ChIP-on-Chip and ChIP-on-Chip and Differential Location Differential Location

AnalysisAnalysis

Junguk HurJunguk HurSchool of InformaticsSchool of Informatics

October 4, 2005

OverviewOverview

Introduction to Transcriptional Introduction to Transcriptional

RegulationRegulation

ChIP-on-Chip (ChIP-Chip)ChIP-on-Chip (ChIP-Chip)

Current ApproachesCurrent Approaches

Our ApproachOur Approach

The Central DogmaThe Central Dogma

Transcription

RNADNA

Translation

Protein

Genes need to be Genes need to be regulatedregulated

* If gene regulation goes awry? => Developmental abnormality

=> Diseases such as Chronic myeloid leukemia rheumatoid arthritis

•transcription •post transcription (RNA stability) •post transcription (translational control) •post translation (not considered gene

regulation) usually, when we speak of gene

regulation, we are referring to transcriptional regulationthe “transcriptome”

Transcriptional Transcriptional RegulationRegulation

DNA binding proteins

Binding sites(specific sequences)

Coding region(transcribed)

Non-coding region

RNA transcript

Gene 1

Gene 2

Gene 3

Activator Repressor

Transcriptional Transcriptional RegulationRegulation

Transcription Factor Transcription Factor Binding SitesBinding Sites

Gene regulatory proteins contain structural elements Gene regulatory proteins contain structural elements that can “that can “readread” DNA sequence “” DNA sequence “motifsmotifs””

The amino acid – DNA recognition is not straightforwardThe amino acid – DNA recognition is not straightforward Experiments can pinpoint binding sites on DNAExperiments can pinpoint binding sites on DNA

Zinc finger Leucine zipperHelix-Turn-Helix

Modeling Binding SitesModeling Binding Sites

GCGGGGCCGGGCTGGGGGCGGGGTAGGGGGCGGGGGTAGGGGCCGGGCTGGGGGCGGGGTTGGGGGCCGGGCATGGGGCGGGGCGTGGGGCGGGGCAAAGGGCCGGGCGGGAGGCCGGGAGCGGGGCGGGGCGAGGGGACGAGTCCGGGGCGGTCCATGGGGCGGGGC

AA 44 33 11 11 00 00 11 00 00 11 00 11

CC 11 33 00 00 00 00 1313 66 00 00 11 99

GG 55 55 1313 1313 1414 1414 00 88 1414 1212 1313 11

TT 44 33 00 00 00 00 00 00 00 11 00 33

Consensus sequenceConsensus sequence Probabilistic modelProbabilistic model

(profile of a binding site)(profile of a binding site)

Given a set of (aligned) binding sites …

NNGGGGCNGGGC

OverviewOverview

Introduction to Transcriptional Introduction to Transcriptional

RegulationRegulation

ChIP-on-Chip (ChIP-Chip)ChIP-on-Chip (ChIP-Chip)

Current ApproachesCurrent Approaches

Our ApproachOur Approach

ChIP-on-ChipChIP-on-Chip

Based on Based on ChIP (Chromatin Immuno-Precipitation)ChIP (Chromatin Immuno-Precipitation) MicroarrayMicroarray

In vivo assayIn vivo assay Genome-wide location analysisGenome-wide location analysis

Chromatin Immuno Chromatin Immuno Precipitation (ChIP)Precipitation (ChIP)

Immunoprecipitation

Supernatant Pellet

Sonication orvortexing with glass-beads

• Using antibody of a protein of interest• DNA bound to specific protein are enriched.

ChIP-on-Chip (ChIP-on-Chip (Ren Ren et al.et al.))

Array of intergenic sequences from the whole

genome

Protein Binding Microarray Protein Binding Microarray (PBM)(PBM)

(Bulyk (Bulyk et al.et al.)) In vitroIn vitro assayassay DNA-binding protein of interest is expressed DNA-binding protein of interest is expressed

with an epitope tag, purified and then bound with an epitope tag, purified and then bound

directly to a double-strand DNA directly to a double-strand DNA

microarraymicroarray

Can overcome the shortcomings of ChIP-on-Can overcome the shortcomings of ChIP-on-

ChipChip Poor enrichmentPoor enrichment No available antibodyNo available antibody Unknown culture condition or time pointsUnknown culture condition or time points

Protein Binding Protein Binding MicroarrayMicroarray

Whole-genome yeast intergenic microarray bound by Rap1

ChIP-on-Chip vs PBMChIP-on-Chip vs PBM

• Done by Mukherjee et al.• Useful when ChIP-on-Chip does not result in enough enrichment• * Lee et al. , # Lieb et al.

OverviewOverview

Introduction to Transcriptional Introduction to Transcriptional

RegulationRegulation

ChIP-on-Chip (ChIP-Chip)ChIP-on-Chip (ChIP-Chip)

Current ApproachesCurrent Approaches

Our ApproachOur Approach

ApproachesApproaches

Representative TFBS (Motif) Representative TFBS (Motif)

DiscoveryDiscovery

Understanding Regulatory ModulesUnderstanding Regulatory Modules

Motif DiscoveryMotif Discovery MEME (Expectation Maximization)MEME (Expectation Maximization) CONSENSUS (greedy multiple CONSENSUS (greedy multiple

alignment)alignment) WINNOWER (Clique finding in graphs)WINNOWER (Clique finding in graphs) SP-STAR (Sum of pairs scoring)SP-STAR (Sum of pairs scoring) MITRA (Mismatch trees to prune MITRA (Mismatch trees to prune

exhaustive search space)exhaustive search space) BioProspector (Gibbs Sampling Based)BioProspector (Gibbs Sampling Based) MDScan (Differential weight for MDScan (Differential weight for

sequences)sequences) Motif RegressorMotif Regressor EBMF (Energy Based Motif Finding)EBMF (Energy Based Motif Finding)

Transcriptional regulatory Transcriptional regulatory codecode

by Harbison et al.by Harbison et al. Saccharomyces cerevisiae (budding Saccharomyces cerevisiae (budding

yeast) - Eukaryoteyeast) - Eukaryote TFBS binding analysisTFBS binding analysis Simple regulatory modelsSimple regulatory models 203 TFs in rich media + 203 TFs in rich media +

84 TFs in at least 1 in 12 other 84 TFs in at least 1 in 12 other environmental conditionsenvironmental conditions

Genome-wide location data 11,000 Genome-wide location data 11,000 unique interaction (p < 0.001)unique interaction (p < 0.001)

Transcriptional regulatory Transcriptional regulatory codecode

by Harbison et al.by Harbison et al. Identification of transcription factor binding site specificitiesIdentification of transcription factor binding site specificities

Transcriptional regulatory Transcriptional regulatory codecode

by Harbison et al.by Harbison et al. Construction of regulatory map of YeastConstruction of regulatory map of Yeast

Transcriptional regulatory Transcriptional regulatory code by Harbison et al.code by Harbison et al.

Promoter architecturesPromoter architectures

Transcriptional regulatory Transcriptional regulatory codecode

by Harbison et al.by Harbison et al. Environment-specific use of regulatory codesEnvironment-specific use of regulatory codes

OverviewOverview

Introduction to Transcriptional Introduction to Transcriptional

RegulationRegulation

ChIP-on-Chip (ChIP-Chip)ChIP-on-Chip (ChIP-Chip)

Current ApproachesCurrent Approaches

Our ApproachOur Approach

Our ApproachesOur Approaches

Better understanding of differential Better understanding of differential binding of TF and DNA in different binding of TF and DNA in different conditions by using ChIP-on-Chip and conditions by using ChIP-on-Chip and gene expression data.gene expression data.

Obstacles in TFBS AnalysisObstacles in TFBS Analysis

Variation in binding sequences might be Variation in binding sequences might be problematic in motif discovery process.problematic in motif discovery process. But for differential binding, there is no But for differential binding, there is no

sequence discrepancy.sequence discrepancy. For eukaryotic systems, lots of For eukaryotic systems, lots of

transcription factors (TFs) work together transcription factors (TFs) work together with other TFs affecting each other’s with other TFs affecting each other’s binding to DNAbinding to DNA

Causes of Differential BindingCauses of Differential Binding

We suspect the possible causes for this We suspect the possible causes for this differential binding to bedifferential binding to be Changes in the TF expressionChanges in the TF expression Changes in other TFs expressionChanges in other TFs expression Modifications in TFs (protein level)Modifications in TFs (protein level) Changes in physical structures (epigenetic Changes in physical structures (epigenetic

features)features) Other unknown reasonsOther unknown reasons

Cooperations in TFsCooperations in TFs

Condition 1

Condition 2

Condition 3

What has caused the difference in the binding affinity?What has caused the difference in the binding affinity?

Differentially Bound Differentially Bound PromotersPromoters

Simple correlationSimple correlation (A, B: binding ratio of TF in condition 1 and 2 (A, B: binding ratio of TF in condition 1 and 2

respectively)respectively)BA

BA

Differentially Bound Differentially Bound PromotersPromoters

Con1 vs Con1 vs Con2Con2

Gene_1Gene_1

Gene_2Gene_2

Gene_3Gene_3

Gene_4Gene_4

~~

Gene_nGene_n

Con1 vs Con1 vs Con3Con3

Gene_2Gene_2

Gene_5Gene_5

Gene_7Gene_7

Gene_8Gene_8

~~

Gene_nGene_n

Con2 vs Con2 vs Con3Con3

Gene_1Gene_1

Gene_2Gene_2

Gene_3Gene_3

Gene_4Gene_4

~~

Gene_nGene_n

How can we confirm which other TF(s) is involved?How can we confirm which other TF(s) is involved?

How can we confirm which other TF(s) is How can we confirm which other TF(s) is

involved?involved? Sequence analyses on the differentially bound Sequence analyses on the differentially bound

promoters?promoters?

Comparison of ChIP-on-Chip results?Comparison of ChIP-on-Chip results?

Protein-protein interaction between TFs?Protein-protein interaction between TFs?

Other possible analysisOther possible analysis Gene Ontology distribution of differentially bound Gene Ontology distribution of differentially bound

promoterspromoters

MethodsMethods

Expected ResultsExpected Results

We may be able to use We may be able to use heterogeneous experimental data to heterogeneous experimental data to reveal the underlying mechanisms of reveal the underlying mechanisms of differential binding of transcription differential binding of transcription factor to cis-regulatory region.factor to cis-regulatory region.

Thank you Thank you

Any question and suggestion ?Any question and suggestion ?