chip-on-chip and differential location analysis junguk hur school of informatics october 4, 2005
Post on 01-Jan-2016
217 Views
Preview:
TRANSCRIPT
ChIP-on-Chip and ChIP-on-Chip and Differential Location Differential Location
AnalysisAnalysis
Junguk HurJunguk HurSchool of InformaticsSchool of Informatics
October 4, 2005
OverviewOverview
Introduction to Transcriptional Introduction to Transcriptional
RegulationRegulation
ChIP-on-Chip (ChIP-Chip)ChIP-on-Chip (ChIP-Chip)
Current ApproachesCurrent Approaches
Our ApproachOur Approach
The Central DogmaThe Central Dogma
Transcription
RNADNA
Translation
Protein
Genes need to be Genes need to be regulatedregulated
* If gene regulation goes awry? => Developmental abnormality
=> Diseases such as Chronic myeloid leukemia rheumatoid arthritis
•transcription •post transcription (RNA stability) •post transcription (translational control) •post translation (not considered gene
regulation) usually, when we speak of gene
regulation, we are referring to transcriptional regulationthe “transcriptome”
Transcriptional Transcriptional RegulationRegulation
DNA binding proteins
Binding sites(specific sequences)
Coding region(transcribed)
Non-coding region
RNA transcript
Gene 1
Gene 2
Gene 3
Activator Repressor
Transcriptional Transcriptional RegulationRegulation
Transcription Factor Transcription Factor Binding SitesBinding Sites
Gene regulatory proteins contain structural elements Gene regulatory proteins contain structural elements that can “that can “readread” DNA sequence “” DNA sequence “motifsmotifs””
The amino acid – DNA recognition is not straightforwardThe amino acid – DNA recognition is not straightforward Experiments can pinpoint binding sites on DNAExperiments can pinpoint binding sites on DNA
Zinc finger Leucine zipperHelix-Turn-Helix
Modeling Binding SitesModeling Binding Sites
GCGGGGCCGGGCTGGGGGCGGGGTAGGGGGCGGGGGTAGGGGCCGGGCTGGGGGCGGGGTTGGGGGCCGGGCATGGGGCGGGGCGTGGGGCGGGGCAAAGGGCCGGGCGGGAGGCCGGGAGCGGGGCGGGGCGAGGGGACGAGTCCGGGGCGGTCCATGGGGCGGGGC
AA 44 33 11 11 00 00 11 00 00 11 00 11
CC 11 33 00 00 00 00 1313 66 00 00 11 99
GG 55 55 1313 1313 1414 1414 00 88 1414 1212 1313 11
TT 44 33 00 00 00 00 00 00 00 11 00 33
Consensus sequenceConsensus sequence Probabilistic modelProbabilistic model
(profile of a binding site)(profile of a binding site)
Given a set of (aligned) binding sites …
NNGGGGCNGGGC
OverviewOverview
Introduction to Transcriptional Introduction to Transcriptional
RegulationRegulation
ChIP-on-Chip (ChIP-Chip)ChIP-on-Chip (ChIP-Chip)
Current ApproachesCurrent Approaches
Our ApproachOur Approach
ChIP-on-ChipChIP-on-Chip
Based on Based on ChIP (Chromatin Immuno-Precipitation)ChIP (Chromatin Immuno-Precipitation) MicroarrayMicroarray
In vivo assayIn vivo assay Genome-wide location analysisGenome-wide location analysis
Chromatin Immuno Chromatin Immuno Precipitation (ChIP)Precipitation (ChIP)
Immunoprecipitation
Supernatant Pellet
Sonication orvortexing with glass-beads
• Using antibody of a protein of interest• DNA bound to specific protein are enriched.
ChIP-on-Chip (ChIP-on-Chip (Ren Ren et al.et al.))
Array of intergenic sequences from the whole
genome
Protein Binding Microarray Protein Binding Microarray (PBM)(PBM)
(Bulyk (Bulyk et al.et al.)) In vitroIn vitro assayassay DNA-binding protein of interest is expressed DNA-binding protein of interest is expressed
with an epitope tag, purified and then bound with an epitope tag, purified and then bound
directly to a double-strand DNA directly to a double-strand DNA
microarraymicroarray
Can overcome the shortcomings of ChIP-on-Can overcome the shortcomings of ChIP-on-
ChipChip Poor enrichmentPoor enrichment No available antibodyNo available antibody Unknown culture condition or time pointsUnknown culture condition or time points
Protein Binding Protein Binding MicroarrayMicroarray
Whole-genome yeast intergenic microarray bound by Rap1
ChIP-on-Chip vs PBMChIP-on-Chip vs PBM
• Done by Mukherjee et al.• Useful when ChIP-on-Chip does not result in enough enrichment• * Lee et al. , # Lieb et al.
OverviewOverview
Introduction to Transcriptional Introduction to Transcriptional
RegulationRegulation
ChIP-on-Chip (ChIP-Chip)ChIP-on-Chip (ChIP-Chip)
Current ApproachesCurrent Approaches
Our ApproachOur Approach
ApproachesApproaches
Representative TFBS (Motif) Representative TFBS (Motif)
DiscoveryDiscovery
Understanding Regulatory ModulesUnderstanding Regulatory Modules
Motif DiscoveryMotif Discovery MEME (Expectation Maximization)MEME (Expectation Maximization) CONSENSUS (greedy multiple CONSENSUS (greedy multiple
alignment)alignment) WINNOWER (Clique finding in graphs)WINNOWER (Clique finding in graphs) SP-STAR (Sum of pairs scoring)SP-STAR (Sum of pairs scoring) MITRA (Mismatch trees to prune MITRA (Mismatch trees to prune
exhaustive search space)exhaustive search space) BioProspector (Gibbs Sampling Based)BioProspector (Gibbs Sampling Based) MDScan (Differential weight for MDScan (Differential weight for
sequences)sequences) Motif RegressorMotif Regressor EBMF (Energy Based Motif Finding)EBMF (Energy Based Motif Finding)
Transcriptional regulatory Transcriptional regulatory codecode
by Harbison et al.by Harbison et al. Saccharomyces cerevisiae (budding Saccharomyces cerevisiae (budding
yeast) - Eukaryoteyeast) - Eukaryote TFBS binding analysisTFBS binding analysis Simple regulatory modelsSimple regulatory models 203 TFs in rich media + 203 TFs in rich media +
84 TFs in at least 1 in 12 other 84 TFs in at least 1 in 12 other environmental conditionsenvironmental conditions
Genome-wide location data 11,000 Genome-wide location data 11,000 unique interaction (p < 0.001)unique interaction (p < 0.001)
Transcriptional regulatory Transcriptional regulatory codecode
by Harbison et al.by Harbison et al. Identification of transcription factor binding site specificitiesIdentification of transcription factor binding site specificities
Transcriptional regulatory Transcriptional regulatory codecode
by Harbison et al.by Harbison et al. Construction of regulatory map of YeastConstruction of regulatory map of Yeast
Transcriptional regulatory Transcriptional regulatory code by Harbison et al.code by Harbison et al.
Promoter architecturesPromoter architectures
Transcriptional regulatory Transcriptional regulatory codecode
by Harbison et al.by Harbison et al. Environment-specific use of regulatory codesEnvironment-specific use of regulatory codes
OverviewOverview
Introduction to Transcriptional Introduction to Transcriptional
RegulationRegulation
ChIP-on-Chip (ChIP-Chip)ChIP-on-Chip (ChIP-Chip)
Current ApproachesCurrent Approaches
Our ApproachOur Approach
Our ApproachesOur Approaches
Better understanding of differential Better understanding of differential binding of TF and DNA in different binding of TF and DNA in different conditions by using ChIP-on-Chip and conditions by using ChIP-on-Chip and gene expression data.gene expression data.
Obstacles in TFBS AnalysisObstacles in TFBS Analysis
Variation in binding sequences might be Variation in binding sequences might be problematic in motif discovery process.problematic in motif discovery process. But for differential binding, there is no But for differential binding, there is no
sequence discrepancy.sequence discrepancy. For eukaryotic systems, lots of For eukaryotic systems, lots of
transcription factors (TFs) work together transcription factors (TFs) work together with other TFs affecting each other’s with other TFs affecting each other’s binding to DNAbinding to DNA
Causes of Differential BindingCauses of Differential Binding
We suspect the possible causes for this We suspect the possible causes for this differential binding to bedifferential binding to be Changes in the TF expressionChanges in the TF expression Changes in other TFs expressionChanges in other TFs expression Modifications in TFs (protein level)Modifications in TFs (protein level) Changes in physical structures (epigenetic Changes in physical structures (epigenetic
features)features) Other unknown reasonsOther unknown reasons
Cooperations in TFsCooperations in TFs
Condition 1
Condition 2
Condition 3
What has caused the difference in the binding affinity?What has caused the difference in the binding affinity?
Differentially Bound Differentially Bound PromotersPromoters
Simple correlationSimple correlation (A, B: binding ratio of TF in condition 1 and 2 (A, B: binding ratio of TF in condition 1 and 2
respectively)respectively)BA
BA
Differentially Bound Differentially Bound PromotersPromoters
Con1 vs Con1 vs Con2Con2
Gene_1Gene_1
Gene_2Gene_2
Gene_3Gene_3
Gene_4Gene_4
~~
Gene_nGene_n
Con1 vs Con1 vs Con3Con3
Gene_2Gene_2
Gene_5Gene_5
Gene_7Gene_7
Gene_8Gene_8
~~
Gene_nGene_n
Con2 vs Con2 vs Con3Con3
Gene_1Gene_1
Gene_2Gene_2
Gene_3Gene_3
Gene_4Gene_4
~~
Gene_nGene_n
How can we confirm which other TF(s) is involved?How can we confirm which other TF(s) is involved?
How can we confirm which other TF(s) is How can we confirm which other TF(s) is
involved?involved? Sequence analyses on the differentially bound Sequence analyses on the differentially bound
promoters?promoters?
Comparison of ChIP-on-Chip results?Comparison of ChIP-on-Chip results?
Protein-protein interaction between TFs?Protein-protein interaction between TFs?
Other possible analysisOther possible analysis Gene Ontology distribution of differentially bound Gene Ontology distribution of differentially bound
promoterspromoters
MethodsMethods
Expected ResultsExpected Results
We may be able to use We may be able to use heterogeneous experimental data to heterogeneous experimental data to reveal the underlying mechanisms of reveal the underlying mechanisms of differential binding of transcription differential binding of transcription factor to cis-regulatory region.factor to cis-regulatory region.
Thank you Thank you
Any question and suggestion ?Any question and suggestion ?
top related