it is said that
dormancy is also of quantitative nature. The major signal to dormancy is photoperiodic variation,
as leaves perceive short-day photoperiod (SD), a dominant cue leading to an inactivation of
meristem development (Wareing, 1956) through a general reprogramming of gene expression,
such as the downregulation of cell division, expansion and differentiation genes (Schrader et al.,
2004). In fact, FT and CO homolog genes in poplar were identified as mediators of short-day
signal for growth cessation and bud set (Böhlenius, 2006).
The direct effect of low temperature in dormancy is related to the acquisition of freezing
tolerance upon exposure to chilling temperatures, as well as the later induction of growth related
to chilling requirements. Recent studies also seem to point out contradictions in these
assertions, as warm temperatures under short-day photoperiod seems to have a huge impact
on growth cessation and also on dormancy development and acclimation (Tanino et al., 2010),
hence the urgent need to further evaluate this model, taking into account a broader regulation
network.
11
Molecular basis of cold acclimation
Most plants in temperate regions are not able to survive freezing (temperatures below
0ºC) but able to activate freezing tolerance – also known as cold/low temperature acclimation
(when exposed to chilling temperatures, usually 0º-15ºC). Many cold-inducible genes are
involved in membrane stability, since chilling and freezing temperatures lead to a rigidification of
the membrane affecting its natural fluidity and protein functionality (Taiz and Zeiger, 2006).
Membrane damage can be caused by accumulation of reactive oxygen species (ROS) but
primarily by the formation of ice between intercellular spaces due to extracellular higher freezing
point and consequent severe dehydration and decrease in water potential outside the cell. Many
different forms of lesions occur in the membrane including expansion-induced lysis
(Thomashow, 1999). Hence low temperatures also affect water and nutrient uptake as well as
protein and nucleic acid conformation, considerably changing and reducing the efficiency of
biochemistry reactions and gene expression (Chinnusamy et al., 2007).
The changes in membrane structure promoted by cold lead to a series of processes of
acclimation, increasing plant tolerance to low temperature stress, one of which is the up-
regulation of COLD-RESPONSIVE (COR) genes. COR genes up-regulation leads to the
transcription and translation of antifreeze membrane-protecting proteins that minimize potential
functionality loss. These genes were firstly identified as part of the LATE EMBRYOGENESIS
ABUNDANT (LEA) protein family, produced prior to seed desiccation, generally hydrophilic and
composed of repeated amino acid sequences which contain regions capable of forming alpha-
helices (Thomashow, 1999). Dehydrins are a sub-group of the LEA family and one of these
protein-encoding genes, PpDHN1, was identified in peach and cloned by Artlip et al. (1997).
Studies were performed between evg and deciduous genotypes and it was found that dehydrin
transcript accumulated earlier and for a longer period of time in the deciduous than in the evg
genotype, which also presented a lag between transcript and protein accumulation, suggesting
a change in the signaling pathways responsible for dormancy. It had been also observed that
the promoter contained CRT/DRE elements (Renaut et al., 2006), as do most COR genes and
also the two DAM genes identified by Bielenberg et al. (2008). These genes are regulated by a
complex pathway which is centered in the conserved AP2/ERF family of transcription factors
named C-REPEAT(CRT)/DEHYDRATION RESPONSIVE ELEMENT (DRE)-BINDING
FACTORS or CBF/DREB1 (Taiz and Zeiger, 2006), which have already been described not only
in Arabidopsis (Thomashow et al., 2001) but also on several woody perennials, including
Prunus (peach (Wisniewski et al., 2011) and sweet cherry (Kitashiba et al., 2004). The
12
regulation of the CBF transcription factors seems to be even more complex in perennial plants.
This is because flowering, and consequently fruit yield and production, seems to be heavily
dependent on chilling temperatures.
For this thesis we planned to functionally analyze two CBF transcription factors cloned
from almond (Barros, 2011) through overexpression of these novel CBF genes in Arabidopsis
and other downstream cold-responsive endogenous genes, responsible for enhanced tolerance
and protection from freezing damage. Along this line of research we also tried to draw a
connection to seasonal development in field trees and analyze the expressions of genes related
to cold regulation, dormancy break and flower induction.
13
CHAPTER ONE:
Functional analysis through overexpression in A. thaliana
Some of the work conducted for this chapter is included in the elaboration of the following
manuscripts:
Barros, P., Gonçalves., N. M., Saibo., N., Oliveira, M. M. Two CBF-like genes are involved in
low temperature signalling in almond (Prunus dulcis Mill.) (in preparation).
Santos, A. P., Barros, P., Ferreira, L., Gonçalves, N. M., Oliveira, M. M. Chromatin remodeling
drugs: a good tool to understand chromosome organization, gene expression and
epigenetic modifications (in preparation).
14
15
Introduction
Cold stress and induction of CBF transcription factors
Most plants in temperate regions are not able to resist freezing (below 0ºC) or even
chilling (below 15-20ºC) temperatures which may occur along development. To survive and
adapt to these conditions, many plants become capable of inducing freezing tolerance – also
known as low temperature acclimation - when exposed to chilling temperatures, which range
from 0º to 15ºC. This tolerance may not only be constitutive but also develop during sudden cold
spells (Zhou et al., 2011). Cold acclimation allows plants to increase cold tolerance after a
previous exposure to low temperatures. Due to a reorganization of the cell metabolism,
structure and gene expression, they are able to avoid more severe damage caused by cold
stress. That enables mechanisms that inhibit water uptake and stimulate cellular dehydration
and the general increase of other damages caused by osmotic and oxidative stresses
(Chinnusamy et al., 2007).
Cellular membranes are phospholipid-constituted fluid structures, which allows for
essential transmembrane protein movement and function, as well as signal transduction
amongst other crucial metabolic mechanisms (Taiz and Zeiger, 2006). Cold stress reduces this
fluidity and increases rigidity of the membrane, impairing protein function. After cold acclimation,
tolerant plants undergo various metabolic and physiological changes such as in lipid
composition, upregulation of genes encoding membrane-protective proteins, accumulation of
compatible solutes (raffinose, sucrose and proline) and increased ability of disposing reactive
oxygen species. Also, the accumulation of these and other proteins such as many Calvin cycle
enzymes may compensate the decreased rate of catalysis during low temperature exposure,
allowing a higher photosynthetic capability (Usadel et al., 2008).
Maintenance of cellular homeostasis is partly possible by the upregulation of cold-
regulated (COR) genes, many of which have a proline-responsive element (PRE, ACTCAT),
which encode proteins that are believed to be cryoprotective, shielding cell membranes from
freezing damage (Steponkus et al., 1998). The promoter region of COR genes share C-
repeat/dehydration responsive elements (CRT/DRE) which are active binding sites for CBF
transcription factors. These are cell response regulators that belong to the
APETALA2/ETHYLENE RESPONSE FACTOR (AP2/EREBP) family which holds a highly
conserved 60 amino acid DNA-binding domain and has also been linked to plant defense
through the transcriptional activator binding to GCC-boxes, of pathogenesis-related promoter
element genes (Chinnusamy et al., 2007). Over 10% of cold-induced genes are regulated by
16
CBFs, which are generally entitled the CBF-regulon. CBF genes start being expressed in plants
15 minutes after transfer to low temperature (4ºC) while their target genes are induced 2 to 3
hours later (Thomashow, 2010).
Most of the current understanding of the CBF regulation pathway has been the result of
a decade of research done in the model plant Arabidopsis thaliana. Three transcription factors,
initially described as CBF1, CBF2 and CBF3, were found to individually upregulate the
expression of the same cold-responsive genes (Gilmour et al., 2004). However CBF2 had a
very distinct function mechanism from the rest, both induced earlier during cold exposure. CBF2
silencing provoked an accumulation of both CBF1 and CBF3 genes, leading to the conclusion
that CBF2 acts as a negative regulator of CBF1 and CBF3 (Novillo et al., 2007). ADF5 (Actin
depolymerizing factor 5) was also found to repress CBFs, as a mutation of this protein results in
an upregulation of CBFs in Arabidopsis in the absence of cold treatment and null cbf2 mutants
present a downregulation of ADF5 under low temperatures (Ruzicka, 2008). In Arabidopsis
ectopically expressing CBFs, a constitutive expression of two cold-responsive RELATED TO
AP2 transcription factors (RAP2.1 and RAP2.6) was also observed, which may indicate they
control part of the CBF regulon (Fowler, 2002). On the other hand, a recessive mutation of the
FIERY2 gene showed enhanced expression of COR genes under cold stress, revealing a
repressor role over of the same CBF regulon (Xiong et al., 2002).
Overexpression studies with the 35S promoter might disguise subtle differences in the
CRT/DRE binding affinities of the various CBF transcription factors, whose understanding of
self-regulation still requires further studies (Thomashow, 2010). Nevertheless they were
important to assert putative functionality attribution possible through multilevel genomic
analysis. By comparing expression profiles in CBF over-expressing plants and chilling-exposed
wild-type plants it was observed that both conditions share a few modifications. These include
repression of genes involved in hormone (auxin, ethylene, brassinosteroid and jasmonate)
metabolism and signaling, several families of receptor kinases, vacuolar invertases, transport-
related PIP and TIP aquaporins, and several members of the AGP cell wall protein family.
Conversely, genes pertaining to starch and raffinose metabolism, mitochondrial metabolite
transporters, cytochrome oxidase and F1- ATPase, flavonoid metabolism are induced, together
with accumulation of sugars and many transcription factors, especially members of the
AP2/EREBP family (Usadel et al., 2008).
A novel homologue of CBFs was described in Arabidopsis, CBF4, the only CBF
transcription factor which does not respond to cold stress inducing temperatures, as well as the
only one which is part of the ABA-dependent pathway, being mainly induced by ABA and
17
drought treatments (Haake et al., 2002). CBF4 or DREB1D was identified along with DREB1E
(DDF2) and most interestingly DREB1F (DDF1) (Sakuma et al., 2002), which appears to
respond to salt stress (Magome et al., 2004). All DREB1 genes all encode proteins structurally
similar to CBFs but with very different expression patterns and induction mechanisms.
CBF overexpression and connection to the gibberellin pathway
Constitutive overexpression of the CBF genes in Arabidopsis, or of respective
homologues from other plants such as barley, wheat, and potato, where shown to increase
freezing tolerance in transgenic plants in the absence of cold acclimation (Gilmour et al., 2000;
Xue 2003; Shen et al., 2003; Pino et al., 2007). This was also true for CBFs from chill-sensitive
plants like rice (Dubouzet et al., 2003) or tomato in which CBF transcripts accumulate but are
not functional (Zhang et al., 2004).
Cold acclimation involving the CBF regulon seems to have further effects though. Most
overexpressing lines of Arabidopsis presented dwarf phenotypes, with a retarded growth rate
and a considerable flowering delay as compared to wild-type plants (Gilmour et al., 2004).
Achard et al. (2008) had a breakthrough regarding the explanation of this phenomenon,
connecting CBF overexpression with dwarfism caused by accumulation of DELLA proteins.
DELLAs are a subfamily of the GRAS transcription factors which repress growth in plants. Five
different DELLA proteins were identified in Arabidopsis: GA-INSENSITIVE (GAI), REPRESSOR
OF GA1-3 (RGA), RGA-LIKE1, 2 and 3 (RGL1, RGL2 and RGL3), all sharing a N-terminal
DELLA-motif with overlappin functions.
The repressive effect caused by DELLA accumulation may be dampened by the action
of gibberelins (GA), a group of phytohormones responsible for plant growth and development,
cell elongation and floral transitioning (Richards et al., 2001). The binding of bioactive GA to
GID1 receptor leads to an interaction of the latter with the DELLA-conserved domain (Griffiths et
al., 2006), enhancing DELLA proteins interaction with an E3 ubiquitin ligase complex, leading to
their degradation through the 26S proteasome (Fu et al., 2004).
Achard et al. (2008) demonstrated that the dwarfism shown in CBF1 overexpressing
lines of Arabidopsis was suppressed when these lines were crossed with a silencing line for GAI
and RGA DELLA-encoding genes. This showed that plant retardation in CBF1 overexpression is
due to DELLA accumulation, a consequence of the cold-induced CBF-upregulation of
transcripts belonging to two bioactive gibberellin-deactivating enzymes. This marks a new
positive account for the dwarf phenotype, reversible by exogenous GA application. Additionally
it was shown that CBF1-overexpressing, GA and RGA-silenced lines showed reduced freezing
18
tolerance than the CBF1-overexpressing plants. This suggests DELLA proteins are partially
responsible for the acclimation promoted by CBF1 accumulation, which specifically upregulates
not only COR gene expression but also DELLA RGL-transcript (Achard et al., 2008). The
overexpression of the novel AP2 transcription factor DWARF AND DELAYED-FLOWERING
(DDF1), closely related to the CBF family, was also connected to dwarfism and late flowering,
as well as increased salt tolerance (Magome et al., 2008).
Circadian clock and light regulation
Many cold acclimation studies done with Arabidopsis were done in constant light or not
considering photoperiodical activity variations, but the circadian gating is essential to
comprehend the low temperature network of responses. It was initially observed that CBF3 and
downstream genes were affected by a circadian clock regulation under ambient temperature
growth (Harmer et al., 2000). Later it was shown that all Arabidopsis CBF induction was much
increased if low temperature was applied at 4 hours after dawn compared to 16 hours after
dawn, under a 12 hour photoperiod and transfer to constant light for the cold treatment (Fowler
et al., 2005). In opposition, low temperature seems to negatively affect circadian clock
regulation as transfer of plants under a 16 hour photoperiod to low temperature leads to a
reduced expression of the circadian clock regulator PRR7 and downstream genes such as
CAB2 (Bieniawska et al., 2008). Furthermore PIF7, a helix-turn-helix DNA-binding transcription
factor, was shown to repress circadian regulation of CBF1 and CBF2 through interactions with
both a central component of circadian variation, TOC1, and a red light photoreceptor, PHYB
(Kidokoro et al., 2009; Franklin and Whitelam, 2007). Expression of CBF-regulated COR15A
transcript level was shown to be upregulated by PHYB and CBF expression was increased by
low-red/far-red radiation signaling in a circadian gated manner, resulting in increased freezing
tolerance (Franklin and Whitelam, 2007).
Transcriptional regulation
ICE1 (INDUCER OF CBF EXPRESSION1) is a MYC-type basic helix-turn-helix
transcription factor which was found to bind to recognized MYC elements in the CBF3 promoter
of Arabidopsis thaliana. The ice1 mutant possesses no cold induction of the CBF3 gene and
impaired freezing tolerance (Chinnusamy et al., 2003). Conversely, constitutive overexpression
of ICE1 in transgenic plants resulted in increased expression of CBF3, but exclusively when
combined with cold exposure, which suggested a direct connection of CBF3 – and also CBF2 –
19
COR stimulation to the upstream ICE1 post-translational activation by low temperatures. It was
also suggested that CBF3 may be a negative regulator of CBF2, since the reduced expression
of CBF3 in the ice1 mutant leads to increased expression of CBF2 (Chinnusamy et al., 2003),
which reinforced the cross- and self-regulating role of CBFs in their own expression levels.
Another transcription factor, an R2R3-MYB protein family named MYB15 was found to
negatively regulate CBF gene expression during cold induction. These transcription factors able
to downregulate CBFs by binding to MYB elements in their promoter region, similar to the
elements to which ICE1 binds to during cold response. Overexpression of MYB15 leads to a
decline of freezing tolerance while the myb15 knockout mutant revealed enhanced expression
of the CBF genes during acclimation and increased cold tolerance. In the ice1 mutant there is
also an increased expression of MYB15 transcript, leading to the conclusion that ICE1 is a
negative regulator of MYB15 (Agarwal et al., 2006).
CBF transcription factors are also negatively regulated by ZAT12, a C2H2 zing finger
transcription factor, as its overexpression decreases CBF transcript induction under cold stress
(Vogel et al., 2005). ZAT10/STZ was also suggested as another negative regulator of the
DREB1 family of transcription factors, as bifunctional enolase LOS2 binds to MYC elements in
ZAT10 promoter and represses them during low temperature regimes, leading to increased CBF
transcription levels (Lee et al., 2002).
Post-transcriptional and post-translational regulation
Both pre-mRNA splicing and alternative splicing are important steps in the processing of
mRNAs that contain introns, both in the nuclear transportation to the cytoplasm and also to the
stress-related synthesis of different proteins encoded by the same gene. Arabidopsis
STABILIZED1 (STA1) is a pre-mRNA splicing factor that seems to be of special importance for
cold tolerance as its knock-out mutant sta1 defectively splices the cold-induced osmoprotector
COR15A, making it very sensitive to chilling temperatures and other stress (Lee et al., 2006).
Another Arabidopsis mutant, los4-1, showed reduced expression of stress-responsive RD29A
and CBF3, as well as delayed expression of both CBF1 and CBF2. LOS4 is a DEAD-box RNA
helicase protein, involved in RNA processing, decay and cytoplasmic transport (Gong et al.,
2002). It was also recently proven that small non-coding mRNAs - microRNAs (miRNAs) and
short interfering RNAs (siRNAs) which are known repressors of gene expression and with roles
in plant development and defense – were linked to abiotic stress as several different stress-
inducing treatments lead to an upregulation of miR393, miR397b, miR402 and also miR319c,
which appears to be cold-stress specific (Sunkar and Zhu, 2004).
20
Post-translational proteolysis also has a major role in TFs regulation as shown on
several pathways related to HOS1 (HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE
GENE 1), which encodes a RING finger ubiquitin E3 ligase that specifically makes several
substrates enter the ubiquitination/26S proteasome degradation pathway. The Arabidopsis hos1
mutant causes an increased upregulation of CBF transcription factors under cold stress (Lee et
al., 2001) and ICE1 was pointed out as a target of HOS1, leading to its ubiquitination.
Additionally HOS1 over-expression lines showed considerable reduction in ICE1 transcript
levels as well as a down-regulation of CBF and COR genes (Dong et al., 2006). On the other
hand it was discovered that SUMO E3 ligase SIZ1 reduced polyubiquitination of the ICE1
transcription factor (Miura et al., 2007). Sumoylation constitutes a post-translation protein
modification by the conjugation of SUMO (small ubiquitin-related modifier) and several proteins
by action of SUMO E3 ligases like SIZ1, which protects them from ubiquitination and
subsequent proteasomal degradation (Ulrich, 2005). SIZ1 was found to be essential for
accumulation of SUMO substrate proteins such as ICE1, which is itself necessary for CBF
expression and MYB15 repression during cold stress and, conversely, the siz1 knock-out
mutant showed decreased transcript expression levels of CBF and the CBF regulon during cold
stress, making it very sensitive to chilling temperatures (Miura et al., 2007).
The following Scheme 1 was adapted from Chinnusamy et al. (2007) and complemented
with additional knowledge gained since then as well as incorporating several different pathways
found to be involved in the cold-response network. It represents a global view of the complex
CBF regulation pathway which only allows a synthesized reductionist view of a vast all-
encompassing network, although some pathways and associations are still only putative.
21
Sch
em
e 1
- S
chem
atic r
epre
senta
tion o
f th
e c
om
ple
x C
BF
regula
tory
netw
ork
of
path
ways a
nd p
uta
tive inte
ractions b
etw
een t
he s
evera
l ele
ments
puta
tively
rela
ted to it.
Bold
lin
es r
epre
sent
gene c
om
ple
xes.
Arr
ow
ed b
lack lin
es r
epre
sent
activation. A
rrow
ed b
lue lin
es r
epre
sent
dir
ect activation b
y
the C
BF
tra
nscri
ption f
acto
rs.
Blo
cked lin
es r
epre
se
nt
repre
ssio
n.
Blu
e b
oxes r
epre
sent
positiv
e r
egula
tors
and r
ed b
oxes r
ep
resent
negative r
egula
tor.
Purp
le b
oxes r
epre
sent
cir
cadia
n c
lock-r
ela
ted e
lem
ents
. T
he g
reen b
ox r
epre
sent
positiv
e g
row
th-r
ela
ted e
lem
ents
. A
nd o
range b
oxes r
epre
sent
AB
A
and d
rought
respon
se o
r re
spon
siv
e e
lem
ents
. A
dapte
d f
rom
Chin
nusam
y e
t al. (
2007)
22
Low temperature provides one of the most important cues for seasonal developmental
changes of woody trees in temperate climates, allowing them to acquire freezing tolerance and
survive low temperature winter conditions. However the role of CBF-like genes in higher plants
such as fruit trees in still poorly understood.
From previous work, we had two almond CBF genes, PrdCBF1 and PrdCBF2, cloned
from almond (Verdeal cultivar) that showed induction by low temperature. In transactivation
assays it was shown through transient expression in protoplasts that they operated as
transcription factors, activating a reporter gene containing the specific CRT/DRE binding
elements in their promoter (Barros, 2011). In this chapter we perform the functional analysis of
both PrdCBFs through constitutive overexpression in A. thaliana and downstream cold-
responsive genes connected to tolerance.
.
23
Material and Methods
A. Plant Material and Growth Conditions
Arabidopsis thaliana ecotype Columbia (Col-0) was used in all experiments genetic
background. Transgenic lines overexpressing Prunus dulcis CBFs (PrdCBF1-2) were obtained
from previous transformation events (Barros, 2011) using the flower-dip method (Clough and
Bent, 1998). Agrobacterium LBA4404was initially transformed with pEarleyGate201 destination
vector (Earley et al., 2006) containing the 35S promoter from Cauliflower Mosaic Virus (CaMV)
upstream of a hemaglutinin-tag (HA) fused in frame to PrdCBF1 or PrdCBF2 coding sequences.
The positive T0 lines were identified as HA-PrdCBF1 or HA-PrdCBF2, according to the
corresponding transformation vector, followed by the line serial number. Germination was
performed as follows: seeds were sterilized with a solution containing equal parts of water and
commercial bleach along with Tween-20 (1:1000); several washes with double-distilled water
were performed in horizontal laminar air flow chamber (Braun Horizontal BBH6), followed by 2-3
days of vernalization by immersion in sterile double-distilled water at 4ºC; Seeds were then
evenly distributed in Arabidopsis medium (MA, composition on Appendix, page I) for wild-type
(Col0) plants, or MA supplemented with 50 mM of phosphinothricin (PPT, active ingredient on
BASTA herbicide) and 100 mM of cefotaxime antibiotic (Ralopar, Portugal) for selection of
transgenic plants. Seeds were plated in sterile round plastic Petri dishes, sealed with surgical
micropore tape (3M, USA) and grown at 22ºC (RT) under 16h/8h photoperiod, in a plant growth
chamber (Fitoclima D1200-PL, Aralab, Portugal). Arabidopsis plants were grown in soil
(Shamrock Professional Range Specialist Pot Plant Medium, Ireland) using the Aracon System
(Arasystem, Belgium) under the same growth conditions as in vitro. Plants were watered
regularly and dwarf phenotype plants were sporadically aspersed with 100 mM gibberellic acid
(GA3) to allow growth. For selection of transgenic plants resistant to the selection agent, plates
were placed in the dark for 2 days and then transferred to normal growth conditions with a 16/8
photoperiod. T0 seeds were grown under selective media, and positive plants that germinated in
these conditions were transferred to soil to allow seed development. Segregation analysis was
performed on T1 seeds resulting from T0 plants, to check the Mendelian distribution expected
for heterozygous plants (eg: for a single insertion site, it was 2:1:1 - {heterozygous for the
transgene}:{homozygous for the transgene}:{homozygous for wild-type}. For selection of
homozygous lines, obtained by controlled self-pollination, several T1 or further T2 plants were
allowed to grow in soil and segregation analysis was repeated.
24
B. Salinity Stress Assays
Wild-type (WT) plants were germinated in regular MA with 0.8% agar and transgenic
lines were germinated in MA with 0.8% agar supplemented with 50 mM PPT, and 100 mM
Cefotaxime. After one week they were transferred to sterile square plastic Petri dishes with MA
or MA supplemented with NaCl at concentrations of 85 mM and 100 mM. Roots growth at this
point was marked in the plaques, which were then placed in a vertical position and growth was
allowed during 5 days. Two and five days later the plaques were scanned using a regular image
scanner and digitalized. Root length was then measured from the point of transfer to the point of
digitalization using ImageJ software scaling and dimension tools.
C. Electrolyte Leakage Test
The electrolyte leakage test was performed according to Ristic and Ashworth (1993) with
minor modifications. Transgenic and WT plants were grown on MA medium as mentioned
above for 2 weeks and then transferred to soil for 27 days. 1, 2 or whole rosette leaves were
collected and placed in sterile falcon tubes containing 100 µL sterile water. The freezing
treatment was performed in a growth chamber (Fitoclima D1200-PLH, Aralab) by gradual
temperature decrease, 2ºC per hour down to -10ºC, and tubes were removed from the chamber
at 0ºC, -4ºC and -8ºC. Three replicates for each collection point for each plant tested. At -1ºC
the remaining tubes were opened and leaves were sprinkled with a small amount nitrogen
grinded ice chips to promote ice nucleation. Tubes were allowed to thaw at 4ºC during 12h.
After that 10 mL of sterile water was added to the tubes and leaves remained in solution for
additional 24h. Solution conductivity was measured (in milli Siemens - mS - units) using a
pH/EC/TDS/Temperature Meter (Hanna Instruments, USA). The total ion composition present in
each replicate samples was determined by incubating the tubes at 100ºC during 1h and
measuring total conductivity. The percentage of electrolyte leakage for a given temperature was
given by the ratio between the conductivities before and after 100ºC incubation.
D. Gibberellic Acid and Light/Dark assays
Transgenic and wild-type plants were germinated separately in selection or regular MA,
as previously mentioned. After 6 days of growth (Fitoclima D1200-PL, Aralab) transgenic and
WT plants were transferred to new medium without antibiotics or herbicides for light/dark
treatment. 14 days later the plants for the light/dark variation assay were collected after a
photoperiod change to 12/12 two days earlier. Two sample pools of plants were harvested in a
25
12h interval. One sample was collected 6 hours after dawn (light period) and the other was
collected 6 hours after dusk (night period). They were collected into Eppendorf tubes, quickly
frozen in liquid nitrogen and conserved at -80ºC. For the experiments using gibberellic acid
(GA3) similar conditions were used but with two pools of 14-days old plants: with or without 50
µM GA3 in MA medium, both under normal RT temperature and with 16h/8h photoperiod.
E. Cold Stress Assays
Transgenic and WT plants were germinated in MA media as mentioned above during 6
days and then transferred to new medium without antibiotics or herbicides. Fourteen days later
some plants were submitted to a cold stress assay while others remained at room temperature
(RT). The cold stress assay was done in a low-temperature capable growth chamber (Fitoclima
D1200-PLH, Aralab) starting with a gradual decrease to 4ºC for 1hour and then 0ºC for 6 hours,
with only 10% of total radiation to avoid photo-inhibition. At the end of the assay, plants
submitted to cold stress and RT controls were collected at the same time into Eppendorf tubes,
quickly frozen in liquid nitrogen and conserved at -80ºC.
F. Proteasome Inhibition Assays
Transgenic and WT plants were grown in regular MA culture medium for 9 days, as
above described and then transferred to 24-well plaques with liquid MA medium (without
selective agents) for one day. Plants were thereafter transferred to 24-well plaques containing
liquid MA medium supplemented with the inhibitor MG132 („Z-Leu-Leu-Leu-al‟, Sigma-Aldrich,
USA) at 10 µM. Control treatments were made using liquid MA with DMSO. One plate was
submitted to a 6h cold treatment at 0ºC (as described above). Proteasome inhibition
experiments were also conducted on protoplasts, transformed according to what is described in
point K. Protoplast incubation was made overnight or for a 2-day period in B5-GM medium
supplemented with 10 µM MG132. Samples were collected into Eppendorf tubes frozen in liquid
nitrogen and stored at -80ºC, prior to protein extraction.
G. Hypomethylation Assays
Transgenic and WT plants were germinated and grown for 4 days as previously
mentioned, and then transferred to liquid MA medium (control) or liquid MA medium
supplemented with 50 µM 5-aza-2‟-deoxycytidine (Sigma-Aldrich, USA). After 8 days, plants
were transferred to regular solid MA and grown for another 3 days, being then harvested and
quickly frozen in liquid nitrogen.
26
H. DNA Extraction and Quantification
DNA extraction was performed in T0 or T1 plants to confirm insertion of the transgene.
Three methods were used on fresh new leaves: a Quick Extraction protocol for Arabidopsis
thaliana (Appendix, page II), the QuickExtract Plant DNA Extraction Solution (Epicentre
Biotechnologies), and the DNeasy Mini-Protocol for Plants (Qiagen, Netherlands). The latter
proved to be the most efficient. Quantification was done using Lambda DNA (10, 20, 40 and 60
ng) to get a standard curve. Using Quantity One Software (BioRad, USA) the intensity of the
bands of the extracted DNA was applied to the standard curve to determine the corresponding
quantity.
I. RNA Extraction and cDNA synthesis
RNA extraction was performed using the TRIzol RNA extraction protocol using TRIzol
Reagent Solution (Invitrogen, USA; Ambion, USA) according to manufacturers‟ instructions. A
QiaShredder column from the RNeasy Mini-Kit (Qiagen) was used for homogenization after
addition of the TRIzol solution and all centrifugation steps were performed at 4ºC. Residual
contamination with genomic DNA was eliminated using the TURBO DNA-free Kit (Ambion).
according to manufacturer‟s instructions. RNA quality was confirmed through electrophoresis
followed by approximate quantification using NanoDrop (NanoDrop 3330, ThermoScientific,
USA). RNA with strong polysaccharide contaminations were precipitated with potassium acetate
(Appendix, page III) and RNA with low concentrations were precipitated with lithium chloride
(Appendix, page III) and then eluted in a smaller volume of RNAse free-water. cDNA was
synthesized using the Transcription High Fidelity cDNA synthesis kit (Roche, Germany),
according to the manufacturer‟s protocol, using 2 µg of total RNA. To confirm the absence of
genomic contamination a no-RT control was also performed using 2 µg of total RNA diluted in
sterile water (the same volume as cDNA synthesis). The resulting cDNA and no-RT control was
then diluted in order to achieve 30 µL of samples and 1 to 2 µL were used as template for semi-
quantitative RT-PCR - semi-qRT PCR - in order to identify differential expression in samples
from multiple assays.
J. PCR conditions and Primer Design for genotyping and semi-quantitative RT-PCR
PCR reactions were prepared using GoTaq® PCR Core Systems (Promega, USA)
reagents using the following reagents for the mix show in Table 1.
27
Table 1 – General PCR Mix recipe used for genotyping T0/T1 lines and gene expression analysis using
semi-quantitative RT-PCR. *1 µL was used as default; 2 µL of template were used for expression analysis
of AtGA2ox3.
PCR MIX
Green FlexiBuffer 1X 4 µL
MgCl2 2mM 1.6 µL
dNTPs 0.2mM 0.4 µL
primers 0.5µM 0.3-0.4 µL each
Taq 1uni 0.2 µL
DMSO 4% 0-0.8 µL
Template 1-2 µL*
H20dd to 20 µL total
For PCR reactions, we used a thermocycler (T300 Thermocycler, Biometra) with a pre-
heated lid (at 99ºC) to reduce evaporation of the solution. The initial denaturation step was done
at 95ºC and each cycle comprised the following conditions: a denaturation step performed at
95ºC for 30 seconds, an annealing step lasting 40 seconds at the corresponding annealing
temperatures (Table 2) and finally an elongation step of 40-60 seconds at 72ºC. After the 26-32
cycles a final elongation was performed at 72ºC for 5 minutes. Primers were designed using
Primer3 (Rozen and Skaletsky, 2000) online software using the default parameters. Self-
complementarity and possible formation of hairpins and secondary structures were checked
using OligoCalc (Kibbe, 2007). All primers used are listed in Table 2 along with the optimized
specific annealing temperatures for each set and corresponding amplicon.
28
Table 2 – Specific primer sequences set for each gene along with preferential annealing temperature and
expected amplicon size.
Primer name Primer sequence (5' - 3') Annealing
temperature
Amplicon
size
PrdCBF1_Fw CGCTAATGAACAGGTTCTTCTCTCA 56ºC 550 bp
PrdCBF1_Rv TTCACACTATCCTTCTTCTTCTTCTTC
PrdCBF2_Fw CTCTAATGGACTTGTCTCAACTTTC 56ºC 540 bp
PrdCBF2_Rv CCAAGTTCACACTACCCTTCTTG
AtCBF1_Fw CTGGACATGGAGGAGACGT 58ºC 320 bp
AtCBF1_Rv TTTTCCACTCGTTTCTACAACAA
PrdTubulin_Fw ATTGAGCGACCCACCTACAC 56ºC 428 bp
PrdTubulin_Rv GTGGGTGGCTGGTAGTTGAT
AtRD29A_Fw GAACACTCCGGTCTCTCTGC 56ºC 511 bp
AtRD29A_Rv TGATGGAGAATTCGTGTCCA
AtXero2_Fw CACCAGAATCAAACCGGAGT 56ºC 572 bp
AtXero2_Rv TAGTGATGACCACCGGGAAG
AtCOR15A_Fw GGCCACAAAGAAAGCTTCAG 56ºC 401 bp
AtCOR15A_Rv AATGTGACGGTGACTGTGGA
AtGA20ox1_Fw GAGCCGCTTCTTTGATATGC 58ºC 446 bp
AtGA20ox1_Rv ATGGTCTTGGTGAAGGATGG
AtGA2ox3_Fw ACCGACTCAGATGCCAAAAC 58ºC 468 bp
AtGA2ox3_Rv CTTCTCCGGGTAATGGTTCA
PCR conditions were optimized using a T-Gradient thermocycler or a regular
thermocycler (T300 Thermocycler) with varying annealing temperatures (from 50ºC to 62ºC).
Nucleic acid electrophoresis was conducted at around 100V in 0.8-1.2% agarose (UltraPure™
Agarose 1000, Invitrogen) with 4% ethidium bromide. Gels were visualized under UV exposure
and pictures were captured using the GelDocXR+ Imaging System (BioRad). Semi-quantitative
RT-PCR reactions and conditions are presented in Appendix, page IV.
K. Protoplast Transformation and Protein Extraction
Three day-old Arabidopsis cell suspensions were used for protoplast extraction
according to standard protocol (Anthony et al., 2004) with minor alterations. All centrifugations
were done in a swing-out rotor Allega X-2R centrifuge (Beckman-Coulter, USA). Protoplast
concentration was estimated with a Fuchs-Rosenthal counting chamber. Polyethylene glycol-
mediated (25% PEG 6000) protoplast transformation, after 15 minute incubation, was
29
performed using 3x105 cells.mL-1 with approx. 1 µg of plasmid (pEarley HA-PrdCBF1 and
pEarley HA-PrdCBF2). Transformed protoplasts were cultured on 24-well plaques with B5-GM
medium [B5 powder (Duchefa) – 3163.98 mg.L-1 - with 0.34M glucose and mannitol, adjusted to
pH 5.5] for 16h or 2 days. Protein extracts were recovered after these periods by protoplast lysis
using 100 µl Lacus Buffer (Appendix, page V) and centrifugation a maximum speed for 1 min.
Supernatants were recovered, frozen in liquid nitrogen and stored at -80ºC.
L. Protein Extraction and Quantification
Tissue samples for protein extraction were grinded in liquid nitrogen using a sterile sharp
glass rod or in a MM300 Tyssue Lyser (Retsch). Grinded tissue (100 mg) was homogenized
with 200-300 µL of protein extraction buffer (Appendix, page V) for 5 minutes in the Tyssue
Lyser. Samples were then centrifuged at maximum speed (15m in 4ºC) and the supernatant
was recovered and stored at -80ºC. Quantification was performed through the Bradford Assay
using 1-2 µL of each protein extract in 18 µL of PEB buffer and 250 µL of Bradford Reagent
(Sigma-Aldrich). A standard curve was obtained using serial dilution of bovine serum albumin
(BSA) obtained from 1 mg.mL-1 stock solution. Dilutions of 1:5 of the protein sample were often
made in order to meet the values within the calibration line. Expected molecular size was
predicted using Genious software (BioMatters, New Zealand).
M. Western Blotting
The system used for Western blotting was the Mini-Protean Tetra Cell (BioRad). Equal amounts
of total protein extracts (75 µg or 100 µg) were mixed with 2-5X SDS-PAGE Loading Buffer for
protein electrophoresis in a 12% resolving gel and 5% stacking gel performed at 30A per gel in
TGS 1X buffer (from a TGX10 Stock Buffer, BioRad). Proteins were then transferred to a
polyvinylidene fluoride (PVDF) membrane (PerkinElmer, USA) at 100V in TG 1X buffer.
Temporary staining of the membrane to check for efficient protein adhesion was done using
Ponceau Stain (Sigma-Aldrich). Membranes were blocked with a solution of TBS 1X and 5%
non-fat dry milk and then probed with a primary antibody – anti-HA (Mouse Monoclonal HA-
probe [F-7] HRP, Santa Cruz Biotechnology) – at varying concentrations (1:1000-1:10.000) in
blocking solution, washed with TBS 1X and then probed with anti-mouse (Goat Peroxidase
Conjugated Affinity Purified anti-Mouse IgG Secondary Antibody, SH023, ABM) antibody at
varying concentrations (1:5000-1:40.000). After another washing step with TBS 1X, membranes
were immersed in the mixture of detection solution (Western Lightning Plus ECL, PerkinElmer)
and exposed to a Hyperfilm ECL film (Amersham, UK) inside an X-Ray Hypercassette
30
(Amersham). The film was developed with Kodak GBX developer and fixer. Buffers used are
described in Appendix, page VI. Another primary antiboby recognizing the same epitope as the
previous one was also used as alternative (Mouse Monoclonal Anti-HA-Alkaline Phosphatase
[F-7], Sigma-Aldrich) at 1:1000 concentration using similar hybridization conditions. However
this specific antibody did not require incubation with the secondary antibody. On these assays
75 and 100 µg of total protein extract were used for electrophoresis. For actin protein detection
a primary antibody was used (Anti-Actin I-19 goat polyclonal IgG, Santa Cruz Biotechnology) at
1:1000 in 4ºC overnight incubation and then a secondary antibody (Anti-Goat H2310 IgG-HRP,
Santa Cruz Biotechnology) was applied. Membranes were colored with Comassie staining for
loading control observation. Membranes and films were scanned using LabScan software and
ImageScanner (Amersham). Stripping for reprobing was done for 5 to 30 minutes in fresh
stripping solution (Appendix, page VI).
31
Results
Selection of positive overexpressing lines
One of the first main objectives of this work was to obtain multiple lines of plants
overexpressing the Prunus dulcis PrdCBF1 and PrdCBF2 genes in order to have material for
study. However, from the 9 T1 lines obtained for the HA-PrdCBF1 transgene and 11 T1 lines for
the HA-PrdCBF2 transgene, which were able to grow in selection media, only 1 of each was
effectively expressing the transgene (Figure 1A). In fact, some of these false positives, like HA-
PrdCBF1.7 exemplifies, showed amplification of the transgene through PCR using genomic
DNA(Figure 1B) but no accumulation of the transcript was observed (Figure 1A).
Figure 1 – Validation of positively transformed plants. (A) Semi-quantitative RT-PCR on cDNAs obtained
from leaves of T1 transgenic lines (HA-PrdCBF1.1, 1.7 and 2.4), grown under normal conditions. WT (col-
0) - wild-type Columbia plants - were used as a negative control. The number of PCR cycles is indicated
on the right. HA-PrdCBF1 transgene accumulation did not occur in positive line HA-PrdCBF1.7. However
PCR amplification from DNA of this line showed amplification (B) confirming its transgene nature. It is
Three T1 lines, including HA-PrdCBF2.4, showed a substantial developmental
insufficiency and bizarre dwarf phenotypes that led to delayed flower emergence. Previously it
was described that CBF transgene overexpression in plants resulted in a dwarf phenotype due
to an accumulation of growth-retardation DELLA proteins, which could be reverted by
exogenous applications of gibberellic acid (GA3) (Achard et al., 2008). Anthesis was also
affected, leading to hindered fertilization. In fact, flower buds often remained closed in these
lines and they were unable to generate seed-producing siliques. Given this, lines with affected
growth were very hard to maintain and often perished without producing any viable seeds
(Figure 2). Exogenous application of gibberellins (GA) was able to revert growth retardation only
32
to some extent, which was not enough to allow efficient flower development and seed
production (data not shown).
Figure 2 – (A) Transgenic PrdCBF1 overexpressing plants (HA-PrdCBF1.5 and HA-PrdCBF1.7).
Comparison of dwarf phenotype line HA-PrdCBF1.5 and normal (similar to WT) phenotype line HA-
PrdCBF1.7 56 DAG (56 days after germination). (B) Close-up of HA-PrdCBF1.5 line 56 DAG. (C and D)
Close-up HA-PrdCBF1.5 line 87 DAG showing flower developmental and functional deficiency and
hampered survival.
Due to the absence of seeds the subsequent assays were conducted using only two T1
lines (Figure 3): HA-PrdCBF1.1 (Figure 3C), overexpressing PrdCBF1, which showed WT-
similar phenotype (Figure 3A); and HA-PrdCBF2.4 (Figure 3B) which showed obvious dwarfism,
but was still able to produce some viable seeds. Additionally, the development of homozygous
lines was also problematic due to transgene silencing events, which will be addressed ahead in
this chapter. This situation was far from ideal as the use of homozygous lines, not only would
provide a more stable expression and functional stability of the transgene but also would avoid
the use of selection media supplemented with antibiotics and herbicides.
A B
C
D
33
Figure 3 – Comparison of wild-type Arabidopsis plants (A) with transgenic T1 lines HA-PrdCBF2.4 and
HA-PrdCBF1.1 (20 DAG) (B and C). The PrdCBF2 line (B) shows a clear dwarf phenotype.
Transcript expression of cold- and growth-related genes in T1 overexpressing lines
CBF genes are involved in downstream activation of cold-regulated genes (CORs)
containing the CRT/DRE motifs in their promoters. Overexpression of CBF transcription factors
(TFs) of different origins (in A. thaliana), was shown to lead to constitutive activation of several
genes from the endogenous CBF regulon without any previous cold exposure (Gilmour et al.
2000; Liu et al. 1998; Siddiqua and Nassuth 2011). To verify if PrdCBF1 and PrdCBF2 would be
able to transcriptionally activate genes from the Arabidopsis CBF regulon, several COR genes
confirmed as upregulated by CBFs were studied: AtXero2 (closest homolog to the Prunus
persica DHN1) a predicted target for CBF TFs in this species (Bassett et al., 2009), AtCOR15A
(Thomashow et al. 2001) and AtRD29A (Medina et al., 2010), with accession numbers
NM_114957, NM_129815 and NM_124610, respectively. For the sake of clarity, PrdCBF1-2
were named following the order of their identification, so they are not necessarily direct
homologs to the AtCBF1 and AtCBF2 from Arabidopsis. RNA was extracted from 18 days-old
transgenic (T1) and wild-type plants (WT), growing at room temperature (RT) or after 6 hours of
cold stress treatment (0ºC). Semi-quantitative RT-PCR was performed using Arabidopsis alpha-
tubulin (AtTubulin) as the control house-keeping gene, as it showed the least variation when
compared to another common house-keeping gene (AtActin1) (data not shown).
PrdCBF1-2 transgenes showed clear accumulation in both transgenic lines, although
superior in HA-PrdCBF2.4, especially at room temperature. This is consistent with a
A B C
34
temperature independent upregulation due to the constitutive overexpression with 35S
promoter. A. thaliana CBF1 (AtCBF1) expression was at a basal level in both HA-PrdCBF1.1
and wild-type plants (WT) at RT and exponentially increased in the cold treatment. However, in
HA-PrdCBF2, expression of AtCBF1 was not detected under RT, although also showed similar
induction by cold stress. This may indicate that overexpression of HA-PrdCBF2 could have a
negative impact on AtCBF1 expression under regular growth conditions.
Xero2 (AtXero2) and COR15A (AtCOR15A) are both genes encoding membrane
cryoprotective proteins regulated by CBF activity and were expressed at low levels at RT, but
upregulated by cold, in WT plants. However, HA-PrdCBF2.4 line showed a clear upregulation of
both genes at RT, leading to the conclusion that these cold acclimation protein transcripts are
present in transgenic plants even without any previous cold exposure. Surprisingly HA-
PrdCBF1.1 showed no activation of these genes at room temperature and the transcript
accumulation was similar to WT plants. RD29A (AtRD29A) is also a COR (AtCOR47) connected
to the CBF pathway but also responds to drought and salt stress, as well as abscisic acid (ABA)
(Huang et al., 2011). It shows similar activation patterns observed by AtXero2 and AtCOR15A.
Both GA20oxidase1 (AtGA20ox1) and GA2oxidase3 (AtGA2ox3) are genes encoding
enzymes involved in growth-related GA regulation pathway, which is proven to be affected by
CBF expression (Achard et al., 2008). The first one is involved in the biosynthesis of bioactive
gibberellins while the second one belongs to a family of enzymes connected to GA deactivation
(Thomas et al., 1999). Once again HA-PrdCBF1.1 showed a similar expression pattern to that if
WT plants. Conversely HA-PrdCBF2.4 presented a marked upregulation of GA20oxidase1 in
the cold stressed plants and also of GA2oxidase3 (although less clear) in both treatments.
35
Figure 4 – Transcript accumulation of CBFs (HA-PrdCBF1, HA-PrdCBF2 and AtCBF1), COR and GA-
related genes in WT, HA-PrdCBF1.1 and HA-PrdCBF2.4 (18 DAG). Gene expression analysis was
performed by semi-quantitative RT-PCR. Transcript expression at normal growth temperature of 22ºC
(RT) was compared to that obtained after 6 hours of cold treatment at 0ºC. The number of PCR cycles is
indicated on the right.
A repetition of this analysis for both AtGA2ox3 and AtRD29A in the HA-PrdCBF2.4 line
and WT plants allowed a clearer interpretation of these results (Figure 5). An increase in PCR
cycles for AtGA2oxidase3 corroborates the distinct upregulation in HA-PrdCBF2.4 plants at
room temperature and in cold stress treated plants, whose transcript accumulation is similar to
wild-type plants. Together with the results obtained for AtGA20ox1, this represents an evidence
for the intervention of HA-PrdCBF2 in the GA regulation as suggested by Achard et al. (2008).
The decrease of PCR cycles also allowed to observe a more distinct pattern of the general
stress-responsive (AtRD29A) which shows a much stronger regulation in the transgenic line at
RT compared with WT, indicating a putative activation of this gene by HA-PrdCBF2.
36
Figure 5 – Transcript accumulation of HA-PrdCBF2, AtGA2ox3 and AtRD29A of HA-PrdCBF2.4 T1 line
and WT (18 DAG). Transcript expression at normal growth temperature of 22ºC (RT) was compared to
that obtained after 6 hours of cold treatment at 0ºC. The number of PCR cycles is indicated on the right.
To further investigate HA-PrdCBF2 putative regulatory involvement in the GA pathway,
we have grown HA-PrdCBF2 T1 line and WT in GA3-supplemented medium during 18 days.
This treatment was performed together with replicate assays for both cold (0ºC) and RT
conditions and gene expression analysis was performed (Figure 6).
As expected, constitutive expression can be observed for the HA-PrdCBF2 gene
transcript in the transgenic plants, showing a stable accumulation in all treatments. The
endogenous AtCBF1 seems to be once again downregulated by the HA-PrdCBF2 gene
overexpression in both room temperature and GA treatments when compared to the wild-type
pattern, reinforcing the hypothesis that the transgene may be repressing endogenous CBF1
transcription.
37
Figure 6 – Transcript accumulation of CBFs (HA-PrdCBF2 and AtCBF1), COR and GA-related genes in
HA-PrdCBF2.4 T1 line and in WT.(18 DAG). Transcript expression at normal growth temperature of 22ºC
(RT) was compared to that obtained after 6 hours of cold treatment at 0ºC or growth in 50 µM GA3
supplemented medium. The number of PCR cycles is indicated on the right.
An upregulation of the gibberellin pathway oxidases in the transgenic plants can also be
confirmed, with AtGA20ox1 showing a strong transcript accumulation at both RT and 0ºC
treatments, but with a downregulation happening in the GA3 treatment due to the exogenous
gibberellin application. AtGA2ox3 is once again only expressed in transgenic plants, although
not in RT, which contrasts to previous observations (Figure 5). Nevertheless, there is a clear
expression of AtGA2ox3 transcripts in 0ºC in HA-PrdCBF2.4 and a less evident accumulation in
the GA3 treatment. HA-PrdCBF2 overexpression seems to lead to a variation in the feedback
loop mechanism of the GA pathway although it is not evident how that takes place.
38
Electrolyte leakage of overexpressing T1 lines
To infer if PrdCBF1-2 overexpression could increase cold tolerance as previously
suggested (Gilmour et al. 2000), membrane stability and freezing damage under cold stress and
its ability to maintain cell functionality was analyzed through an electrolyte leakage assay.
Averages for the replicates were performed for leaked and total electrolytes leading to the ratios
represented in Figure 7. We observe that the HA-PrdCBF2.4 line presented only a 27% loss at -
4ºC when compared to 70% in WT and a 79% to 94% loss, respectively at -8ºC. It was also
observed that HA-PrdCBF1.1 line seemed to have no enhanced ability of membrane
functionality preservation since the percentage of leaked electrolytes were closely similar to WT
(74% to 70% at -4ºC and 89% to 94% at -8ºC, respectively). The results obtained for HA-
PrdCBF2.4 were confirmed in a replicate analysis (Figure 8). As expected HA-PrdCBF2.4 line
holds a higher capacity of maintaining cell membrane integrity during cold stress as compared
with non-acclimated WT. It lost only 65% of total electrolytes at -4ºC when compared to WT
93% loss, 65% and most notably at -8ºC, losing only 76% total electrolytes contrasting to a 98%
loss in wild-type plants.
Figure 7 – Verification of freezing damage through an electrolyte leakage test for HA-PrdCBF1.1, HA-
PrdCBF2.4 lines and WT (28 DAG) by measured leaked electroyle/total electrolytes ratio. Leaves from
these plants were exposed to decreasing temperatures and three collection points (0, -4 and -8ºC) were
performed in the duration of the test. The asterisk represents significant difference (p<0.05), determined
by T-student test .
0.01
0.27
0.79
0.01
0.74
0.89
0.01
0.70
0.94
0.0000
0.2000
0.4000
0.6000
0.8000
1.0000
1.2000
0ºC -4ºC -8ºC
HA-PrdCBF2.4
HA-PrdCBF1.1
WT (col0)*
39
Figure 8 – Verification of freezing damage through an electrolyte leakage test for HA-PrdCBF2.4 lines
and WT (28 DAG) by measured leaked electrolyes/total electrolytes ratio. Leaves from these plants were
exposed to decreasing temperatures and three collection points (0, -4 and -8ºC) were performed in the
duration of the test. The asterisk represents significant difference (p<0.05), determined by T-student test .
Collectively, these results showed that HA-PrdCBF2 overexpression lead to a low-
temperature tolerance to withstand cold stress without any previous low temperature exposure
which is probably related to the constitutive activation of COR genes such as AtCOR15A,
AtXERO2 and also AtRD29A (Figures 4, 5 and 6).
Root growth under salt stress treatment of T1 overexpressing lines
Activation of the CBF regulon by constitutive overexpression of CBF genes often lead to
increased tolerance, not only to cold, but sometimes to drought (Liu et al., 1998) and salt
(Kitashiba, 2004) as well, suggestion an overlap in stress response. To check for any possible
variations in salt tolerance between transgenic CBF overexpressing plants and WT under
normal growth medium or supplemented with NaCl (85 mM was the concentration used after
method optimization). Plants were grown in vertically placed plaques and roots were measured
after 2 days (Figure 9A) and 5 days (Figure 9B) of growth in salt-containing medium.
0.07
0.65 0.76
0.12
0.93 0.98
0.00
0.20
0.40
0.60
0.80
1.00
1.20
0ºC -4ºC -8ºC
HA-PrdCBF2.4
WT (col0)
*
40
Figure 9 – Example of vertical root growth measurement in transgenic PrdCBF2 overexpressing plants
(HA-PrdCBF2.4) and wild-type plants (WT) after 2 (9 DAG) (A) and 5 days (12 DAG) (B) after transfer to
sodium chloride (NaCl 85 mM) supplemented medium.
Analysis of the 3 day growth calculated by the difference between the two measurement
points is graphically represented in Figure 10A. As it is visible in the graphic, HA-PrdCBF2.4
seems to have decreased root growth with and without salt treatment, possibly linked to the
dwarf phenotype discussed earlier and its general growth deficiency. Still, no significant
increase in root growth is observed in for any transgenic line under salt, as compared to control.
Furthermore, analyzing the ratio between control and salt-grown plants (Figure 10B) we see no
major or significant difference in HA-PrdCBF2.4 root growth in comparison with WT, since both
have shown approximately 50% growth retardation in comparison to control. HAPrdCBF1.1
appears to have a slight enhanced growth under salt (63% root growth) over both HA-
PrdCBF2.4 and WT, still not statistically significant.
HA-PrdCBF2.4 WT
(col0)
HA-PrdCBF2.4 WT
(col0)
41
Figure 10 – Root growth under salt stress (85 mM NaCl-supplemented medium). (A) Total vertical root
growth of transgenic plants HA-PrdCBF1.1 (PrdCBF1.1) and HA-PrdCBF2.4 (PrdCBF2.4) as well as wild-
type plants (WT) after 3 days growth upon transfer to salt stress-inducing medium (NaCl) and regular MA
(control). (B) Ratio between root growth of NaCl-treated plants and control plants.
Protein expression and characterization of T1 overexpressing lines under cold stress
and other treatments
One crucial aspect of this thesis was to analyze and characterize transgene-encoded
protein expression through Western blotting. This was possible through the fusion of a mouse
hemaglutinin tag (HA) in frame to the N-terminal portion of the encoded PrdCBF1-2 proteins. In
addition to confirming the correct translation of the transgene, another additional goal was to
study possible post-translational regulation under different conditions, such as comparing
protein accumulation under RT and cold stress (0ºC). After protein was extracted from plants
submitted to both RT and cold treatments, protein quantification was performed using the
Bradford test, and equal amounts of protein were separated by gel electrophoresis. Western-
blotting was then performed. However we struggled to efficiently detect the fusion-proteins of
interest, due to unspecific or inefficient hybridization, which lead us to a series of optimization
44.45
70.35
32.93
61.33
40.24
78.28
0
10
20
30
40
50
60
70
80
90
NaCl control
HA-PrdCBF1.1 HA-PrdCBF2.4 WT (col0)
Ro
ot
Gro
wth
(m
m)
0.63
0.54 0.51
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
Ra
tio
A B
42
attempts. For this we attempted different concentrations of total protein extract for gel
electrophoresis or different concentrations of both primary (anti-HA probe) and secondary (anti-
mouse with HRP for detection) antibodies, different incubation times for probing, various
washing procedures and even different detection solutions. Still no conclusive results were
obtained. As observed in Figure 11, and expecting a predicted molecular size of around 36kDa,
specific bands were not observed in the film. We were only able to observe a varying number of
unspecific bands indicating unspecific hybridation to endogenous proteins with several
molecular weights. A positive control for the HA tag was always detected though, suggesting
that that the HA-antibody recognition was working, although it was unable to detect the specific
HA-PrdCBFs fusion proteins (Figures 11A, 11B and 11C).
Given the effect of CBFs overexpression in inducing a stress response in Arabidopsis
even at RT, one of the hypotheses raised was could the putative occurrence of a translation
suppressive mechanism in these plants, or too rapid protein turn-over that would not allow for
efficient accumulation of PrdCBF1-2 proteins appropriate for detection, even in constitutive
overexpression. To test this hypothesis, we first induced transient expression of HA-PrdCBF1
and HA-PrdCBF2 through protoplast transformation, using the same plasmids used for
Arabidopsis transformation. However, results obtained were similar and specific protein
accumulation was not observed (Figure 11D). Additionally, to test the putative effect of the
proteasome in the fusion-protein a proteasome inhibition assay was performed with MG132, an
agent that blocks the proteasome activity and enables an accumulation of proteins that
otherwise would be degraded. Unfortunately the results were once again inconclusive and only
the same unspecific bands were obtained in final detections of both MG132 treated plants
(Figure 11F) and protoplasts (Figure 11E).
43
Figure 11 – Detection of the proteins through Western blotting using HA-PrdCBF1.1, HA-PrdCBF2.4 lines
and WT (18 DAG) or through transient expression in protoplasts. 100 g of total protein extract was used
for plant studies and 50 g of total protein was used for protoplast studies. (+) A positive control for the
HA-tag is shown on the right side of all blots. (A, B, C) Tentative detection in proteins extracts of
transgenic and WT plants from RT and 0ºC treatments. (D) Tentative detection in proteins extracts of
transformed (CBF1 and CBF2) protoplasts after overnight (ON) and 2-day (2d) incubation periods. (D)
Tentative detection in proteins extracts of transformed (HA-PrdCBF1 and HA-PrdCBF2) and MG132-
treated protoplasts after an overnight incubation period. (E) Tentative detection in proteins extracts of
transgenic and wild-type plants from RT and 0ºC assays after being treated with MG132 in contrast to
control plants (DMSO).
44
The antibody used could have decreased sensibility due to an early production date. It
was thought that the results observed, both in protein extracts as well as a purified extract
fusion-protein used as HA positive control, could be due to unspecific hybridization to the most
abundant proteins present in each extract. To assert higher specificity to the fusion proteins a
different anti-HA antibody was used. With the use of a new antibody we managed to obtain a
positive and specific detection of the HA-PrdCBF2 protein in the HA-PrdCBF2.4 T1 plants, with
the expected molecular weight of 36kDa. Additionally, it was not observed any variation in either
molecular weight or accumulation between RT and 0ºC treatments (Figure 12), suggesting the
absence of post-translational modifications under these conditions. Conversely, there was no
detection of HA-PrdCBF1 in the HA-PrdCBF1.1 line, which indicates that the protein is not being
expressed. This may correlate with the previously observed lack of activation of COR genes,
and suggest that in this line a co-suppression mechanism is affecting the correct translation of
the transgene.
Figure 12 – Positive detection and putative expression of HA-PrdCBF2 protein with the estimated 36kDa
of molecular weight in 18-days old transgenic plants (HA-PrdCBF2.4) through Western blotting after RT
and 0ºC treatments. No PrdCBF1 protein could be detected in transcript-accumulating transgenic plants
(HA-PrdCBF1.1). Wild-type plants (WT) presented no protein detection. A protein used as loading control
is presented below after Comassie coloring.
As it had been observed through semi-quantitative RT-PCR that HA-PrdCBF1-2
transcript expression was more highly activated if low-temperature shock was applied towards
the end of the light period (Barros, 2011). We went on to check if there was any significant
different protein accumulation during the day or night periods through an assay of light/dark
variation in this constitutive overexpression system at RT. However, it was observed that there
PrdCBF2
loading
control
45
was no substantial difference in protein expression between the day and night treatments, as
accumulation of HA-PrdCBF2 seemed to be the same in both extracts (Figure 13).
Figure 13 – Positive detection and putative expression of HA-PrdCBF2 protein with the estimated 36kDa
of molecular weight in 18-days old transgenic plants (HA-PrdCBF2.4) through Western blotting after a
light variation (day- and night-collected plants) treatment.
To draw connections of HA-PrdCBF2‟s putative involvement in the GA pathway, protein
extracts were obtained from the same lines used from the assay done for the transcript
expression assays comparing cold and GA3 treatments. There seemed to be no clear variation
regarding protein accumulation in transgenic plants submitted to the different treatments which
suggests that none of these factors affect HA-PrdCBF2 at the post-translational level (Figure
14).
Figure 14 – Positive detection and putative expression of HA-PrdCBF2 protein with the estimated 36kDa
of molecular weight in 18-days old transgenic plants (HA-PrdCBF2.4) through Western blotting after RT,
GA3 and 0ºC treatments along with control wild-type plants (WT).
´
46
Selection of homozygous and heterozygous T2 and T3 overexpressing lines
As previously mentioned, of the two T1 lines selected for stress treatment studies only
the T1 HA-PrdCBF2.4 transgenic line seemed to present the dwarf phenotype coinciding with
constitutive cold acclimation and tolerance. The obtention of homozygous lines was a primary
objective to enable more stable expression and more consistent assay conditions. However that
also proved to be a challenge as the subsequent generations started to present growth
recovery. In fact, homozygous plants were obtained in T3 generation, but these showed no
phenotypical similarity to the transgenic T1 line and appeared to be very similar to the WT
plants (Figure 15).
Figure 15 – Comparison of wild-type Arabidopsis plants with transgenic lines (T1 line HA-PrdCBF2.4 and
T3 homozygous line HA-PrdCBF2.4.4.4H). The T1 line shows a clear dwarf phenotype concurrent with
CBF overexpression.
Transcript expression of CBFs, cold- and growth-related genes in T2 and T3
overexpressing lines and respective protein detection
To verify if this loss of phenotype was related to transcript or protein accumulation of the
transgene or transgene-encoded protein, the same previous assays were repeated for the
homozygous lines, both for the HA-PrdCBF2.4.4.4H homozygous line as well as a HA-PrdCBF1
transgenic homozygous T2 line HA-PrdCBF1.1.9H. RNA extraction was done for semi-
47
quantitative RT-PCR transcript accumulation verification (Figure 16). It was observed that
homozygous T2 line HA-PrdCBF1.1.9H showed no accumulation of the HA-PrdCBF1
transgene, in opposition to the T1 heterozygous line (Figures 4) which showed a relative level of
transgene expression. This suggests that the transgene was fully repressed in the homozygous
plants. Consistently the expression pattern of all the additional genes analyzed was similar to
WT (Figures 4 and 6). On the other hand HA-PrdCBF2.4.4.4H showed a considerable
downregulation of the HA-PrdCBF2 transgene when compared with the T1 HA-PrdCBF2.4 line
(Figure 4, 5 and 6) and the activation of downstream cold-responsive genes such as COR15A
and Xero2 under RT conditions was not as pronounced.
Figure 16 – Transcript accumulation of CBFs (HA-PrdCBF1, HA-PrdCBF2 and AtCBF1), cold-responsive
genes and growth-related genes in 18 days-old transgenic homozygous T2 line overexpressing HA-
PrdCBF1 (HA-PrdCBF1.1.9H), homozygous T3 line overexpressing HA-PrdCBF2 (HA-PrdCBF2..4.4.4H)
and wild-type plants (WT) at a constant temperature of 22ºC (RT) and after 6 hours of cold treatment at
0ºC. The number of PCR cycles is indicated on the right.
Another assay was performed to check transcript accumulation loss in HA-PrdCBF2.4
T3 lines in comparison to the previously studied T1 line. These results were corroborated
(Figure 17), even though transcript accumulation for HA-PrdCBF2.4.4.4H T3 line was
48
considerably lower than in previous analysis (Figure 16) using the same PCR conditions,
probably due to RNA extractions from plants from a following assay, although under equivalent
conditions. Nevertheless the patterns appeared to match both assays and in Figure 17 we can
see there is a very faint expression in the HA-PrdCBF2.4.4.4H T3 line in comparison to a strong
accumulation in T1 HA.PrdCBF2.4. It can also be observed that a newly tested heterozygous T3
line HA-PrdCBF2.4.4.5, also with normal phenotype, presented also a low expression of
transgene transcript, although it appeared to be slightly higher than its homozygous counterpart.
This means that the repression in transgene expression occurred between generations, and
was not exclusive of homozygous genotypes and could possibly vary amongst homo- and
heterozygous plants.
Figure 17 – Transcript accumulation of HA-PrdCBF2 in 18 days-old transgenic PrdCBF2 overexpressing
lines – T1 lines HA-PrdCBF2.4, homozygous T3 line HA-PrdCBF2..4.4.4H and heterozygous T3 line HA-
PrdCBF2.4.4.5 - and wild-type plants (WT) at a constant temperature of 22ºC (RT) and after 6 hours of
cold treatment at 0ºC. The number of PCR cycles is indicated on the right.
By Western blotting it could be observed that no protein was detected in the
homozygous T3 line for HA-PrdCBF2 (Figure 18), showing that the transcript accumulated in
the T3 line (Figure 16 and 17) was not enough to allow subsequent protein detection.
49
Figure 18 – Positive detection and putative expression of HA-PrdCBF2 protein with the estimated 36kDa
of molecular weight in 18-days old T1 transgenic line HA-PrdCBF2.4 and T3 homozygous line HA-
PrdCBF2.4.4.4H through Western blotting after RT and 0ºC treatments along with control wild-type plants
(WT). A protein used as loading control is presented below after Comassie coloring.
Hypomethylation treatment of overexpressing lines, transgene transcript expression and
protein expression
In the past it was verified that transcriptional silencing often occurred in transgenes
associated with the 35S overexpression promoter and seems to increase developmentally
(Elmayan and Vaucheret, 1996; Mishiba et al., 2005). Given this, we have conducted a
hypomethylation assay, so all the putative methylated cytosines occurring in the transgene
region, as well as any others in the genome, would be removed. Assays were performed with
hypomethylation agent 5-aza-2‟-deoxycytidine (5Aza-dC or 5-AC). 5-AC treated plants and
control plants were grown under normal conditions and semi-quantitative RT-PCR was
performed to substantiate transcript accumulation. As it is shown in Figure 19, HA-
PrdCBF2.4.4.4H had a very dim transcript accumulation when compared with HA-PrdCBF2.4 at
control conditions, but constitutive HA-PrdCBF2 transgene expression was successfully
recovered in the HA-PrdCBF2.4.4.4H plants with the 5-AC assay, showing similar transcript
accumulation to the T1 line.
PrdCBF2
loading
control
50
Figure 19 – Semi-quantitative RT-PCR transcript accumulation of PrdCBF2 in 18 days-old transgenic
PrdCBF2 overexpressing lines – T1 lines HA-PrdCBF2.4 and homozygous T3 line HA-PrdCBF2.4.4.4H -
and wild-type plants (WT) after 5AC treatment and under control conditions.
Detection through Western blotting after protein extraction confirmed these results as
HA-PrdCBF2.4.4.4H shows a considerable protein accumulation with the hypomethylation
treatment, similar to the one observed in the HA-PrdCBF2.4 line (Figure 20).
Figure 20 – Positive detection and putative expression of HA-PrdCBF2 protein with the estimated 36kDa
of molecular weight in 18-days old T1 transgenic line HA-PrdCBF2.4 and T3 homozygous line HA-
PrdCBF2.4.4.4H through Western blotting after 5AC treatment and under control conditions, along with
wild-type plants (WT). A protein used as loading control is presented below after Comassie coloring.
PrdCBF2
loading
control
51
Discussion
The main objective of the work performed for this chapter was to describe in an
heterologous system the functional expression of the two Prunus dulcis CBF transcription
factors (TF), PrdCBF1 and PrdCBF2 (Barros, 2011). It was proposed that possible variations of
transgene expression and exogenous protein may occur under different temperature and light
treatments, as well as the putative activation of genes of the CBF regulon responsible for
increased cold tolerance.
We were able to analyze both of the almond TFs in the Arabidopsis model plant, but
problems concerning growth retardation and transgene silencing lead us to successfully obtain
only two positive lines, one for each transgene transformation. The HA-PrdCBF2 T1 line
presented the dwarf phenotype but the HA-PrdCBF1 T1 line did not (Figure 3). We observed
that the PrdCBF1 transgene was positively transcribed in both RT and 0ºC treatments but did
not activate any of the cold-regulated genes transcripts (Figure 4), as well as failing to induce
any protection against freezing damage (Figure 11), as it behaved mostly like control non-
acclimated plants on both accounts. This went on to be justified by the lack of detection of the
protein through Western blotting (Figure 12) in this overexpression positive line as it did not
enhance tolerance under non-acclimated conditions. It was observed that the protein was not
activating the CBF regulon genes and their encoded COR proteins (Bassett et al., 2009;
Medina, et al., 2010; Thomashow et al., 2001), responsible for constitutive cryoprotection.
These could be due to a post-transcriptional repression that does not allow the protein to
become active or functional, as evidenced by these results. More lines need to be obtained and
tested.
The irregular dwarf phenotype described in the T1 line for PrdCBF2 had been previously
observed in some overexpression studies of the CBF and CBF-like AP2 family transcription
factors (Magome et al., 2004; Achard et al., 2008, Siddiqua and Nassuth, 2011) and proven to
be caused by CBF cold-upregulated transcript accumulation of genes encoding DELLA proteins,
which are growth repressors in the gibberellin (GA) pathway (Achard et al., 2008). HA-PrdCBF2
overexpression leads also to an accumulation of gibberellin pathway-associated enzymes, one
of which (AtGA2ox3) is associated with GA degradation (Figures 5 and 6). This is consistent
with the proposed model by Achard et al. (2008) that shows that CBFs regulate GA levels
during cold exposure, leading to a decrease in growth and increase of low temperature
acclimation that is caused in part by the DELLA proteins, which under normal circumstances are
52
degraded by bioactive GAs. It was also observed in the HA-PrdCBF2 overexpressing line an
upregulation of an enzyme responsible for GA biosynthesis activation, GA20oxidase1 (Figures 4
and 6), in HA-PrdCBF2.4, which was repressed by GA3 treatment (Figure 6). Both the increase
observed in the HA-PrdCBF2.4 line and the decrease in GA treatments could be related to the
feedback loop mechanism proposed to regulate the GA pathway. The deduced decrease in
endogenous GAs, observed by Achard et al. (2008) in AtCBF1 overexpressing plants, which
would also be expected for HA-PrdCBF2.4, may cause the induction of GA20oxidase1 to
balance this effect. On the other hand, the treatment with GA3 may dampen said result over
induction in transgenic plants. AtGA2Ox3 transcript seems to accumulate unevenly in the
repetitions done for each treatment (Figures 5 and 6), although it was also shown to be
downregulated by growth in GA-supplemented media (Figure 6). There are many other similar
gibberellin pathway oxidases in action in this mechanism (Achard et al., 2008), and its still
indefinite regulation is too complex to allow any further conclusions.
There did not seem to be any variation in HA-PrdCBF2 expression between plants
grown in GA-supplemented media and the other treatments, neither in transcript accumulation
(Figure 6) nor in subsequent fusion protein detection (Figure 14). An additional assay that
combines both cold and GA treatments could be performed and be antagonistic to these
observations, as it was previously shown that GA repressed cotton (Gossypium hirsutum) CBF-
like GhDREB1 RNA accumulation under those conditions (Shan et al., 2007). Nonetheless, we
show that overexpression of HA-PrdCBF2 has a clear effect in GA pathway enzymes and
possibly causes a constitutive accumulation of DELLA proteins, leading to increased tolerance
but also retarded growth and dwarf phenotype (Figure 3). This phenotype, which did not revert
fully under exogenous GA application, is a major impediment in functional studies as multiple
positive lines and obtention of further generations is apparently hampered.
The dwarf phenotype was also previously described in DDF1 overexpression (Magome
et al., 2004; Magome et al., 2008), which is an AP2 family CBF-like transcription factor. In fact,
phylogenetic analysis revealed that PrdCBF2 clustered more closer to DDF1 than to the other
Arabidopsis CBF genes, which may suggest a putative common ancestor (Barros, 2011). It also
upregulated a growth-repressing GA2 oxidase enzyme (GA2ox7), whose null mutant showed
increased high salt tolerance as well as growth recuperation (Magome et al., 2008). The
PrdCBF2 overexpression showed no difference in salt tolerance under the tested conditions
although it would be interesting to similarly silence the GA2oxidase3 gene in these
overexpressing transgenic lines and study the effect it has on cold and salt tolerance as well as
putative growth recovery, without losing expression.
53
The loss of transgene expression was observed when working with PrdCBF2 T3
overexpressing lines (Figures 16 and 17), as well as their inability to constitutively activate any
cold-regulated genes (Figure 16). Conjugated with the fact that T3 homozygous lines under
control conditions and cold treatment showed null protein detection (Figures 18), this lead us to
believe these lines had no enhanced cold tolerance without any previous low-temperature
exposure, no different from WT plants (Figure 4). There also seemed to be a slight
downregulation of the T3 homozygous line when compared to the T3 heterozygous line (Figure
17), when it would be expected to happen otherwise as the homozygous line has two copies of
the same gene allele instead of one.
Consequently it was proven that these observations were concurrent with transgene
silencing. This silenced state that occurs post-transcriptionally in overexpressing plants using
the 35S promoter can be reverted by application of an hypomethylation agent (Elmayan and
Vaucheret, 1996; Mishiba et al., 2005). The suppression of DNA methyltransferase activity,
allows new cells to activate full transcription of the transgene without any repressive silencing.
After treating homozygous T3 with hypomethylation agent 5-AC, these plants showed to recover
not only transcript accumulation (Figure 19) but also accumulation of protein, when compared
with the T1 line (Figure 20). 5-AC promotes inhibition of DNA methyltransferases and is capable
of incorporating itself in DNA, consequently replacing 5-methyl cytosine incorporation (Castilho
et al., 1999). It may be suggested that the constitutive cold acclimation state of silenced
transgenic lines can be recovered by application of an hypomethylation agent removes 35
promoter methylations. However, this hypomethylation is not transgene-specific and would
remove methylation from genes that should not be active under normal circumstances,
disrupting the whole metabolism. Arabidopsis with decreased methylation have been shown to
present developmental abnormalities, such as reduced apical dominance, smaller size, altered
leaf size and shape, decreased fertility and delayed flowering time (Finnegan et al., 1996). The
detected chromatin silencing can be associated with siRNAs, as double-stranded RNAs specific
to the 35S promoter and induced by the integration of T-DNA into were shown to repress
transgene expression in transformed Arabidopsis lines (Mlotshwa et al., 2010), although it is still
yet unknown how this is processed.
Transgene silencing has been proven to be age-related as it seems to increase almost
exponentially as plants become older (Elmayan and Vaucheret, 1996). Nevertheless it is
simultaneous interesting and unfortunate that in our studies this transgene silencing seems to
be also correlated to generational expression, as T1 plants showed strong transcript and protein
accumulation and T2 and T3 lines present diminished or null expression. This makes these
54
experimentally favored homozygous plants inadequate for further functional studies. An
explanation for the recovered phenotype of these transgene silenced lines can be found in the
stability brought by CG methylation. It was proposed that this type of methylation was essential
for transgenerational inheritance of epigenetic information and that non-heritable stress
responses may be associated with alteration of non-CG methylation patterns mediated by
siRNAs through the RNA-directed DNA methylation (RdDM) pathway (Mathieu et al., 2007).
Taken together with the demonstrated siRNA mediated methylation of the 35 promoter, this may
provide an explanation to why transgene silencing increases in subsequent generations, leading
to plants which would not present any enhanced tolerance to cold, even with hypomethylation
treatments. Consequently the use of other kinds of promoters may be preferable, such as an
additional constitutive Arabidopsis UBQ1 overexpression promoter (Holtorf et al., 1995) as well
as inducible promoters, of which soybean heat-shock promoter GmHSP17.3 (Holtorf et al.,
1995), yeast copper-inducible promoter (Granger and Cyr, 2001) and detergent-induced 12-
oxophytodienoic acid reductases promoters (Hunzicker, 2008) are putative and viable examples
for Arabidopsis transformation.
It has been documented that PrdCBFs showed differential expression patterns
depending on each time of the photoperiod the cold shock was applied, having a peak of
expression eight hours after exposure to low-temperatures in the night period in contrast to a
lower transcript accumulation in the day period, only regained towards the end of day (Barros,
2011). The results showed in HA-PrdCBF2 protein accumulation suggest that PrdCBF2 is not
regulated at the post-translational level by varying light conditions. Thus, the light-mediated
regulation may occur only at the transcriptional level. Arabidopsis has the ability to compensate
temperature variation in its circadian clock regulation (Gould et al., 2006), which was proven to
be different from the one observed in woody plants including the Prunus genus, especially
sensitive to temperature variations in their light regulatory mechanisms (Tanino et al., 2010).
The identification of this group of transcription factors through Western blotting is very
rare and only one account could be found in the bibliography. A hot pepper (Capsicum annuum)
CBF was previously detected with a monoclonal specific antibody and showed to induce protein
accumulation with cold treatments (Kim et al., 2004). Most CBF studies described relate only to
transcriptional induction and there are not many who focus on post-translational regulation of
these TFs. Variations linked to either upstream HOS1-mediated proteasome degradation (Dong
et al., 2006) or SIZ1-mediated sumoylation (Miura et al., 2007) under different treatments were
a possibility we went on to investigate, using a HA-tagged fusion protein, easily detectable
through Western blotting. As shown in Figure 14 the protein remains stable under cold stress
55
and GA application, as well as RT conditions, meaning the PrdCBFs do not seem to be post-
translationally regulated through these pathways, at least not under an overexpression system.
Although overexpression of PrdCBF1 in a heterologous system remains to be
successfully studied, this work proves that overexpression of PrdCBF2 in Arabidopsis results in
increased cold tolerance even without any previous low temperature exposure. Endogenous
downstream genes encoding proteins that protect the functionality of the cell membrane
(Steponkus et al. 1998; Thomashow 1999; Gilmour et al. 2004; Chinnusamy et al. 2007)
induced by cold and belonging to the endogenous CBF regulon, become constitutively activated
at room temperature conditions (Figure 4). This provides the transgenic plants enhanced
protection to cold stress and freezing damage than can be tested through electrolyte leakage
(Gilmour et al. 2000; Siddiqua and Nassuth 2011), as performed in our research (Figures 7 and
8).
The COR genes (AtXero2, AtCOR15A and AtRD29A) seemed to be equally transcribed
in the overexpressing plants under different treatments, in contrast to the WT plants which only
show a clear upregulation within cold stress conditions (Figure 6). These cold-responsive
dehydrins provide a clear enhancement of protection and stability of cell membranes that due to
extracellular ice formation suffers a decrease in water potential and consequently dehydrate
(Steponkus, 1984). This increase in freezing tolerance, observed in Figures 7 and 8, involves
documented changes in membrane lipid composition such as increased levels of fatty acid
desaturation in membrane phospholipids and level changes in several types of membrane
sterols and cerebrosides, as well as sucrose accumulation (Uemura and Steponkus 1999). This
later proved to enhance chloroplast freezing tolerance and protoplast survival from leaves of
nonacclimated transgenic plants expressing COR15A (Artus, 1996). There also appears to be a
slight downregulation of endogenous Arabidopsis CBF1 gene with exogenous PrdCBF2
expression, which would be in agreement with the suggested CBF self- and cross-regulation,
observed in Arabidopsis CBF2 repression of CBF1 and CBF3 (Novillo et al., 2004). However,
since only one line was studied this needs to be further confirmed in additional independent
lines.
It can be concluded that the stipulated goals for this chapter were accomplished in spite
of the difficulties arisen in selection of stable transgenic lines, with growth retardation evident by
the dwarf phenotyping and transgene silencing caused by methylation of the transgene locus.
However it was successfully proven that the Prunus dulcis CBF2 is not only involved in
gibberellin-mediated growth regulation under low temperature but is most notably capable of
constitutively activating Arabidopsis COR genes from the endogenous CBF regulon in an
56
overexpression system, which does not seem to affect protein stability through post-translation
mechanisms. PrdCBF2 successfully improved low-temperature tolerance in comparison to non-
acclimated Arabidopsis, once again proposing this tolerance regulation is highly conserved in
plants, and constitutes a viable gene to be used for constitutive cold acclimation and protection
to damage caused by freezing temperatures in other plant systems studies.
57
CHAPTER TWO:
Seasonal Expression in Field Plants
Some of the work conducted for this chapter is included in the elaboration of the following
manuscript:
Barros, P., Gonçalves., N. M., Saibo., N., Oliveira, M. M. Differential regulation of two cold-
responsive CBF transcription factors during early blooming in almond (Prunus dulcis
Mill.) (in preparation).
58
59
Introduction
Dormancy
As previously mentioned in the General Introduction, the main difference between
annual/biennal and perennial plants is the latter‟s need for meristematic latency and growth
arrest in order to survive winter months and undergo their annual cycle of seasonal
development. The sessile nature of plants led to the evolution of mechanisms that allows them
to endure unfavorable winter conditions after growth is arrested in the autumn. One of them is
the maintenance of growth buds in a quiescent state and, consequently, a strict regulation of
growth resumption happening only when the correct environmental cues are provided (Horvath
et al., 2003). This process occurs during perennial plants seasonal development and their
induced dormancy state.
Dormancy is enabled by growth cessation signaling that is provided by environmental
cues such as cold, dehydration and, most importantly, photoperiodism. In poplar, the
FLOWERING LOCUS T (FT) and CONSTANS (CO) genes were proven to be involved in
dormancy regulation by short-day (SD) exposure coincident with FT downregulation (Böhlenius
et al., 2006). Lang et al. (1987) described three separate types of dormancy, even though
signaling from all of them is interconnected in flower bud development regulation. All three types
regulate growth inhibition, be it from distal organs (paradormancy), internal buds
(endodormancy) or antagonistic environmental conditions (ecodormancy). Paradormancy, often
named apical dominance, is associated with plant architecture control and reproduction
stimulation. It is mainly controlled by auxin regulatory signaling but also by a balance provided
by other phytohormones such as growth promoters gibberellins (GA) and repressors abscisic
acid (ABA) and ethylene (Horvath et al., 2003). Endodormancy is related to physiological
changes in the dormant bud, imposed by environmental cues and conditioned by accumulation
of chilling temperatures (Horvath et al., 2003). Transition to endodormancy can be recognized
by post translational alterations in the cell, including the decreasing phosphorylation of cyclin-
dependent kinases (Espinosa-Ruiz et al., 2004). The need for woody perennials to meet their
chilling requirements during endodormancy is crucial to growth resumption and the timing of
dormancy break during ecodormancy. Ecodormancy on the other hand is mainly imposed by
environmental cues such as cold and dehydration stress, as well as marking the transition from
the previous stage of endormancy (Horvath et al., 2003).
Endodormancy regulatory mechanisms at the molecular level are still poorly understood.
60
This state is believed to be crucial to vegetative state maintenance during periods of oscillatory
environmental conditions that can rapidly vary from permissive to suppressive. Both day length
and temperature play an essential role in its induction and regulation. SD photoperiod is
believed to be the main repressor of growth in woody perennials, leading to the bud transitioning
from developing to dormant. The evergrowing (evg) Prunus persica mutant is incapable to
undergo dormancy under normal dormancy inducing conditions (a trait segregated as a single
recessive nuclear locus) ultimately failing to cease growth (Rodriguez et al., 1994)
Consequently it is not able to form terminal buds in response to SD. Probably due to this
condition, the evg genotype also fails to develop significant levels of cold hardiness, when
compared to deciduous peach trees (Artlip et al., 1997). Recently, sequencing and annotation of
the genomic region controlling the evg trait in peach, lead to the identification of six MADS-box
transcription factors designated as DORMANCY-ASSOCIATED MADS-BOX (DAM) genes,
which were found to have no expression in the evg mutant (Bielenberg et al., 2008). DAM1,
DAM2 and DAM4 are putative regulators of seasonal growth cessation and terminal bud
formation and DAM3, DAM5 and DAM6 are associated with winter expression, reaching a
minimum before bud break and blooming (Li et al., 2009). All DAM genes suffer a
downregulation connected to exposure to chilling temperatures, but only DAM5 and DAM6 were
found to be positively regulated by SD treatments and expression was always stronger in
cultivars with higher chilling requirements, stopping upon bud break (Jimenez et al., 2010). A
QTL for chilling requirement and blooming time was found to co-localize with the evg gene
locus, with DAM5 and DAM6 part of the overlapping region (Fan et al., 2010). In the almond x
peach reference map for Prunus, the almond PrdMADS1 also co-locates (Silva et al., 2005) in
said region, connecting both MADS-box transcription factors in Prunus to a shift in flower
development.
Chilling Requirements and Cold Acclimation
Fruit production and yield is heavily dependent on chilling temperatures as low chilling
requirements anticipate blooming, exposing flowers to frosts and ultimately hurting crops. For
instance, almond flowering time was proven to be more affected by chilling requirements than
subsequent heat requirements among various genotypes (Egea, 2003). These chilling
requirements can be measured in a variety of ways, including one that involves theoretical
quantification of chilling units, i.e. hours of accumulation of different temperature ranges,
assumed to have varying impacts on endormancy break and differentially accounted in each
mathematical model. The most common and simple method is the simple amassing of chilling
61
hours or number of hours below 7ºC (Egea, 2003). The dependence on chilling requirements in
order for trees to undergo dormancy break is different for each genotype and cultivars. They
remain unmodified through the years in the same locations (Jansson and Douglas, 2007),
making chilling requirements an important feature in breeding programs and also the main
impediment for the expansion of temperate fruit crops to warmer climates is so challenging
(Perry, 1971).
Both photoperiod and temperature were shown to have a major influence on dormancy
maintenance and cold hardiness (Rohde and Bhalerao, 2007). Cold hardiness/acclimation
makes perennial trees, capable of enhanced mechanisms of ice nucleation and deep
supercooling, much more tolerant to freezing temperatures than herbaceous plants. Boreal
forest trees are capable of withstanding -40ºC and even -196ºC in contrast to a minimum
threshold of -25ºC by annual plants (Wisniewski et al., 2003). The development of cold
hardiness goes through several stages: cold induction time, levels and maintenance of
acclimation, resulting freezing tolerance and then rate of acclimation loss during growth
resumption (Wisniewski et al., 2003). The mechanisms of low temperature (LT) acclimation and
freezing tolerance have been described in detail in the previous chapter, and they were shown
to be regulated by the C-REPEAT BINDING FACTORS (CBF) family of transcription factors. In
Arabidopsis CBFs have been connected to the regulation of seed dormancy-related genes such
as DELAY OF GERMINATION1 (DOG1) and a GA pathway repressor enzyme (GA2ox6) and
their downregulation may indicate a way to allow cold to promote seed germination (Kendall et
al., 2011). Recently it was discovered that overexpression of a peach (Prunus persica) CBF
(PpCBF1) in apple (Malus x domestica) caused a SD-induction of dormancy even though apple
dormancy is mainly triggered by LT and not SD, leading to a direct connection between the CBF
regulon and dormancy induction (Wisniewski et al., 2011).
The CBF transcription factors activate the production of downstream cryoprotective
proteins to which some groups of dehydrins belong. These are included in the LATE
EMBRYOGENESIS ABUNDANT (LEA - group II) protein family, shown to be well conserved in
evolutionary terms and easily associated with Arabidopsis through sequence analysis, not only
due to high similarity but also related to introns and their relative position. Many of these, such
as Prunus persica PpDHN1 and PpDHN3, are markedly upregulated by cold (Bassett et al.,
2009). Dehydrin transcript accumulation in flower buds has been found to coincide with higher
chilling requirements among Japanese apricot (Prunus mume) cultivars (Yamane et al., 2006)
and expression analysis in Norway spruce (Picea abies) showed lower accumulation of
62
dehydrins transcript towards bud break in both early- and late-flushing spruces (Yakovlev et al.,
2008).
Flowering
Once chilling requirements are effectively accumulated and dormancy is broken, bud
break and growth resumption occur. This was previously related by an high expression of
repressor genes in Arabidopsis such as FLOWERING LOCUS C (FLC) (Lee et al., 2000;
Samach et al., 2000). MADS box protein-encoding FLC is a known repressor of flowering
pathway integrators such as FT, CO, SUPPRESSOR OF OVEREXPRESSION OF
CONSTANS1 (SOC1) and LEAFY (LFY) (Boss et al., 2004). In Arabidopsis, FLC is promoted by
FRIGIDA (FRI) and VERNALIZATION INDEPENDENCE (VIP) genes and repressed by
vernalization inductors, such as FLOWERING LOCUS D (FLD), FLOWERING LOCUS K (FLK)
and LUMINIDEPENDENS (LD) (Henryk et al., 2007). The induction of FLC is also suppressed
by vernalization-related genes (VRN), causing histone methylation-induced silencing (Bastow et
al., 2004). Also in Arabidopsis this FLC downregulation leads to flowering promotion and FT
upregulation during SD photoperiod (Henryk et al., 2007). FT is thought to be the main marker
for flowering time (Zeevaart, 2006) and in poplar it has been shown to be crucial in vegetative
and generative growth during endodormancy break (Rinne et al. 2011). In flower promotion it
acts through SOC1 to activate the shoot apical meristem (SAM), along with LFY (Vijayraghavan
et al., 2005). In poplar, long-term chilling exposure induces FT expression. Additionally, it also
upregulates expression several GA biosynthesis genes, which are later involved in the induction
of a specific type of 1,3-β-glucanase (glucan hydrolase family 17, GH17) enzymes. These are
responsible for the degradation of callose, which is previously deposited at the plasmodesmata
(PD) during dormancy development. The reopening of PD is later induced by temperature
increase, allowing FT to reach their targets, promoting bud burst, shoot elongation and
morphogenesis (Rinne et al., 2011).
In congrast to other woody perennials, fruit trees present a substantial delay between
flower initiation and flower emergence. Initiation usually takes place the year before and
flowering or blooming in the subsequent spring requires the action of the already described
mechanisms of chilling accumulation and regulation during winter months. In almond, and
similar to most fruit trees, dormancy break happens after flower initiation occurs in July/August
and flower buds first undergo organogenesis, arrested with winter dormancy set (Lamp et al.,
2001; Silva, 2005). Although few molecular studies concerning MADS box family of protein
belonging to the ABCDE floral organ identity model have been made in fruit species such as
63
Malus domestica (Hattasch et al., 2008) and Prunus persica (Tani et al., 2009), even fewer tried
to integrate this information with dormancy acquirement and disruption (Yamane et al., 2011).
With this work we aimed to study and identify new molecular integrators of the
environmental mechanisms regulating dormancy break in almond. We analyzed the expression
of several genes related to low temperature signaling (PrdCBFs and PrdDHN1), abiotic stress
response and flower development, during natural seasonal development during fall and winter
months in field trees. In this way we found several candidate genes, which can be further
studied as markers for the developmental changes occurring during dormancy in flower buds.
Additionally, we attempted to further deepen the understanding of almond flowering gained by
the previously mentioned candidate gene approach (Silva et al., 2005; Silva, 2005) and the
putative connections between identified MADS-box protein-encoding genes applied to blooming
time - proposed not to be controlled at flower induction phase but with the accumulation of
chilling requirements during dormancy (Silva, 2005).
64
65
Material and Methods
A. Plant Material, Collection and Analysis
Three almond trees - #1 to #3 – were selected for analysis in the Monsanto Forest Park
in Lisbon. Collections of both flower buds were made in September 16th, October 15th (although
sample extraction and subsequent analysis was impossible for these first two points), November
5th and 19th, December 6th and 20th, January 6th and 20th and February 4th, in the same order
and at the same time of day (from 9am to around 11am). Similar collections/analysis were made
the previous year at November 5th and 18th, December 4th and 17th, January 6th and 21th and
February 3th. Samples were collected into 2 mL tubes and frozen in dry ice before conservation
at -80ºC. Additionally, stems with flower buds still attached were kept intact and hydrated, are
were brought to the laboratory for morphological analyzes. These were performed by splicing
the buds transversally into two halves, so that the reproductive organs could be visualized.
Sections were analyzed using a stereomicroscope (Leica, Germany) and images were captured
with Digital Sight Camera System (Nikon, Japan). On January 6 th scales and flowers were
separated in loco for differential tissue gene expression analysis. That was also done for sepals
and inner flower whorls in material collected in the January 20 th, although separation occurred
after freezing.Temperature records were obtained from the nearest meteorological station (38º
44‟ 35” N, -9º 13‟ 13” W), available at www.wundergroung.com.
B. RNA Extraction and cDNA synthesis
RNA from flower buds was extracted by means of two different methods. The first one
used the RNeasy Mini-Kit Protocol (Quiagen, Netherlands) modified by Brunner et al. (2004)
and an extra final step of treatment with TURBO DNA-free Kit (Ambion, USA) was added to
avoid DNA contamination, in a protocol described by manufacturer‟s instructions. Because it
was difficult to obtain good quality RNA from the first collection points a new protocol developed
by Meisel et al. (2005) for peach was also used, which presented better results after a few
optimization steps. In brief, 100 µg of grinded sample was ressuspended in 300 µL of extraction
buffer and the homogenization step at 65ºC was prolonged to 20 minutes with continuous
vortexing allowing higher final concentrations. Two extractions were performed with chloroform-
isoamyl alcohol (24:1) with intermediate precipitation with LiCL 10 M ressuspended in SSTE
after overnight incubation at 4ºC and a final precipitation with ethanol 100% and pellet cleaning
with ethanol 75%. Centrifugations were made at 4ºC in 12.000-14.000 speeds. The final pellet
66
was eluted in 20-30 µL of RNAse-free water. Residual contamination with genomic DNA was
eliminated also using the TURBO DNA-free Kit (Ambion). RNA quality was confirmed through
electrophoresis, followed by approximate quantification using NanoDrop (NanoDrop 3330,
ThermoScientific, USA). RNA with strong polysaccharide contaminations were precipitated with
potassium acetate (in Appendix, page III) and RNA with low concentrations were precipitated
with lithium chloride (in Appendix, page III) and then eluted in a smaller volume of RNAse free-
water. cDNA was synthesized using the Transcription High Fidelity cDNA synthesis kit (Roche,
Germany), according to manufacturers‟ instructions, using 2 µg of total RNA. To confirm the
absence of genomic contamination a no-RT control (without reverse transcriptase enzyme) was
also performed using 2µg of total RNA diluted in sterile water, the same volume as cDNA
synthesis. The resulting cDNA (10 µL) and no-RT control was then diluted in order to achieve 30
µL of samples and 1 to 2 µL were used as template for semi-quantitative RT-PCR - semi-qRT
PCR - in order to identify differential expression in samples from multiple assays.
C. PCR conditions and Primer Design for genotyping and semi-quantitative RT-PCR
PCR reactions were prepared using GoTaq® PCR Core Systems (Promega, USA)
reagents using the following reagents in the reaction mixture (Table 1).
Table 1 – PCR reaction mixture used for gene expression analysis using semi-quantitaive RT-PCR. *1 µL
was used as default; 2 µL of template were used for expression analysis of PrdCBF1 and PrdCBF2.
PCR MIX
Green FlexiBuffer 1X 4 µL
MgCl2 2mM 1.6 µL
dNTPs 0.2mM 0.4 µL
primers 0.5uM 0.3 µL each
Taq 1uni 0.2 µL
Template 1-2 µL*
H20dd to 20 µL total
For PCR reactions, we used a thermocycler (T300 Thermocycler, Biometra) with a pre-
heated lid (at 99ºC) to reduce evaporation of the solution. The initial denaturation step was done
at 95ºC and each cycle comprised the following conditions: a denaturation step performed at
67
95ºC for 30 seconds, an annealing step lasting 40 seconds at the corresponding annealing
temperatures (Table 2) and finally an elongation step of 40-60 seconds at 72ºC. After the 24-32
cycles a final elongation was performed at 72ºC for 5 minutes. Primers were designed using
Primer3 (Rozen and Skaletsky, 2000) online software using the default parameters. Self-
complementarity and possible formation of hairpins and secondary structures were checked
using OligoCalc (Kibbe, 2007). All primers used are listed in Table 2 along with the optimized
specific annealing temperatures for each set and corresponding amplicon.
Table 2 – Specific primer sequences set for each gene along with preferential annealing temperature and
expected amplicon size.
Primer name Primer sequence (5' - 3') Annealing
temperature
Amplicon
size
PrdCBF1_Fw CGCTAATGAACAGGTTCTTCTCTCA 56ºC 550 bp
PrdCBF1_Rv TTCACACTATCCTTCTTCTTCTTCTTC
PrdCBF2_Fw CTCTAATGGACTTGTCTCAACTTTC 56ºC 540 bp
PrdCBF2_Rv CCAAGTTCACACTACCCTTCTTG
PrdActin_Fw AGCAAGGTCCAGACGAAGAA 58º C 385 bp
PrdActin_Rv TGTAGGTGATGAAGCCCAATC
PrdTubulin_Fw ATTGAGCGACCCACCTACAC 56ºC 428 bp
PrdTubulin_Rv GTGGGTGGCTGGTAGTTGAT
PrdDHN1_Fw TCGTACTTTGAAAAATGGCG 62º C 329 bp
PrdDHN1_Rv TAGTAAACCCTTCTTCTCCTGGTG
PrdGA20ox1_Fw GAGCACTCTTTCTATTGGGATCAT 58º C 559 bp
PrdGA20ox1_Rv TCAGCTGATTTTCTGTTGAAGCCA
PrdGA2ox3_Fw AAGCAGGGCAACCTAATCCT 58º C 466 bp
PrdGA2ox3_Rv TGATCAGGTGGGACTGGAAT
PdMADS1_Fw CGGAGTGGAAGCAAAAGTAAAGGT 58º C 737 bp
PdMADS1_Rv TAGCATTTGCTGAATCTCTCTCC
PrdMADS3_Fw GATAATATTTTAGCTGGCAAGGA 58º C 800 bp
PrdMADS3_Rv TTGGCAAGCTTTTATGACTGA
PrdChitinase_Fw GGACCGCTCCAACTGACAT 58ºC 583 bp
PrdChitinase_Rv TGATCATAGAACCAACCCTGGTA
PrdKnotted_Fw GGTCAAATGATGAGTAGCAGC 55ºC 653 bp
PrdKnotted_Rv GGGGACCACTTTGTAGAAGAAAGCTGGGTGTCAGAGCAGTGTGGGAGT
PrdPOX3_Fw GGCTCAGGAGACAACAACCT 56º C 454 bp
PrdPOX3_Rv AACATGCTTTTATTCATTGGAAGA
PrdGlyc_Fw CGGGGACTCATCAATCATCT 56ºC 387 bp
PrdGlyc_Rv CCTTACAACACAACTGCAACG
68
PCR conditions were optimized using a T-Gradient thermocycler or a regular
thermocycler (T300 Thermocycler) with varying annealing temperatures (from 50ºC to 62ºC).
Nucleic acid electrophoresis was conducted at around 100V in 0.8-1.2% agarose (UltraPure™
Agarose 1000, Invitrogen) with 4% ethidium bromide. Gels were visualized under UV exposure
and pictures were captured using the GelDocXR+ Imaging System (BioRad). Semi-quantitative
RT-PCR reactions and conditions are presented in Appendix, page IV.
69
Results
Seasonal Development of Almond Field Trees
To develop a correlation between cold acclimation and the breaking of dormancy, the
expression of several genes was studied during flower bud development and blooming from a
collection of six field trees - of which two were fully analyzed - in Monsanto Forest Park. This
study had already been performed in 2009/2010 (Barros, 2011) and the analysis of this
additional year (2010/2011) was projected to corroborate those results.
The trees were observed beginning at September 6th of 2010, where the flower buds
were still in an early stage of development. Differentiation between flower and vegetative buds
was already clear. Although both were strongly enclosed in scales, the former presented a
much fuller, less angular form (data not shown). On October 15 th, collection was initiated as it
was estimated to be the time when dormancy commenced (Egea, 2003). This thesis will only
focus on flower bud development of two of the trees studied (Tree #1 and Tree #2), distanced
around 10 meters from each other. The trees presented different phenotypes suggesting that
they may not belong to the same variety/genotype. Although flower bud development depends
on the placement on the shoot, since meristems closer to the apex develop earlier (Silva, 2005),
the observations described take into account a global phenotyping of the whole tree. A
photographical account of this description can be seen in the representation of tree #1 flower
bud development presented in Figure 1. Between October 15 th and December 06th, flower buds
were slowly expanding but on December 20th a more pronounced swelling was observed. Most
importantly, a massive amount (more than 50%) of flower buds was already at the „green tip
stage‟ (represented in Figure 2B). In January 06 th of 2011 the „pink tip stage‟ (represented in
Figure 2B) began to be established as a few flower buds were already showing the corolla. By
January 20th most flower buds were already at the blooming stage while some were at an
advanced „pink-tip stage‟ (represented in Figure 2B), concordant with ecodormancy break
provided by sufficient heat requirement accumulation (Egea, 2003). In the next collection point,
February 4th, full bloom was established and many flowers had already lost their petals.
70
Figure 1 – Representative developmental stages observed in flower buds from almond tree #1, at each
of the eight collection points analyzed from autumn to mid-winter (2010/2011).
In Figure 2, two representative stages of development are presented for both tree #1
and tree #2 at the January 6th and January 20th collection points. Before January 6th tree #2 had
presented a more advanced development, as „pink tip stage‟ could be already be seen in few
floral buds, opposing the still predominant „green tip stage‟ in tree #1. However, they did not
appear to present such a noticeable variation by January 20 th and after that bud break and
blooming took place concomitantly.
71
Figure 2 – Developmental stages of almond flower buds during two collection points (January 6th and 20
th,
2010/2011) for trees #1 and #2. (A) Photographs of shoots and flower buds at their respective dates and
trees. (B) Representative stage of flower buds at both collection points. First row of flower buds show for
January 6th are representative of „green tip stage‟ and early „pink tip stage‟, respectively. First row of
flower buds show for January 20th are representative of blooming and second row of more advanced „pink
tip stage‟, respectively.
Chilling Requirement Accumulation
As previously mentioned, chilling requirements can be calculated by various series of
mathematical models (Egea, 2003). We decided to use the most widespread and simple model,
taking into account the cumulative number of hours below 7ºC. These will correspond to chilling
units, which are used to estimate requirements for the timing of endormancy break (Egea, 2003;
Rohde and Bhalerao, 2007).
In Figure 3 a graphic is presented with both maximum and minimum temperatures,
recorded from the closest meteorological station to the collection site. Chilling accumulation was
measured accordingly and showed to start at November 28 th, which was the first day where
A
B
72
temperatures decreased below 7ºC. Some authors consider that the transition from endo- to
ecodormancy happens when around 50% of the flower buds are in the b-c state of Fleckinger,
from swollen bud to the „green tip‟ stage (Egea, 2003). However, the precise timing for this
transition is difficult to determine, because while no external signs of development can be
detected prior to bud burst, growth ability may already be acquired and masked as
endodormancy (Julian et al., 2011). Based on direct visualization we assumed that this
transition occurred before December 20th (Figure 3), the closest collection point from the
beginning of green tip stage, in which a total of 72 chilling units were accumulated. The
pronounced drop in temperatures that occurred prior to this date could have contributed to a
faster fulfillment of chilling needs. However, only more detailed studies on determining the
timing for endodormancy break during several years would allow an approximate conclusion
about each tree‟s specific chilling requirements, as they vary greatly amongst cultivars. Even
individual tree buds have different chilling requirements for breaking dormancy (Rohde and
Bhalerao, 2007).
Figure 3 – Graphical representation of maximum and minimum temperatures from September 2010 until
February 2011. Accumulation of chilling units is represented as the black area in the chart as the
accumulated number of hours below 7ºC (red horizontal line). Vertical dashed line represents December
20th collection point at which ecodormancy was already broken. A potentially significant warm spell in
January is represented by the orange rectangle.
0
50
100
150
200
250
0
5
10
15
20
25
30
35
9/1/2010 10/1/2010 11/1/2010 12/1/2010 1/1/2011 2/1/2011
Chilling Req. Maximum Minimum
Te
mp
era
ture
(ºC
) Ch
illing
ho
urs
73
Analysis of Flower Bud Organ Development
To complement the observations made in loco, several flower buds were selected for
observation under a stereomicroscope so that reproductive organ development could be
followed and linked to dormancy break. Even though dormancy is characterized by meristem
activity cessation (Wareing, 1956) some reproductive tissues, such as anthers and pistils, were
found to be slowly developing (Figure 4), in agreement to what was observed by Reinoso et al.
(2002). The slow increase in length of the pistil and the enlargement of anthers can be clearly
seen throughout time. These observations also seem to corroborate the proposed shift of
endodormancy to ecodormancy prior to the December 20th collection point, as there is an
exponential growth resumption and maturation of the reproductive organs with the yellowing of
anthers as well as the expansion of the loculus cavity where the two ovules will develop.
Figure 4 – Amplification (2X) of the interior of almond flower buds from trees #2 and #1 after transversal
sectioning along with representative shoot and flower bud photographs from each date. For December
20th two representative stages are shown. The white line in magnified flower bud pictures represents a 1
mm scaled measurement. Higher resolution pictures of magnified flower buds are presented in Appendix,
page VII, Figure A.
74
Transcript Accumulation of Cold- and Flowering-related Genes
To draw a connection between flower bud development and cold acclimation, we
determined the expression pattern of several candidate genes involved in each process.
Expression analysis was performed by semi-quantitative RT-PCR for: PrdCBF1, PrdCBF2 and
PrdDHN1 as putative markers for cold acclimation; PrdMADS1 (accession no. AY947462) and
PrdMADS3 (accession no. AY947464) as markers for flower development; and PrdGA20ox and
PrdGA2ox, which code for enzymes putatively involved in gibberellic acid (GA) biosynthesis and
catabolism, respectively. All of these genes had given promising results on their expression
analysis during seasonal development in 2009/2010 (Barros, 2011) and their function had also
been elucidated (Barros, 2011; Silva, 2005). RNA samples for earlier collection points were hard
to obtain as quantification was either very low or RNA obtained was of poor quality. It was
impossible to obtain RNA for tree #2 from the November 5 th collection point as well as all
samples from previous collection points, possibly due to high content of polysaccharides in
dormant undeveloped flower buds (data not shown). Consequently a good housekeeping gene
was difficult to use as control and PrdTubulin (accession no. X67162) was used as it showed
the least variation among all flower bud collection point samples, compared to PrdActin1
(accession no. AM491134), used for samples collected in 2009/2010. Extrapolations were made
from the PrdTubulin pattern along the samples to analyze transcript accumulation in remaining
genes, presented in Figure 5. Result patterns for trees #1 and #2 are shown as to corroborate
each other.
PrdCBF2 and downstream cold-regulated PrdDHN1, homologue to Prunus persica
DHN1 and Arabidopsis Xero2, are expressed during dormancy, decreasing by January 6th
(Figure 5) as growth resumed and temperatures increased, with a warm spell observed around
this time point (Figure 3). These genes seemingly regaining partial expression by February 4 th,
possibly related to a new drop in temperature (Figures 3 and 5). PrdCBF1 showed a similar
pattern although it also appeared to be expressed after endodormancy break, with strong
upregulation seen at the January 6th collection point. PrdMADS3, a gene belonging to the
MADS box family (E-class) that is expressed in all almond flower tissues (Silva, 2005), is
upregulated during ecodormant stages (starting December 20 th) and transcript accumulation
happens more steadily during ecodormancy break. In our study that would have happened at
the most in January 20th collection point (Figure 3). PrdMADS1 codes for an D-class MADS box
protein, which is only expressed in pistils (Silva, 2005), and being a close homolog to the
Arabidopsis SEEDSTICK (STK), which is specifically expressed during ovule development
75
(Pinyopich et al., 2003). In almond flower buds, this gene shows no expression prior to January
6th (Figure 5), after growth is reactivated and floral organs are developing and becoming set for
flowering time. Bioactive GA activator and putative dormancy inducer (Thomas et al., 1999)
PrdGA20oxidase (PrdGA20ox) is expressed mainly before and after endodormancy break,
showing a comparative peak of upregulation in tree #2 in the December dates. However, it
sharply decreases prior to ecodormancy break, during January 20th and February 4th.
PrdGA2oxidase (PrdGA2ox), belonging to a family of enzyme-encoding genes responsible for
the inactivation of GA (Achard et al., 2008), appears to be mainly upregulated after December
20th, during early ecodormancy.
Figure 5 - Transcript accumulation detected during seasonal development (2010/2011) from autumn to
mid-winter stages in almond tree field flower bud samples – trees #2 and #1 - of the two Prunus dulcis
CBFs (PrdCBF1 and PrdCBF2), cold-responsive PrdDHN1, flowering-related PrdMADS1 and PrdMADS3,
and gibberellin pathway-related PrdGA20ox and PrdGA2ox. Gene expression analysis was performed by
semi-quantitative RT-PCR. The number of PCR cycles is indicated on the right.
76
Differential tissue gene expression was then analyzed in order to verify variations
happening specifically in more specific flowers tissue pools. Therefore we detached flowers
from the scales covering and protecting flowers in loco during the January 6th collection point for
tree #1. Additionally, we tried to carefully separate the calix from the remaining inner whorls
(petals, stamens and carpel) from previously frozen material for the tree #2 samples from
January 20th.
As seen in Figure 6, the separation between scales and flowers from tree #1 lead to the
observation that both PrdMADS1 and PrdMADS3 are indeed flower-specific and are not
detected in the scales, which surround the developing flowers. PrdGA20ox does not seem to be
expressed in any tissue by this collection point and PrdGA2ox is not differentially expressed in
scales or flowers. Both results are comparable to the general transcript accumulation observed
before for tree #1 in Figure 5. The division in two pools (calix and inner whorls) lead to the
corroboration that PrdMADS1 is only expressed in the carpel-containing transcript pool. This is
in agreement with the previously described distinct expression of PrdMADS1 in ovules of
PrdMADS3 in all flower tissues. PrdGA20ox shows no transcript accumulation, coinciding with
what is observed for tree #2 in Figure 5 and PrdGA2ox transcript accumulates preferentially in
calix than in inner whorls, leading to the suggestions that GA inactivation is not happening so
vigorously in the developing reproductive flower organs, but is mainly occurring in sepals.
77
Figure 6 - Transcript accumulation detected during seasonal development (2010/2011) almond tree field
flower bud samples – trees #2 and #1 - of flowering-related PrdMADS1 and PrdMADS3 and gibberellin
pathway-related genes PrdGA20ox and PrdGA2ox. To assert differential tissue expression analysis, in
tree #2 calix and inner whorls (petals, carpel and anthers) were separated into two pools; in tree #1
flowers and scales were separated into two pools as well. Gene expression analysis was performed by
semi-quantitative RT-PCR. The number of PCR cycles is indicated on the right.
Candidate Genes for Seasonal Development
In addition to this work, we were seeking to investigate new genes related to stress
response and general development so we could find new markers that would allow us an
understanding of the transitioning between endo- and ecodormancy and also between
dormancy and flowering. Santos et al. (2009) identified several almond genes putatively
involved in stress response, cell wall maintenance and meristematic activity during almond
adventitious root regeneration. Some of them were selected, and their potential involvement in
seasonal dormancy shifts and transcript expression was analyzed for samples from the previous
year of collection (2009/2010) for trees #3 and #2 (Figure 7). In the course of this year‟s
seasonal development it was observed that chilling started later and consequently presented a
delayed ecodormancy break (Barros, 2011) when compared with the following year of collection
(2010/2011).
PrdChitinase encodes a class IV chitinase protein, which along with an upregulation of
type III peroxidases (to which PrdPOX3 belongs), is responsible for cell-wall strengthening
(Andrews et al., 2002). PrdChitinase seems to be expressed during endo and ecodormancy but
the expression pattern was not consistent in both trees analyzed. Curiously, in each tree
PrdPOX3 transcript accumulation pattern seems to follow PrdChitinase upregulation up to
78
ecodormancy (Dec/17 and Jan/06 in tree #3 and #2, respectively), decreasing after bud break
and blooming. PrdKnotted was previously described to be a putative marker for organogenesis
events (Santos et al., 2009) and has a similar expression pattern to PrdChitinase with a peak of
accumulation possibly happening at the transition between endo- and ecodormancy. PrdGlyc is
a putative glycine-rich protein encoding gene, which have also been linked to cell wall protection
and stage transitioning during plant development (Gil et al., 2003). The transcript accumulation
showed an increase during the dormancy period, but was downregulated towards ecodormancy
break. This pattern of expression coincided with that of PrdCBF2 and PrdDHN1 determined for
that year (Barros, 2011). The fact that it happens first in tree #3 than in tree #2 could be related
to the timing ecodormancy break in that year, which have occurred first in tree #3, possibly
related to differential chilling requirements (Barros, 2011).
Figure 7 - Transcript accumulation of the indicated genes detected during seasonal development from
autumn to mid-winter stages (2009/2010) in flower bud samples from two almond trees (#3 and #2).
Expression of PrdChitinase, PrdPOX3 and PrdGlyc, genes related to cell wall strengthening and
developmental shift, as well as of PrdKnotted, linked to organogenesis, is analyzed by semi-quantitative
RT-PCR. The number of PCR cycles is indicated on the right.
79
Discussion
The objective of the work reported in this chapter was to conduct an expression analysis
of different genes related to cold acclimation in almond field trees, with special focus on
PrdCBFs. Knowledge concerning these transcription factors (TF) gained from Arabidopsis
studies (Chapter 1) still has to be fully applied and characterized in woody perennials and fruit
trees. Seasonal development and subsequent crop production and yield in woody trees largely
depends on the timing of dormancy induction and release and also the ability to cold hardy
probably influenced by the CBF-signaling pathway (reviewed in Welling and Palva, 2006).
However the effect of temperature variations in dormancy regulation is in dire need of revision
as new proof is accounting another major influence besides chilling temperatures on dormancy
initiation. Warm temperatures were found to prompt short-day (SD)-induced dormancy, more in
night than in day temperatures, which seem to have antagonistic effects (Kalcsits et al., 2009).
This knowledge goes against the current seasonal development knowledge and may indicate
woody perennials halt growth much earlier than initially expected (Tanino et al., 2010).
Additionally, the mechanisms related to chilling perception, dormancy release and deacclimation
in late-winter/spring are still poorly understood in woody plants, particularly in fruit trees.
Although CBF TFs have been shown to be involved in cold acclimation in woody plants,
their role in seasonal development and winter dormancy remains to be clarified. To develop our
work on this subject matter we determined the expression pattern of PrdCBFs and PrdDHN1
genes in almond flower buds collected from field trees during dormancy, in order to confirm the
results previously attained during the previous year (Barros, 2011). Genes related to floral
identity and gibberellin metabolism were also studied to investigate their role during transitioning
to growth resumption and blooming. The fact that was very hard to find a proper and stable
housekeeping gene for the collected samples has mainly to do with the dormant state of the
tissues and also RNA quality. It would be appropriate to attempt using UBIQUITIN (UBQ), found
to be more stable than actin and EF1 in vegetative buds (Yamane et al., 2011).
Although in an uncontrolled environment, morphological development was somewhat
congruent with what had been observed in 2009/2010, which may help on the validation of the
results obtained in both years. Nevertheless, there were some changes in environmental cues
which lead to an acceleration of flowering compared to the one that happened in 2009/2010,
most importantly a warm spell that occurred in January. That did not occur in the previous year,
which presented low temperatures throughout this month, which could have lead to a later
80
fulfillment of heat requirements to break ecodormancy (Egea, 2003). Moreover, in 2009/2010
tree #3 (an additional tree studied to complement these results) entered full bloom before tree
#2. It also presented more advanced flower bud development, suggesting a possible early
bloomer status, but in 2010/2011 development of both trees was concurrent. After 2009/2010
sampling, Barros (2011) analyzed gene expression patterns in flower buds and observed that
both PrdCBFs and PrdDHN1 suffered a consistent decrease after endodormancy break, which
also happened in between the two December collection points. Both genes had transcript
accumulation during endo- and ecodormancy periods and showed a noticeable decrease
around the developmental transitioning from „green tip‟ to „pink tip stage‟ and blooming.
Flowering-related MADS-box genes (PrdMADS1 and PrdMADS3) were induced mainly around
ecodormancy induction and subsequent growth resumption. Two candidate genes related to the
gibberellin (GA) biosynthesis pathway showed contrasting expression patterns. While
PrdGA20ox (related to GA biosynthesis) transcription was only detected up till blooming,
PrdGA2ox (related to GA catabolism) was expressed during dormancy with an upregulation
after dormancy break.
As mentioned above, during 2010/2011 blooming happened sooner, between January
6th and 20th, when compared with previous year (after January 21st). Chilling requirements,
marking the shift from endodormancy to ecodormancy, seemed to have been met before the
December 20th collection point (Figure 3), similar to the timing and chilling units measured the
year before (Barros, 2011) . PrdCBF1 presented a differential pattern than the one observed in
2009/2010, presenting transcript accumulation in flower buds during endo- and ecodormancy,
before „green tip stage‟ was established. It was also present after ecodormancy break, during
„green tip‟ to „pink tip‟ transitioning in January 6th (Figure 5). However PrdCBF2 and PrdDHN1
showed a similar expression pattern compared with last year and with each other, with transcript
accumulation happening before ecodormancy break, but being downregulated after that . This
suggests that PrdCBF2, perhaps activated by different mechanisms than those for PrdCBF1,
and PrdDHN1 are directly correlated, with the former possibly being a main regulator of this
downstream COR protein-encoding gene. Another unexpected result observed this year was
the upregulation of all of these cold-responsive genes at the February 4th collection point when
full bloom was already established and many flowers had already lost their petals. Considering
the decrease in minimum temperatures observed during this stage, this slight upregulation may
be related to a reacclimation phenomenon, where hardiness is regained with sudden exposures
to cold temperatures after deacclimation (i.e. the process of loss of cold hardiness after a long
period of acclimation). Deacclimation is suggested by the downregulation of PrdCBFs and
81
PrdDHN1 during the January warm spell period (Figure 3 and 5). While cold acclimation may
take weeks to months to occur, deacclimation is much quicker, happening in a matter of hours
or days when exposed to favorable growth conditions (Chen and Li, 1980). Additionally,
deacclimation requires less energy to trigger gene downregulation and it also takes advantage
of products generated by catalysis of acclimation-induced metabolites (Kalberer et al., 2006).
Reacclimation, on the other hand, never seems to match the acclimation gained during
dormancy. Furthermore, it has been shown to lose acclimation properties after consecutive
cycles of varying temperatures that can be either inducive or repressive of growth (Gusta and
Weiser, 1972). This is very different in woody perennials still undergoing dormancy as
acclimation or hardiness levels are much stronger, preventing subsequent deacclimation
(Leinonen et al., 1997). In peach, deacclimation has also been connected to a dehydrin
(PpDHN1) downregulation. Expression of PpDHN1 during fall/winter dormancy was found to be
downregulated early in non-dormant evergreen variety, with low ability to properly cold
acclimate, than in deciduous cold-acclimated trees (Artlip et al, 1997). Thus, early deacclimation
may explain why almond cold-responsive genes (PrdCBFs and PrdDHN1) suffer considerable
downregulation during endodormancy break, since both were probably induced after the
exposure to a period of warm temperatures during earlier to mid-January. After that, a
reacclimation period could have occurred when temperatures drastically drop again below 7ºC
in late-January and February (Figure 3), resulting in the upregulation of PrdCBFs and PrdDHN1,
but to a lower extent than the observed during fall. This could be used as evidence that these
genes may not directly involved in endodormancy regulation but could be mediating the effects
of temperature variation during ecodormancy, until favorable conditions are met. Further
connections to SD-regulation also need to be evaluated as it was previously shown that ectopic
CBF expression resulted in a SD-induced dormancy on a SD-unresponsive fruit tree
(Wisniewski et al., 2011), suggesting a putative connection between CBF expression and SD-
responsive dormancy induction.
The flowering-related genes were previously identified by Silva (2005) along with many
other candidate genes for flowering time. PrdMADS1 expression was determined to be
exclusive to carpel tissues during late organogenesis in almond flower buds and PrdMADS3
transcript accumulation seemed to happen on all mature flower buds tissues but not on earlier
developmental stages (Silva, 2005). Our results corroborate these patterns for PrdMADS1, as it
is only expressed in the later collection point samples after ecodormancy break, coinciding with
PrdMADS3 upregulation and the cold-responsive genes downregulation (Figure 5). This occurs
after growth is resumed and carpel development is clearly sustained by earlier observation of
82
pistil elongation and loculus enlargement in the shift to ecodormancy (Figure 4). Not
surprisingly, in differential tissue expression it was observed that PrdMADS1 transcript was only
accumulating in flowers and inner-floral whorls, where ovule-specific expression happens, when
compared to scale-leaves or calyx, respectively (Figure 6). Conversely, PrdMADS3 showed
slight alterations to what was anticipated. Strong transcript accumulation started upon growth
resumption but an upregulation prior to ecodormancy break can also be observed (Figure 5).
This is in agreement with what was observed in peach by Reinoso et al. (2002) indicating that
during dormancy, organogenesis is not fully halted but only decelerated (Figure 4). However, in
apricot (Prunus armeniaca), another Prunoideae like peach and almond, it was shown that
anther sporogenous tissue and microspore development bound into a truly dormant state by
overwintering (Julian et al., 2011) even though that may be more related with meiosis arrest
before endodormancy break than global organ development. Although tissue-specific gene
expression pattern between calix and inner whorls is not particularly different (Figure 6) it is
interesting that PrdMADS3 is strongly expressed in flowers and not at all in scales, suggesting
that the robust upregulation seen during seasonal expression (Figure 5) is flower-specific. The
fact that this upregulation happens from endo- to ecodormancy turns PrdMADS3 into a putative
marker for this dormancy transition. It would be interesting to further develop this data and
check for connections to other putative markers already suggested like starch accumulation in
procambium tissues during dormancy break, reestablishment of vascular connections in flower
buds, or the initiation of microsporogenesis, as observed by Julian et al. (2011) in apricot. It is
also appropriate to suggest a possible link between this MADS-box gene and DORMANCY
ASSOCIATED MADS-BOX (DAM) genes, shown to induce dormancy in Japanese apricot
(Yamane et al., 2008) and delay flowering when overexpressed in leafy spurge (Horvath et al.,
2010).
In studies conducted in peach, Reinoso et al. (2002) showed that exogenous GA3 (a
family of bioactive gibberellins) applications had conflicting effects depending on what stage of
development they occurred. This was correlated to endogenous GA3 levels, which are high
during early stages leading to a possible feedback loop mechanism-mediated growth repression
and lower when applications are made in later stages, promoting bud development and
anthesis. As blooming approaches endogenous GA3 levels diminish but their likely precursor,
GA20, shows an increased accumulation (Luna et al., 1993). PrdGA20Ox, a candidate gene
coding for an enzyme involved in the synthesis of bioactive GA (through catalysis of its inactive
percursor, GA20) was also previously identified by Silva (2005) in a candidate gene approach
and was suggested to be downregulated upon dormancy set. Our results do not coincide with
83
that assumption as PrdGA20ox seems to be expressed during endodormancy and initial stages
of ecodormancy, suffering a subsequent deactivation before ecodormancy break (Figure 5). The
expression of this gene could be related with the slow growth visible in flower bud interior
analysis (Figure 4). Also, by similarly connecting stereomicroscope observations (Figure 4) and
transcript accumulation (Figure 5), we can observe an upregulation of PrdGA20ox in December
20th coinciding with the emergence of yellow mature anthers in flower buds from the examined
trees. In Arabidopsis, bioactive gibberellins were shown to be essential for stamen and anther
development promoting flower growth (Hu et al., 2008) and were also linked to stamen filament
elongation and the transitioning from microspores to mature pollen in anthers (Cheng et al.,
2004). As PrdGA20ox is expressed mainly before endodormancy break, up to when anthers are
reaching full maturation, a link between this gene expression and anther development can be
hypothesized, making PrdGA20ox a putative marker for this developmental stage transitioning,
however this still requires further studies.
The upregulation of PrdGA2ox, a candidate gene involved in GA catabolism and
homologue to peach (Barros, 2011), was concurrent with PrdGA20ox repression, suggesting
once again action of the feedback loop mechanism reported in endogenous GA regulation.
However, when PrdGA20ox transcripts were shown to decline in later stages while PrdGA2ox
transcription remained strong. In tissue-specific gene expression analysis, it was observed that
PrdGA2ox transcript accumulates strongly in calix when compared to inner whorls (Figure 6),
suggesting the GA deactivation happens preferentially in flower tissues not related to
reproductive organ development. However, the role of these and other enzymes working in
differential gibberellin regulation during seasonal development still has to be fully determined in
woody perennials during dormancy periods.
During this work we have also tried to identify new putative markers for seasonal
development by the expression analysis of several genes related to stress response, cell wall
maintenance and meristematic activity, which could allow for a connection to dormancy
transition or cold stress. PrdChitinase and PrdPOX3 were suggested by Santos et al. (2009) to
be homologues of genes that had been shown to be responsible for the strengthening of the
cell wall (Andrews et al., 2002). Both chitinases and peroxidases protein groups were linked to
drought stress and fungi infection response in Norway spruce (Nagy et al., 2004) as well as
being part of a group of pathogen related (PR) protein-encoding genes upregulated during biotic
stress, along with a 1,3-β-glucanase enzyme (Gorovits et al., 2007). Another 1,3-β-glucanase
enzyme in poplar - GA-activated GH17 - has been shown to be linked to dormancy break (Rinne
et al., 2011), suggesting a possible connection between all these three groups of proteins and
84
upregulation following dormancy break. Although both PrdChitinase and PrdPOX3 genes
showed enhanced expression after endormancy break and PrdPOX3 seemed to halt expression
upon ecodormancy break (Figure 7), results obtained were not consistent on both specimens.
Putative organogenesis marker PrdKnotted is an homologue of maize homeobox gene
KNOTTED-1 (KN1), which is present in shoot apical meristems and whose downregulation in
leaves and flowers indicates a transitioning between indeterminate and determinate cell fates
(Smith et al., 1992). Although a downregulation is also observed in our results after
ecodormancy break (Figure 7), coinciding with cell differentiation upon growth resumption, a
clear pattern is not seen in tree #2. Further and definite connections between these three genes
and dormancy would require a larger pool of analyzed trees over different collection years. The
most promising results in this approach concerned a glycine-rich protein (GRP) (PrdGlyc),
suggested to be involved in development stage transitioning (Gil et al., 2003). It was shown to
be part of cell wall scaffold and responsible for cell wall reconstruction and secondary structure
formation (Keller and Baumgartner, 1991; Yokoyama and Nishitani, 2006). Class IV of GRPs
genes contain a cold shock domain and were shown to not only enhance cold tolerance by
heterologous expression in a cold sensitive E. coli mutant (Kim et al., 2007) but also to be
responsible for flowering repression (Fusaro et al., 2007). PrdGlyc showed an expression
pattern that coincided to the pattern observed for cold-regulated PrdCBF2 and PrdDHN1 in the
correspondent year (2009/2010). Consequently this gene could be also be related to cold
acclimation in similarity to previously mentioned GRPs. It also displayed considerable
downregulation after ecodormancy break and flowering induction and the degree at which it
happens seems to be influenced by differential blooming time – tree #3 had earlier anthesis -
observed in 2009/2010 (Barros, 2011), connecting it to the flowering repression described
above. This makes PrdGlyc a putative marker for dormancy break and/or deacclimation in early
winter.
The results gathered in the second year were consistent with the ones obtained the year
before and in a different almond tree examined by (Barros, 2011). Some differences verified
between collection years were explained by varying environmental cues, which affected
ecodormancy break and blooming time, but apparently not the previous transition from
endodormancy. Significant evidence that PrdCBFs are activated concurrently with in the
meeting of chilling requirements was also provided and corroborated. With endodormancy
studies applying more sensitive quantitative gene expression techniques, such as real-time
quantitative PCR (qPCR) with more than one gene as housekeeping control, and also using
varieties with different chilling requirements further connections may be made. The connection
85
between cold hardiness, deacclimation at the time of ecodormancy break, and reacclimation
after a period of warm temperatures was positively demonstrated by low-temperature regulation
of transcript accumulation for both PrdCBFs and cold-induced ice dehydration-preventive
PrdDHN1. New characterizations of floral pathway MADS-box protein and GA pathway enzyme
encoding-genes were also successful with the discovery of two new putative markers for
endodormancy break, with the later also being related with stamen development. Another
potential marker for ecodormancy break and blooming time was also suggested through the
candidate gene approach during seasonal development.
86
87
FINAL CONCLUSIONS
Functional analysis of novel Prunus dulcis CBFs genes and their seasonal expression
offered evidence into how cold acclimation is processed under the influence of this family of
DNA-binding transcription factors. PrdCBF2 seemed to preferentially activate a downstream
cryoprotective protein-encoding gene related to cold hardiness gained during dormancy periods
in woody perennials. This is concurrent with the strong activation of several homologue cold-
responsive genes with overexpression of PrdCBF2 in transformation performed in Arabidopsis
thaliana. These transgenic plants presented increased freezing tolerance when compared to
non-acclimated plants, making this CBF transcription factor, which is apparently stable under
varying conditions, a good candidate for constitutive cold-acclimation. New accounts of the
gibberellin feedback loop mechanism happening in growth and stress regulation in plants were
also made. Not only are enzymes related to bioactive gibberellin activation and repression
involved in dormancy break and flowering events, but it was once again shown that these
phytohormones may be regulated under cold stress by CBF-like genes, leading to their
inactivation in favor of low-temperature acclimation, consequently inducing growth retardation.
The findings and emergence of three putative markers related to floral pathway MADS-box,
gibberellin pathway enzyme and glycine-rich protein-encoding gene expression with dormancy
transitioning may also provide more data for the impeding reformulation of perennial plants
dormancy models. Along with further knowledge to be gained from temperature-driven
dormancy regulatory mechanisms, and further validation of the marker genes suggested in this
study, the results obtained could be a starting point to new almond breeding programs
concerning the early identification of cultivars with late blooming and higher chilling
requirements regulating dormancy break (Egea, 2003). This would also be helpful in order to
predict more accurately dormancy break in mature trees and subsequently increase yield, as
early flowering exposes flowers to frosts which then obviously affects fruit harvest. By
integrating information from research made in several previously unconnected pathways, new
and more effective breeding programs can be achieved, using knowledge gained in almond as a
model and applying it to other Prunus species and even other Rosaceae fruit trees. Production
can be improved and growth under climates previously unsatisfactory can be developed and
achieved.
88
89
REFERENCES
Achard, P., Gong, F., Cheminant, S., Alioua, M., Hedden, P., and Genschik, P.(2008).The cold-inducible CBF1 factor-dependent signaling pathway modulates the accumulation of the growth-repressing DELLA proteins via its effect on gibberellin metabolism.The Plant cell, 20(8), 2117-29.
Agarwal, M., Hao, Y., Kapoor, A., Dong, C.-H., Fujii, H., Zheng, X., and Zhu, J.-K.(2006).A R2R3 type MYB transcription factor is involved in the cold regulation of CBF genes and in acquired freezing tolerance.The Journal of Biological Chemistry, 281(49), 37636-37645.
Aguilar, A.A., and Smith, N.E.(1984).Nutritional value of almonds hulls for dairy cows.Journal of Dairy Science, 67, 97-103.
Andrews, J., Adams, S.R., Burton, K.S., and Edmondson, R.N.(2002).Partial purification of tomato fruit peroxidase and its effect on the mechanical properties of tomato fruit skin.Journal of Experimental Botany, 53(379), 2393-2399.
Anthony, R. G., Henriques, R., Helfer, A., Mészáros, T., Rios, G., Testerink, C., Munnik, T., et al.(2004).A protein kinase target of a PDK1 signalling pathway is involved in root hair growth in Arabidopsis.The EMBO journal, 23(3), 572-81.
Artlip, T. S., Callahan, A.M., Bassett, C. L., and Wisniewski, M.E.(1997).Seasonal expression of a dehydrin gene in sibling deciduous and evergreen genotypes of peach (Prunus persica [L.] Batsch).Plant Molecular Biology (Vol.33, pp.61-70-70).Springer Netherlands.
Artus, N. N.(1996).Constitutive expression of the cold-regulated Arabidopsis thaliana COR15a gene affects both chloroplast and protoplast freezing tolerance.Proceedings of the National Academy of Sciences, 93(23), 13404-13409.
Arumuganathan, K., and Earle, E.D.(1991).Nuclear DNA content of some important plant species.Plant Molecular Biology Reporter, 9(3), 208-218.Springer Netherlands.
Arús, P., Gradziel, T., Oliveira, M.M., and Tao, R.(2009).Genetics and Genomics of Rosaceae.In K.M.Folta and S.E.Gardiner (Eds.), Genetics and Genomics of Rosaceae.New York, NY: Springer
New York.
Ballester, J.(2001).Genetic mapping of a major gene delaying blooming time in almond.Plant breeding, 120(3), 268–270.Wiley Online Library.
Bangerth, K. F.(2009).Floral induction in mature, perennial angiosperm fruit trees: Similarities and discrepancies with annual/biennial plants and the involvement of plant hormones.Scientia Horticulturae, 122(2), 153-163.
Barros, P.(2011).Almond CBF transcription factors act in the environmental control of cold acclimation and dormancy break. PhD Thesis. ITQB-UNL (submitted).
Bassett, C. L., Wisniewski, M. E., Artlip, T. S., Richart, G., Norelli, J. L., and Farrell, R.E.(2009).Comparative expression and transcript initiation of three peach dehydrin genes.Planta, 230(1), 107-18.
Bastow, R., Mylne, J. S., Lister, C., Lippman, Z., Martienssen, R. A., and Dean, C.(2004).Vernalization requires epigenetic silencing of FLC by histone methylation.Nature, 427(6970), 164-167.Nature Publishing Group.
Bielenberg,, D. G., Wang, Y., Li, Z., Zhebentyayeva, T., Fan, S., Reighard, Lynn, G., Scorza, R., et al.(2008).Sequencing and annotation of the evergrowing locus in peach [Prunus persica (L.) Batsch] reveals a cluster of six MADS-box transcription factors as candidate genes for regulation of terminal bud formation.Tree Genetics and Genomes, 4(3), 495-507.
Bieniawska, Z., Espinoza, C., Schlereth, A., Sulpice, R., Hincha, D.K., and Hannah, M.A.(2008).Disruption of the Arabidopsis Circadian Clock Is Responsible for Extensive Variation in
90
the Cold-Responsive Transcriptome1[C][W][OA].Plant Physiology, 147(1), 263-279.American Society of Plant Biologists.
Boss, P. K., Bastow, R. M., Mylne, J. S., and Dean, C.(2004).Multiple Pathways in the Decision to Flower : Enabling , Promoting , and Resetting.Society, 16, 18-31.
Brunner, A. M., Yakovlev, I. A., and Strauss, S.H.(2004).Validating internal controls for quantitative plant gene expression studies.BMC Plant Biology, 4(1), 14.BioMed Central.
Böhlenius, H., Huang, T., Charbonnel-Campaa, L., Brunner, A.M., Jansson, S., Strauss, S.H., and Nilsson, O.(2006).CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees.Science, 312(5776), 1040-1043.AMER ASSOC ADVANCEMENT SCIENCE.
Castilho, A., Neves, N., Rufini-Castiglione, M., Viegas, W., and Heslop-Harrison, J.S.(1999).5-Methylcytosine distribution and genome organization in triticale before and after treatment with 5-azacytidine.Journal of Cell Science, 112 ( Pt 2(23), 4397-4404.
Chen, H.-H., and Li, P.H.(1980).Characteristics of Cold Acclimation and Deacclimation in Tuber-bearing Solanum Species.Plant Physiology, 65(6), 1146-1148.
Cheng, Hui, Qin, L., Lee, S., Fu, X., Richards, Donald E, Cao, D., Luo, D., et al.(2004).Gibberellin regulates Arabidopsis floral development via suppression of DELLA protein function.Development (Cambridge, England), 131(5), 1055-64.doi:10.1242/dev.00992
Chinnusamy, V., Ohta, M., Kanrar, S., Lee, B.-H., Hong, X., Agarwal, M., and Zhu, J.-K.(2003).ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis.Genes and Development, 17(8), 1043-1054.Cold Spring Harbor Laboratory Press.
Chinnusamy, V., Zhu, J., and Zhu, J.-K.(2007).Cold stress regulation of gene expression in plants.Trends in plant science, 12(10), 444-51.
Clough, S.J., and Bent, A.F.(1998).Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.The Plant journal : for cell and molecular biology, 16(6), 735-43.
Dirlewanger, E., Moing, A., Rothan, C., Svanella, L., Pronier, V., Guye, A., Plomion, C., et al.(1999).Mapping QTLs controlling fruit quality in peach ( Prunus persica (L.) Batsch).TAG Theoretical and Applied Genetics, 98(1), 18-31.
Dong, C.-H., Agarwal, M., Zhang, Y., Xie, Q., and Zhu, J.-K.(2006).The negative regulator of plant cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and degradation of ICE1.Proceedings of the National Academy of Sciences of the United States of America, 103(21), 8281-6.
Dubouzet, J.G., Sakuma, Yoh, Ito, Y., Kasuga, Mie, Dubouzet, E.G., Miura, Setsuko, Seki, M., et al.(2003).OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought-, high-salt- and cold-responsive gene expression.The Plant Journal, 33(4), 751-763.
Earley, K.W., Haag, J.R., Pontes, O., Opper, K., Juehne, T., Song, K., and Pikaard, C.S.(2006).Gateway-compatible vectors for plant functional genomics and proteomics.The Plant journal : for cell and molecular biology, 45(4), 616-29.
Egea, J.(2003).Chilling and heat requirements of almond cultivars for flowering.Environmental and Experimental Botany, 50, 79-85.
Elmayan, T., and Vaucheret, H.(1996, June).Expression of single copies of a strongly expressed 35S transgene can be silenced post-transcriptionally.The Plant Journal.
Espinosa-Ruiz, A., Saxena, S., Schmidt, J., Mellerowicz, E., Miskolczi, P., Bakó, L., and Bhalerao, Rishikesh P.(2004).Differential stage-specific regulation of cyclin-dependent kinases during cambial dormancy in hybrid aspen.The Plant Journal, 38(4), 603-615.
Fan, S., Bielenberg, Douglas G, Zhebentyayeva, T. N., Reighard, Gregory L, Okie, W. R., Holland, D., and Abbott, Albert G.(2010).Mapping quantitative trait loci associated with chilling requirement, heat requirement and bloom date in peach (Prunus persica).New Phytologist, 185(4), 917-930.
91
Finnegan, E. J., Peacock, W. J., and Dennis, E. S.(1996).Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development.Proceedings of the National Academy of Sciences of the United States of America, 93(16), 8449-54.
Fowler, S.(2002).Arabidopsis Transcriptome Profiling Indicates That Multiple Regulatory Pathways Are Activated during Cold Acclimation in Addition to the CBF Cold Response Pathway.THE PLANT CELL ONLINE, 14(8)
Fowler, S., Cook, D., and Thomashow, M.(2005).Low temperature induction of Arabidopsis CBF1, 2, and 3 is gated by the circadian clock.Plant physiology, 137(March), 961-968.
Franklin, K.A., and Whitelam, G.C.(2007).Light-quality regulation of freezing tolerance in Arabidopsis thaliana.Nature genetics, 39(11), 1410-3.Nature Publishing Group.
Fu, X., Richards, Donald E, Fleck, B., Xie, D., Burton, N., and Harberd, Nicholas P.(2004).The Arabidopsis Mutant sleepy1gar2-1 Protein Promotes Plant Growth by Increasing the Affinity of the SCFSLY1 E3 Ubiquitin Ligase for DELLA Protein SubstratesW.The Plant Cell, 16(6), 1406-1418.American Society of Plant Biologists.
Fusaro, A.F., Bocca, S.N., Ramos, R.L.B., Barrôco, R.M., Magioli, C., Jorge, V.C., Coutinho, T.C., et al.(2007).AtGRP2, a cold-induced nucleo-cytoplasmic RNA-binding protein, has a role in flower and seed development.Planta, 225(6), 1339-1351.Springer Berlin / Heidelberg.
Gil, B., Pastoriza, E., Ballester, A., and Sánchez, C.(2003).Isolation and characterization of a cDNA from Quercus robur differentially expressed in juvenile-like and mature shoots.Tree Physiology, 23(9), 633-640.
Gilmour, S J, Sebolt, A.M., Salazar, M.P., Everard, J.D., and Thomashow, M F.(2000).Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation.Plant physiology, 124(4), 1854-65.
Gilmour, Sarah J, Fowler, S.G., and Thomashow, Michael F.(2004).Arabidopsis transcriptional activators CBF1, CBF2, and CBF3 have matching functional activities.Plant molecular biology, 54(5), 767-81.Springer Netherlands.
Gong, Z., Lee, Hojoung, Xiong, L., Jagendorf, A., Stevenson, B., and Zhu, J.-K.(2002).RNA helicase-like protein as an early regulator of transcription factors for plant chilling and freezing tolerance.Proceedings of the National Academy of Sciences of the United States of America, 99(17), 11507-11512.National Academy of Sciences.
Gorovits, R., Akad, F., Beery, H., Vidavsky, F., Mahadav, A., and Czosnek, H.(2007).Expression of stress-response proteins upon whitefly-mediated inoculation of Tomato yellow leaf curl virus in susceptible and resistant tomato plants.Molecular plant-microbe interactions : MPMI, 20(11), 1376-83.The American Phytopathological Society.
Gould, P.D., Locke, J.C.W., Larue, C., Southern, M.M., Davis, S.J., Hanano, S., Moyle, R., et al.(2006).The molecular basis of temperature compensation in the Arabidopsis circadian clock.The Plant cell, 18(5), 1177-87.
Granger, C.L., and Cyr, R.J.(2001).Characterization of the yeast copper-inducible promoter system in Arabidopsis thaliana.Plant cell reports, 20(3), 227-34.
Grasselly, C., and Crossa-Raynaud, P.(1980).L’amandier (Almonds).Paris: Maisonneuve et Larose.
Grassely, C.(1978).Observations sur l'utilisation d'un mutant d'amandier à floraison tardive dans un programme d'hybridation.Ann Amélior Plant, 685-695.
GRD.(2008).Peach Genome.Retrieved from Genome Database for Rosaceae: http://www.rosaceae.org/peach/genome
Griffiths, J., Murase, K., Rieu, I., Zentella, R., Zhang, Z.-L., Powers, S.J., Gong, F., et al.(2006).Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis[W].The Plant Cell, 18(12), 3399-3414.American Society of Plant Biologists
92
Gusta, L V, and Weiser, C.J.(1972).Nucleic Acid and protein changes in relation to cold acclimation and freezing injury of korean boxwood leaves.Plant Physiology, 49(1), 91-96.
Haake, V., Cook, D., Riechmann, J.L., Pineda, O., Thomashow, Michael F, and Zhang, J.Z.(2002).Transcription factor CBF4 is a regulator of drought adaptation in Arabidopsis.Plant physiology, 130(2), 639-48.American Society of Plant Physiologists.
Harmer, S.L., Hogenesch, J.B., Straume, M., Chang, H.S., Han, B., Zhu, T., Wang, X., et al.(2000).Orchestrated Transcription of Key Pathways in Arabidopsis by the Circadian Clock.Science, 290(5499), 2110-2113.AAAS.
Henryk, M.-viola H., Andreas, F., and Conny, P.(2007).No Flower no Fruit – Genetic Potentials to Trigger Flowering in Fruit Trees.Signal Processing.
Holtorf, S., Apel, K., and Bohlmann, H.(1995).Comparison of different constitutive and inducible promoters for the overexpression of transgenes in Arabidopsis thaliana.Plant Molecular Biology, 29(4), 637-646.Springer Netherlands.
Horvath, D.P., Anderson, J.V., Chao, W.S., and Foley, M.E.(2003).Knowing when to grow: signals regulating bud dormancy.Trends in plant science, 8(11), 534-40.
Horvath, D.P., Sung, S., Kim, D., Chao, W., and Anderson, J.(2010).Characterization, expression and function of DORMANCY ASSOCIATED MADS-BOX genes from leafy spurge.Plant Molecular Biology, 73(1-2), 169-79.
Hu, J., Mitchum, M.G., Barnaby, N., Ayele, B.T., Ogawa, M., Nam, E., Lai, W.-C., et al.(2008).Potential sites of bioactive gibberellin production during reproductive growth in Arabidopsis.The Plant cell, 20(2), 320-36.
Huang, G.-T., Ma, S.-L., Bai, L.-P., Zhang, L., Ma, H., Jia, P., Liu, J., et al.(2011).Signal transduction during cold, salt, and drought stresses in plants.Molecular biology reports.
Hunzicker, G.M.(2008).Exploring a new detergent-inducible promoter active in higher plants and its potential biotechnological application.Crop Science.The Regional Institute Ltd.
Hättasch, C., Flachowsky, H., Kapturska, D., and Hanke, M.-V.(2008).Isolation of flowering genes and seasonal changes in their transcript levels related to flower induction and initiation in apple (Malus domestica).Tree physiology, 28(10), 1459-66.
Immink, R.G.H., Kaufmann, K., and Angenent, G.C.(2010).The “ABC” of MADS domain protein behaviour and interactions.Seminars in cell and developmental biology, 21(1), 87-93.
Jansson, S., and Douglas, C.J.(2007).Populus: a model system for plant biology.Annual Review of Plant Biology, 58(January), 435-458.
Jiménez, S., Reighard, G L, and Bielenberg, D G.(2010).Gene expression of DAM5 and DAM6 is suppressed by chilling temperatures and inversely correlated with bud break rate.Plant molecular biology, 73(1-2), 157-67.
Joobeur, T., Periam, N., De Vicente, M.C., King, G.J., and Arus, P.(2000).Development of a second generation linkage map for almond using RAPD and SSR markers.Genome, 43(4), 649-655.
Julian, C., Rodrigo, J., and Herrero, M.(2011).Stamen development and winter dormancy in apricot (Prunus armeniaca).Annals of botany.
Kalberer, S., Wisniewski, M, and Arora, R.(2006).Deacclimation and reacclimation of cold-hardy plants: Current understanding and emerging concepts.Plant Science, 171(1), 3-16.
Kalcsits, LA, Silim, S, and Tanino, K.(2009).Warm temperature accelerates short photoperiod-induced growth cessation and dormancy induction in hybrid poplar (Populus × spp.).Trees Structure and Function, online(5), 971-979.
Keller, B., and Baumgartner, C.(1991).Vascular-specific expression of the bean GRP 1.8 gene is negatively regulated.The Plant Cell, 3(10), 1051-1061.
Kendall, S.L., Hellwege, A., Marriot, P., Whalley, C., Graham, I.a, and Penfield, S.(2011).Induction of Dormancy in Arabidopsis Summer Annuals Requires Parallel Regulation of DOG1 and Hormone
93
Metabolism by Low Temperature and CBF Transcription Factors.The Plant cell, 1-14.
Kester, D.(1965).Inheritance of time of bloom in certain progenies of almond.Proceedings of the American Society for Horticultural Science(87), 214-221.
Kester, D., and Ross, N.(1996).History in Almond: Production Manual.University of California, Oakland.
Kester, D., Gradziel, T., and Grasselly, C.(1991).Almond (Prunus).Acta Horticulturae(290), 701–760.
Kibbe, W. A.(2007).OligoCalc: an online oligonucleotide properties calculator.Nucleic acids research, 35(Web Server issue), W43-6.
Kidokoro, S., Maruyama, K., Nakashima, K., Imura, Y., Narusaka, Y., Shinwari, Z.K., Osakabe, Y., et al.(2009).The phytochrome-interacting factor PIF7 negatively regulates DREB1 expression under circadian control in Arabidopsis.Plant Physiology, 151(4), 2046-2057.American Society of Plant Biologists.
Kim, J. S., Park, S. J., Kwak, K. J., Kim, Y. O., Kim, J. Y., Song, J., Jang, B., et al.(2007).Cold shock domain proteins and glycine-rich RNA-binding proteins from Arabidopsis thaliana can promote the cold adaptation process in Escherichia coli.Nucleic Acids Research, 35(2), 506-516.Oxford University Press.
Kim, S., An, C. S., Hong, Y.-N., and Lee, K.-W.(2004).Cold-inducible transcription factor, CaCBF, is associated with a homeodomain leucine zipper protein in hot pepper (Capsicum annuum L.).Molecules and cells, 18(3), 300-8.
Kitashiba, H. (2004).Expression of a sweet cherry DREB1/CBF ortholog in Arabidopsis confers salt and freezing tolerance.Journal of Plant Physiology, 161(10), 1171-1176.
Kitashiba, H., Ishizaka, T., Isuzugawa, K., Nishimura, K., and Suzuki, T.(2004).Expression of a sweet cherry DREB1/CBF ortholog in Arabidopsis confers salt and freezing tolerance.Journal of Plant Physiology, 161(10), 1171-1176.
Lamp, B.M., Connell, J.H., Duncan, R.A., Viveros, M., and Polito, V.S.(2001).Almond Flower Development : Floral Initiation and Organogenesis.JOURNALAMERICAN SOCIETY FOR HORTICULTURAL SCIENCE, 126(6), 689-696.AMERICAN SOCIETY FOR HORTICULTURAL SCIENCE.
Lang, G. A., Early, J. D., Martin, G. C., and Darnell, R. L.(1987).Endodormancy, Paradormancy, and Ecodormancy - Physiological Terminalogy and Classification for Dormancy Research.Hortscience, 22(3), 371-377.AMER SOC HORTICULTURAL SCIENCE.
Lee, C. -S., Chien, C. -T., Lin, C. -H., Chiu, Y.- Y., and Yang, Y.- S.(2006).Protein changes between dormant and dormancy-broken seeds of Prunus campanulata Maxim.Proteomics, 6(14), 4147-54.
Lee, Hojoung, Guo, Y., Ohta, M., Xiong, L., Stevenson, B., and Zhu, J. -K.(2002).LOS2, a genetic locus required for cold-responsive gene transcription encodes a bi-functional enolase.the The European Molecular Biology Organization Journal, 21(11), 2692-2702.Oxford University Press.
Lee, H., Xiong, L., Gong, Z., Ishitani, M., Stevenson, B., and Zhu, J. -K.(2001).The Arabidopsis HOS1 gene negatively regulates cold signal transduction and encodes a RING finger protein that displays cold-regulated nucleo--cytoplasmic partitioning.Genes and Development, 15(7), 912-924.Cold Spring Harbor Laboratory Press.
Lee, Horim, Suh, S.- S., Park, E., Cho, E., Ahn, J. H., Kim, S. -G., Lee, J. S., et al.(2000).The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis.Genes and Development, 14(18), 2366-2376.Cold Spring Harbor Laboratory Press.
Leinonen, I., Repo, T., and Hänninen, H.(1997).Changing environmental effects on frost hardiness of Scots pine during dehardening.Annals of Botany, 79(2), 133-138.Annals Botany Co.
Li, Z., Reighard, G.L., Abbott, A. G., and Bielenberg, D. G. (2009).Dormancy-associated MADS genes from the EVG locus of peach [Prunus persica (L.) Batsch] have distinct seasonal and photoperiodic expression patterns.Journal of experimental botany, 60(12), 3521-30.
94
Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K., and Shinozaki, K. (1998).Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis.The Plant cell, 10(8), 1391-406.
Luna, V., Soriano, M. D., Bottini, R., Sheng, C., and Pharis, R. P.(1993).Levels of Endogenous Gibberellins, Abscisis Acid, Iold 4 Acetic Acid and Narigenin during Dormancy of Peach Flower Buds.
Magome, H., Yamaguchi, S., Hanada, A., Kamiya, Y., and Oda, K.(2004).dwarf and delayed-flowering 1, a novel Arabidopsis mutant deficient in gibberellin biosynthesis because of overexpression of a putative AP2 transcription factor.The Plant Journal, 37(5), 720-729.
Magome, H., Yamaguchi, S., Hanada, A., Kamiya, Y., and Oda, K.(2008).The DDF1 transcriptional activator upregulates expression of a gibberellin-deactivating gene, GA2ox7, under high-salinity stress in Arabidopsis.The Plant journal : for cell and molecular biology, 56(4), 613-26.
Mathieu, O., Reinders, J., Caikovski, M., Smathajitt, C., and Paszkowski, J.(2007).Transgenerational stability of the Arabidopsis epigenome is coordinated by CG methylation.Cell, 130(5), 851-62.
Medina, J., Catalá, R., and Salinas, J.(2010).The CBFs: Three arabidopsis transcription factors to cold acclimate.Plant Science.
Meisel, L., Fonseca, B., González, S., Baeza-Yates, R., Cambiazo, V., Campos, R., Gonźalez, M., et al.(2005).A rapid and efficient method for purifying high quality total RNA from peaches (Prunus persica) for functional genomics analyses.Biological Research, 38(1), 83-88.
Mishiba, K.-ichiro, Nishihara, M., Nakatsuka, T., Abe, Y., Hirano, Hiroshi, Yokoi, T., Kikuchi, A., et al.(2005).Consistent transcriptional silencing of 35S-driven transgenes in gentian.The Plant journal : for cell and molecular biology, 44(4), 541-56.
Miura, K., Jin, J. B., Lee, J., Yoo, C. Y., Stirm, V., Miura, T., Ashworth, E. N., et al.(2007).SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis.The Plant cell, 19(4), 1403-14.
Mlotshwa, S., Pruss, G. J., Gao, Zhihuan, Mgutshini, N. L., Li, J., Chen, X., Bowman, L. H., et al.(2010).Transcriptional Silencing Induced by Arabidopsis T-DNA Mutants is Associated with 35S Promoter siRNAs and Requires Genes Involved in siRNA-mediated Chromatin Silencing.The Plant Journal
Nagy, N. E., Fossdal, C. G., Dalen, L. S., Lönneborg, A., Heldal, I., and Johnsen, Ø.(2004).Effects of Rhizoctonia infection and drought on peroxidase and chitinase activity in Norway spruce (Picea abies).Physiologia plantarum, 120(3), 465-473.
De Nettancourt, D.(1997).Incompatibility in angiosperms.Sexual Plant Reproduction, 10(4), 185-199.Springer-Verlag.
Novillo, F., Alonso, J. M., Ecker, J. R., and Salinas, J.(2004).CBF2/DREB1C is a negative regulator of CBF1/DREB1B and CBF3/DREB1A expression and plays a central role in stress tolerance in Arabidopsis.Proceedings of the National Academy of Sciences of the United States of America, 101(11), 3985-90.
Novillo, F., Medina, J., and Salinas, J.(2007).Arabidopsis CBF1 and CBF3 have a different function than CBF2 in cold acclimation and define different gene classes in the CBF regulon.Proceedings of the National Academy of Sciences of the United States of America, 104(52), 21002-7.
Oliveira, M., Miguel, C., and Costa, M.(2008).Almond.In C.Kole, and T.C.Hall, Compedium of Transgenic Crop Plants: Transgenic Temperate Fruits and Nuts (Vol.4, pp.259-283).Wiley-Blackwell.
Perry, T. O.(1971).Dormancy of trees in winter.Science, 171(3966), 29-36.
Pino, M. -T., Skinner, J. S., Park, E. -J., Jeknić, Z., Hayes, P. M., Thomashow, M. F., and Chen, T.H.H.(2007).Use of a stress inducible promoter to drive ectopic AtCBF expression improves potato freezing tolerance while minimizing negative effects on tuber yield.Plant Biotechnology Journal, 5(5),
95
591-604.
Pinyopich, A., Ditta, Gary S, Savidge, B., Liljegren, S. J., Baumann, E., Wisman, E., and Yanofsky, M. F.(2003).Assessing the redundancy of MADS-box genes during carpel and ovule development.Nature, 424(6944), 85-88.
Reinoso, H., Luna, Virginia, D. C., Pharis, R. P., and Bottini, R.(2002).Dormancy in peach (Prunus persica) flower buds.VI.Effects of gibberellins and an acylcyclohexanedione (trinexapac-ethyl) on bud morphogenesis in field experiments with orchard trees and on cuttings.Canadian Journal of Botany, 80(6), 664-674.NATL RESEARCH COUNCIL CANADA.
Renaut, J., Hausman, J. -F., and Wisniewski, M. E.(2006).Proteomics and low-temperature studies: bridging the gap between gene expression and metabolism.Physiologia Plantarum, 126(1), 97-109.
Richards, D. E., King, K. E., Ait-Ali, T., and Harberd, N. P.(2001).HOW GIBBERELLIN REGULATES PLANT GROWTH AND DEVELOPMENT: A Molecular Genetic Analysis of Gibberellin Signaling.Annual Review of Plant Physiology and Plant Molecular Biology, 52(1), 67-88.
Rinne, P.L.H., Welling, A., Vahala, J., Ripel, L., Ruonala, R., Kangasjärvi, J., and van der Schoot, C.(2011).Chilling of dormant buds hyperinduces FLOWERING LOCUS T and recruits GA-inducible 1,3-beta-glucanases to reopen signal conduits and release dormancy in Populus.The Plant cell, 23(1), 130-46.
Rodrigo, J., and Herrero, M.(1998).Influence of intraovular reserves on ovule fate in apricot ( Prunus armeniaca L.).Sexual Plant Reproduction, 11(2), 86-93.doi:
Rodriguez, J., Sherman, W., Scorza, R., Wisniewski, M., and Okie, W.(1994).Evergreen peach, its inheritance and dormant behavior.Journal of the American Society for Horticultural Science, 119.
Rohde, A., and Bhalerao, Rishikesh P.(2007).Plant dormancy in the perennial context.Trends in plant science, 12(5), 217-23.
Rouhi, V., Samson, R., Lemeur, R., and Damme, P.V.(2007).Photosynthetic gas exchange characteristics in three different almond species during drought stress and subsequent recovery.Environmental and Experimental Botany, 59(2), 117-129.
Rozen, S., and Skaletsky, H.(2000).Primer3 on the WWW for general users and for biologist programmers.Methods in molecular biology (Clifton, N.J.), 132, 365-86.
Rugini, E.(1986).Almond.In D.Evans, W.Sharp, and P.Ammirato, Handbook of Plant Cell Culture (Vol.4, pp.574–611).New York: Macmillan.
Ruzicka, D.R.(2008, November 19).Arabidopsis Actin Depolymerizing Factor5 functions in multicellular development and is a novel repressor of the CBF cold response transcription factors.Developmental Biology.
Sakuma, Yoh, Liu, Qiang, Dubouzet, J.G., Abe, Hiroshi, Shinozaki, Kazuo, and Yamaguchi-Shinozaki, Kazuko.(2002).DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression.Biochemical and Biophysical Research Communications, 290(3), 998-1009.
Samach, A., Onouchi, H., Gold, S.E., Ditta, G S, Schwarz-Sommer, Z., Yanofsky, M F, and Coupland, G.(2000).Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis.Science, 288(5471), 1613-1616.
Santos, A. M., Oliver, M. J., Sánchez, A. M., Payton, P. R., Gomes, J. P., Miguel, C., and Oliveira,M. M.(2009).An integrated strategy to identify key genes in almond adventitious shoot regeneration.Journal of Experimental Botany, 60(14), 4159-4173.
Schrader, J., Moyle, R., Bhalerao, R., Hertzberg, M., Lundeberg, J., Nilsson, P., and Bhalerao, R P.(2004).Cambial meristem dormancy in trees involves extensive remodelling of the transcriptome.The Plant Journal, 40(2), 173-87.Wiley Online Library.
Shan, D. -P., Huang, J. -G., Yang, Y. -T., Guo, Y. -H., Wu, C. -A., Yang, G. -D., Gao, Z., et al.(2007).Cotton GhDREB1 increases plant tolerance to low temperature and is negatively regulated
96
by gibberellic acid.The New phytologist, 176(1), 70-81.
Shen, Y. -G., Zhang, W. -K., Yan, D. -Q., Du, B. -X., Zhang, J. -S., Liu, Q., and Chen, S. -Y.(2003).Characterization of a DRE-binding transcription factor from a halophyte Atriplex hortensis.Tag Theoretical And Applied Genetics Theoretische Und Angewandte Genetik, 107(1), 155-161.
Siddiqua, M., and Nassuth, A.(2011).Vitis CBF1 and Vitis CBF4 differ in their effect on Arabidopsis abiotic stress tolerance, development and gene expression.Plant, cell and environment, 34(8), 1345-59.
Silva, C.(2005).Mechanism underlying flowering in Almond (Prunus dulcis) - A molecular perspective.PhD Thesis.
Silva, C, Garcia-Mas, J., Sánchez, A.M., Arús, P., and Oliveira, M.M.(2005). Looking into flowering time in almond (Prunus dulcis (Mill) D.A.Webb): the candidate gene approach.TAG.Theoretical and applied genetics.Theoretische und angewandte Genetik, 110(5), 959-68.Springer Berlin / Heidelberg.
Simpson, G., and Dean, C.(2002).Arabidopsis, the rosetta stone of flowering time? Science(296), 285-289.
Smith, L. G., Greene, B., Veit, B., and Hake, S.(1992).A dominant mutation in the maize homeobox gene, Knotted-1, causes its ectopic expression in leaf cells with altered fates.Development Cambridge England, 116(1), 21-30.
Socias i Company, R., and and Felipe, A.(1977).Heritability of self-compatibility in almond.In C.Grasselly, Third Coll GREMPA (pp.181–183).Bordeaux: INRA.
Socias i Company, R., Felipe, A., Gómez Aparisi, J., García, J., and Dicenta, F.(1998).The ideotype concept in almond.Acta Horticulturae(470), 51–56.
Spiller, G. A., Jenkins, D. A., Bosello, O., Gates, J. E., Cragen, L.N., and Bruce, B.(1998).Nuts and plasma lipids: an almond-based diet lowers LDL-C while preserving HDL-C.Journal of the American College of Nutrition, 17(3), 285-290.
Srinivasan, C., Padilla, I. M., and Scorza, R.(2005).Prunus spp.Almond, Apricot, Cherry, Nectarine, Peach and Plum.In R.Litz, Biotechnology in Agriculture Series: Biotechnology of Fruit and Nut Crops (Vol.29, pp.512-542).CABI Publishing.
Steponkus, P. L., Uemura, M, Joseph, R. A., Gilmour, S.J., and Thomashow, M.F.(1998).Mode of action of the COR15a gene on the freezing tolerance of Arabidopsis thaliana.Proceedings of the National Academy of Sciences of the United States of America, 95(24), 14570-5.
Steponkus, P. L.(1984).Role of the plasma membrane in freezing injury and cold acclimation.Annual Review of Plant Physiology, 35(1), 543-584.Annual Reviews 4139 El Camino Way, PO Box 10139, Palo Alto, CA 94303-0139, USA.
Sunkar, R., and Zhu, J. -K.(2004).Novel and Stress-Regulated MicroRNAs and Other Small RNAs from Arabidopsis.Society, 16(August), 2001-2019.
Taiz, L., and Zeiger, E.(2006).Plant Physiology.(Lincoln Taiz and Eduardo Zeiger, Eds.)Annals of Botany (Vol.132, p.682).Sinauer Associates.
Tani, E., Polidoros, A. N., Flemetakis, E., Stedel, C., Kalloniati, C., Demetriou, K., Katinakis, P., et al.(2009).Characterization and expression analysis of AGAMOUS-like, SEEDSTICK-like, and SEPALLATA-like MADS-box genes in peach (Prunus persica) fruit.Plant physiology and biochemistry : PPB / Société française de physiologie végétale, 47(8), 690-700.
Tanino, K .K., Kalcsits, Lee, Silim, Salim, Kendall, E., and Gray, G. R.(2010).Temperature-driven plasticity in growth cessation and dormancy development in deciduous woody plants: a working hypothesis suggesting how molecular and cellular function is affected by temperature during dormancy induction.Plant molecular biology, 73(1-2), 49-65.
Thomas, S. G., Phillips, A. L., and Hedden, P.(1999).Molecular cloning and functional expression of
97
gibberellin 2- oxidases, multifunctional enzymes involved in gibberellin deactivation.Proceedings of the National Academy of Sciences of the United States of America, 96(8), 4698-703.
Thomashow, M. F.(1999).PLANT COLD ACCLIMATION: Freezing Tolerance Genes and Regulatory Mechanisms.Annual review of plant physiology and plant molecular biology, 50, 571-599.
Thomashow, M.F.(2010).Molecular Basis of Plant Cold Acclimation: Insights Gained from Studying the CBF Cold Response Pathway.PLANT PHYSIOLOGY, 154(2), 571-577.
Thomashow, M. F., Gilmour, Sarah J., Stockinger, E. J., Jaglo-Ottosen, K. R., and Zarka, D. G.(2001).Role of the Arabidopsis CBF transcriptional activators in cold acclimation.Physiologia Plantarum, 112(2), 171-175.
Uemura, M., and Steponkus, P. L.(1999).Cold Acclimation in Plants: Relationship Between the Lipid Composition and the Cryostability of the Plasma Membrane.Journal of Plant Research, 112(2), 245-254.Springer Japan.
Ulrich, H. D.(2005).Mutual interactions between the SUMO and ubiquitin systems: a plea of no contest.Trends in Cell Biology, 15(10), 525-532.
Usadel, B., Bläsing, O .E., Gibon, Y., Poree, F., Höhne, M., Günter, M., Trethewey, R., et al.(2008).Multilevel genomic analysis of the response of transcripts, enzyme activities and metabolites in Arabidopsis rosettes to a progressive decrease of temperature in the non-freezing range.Plant, cell and environment, 31(4), 518-47.
Ushijima, K., Sassa, H., Dandekar, A. M., Gradziel, T. M., Tao, R., and Hirano, H.(2003).Structural and Transcriptional Analysis of the Self-Incompatibility Locus of Almond: Identification of a Pollen-Expressed F-Box Gene with Haplotype-Specific Polymorphism.Society, 15(March), 771-781.Am Soc Plant Biol.
Verde, I., Quarta, R., Cedrola, C., and Dettori, M.(2002).QTL analysis of agronomic traits in a BC1 peach population.Acta Horticulturae, 592, 291-297.
Vijayraghavan, U., Prasad, K., and Meyerowitz, E.(2005).Specification and maintenance of the floral meristem : interactions between positively- acting promoters of flowering and negative regulators.Current, 89(11).
Vogel, J. T., Zarka, D.G., Van Buskirk, H. A., Fowler, S. G., and Thomashow, M. F.(2005).Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis.The Plant Journal, 41(2), 195-211.
Wareing, P. F.(1956).Photoperiodism in Woody Plants.Annual Review of Plant Physiology, 7(1), 191-214.Annual Reviews 4139 El Camino Way, P.O.Box 10139, Palo Alto, CA 94303-0139, USA.
Watkins, R.(1979).Cherry, plum, peach, apricot and almond.Prunus spp.In Evolution of Crop Plants (pp.242-247).London: Longman.
Welling, A., and Palva, E. T.(2006).Molecular control of cold acclimation in trees.Physiologia Plantarum, 127(2), 167-181.
Wisniewski, M., Bassett, C., and Gusta, L. V. (2003).An overview of cold hardiness in woody plants: seeing the forest through the trees.HortScience, 38(5), 952–959.
Wisniewski, M., Norelli, J., Bassett, Carole, Artlip, T., and Macarisin, D.(2011).Ectopic expression of a novel peach (Prunus persica) CBF transcription factor in apple (Malus × domestica) results in short-day induced dormancy and increased cold hardiness.Planta.
Xiong, L., Lee, Hojoung, Ishitani, M., Tanaka, Y., Stevenson, B., Koiwa, H., Bressan, R. A., et al.(2002).Repression of stress-responsive genes by FIERY2, a novel transcriptional regulator in Arabidopsis.Proceedings of the National Academy of Sciences of the United States of America, 99(16), 10899-904.
Xue, G. -P.(2003).The DNA-binding activity of an AP2 transcriptional activator HvCBF2 involved in regulation of low-temperature responsive genes in barley is modulated by temperature.The Plant Journal, 33(2), 373-383.
98
Yakovlev, L., Asante, D. K., Fossdal, C. G., Partanen, J., Junttila, O., and Johnsen, O.(2008).Dehydrins expression related to timing of bud burst in Norway spruce.Planta, 228(3), 459-72.
Yamane, H., Kashiwa, Y., Ooka, T., Tao, R., and Yonemori, K.(2008).Suppression Subtractive Hybridization and Differential Screening Reveals Endodormancy-associated Expression of an SVP/AGL24-type MADS-box Gene in Lateral Vegetative Buds of Japanese Apricot.Journal of the American Society for Horticultural Science, 133(5), 708-716.
Yamane, H., Kashiwa, Y., Kakehi, E., Yonemori, K., Mori, H., Hayashi, K., Iwamoto, K., et al.(2006).Differential expression of dehydrin in flower buds of two Japanese apricot cultivars requiring different chilling requirements for bud break.Tree physiology, 26(12), 1559-63.
Yamane, H., Ooka, T., Jotatsu, H., Hosaka, Y., Sasaki, R., and Tao, R.(2011).Expressional regulation of PpDAM5 and PpDAM6, peach (Prunus persica) dormancy-associated MADS-box genes, by low temperature and dormancy-breaking reagent treatment.Journal of experimental botany, 62(10), 3481-8.
Yokoyama, R., and Nishitani, K.(2006).Identification and characterization of Arabidopsis thaliana genes involved in xylem secondary cell walls.Journal of Plant Research, 119(3), 189-194.
Zeevaart, J. A. D.(2006).Florigen coming of age after 70 years.The Plant Cell, 18(8), 1783-9.Am Soc Plant Biol.
Zhang, X., Fowler, S. G., Cheng, H., Lou, Y., Rhee, S. Y., Stockinger, E.J., and Thomashow, M. F.(2004).Freezing-sensitive tomato has a functional CBF cold response pathway, but a CBF regulon that differs from that of freezing-tolerant Arabidopsis.The Plant Journal, 39(6), 905-919.
Zhou, M. Q., Shen, C., Wu, L.H., Tang, K. X., and Lin, J.(2011).CBF-dependent signaling pathway: a key responder to low temperature stress in plants.Critical reviews in biotechnology, 31(2), 186-92.Informa Healthcare.
I
APPENDIX
MA – MS based medium (1%) (1L)
MS Medium 100mL
MES Buffer 0.5g
Sucrose 10g
Sterile Water to 1L
(pH to 5.7 with KOH)
Plant-Culture Agar 8g
(sterilize 30min/121ºC)
II
QUICK DNA EXTRACTION PROTOCOL
(for A.thaliana)
Homogenization Buffer (HB) TrisHCl 200mM
NaCl 250mM EDTA 25mM SDS 0.50% H20dd
1. Grind leaf/leaves in liquid nitrogen
2. Add 300uL of HN, homogenize and incubate 10min at room temperature (RT)
3. Add 150uL of NaAc ph 5.2 and mix by inversion
4. Incubate 10min at -20ºC
5. Centrifuge 10min at maximum speed
6. Transfer supernatant to new tube and add equal volume of isopropanol
7. Incubate 10min at RT
8. Centrifuge 15min at maximum speed
9. Discard supernatant and wash pellet with 1mL 70% ethanol
10. Centrifuge 5min at maximum speed, discard supernatant and dry pellet
11. Ressuspend pellet in 50uL of H20dd + RNase (0.1ug.uL-1)
III
POLYSACCARIDE PRECIPITATION
1. Add 1vol (volume) KAc 2M to the RNA solution
2. Incubate on ice for 30min
3. Centrifuge at 4ºC and 12.000g during 20min
4. Collect supernatant to new tube
5. Add 2.5vol EtOh 100% to precipitate RNA
6. Incubate at -20ºC for 15min
7. Centrifuge at 4ºC and 12.000g during 20min
8. Discard supertant
9. Wash with 1mL EtOH 70%
10. Centrifuge at 4ºC and 12.000g for 10min
11. Discard supernatant and dry pellet
12. Ressuspend pellet in 20-50uL RNA-se free water
RNA PRECIPITATION
Precipitation Solution (PS) RNA 30uL
LiCl 8M 25uL
EDTA 0,5M 2uL
H20 DEPC-treated 23uL
1. Add precipitation solution (PS)
2. Vortex
3. Incubate 30min at -20ºC
4. Centrifuge at 4ºC and 11.000rpm during 30min
5. Discard supernatant
6. Add EtOH 70% - conserved at -20ºC – to wash pellet
7. Centrifuge at 4ºC and 11.000rpm during 20min
8. Discard supernatant and dry pellet
9. Ressuspend pellet in 20-50ul RNA-se free water
IV
SEMI-QUANTITATIVE PCR REACTIONS
cDNA synthesis
Template-primer mix RNA solution 2ug
OligoDt primers 0,5uL
RNA-se free water 5,75uL
total
65ºC - 10min Immediately place on ice
Master RT Mix Buffer 5X 2uL
RNAse inhibitor 0.25uL
Deoxynucleotide mix 10mM 1uL
DTT 0.5uL
RT (Reverse Transcriptase) 0.5uL
RT-PCR Program 25ºC 10min
55ºC 30min
85ºC 5min
V
PROTEIN EXTRACTION BUFFER (PEB)
TricHCl pH8.0 50mM
NaCl 150mM
EDTA pH8.0 2mM
Triton X-100 0.40%
Complete (Protease Inhibitor) 2X
H20dd
(PEB should be stored at -20ºC without 2X Complete)
LACUS BUFFER (STOCK)
TrisHCl pH8 25mM
MgCl2 10mM
EGTA 15mM
NaCl 15mM
Naf 1mM
NaVO3 0.5mM
Tween-20 0.10%
β-glycerol phosphate 15mM
H20dd
LACUS BUFFER
DTT 1mM
PNPP 15mM
PMSF 0.5mM
Complete 1X
Lacus Buffer stock
VI
WESTERN BLOTTING GEL PREPARATION AND SOLUTIONS
RESOLVING GEL 12% TrisHCl pH 8,8 1.5mM 2.5mL
SDS 10% 100uL
H20dd 3.28mL
Acrylamide mix 30% (29:1) 4mL
APS 10% 100uL
TEMED 4uL
10mL(2 gels)
STACKING GEL 5%
TrisHCl pH 6,8 1M 630uL
SDS 10% 50uL
H20dd 3.4mL
Acrylamide mix 30% (29:1) 850uL
APS 10% 50uL
TEMED 5uL
TG 10X (Stock solution) Tris 58g
Glycine 29g
H20dd to 1L
TG 1X TG 10X 1X
Methanol 20%
H20dd
TBS 1X Tris 1M pH7.5 25mL
NaCl 4M 37.5mL
Tween-20 25% 4mL
H20dd to 1L
Stripping Solution SDS 10% 20mL
TrisHCl pH 6.8 1M 6.5mL
β-mercaptoethanol 300uL
VII
Fig
ure
A –
Am
plif
ication (
2X
) of
the inte
rior
of
alm
ond flo
wer
bud
s f
rom
tre
es #
2 a
nd #
1 a
fter
transv
ers
al sectionin
g a
long w
ith r
epre
se
nta
tive
shoot.
For
Decem
ber
20
th tw
o r
epre
se
nta
tive s
tages a
re s
ho
wn.
The w
hite lin
e in m
agnifie
d flo
wer
bud p
ictu
res r
epre
sents
a 1
mm
scale
d
measure
ment
top related