biotransformation of saponins to diosgenin for enhanced
Post on 04-Jun-2022
5 Views
Preview:
TRANSCRIPT
1
Biotransformation of saponins to diosgenin for enhanced yield from Dioscorea sp using
indigenous fungal strains
FINAL TECHNICAL REPORT
BACK TO LAB PROGRAMME
(08-34/BLP/WSD/KSCSTE/ 2016-17)
Dr. Reji. S. R,
Post Doctoral Researcher
Division of Microbiology
Jawaharlal Nehru Tropical Botanic Garden and Research Institute
Palode, Thiruvanathapuram, India, 695562
2
CONTENT
Titles Page no
Authorization 3
Acknowledgement 4
Abstract 5
Introduction and review of literature 6-10
Objectives 11
Materials and methods 12- 18
Results and discussion 19 – 40
Summary 41
Scope of future work 42
Outcomes of the project 43 – 46
References 45 -47
3
AUTHORIZATION
The project entitled “Biotransformation of saponins to diosgenin for enhanced yield from
Dioscorea sp using indigenous fungal strains” by Reji. S.R, was carried out under the “Back to
lab programme” of Women Scientists Division, Kerala State Council for Science Technology
and Environment, Govt. of Kerala. The work was carried out at Microbiology Division,
KSCSTE- Jawaharlal Nehru Tropical Botanic Garden and Research Institute, Palode under the
mentorship of Dr. N. S. Pradeep. The project was initiated on 15th march 2016 with sanction
No: 08-34/BLP/WSD/KSCSTE/ 2016-17 and scheduled completion by 14th August 2020 with
a financial expenditure of Rs. 1,847,630 lakhs.
4
ACKNOWLEDGEMENT
This work was carried out during the year 2017– 2020 at Jawaharlal Nehru Tropical Botanical
Garden at the Department of Microbiology. I owe my deepest gratitude to the Director
JNTBGRI for providing the infrastructure for the implementing the project.
I would like to express my sincere gratitude to Dr. N. S. Pradeep (senior scientist, JNTBGRI)
for the guidance and encouragement to realize this assignment. My sincere thanks to all
scientific and technical staff of the department for their valuable advice and support.
This work was supported by funds from Back to Lab program of KSCSTE. So i express my
gratitude to Women Scientist Division and KSCSTE for the financial support.
I want to express my gratitude to the revisors of the project proposal for giving such a
wonderful opportunity to carry out 3 years of Post-Doctoral research. I humbly extend my
thanks to all concerned persons who co-operated with me in this regard.
Finally I thank God for the wisdom and perseverance that he has bestowed upon me during
this project and indeed through-out my life.
5
ABSTRACT
Diosgenin is a hydrolysate of dioscin found in the rootstock of yam (Dioscorea) and
exists widely in the natural plant in the form of glucoside. It is the major base chemical for
several steroid hormones and an active ingredient in the oral contraceptive pill. The most
promising source of diosgenin is Dioscorea sp. In the Initial stage of our studies we selected 3
dioscorea sp (Dioscorea composita, floribunda and esculanta) for diosgenin production. From
this only one sp Dioscoria floribunda was screened for the further studies due to the high
concentration of diosgenin in the tuber. Enzymatically treated floribunda tubers were
employed for the studies. Multienzyme producing fungal strains were employed for the
production of diosgenin from the treated tubers. During project period we have isolated 32
multienzyme producing fungal strains. From which the most productive strain was selected
through primary and secondary screening. The strain was identified as pencilium chrysogenum
and is deposited in NCBI with accession number MH201392 and was employed for the
diosgenin production from Dioscorea tuber. Different fermentation factors and parameters for
diosgenin production using this fungal strain also studied using RSM technique. This study has
demonstrated that treatment with multienzyme producing pencilium chrysogenum is a very
effective and eco-friendly approach for the cleaner production of diosgenin from the tubers of
Dioscorea floribunda. The results show that the novel method enhances product yield and also
reduces the usages of water, acid and organic solvents.
6
CHAPTER -1
INTRODUCTION & REVIEW OF LITERATURE
Traditional knowledge of medicine has long been used since ages for curing various
human ailments. About 60-80% of world populations still rely on plant-based medicines.
Though the traditional Indian system of medicine has a long history of use, yet they lack
adequate scientific documentation, particularly in light of modern scientific knowledge. The
medicinal value of plant lies in the bioactive phytochemical constituents of the plant and which
shows various physiological effects on human body. So through phytochemical screening one
could detect the various important compounds which could be used as the base of modern drugs
for curing various diseases. Keeping this in view, the plant Dioscorea commonly known as
yam has been taken for phytochemical screening.
Dioscorea, a pan-continental genus belonging to the family Dioscoreaceae, is found in
Africa, India, Southeast Asia, Australia and tropical America, with about 630 scientifically
described taxa. Prain and Burkill (1936) reported the occurrence of about 50 different
Dioscorea in India, largely in the west, east and northeast regions. In addition to the importance
of many Dioscorea species (yams) as starchy staple food, some representatives are used as a
source for the steroidal saponin diosgenin. Diosgenin occurs in plants in the form of saponins
attaching glucose or rhamnose to aglycone by glyco-sidic bonds at C-3 and C-26 (Qian et al.,
2006). Diosgenin has been reported to significantly used a precursor for partial synthesis of
oral contraceptives, sex hormones, and other steroids. It also shows pharmacological activities
such as antilipoperoxidative (Jayachandran et al., 2009) and antiskin aging (Yayoi et al., 2009)
effects. Preparation of diosgenin from saponins mainly depends on hydrolyzation of sugars at
these two positions. In industry, sulfuric acid and solvent extraction method are usually applied
in hydrolyzing raw herb to produce diosgenin. This method, however, is associated with many
environmental problems due to the high concentration of chemical oxygen demand and acid in
wastewater (Zhao et al., 2008; Cheng et al., 2009). Efforts have been made by many researchers
to solve this problem by focusing on clean methods to produce diosgenin. If microorganisms
could be applied in trans-forming saponins from the treated tubers, the cost and environmental
pollution of the biological process would be significantly reduced.
Out of the total steroid drug precursors, diosgenin accounts for 60% of the steroidal products
in the world. The current global demand for diosgenin is approximately between 50,000 and
80,000 kg/annum. About 10,000 tons of Dioscorea tubers per annum is the current requirement
for diosgenin in pharmaceutical industry. In India, commercial production of steroidal drugs in
7
pharmaceutical industry is totally based on diosgenin which is about 450 tones. So this project
may help to increase the production of diosgenin through microbial transformation and may
boost up the industrial production of steroidal drugs. The current annual production of
diosgenin is 30 tones which is well short of global requirements (150 ton) and therefore relies
on production of new plant species and new production methods, including biotechnological
approaches. Emphasizes should be given to develop techniques for enhancing diosgenin
production which can overcome the deficit of the current techniques applied for its synthesis.
Dioscorea zingiberensis C. H. Wright is the dominant source for diosgenin production
in China. However, overexploitation of natural D. zingiberensis has led to a rapid decrease of
this plant resource and a sharp shortage of diosgenin for pharmaceutical synthesis. Plant cell
culture has been considered as an efficient and convenient alternative for the production of
diosgenin, but the low yield of diosgenin obtained in suspension cultures makes a barrier for
its commercialization. Therefore great efforts have been made seeking strategies for
improvement of secondary metabolite production, such as selection of cell lines with high
productivity, optimization of medium and culture conditions, application of genetic
engineering and biotransformation, use of immobilization and permeabilization of cell cultures,
and enhancement of secondary metabolite production by using elicitors. In the specific project
we employed fungal preparations as elicitor in batch fermentation technique and become one
of the most important and successful method to enhance secondary metabolite production in
Dioscorea sp.
Medicinal yam
Dioscorea is the largest genus among the monocotyledons of over 850 species in the world of
angiosperms and was first described by Robert Brown in 1810 (Arackal et al., 2015). The roots
generally known as yam, furnish to the basis of the staple starchy food and employed in the
third position as the food crop in the world next to cereals and pulses. So has an immense value
during the period of scarcity of food and was mainly cultivated in South East Asia, Africa and
South America. In addition to the importance of many yams as starchy staple food, some
representatives are used as a source for the steroidal saponin diosgenin, which is the starting
material of industrial interest in the synthesis of many steroids which are on the market as anti-
inflammatory, androgenic, estrogenic, and contraceptive drugs (Djerassi, 1992; Sautour et al.,
2007). In addition to sapogenins, alkaloids, steroid derivatives, phenolic compounds are also
found in yam so few varieties were used in traditional hunting and fishing, and other traditional
practices (Onwueme, 1978; Osagie 1992; Degras, 1993; IITA, 1995). Diosgenin play an
important role among the tribal communities as a traditional medicine to cure different diseases
8
like hypercholesterolemia, hypertriacylglycerolemia, diabetes and hyperglycemia (Chen et al.,
2011). Many South Asians use syrup of the root, Powdered tubers, plant juice etc to treat
different illness like cholera, constipation, piles, skin diseases obesity etc (Kumar et al., 2013).
Modern medicine also extensively studied, diosgenin as a therapeutic agent for different illness
like cancer (Sethi et al., 2018), osteoporosis (Chiang et al., 2011), cardiovascular diseases
(Kalailingam et al.,2014), atherosclerosis (Lv et al., 2015), diabetes mellitus (Hua et al., 2016),
and skin diseases (Kim et al.,2016).
Chemical synthesis of diosgenin is not attain successes therefore Dioscorea species are
the only source for diosgenin. Edible Dioscorea species lacks exceeding amounts of steroidal
drug diosgenin. Therefore wild Dioscorea are cultivated in different countries like Mexico,
China, India, Europe etc. About 15 species of Dioscorea genus known to contains diosgenin in
which the highest concentrations (6- 8%) of diosgenin has been found in D. floribunda Mart.
& Gal. from Mexico (Correll, et al., 1955). D. floribunda is suitable for cultivation in Kerala,
Karnataka, West Bengal, Assam and Thamilnadu and was introduced by Indian Institute of
Horticultural Research. Tubers of D. floribunda were elongated growing horizondaly upto 15-
50cm long, skin white with brown bark, semi woody, somewhat hairy, heavily wrinkled or
rectaculate with amorphous establishment. Dioscorea floribunda can be propagated by tuber
pieces, single node stem cuttings or seed. Commercial planting is normally established by tuber
pieces only. During the dry season, the plants are inclined to dormancy and vine dieback.
Diosgenin (C27H42O3) belongs to the family of spirostanol steroidal compounds with
molecular mass 414.62 (Cai et al., 2020). Diosegenin is relatively stable to light and
temperature exposure. It is highly soluble in most nonpolar organic solvents such as
chloroform, dichloroethane, propanol, ethyl acetate etc and partially in polar solvents such as
acetone, methanol, and anhydrous ethanol (Cai et al., 2020). The oral bioavailability of
diosgenin is very low due to poor aqueous solubility and strong hydrophobicity. In plants it
noticed in the form of saponins attaching glucose or rhamnose to aglycone by glyco-sidic bonds
at C-3 and C-26 (Qian et al., 2006). Preparation of diosgenin from saponins mainly depends
on hydrolyzation of sugars at these two positions. In industry, sulfuric acid and solvent
extraction method are usually applied in hydrolyzing raw herb to produce diosgenin. This
method, however, is associated with many environmental problems due to the high
concentration of chemical oxygen demand and acid in wastewater (Zhao et al., 2008; Cheng et
al., 2009).
Medicinal Significance of Diosgenin
9
Diosgenin, one of the most important secondary metabolites present in Dioscorea tuber
and is successfully exploited in a number of commercial applications in food, cosmetics,
agriculture and pharmaceutical sectors. Pharmaceutical applications of saponins include as raw
materials for production of hormones (Blunden et al., 1975), immunological adjuvants (Kensil
et al., 2004), treatment of cognitive impairment (Chuang et al., 2011) and as drugs. It is a
precursor of sex hormones (progesterone), corticosteroids (corticosone) and contraceptives
(Onwueme, 1978; Coursey, 1967). Diosgenin induces apoptosis in cancerous cells and in HeLa
cells by different pathways (Huo et al., 2004). Diosgenyl saponins induce apoptosis and mitotic
arrest in human leukemia cell lines (Ming-Jie, 2004). Diosgenin has both antioxidant property
and anticholesterolomic activity. Cholesterol-lowering activity of saponins, which was
demonstrated in animal (Matsuura, 2001), and human trials were attributed to inhibition of the
absorption of cholesterol from the small intestine, or the re-absorption of bile acids (Oakenfull
and Sidhu, 1990).
In cosmetics, saponins are being utilized as natural surfactants in cleansing products in
the personal care sector such as shower gels, shampoos, foam baths, hair conditioners and
lotions, bath/shower detergents, liquid soaps, baby care products, mouth washes, and
toothpastes (Indena, 2005; Brand and Brand, 2004; Olmstead, 2002). Saponins and sapogenins
are also marketed as bioactive ingredients in cosmetic formulations with claims to delay the
aging process of the skin (Yoo et al., 2003; Bonte et al., 1998) and prevent acne (Bombardelli
et al., 2001).
Extraction techniques of Diosgenin
Because of the biological activities, numerous researches on separation and purification
of diosgenin from herb have widely been explored through the traditional separation techniques
such as liquid-liquid extraction (LLE) and solid-phase extraction (SPE), which can meet the
separating requirements of purity. The first step in the processing of saponins involves their
extraction from the plant matrix. Factors that determine extraction efficiency and the characters
of the end product are the extraction solvent, extraction conditions and sample pretreatments.
The sample processing methods and temperatures used for drying have considerable effect on
the quality of the medicinal plant materials. Shade drying or drying at lower temperatures are
the suitable method. Lower temperature can maintain loss of color of the plant material and
loss of volatile substances in the plant materials (Ibanez et al., 2003, Bartram, 1995).
A few analytical methods for the Diosgenin estimation from plant material were
mentioned as follows. These protocols refer to use pulversied plant material of approximately
8.0 gm of fresh tubers/whole plantlet. The hydrolysed sample for 4 h with hydrochloric acid
10
were filtered using Qualigen filter paper No. 615 and washed with distilled water until the
residue was acid free. The washed residue was extracted with petroleum ether (Boiling point:
60-80°C) in a soxhlet extractor for 4-6 h. The solvent was evaporated and the residue dissolved
in HPLC grade light petroleum ether and isopropanol (12:1). It was then filtered into a
measuring flask using a sample clarification kit (Millipore, Bedford, MA) consisting of a 10
mL syringe, filter holder and Millipore filters (0. 5 mM) (Dixit et al., 2003). Another general
method consist of using fresh tubers, which were cleaned under running tap water and dried by
wiping with clean cloth/tissue. The whole plantlet/ tubers were chopped and dried. The dried
tubers/whole plantlet were powdered and mixed with 50 mL of distilled water with
simultaneous stirring for 10 minutes in round bottom flask. To the slurry add distilled water
and concentrated hydrochloric acid in accord to maintain 5% of acid concentration (w/v). The
flask fixed with condenser was refluxed on a boiling water bath for 2 hour 30 minutes to 3.0
hour to complete the hydrolysis. After the hydrolysis, this slurry was allowed to attain room
temperature and filtered in a Buchner funnel under vacuum. The residue was washed with
distilled water till the filtrate is free from acid. The acid free residue was transferred to Petri
dish and dried in an oven at 100°C at 6 hours. The dried residue was extracted with n-hexane
in a soxhlet apparatus for 8 hours. The extracted solvent containing Diosgenin was
concentrated, chilled on ice (0°C) and filtered. The mother liquor obtained after filtering was
again concentrated, chilled on ice and re-extracted.
Diosgenin obtained from extractions were pooled and weighed after drying (for 2 hours at
80°C) temperature and values were expressed on dry weight basis (Nandi, 1980).
Application of microbes for the extraction of microbes
Microorganisms can secrete enzymes rapidly responding to the ambient environment and
reduce product inhibition effects through metabolism, microbial treatment is suggested to be
more effective than direct enzymatic treatment in enzymatic hydrolysis. In addition, the high
cost of enzymes can be reduced when microbial treatment is employed in place of enzymatic
treatment. Therefore, it is of great interest to screen microorganisms which can efficiently
secrete related enzymes that can disintegrate the tuber compositions, and to apply them in
microbial treatment to promote the release of saponins. After recovering the starch from dried
tuber, Trichoderma reesei exhibited a significant effect on biotransformation of saponion.
Moreover, Trichoderma harzianum and Aspergillus oryzae were also found can convert
saponin into diosgenin through biotransformation (Dong et al., 2009, Liu et al., 2010). Inspired
by the above said successful research, Pencillium strain had been selected as fermentation
strain for biotransformation after a series of screen work.
11
OBJECTIVES:
Collection and cultivation of Dioscorea composita, Dioscorea floribunda and
Dioscorea esculanta
Isolation and identification of efficient cellulase and amylaseproducing fungal
strains for diosgenin production.
To investigate the effects of different pretreatment methods for fungal growth
and enzyme production in microbial transformation procedure.
Optimization diosgenin production using most prominent strain by response
surface methodology.
Purity analysis of diosgenin using HPLC studies
Development of an effective microbial system for diosgenin production using
fungal strains.
12
CHAPTER -2
MATERIALS AND METHODS
Plant collection and taxonomic studies
Extensive survey has been conducted in Western Ghats for collecting different species of
Dioscorea. Specimens were collected in flowering and fruiting conditions preferably in
quadupilcate and relavant field notes on them were recorded in the field book then and there.
Special attention was paid to gather data pertaining to note habit, habitat and other features like
colour of the flowers, fragrance etc. which cannot be deduced from the examinations of the
herbarium specimens. The photographs of the specimens were also taken. The taxonamic
identities of the collected materials were confirmed with the help of various regional and
adjacent countries floras and also by consulting with authentic specimens depositries in various
National Herberium like CAL, BLAT, BSI, BSD, BSIM, NBG, MH, TBGT, CALI etc.
In the laboratory, the specimens were carefully examined under zoom stereomicroscope on the
morphological characters of both aerial and underground parts. micromorphological characters
were observed under a compound research microscope. Observations on venation pattern were
carried out after clearing the leaves. Clearing was done by immersing leaves in 10% KOH in a
petridish for about 12 hours at 60 C and washing in running water. The specimens were stained
with safranin. Excess safranin was removed by washing again in water. The specimens were
then dried and mounted on butter paper and examined with zoom steriomicroscope and
illustration was made.
Comparative analysis of diosgenin content in Dioscorea esculanta, floribunda and
composita
Diosgenin extraction was carried out according to (Drapeau et al., 1986) dried and powdered
tubers (10g each) were refluxed with10 ml 2N HCL for 2 hours to hydrolyse the saponins to
sapogenins and sugars. The residue seperarated by filtration was washed with 50ml of water,
dried at 650C for 2 hours and extracted with chloroform in a soxhlet apparatus. The extracts
were filtered through nylon 0.45µm membrane filters (PAL Gelman Laboratory, India) and
concentrated to dryness. The dried residue was then dissolved in 1ml of 100% (v/v) methanol.
The diosgenin concentration was determined by high pressure liquid chromatography (HPLC)
according to the method described by Huang et al., 2010.
Soil collection and isolation of fungal culture
Soil samples were randomly collected from 4-5 cm depth with help of sterile spatula from the
various locations in Western Ghats. Isolation of fungal colony was performed by serial dilution
and spread plate method. One gram of soil sample was serially diluted in sterilized distilled
13
water to get a concentration range from 10-1 to 10-6. A volume of 0.1 ml of each dilution was
transferred aseptically to Potato dextrose agar plates. The sample was spreaded uniformly using
a glass rod. The plates were incubated at 28 °C for 72 hr.
The selected fungal isolates were screened for amylolytic activity by starch hydrolysis test on
starch agar plate. The selected fungal isolates were streaked on the starch agar plate and
incubated at 37°C for 2-3 days. After incubation iodine solution was flooded with dropper for
30 seconds on the starch agar plate (Malik et al., 2017).
Screening of potent cellulase producing fungi
The isolated fungus was grown on carboxymethylcellulose agar medium. The pure cultures
were inoculated in the centre with almost equal amounts and incubated at 30 ± 2°C until
substantial growth was recorded. The Petri plates were flooded with Congo red solution (0.1%),
and after 5min the Congo red solution was discarded, and the plates were washed with 1N NaCl
solution, allowed to stand for 15 - 20 minutes (Reddy et al., 2014).
Determination of soil pH
Soil pH was determined in 1: 3.0 soil/water ratio by a combination glass electrode HI98129,
Hanna Instruments.
Determination of soil organic carbon and soil organic matter
The soil organic C (SOC) content was estimated by dichromate oxidation method in which the
oxidation of K2Cr2O7 in a concentrated H2SO4 medium and the excess dichromate was
measured using (NH4)2Fe(SO4)2 (Yeomans and Bremner, 1989). Soil organic matter (SOM)
were determined according to Pribyl, 2010.
Quantitative enzyme assays
Amylase assay
Enzyme production medium
Production medium contained (g/l) peptone- 26.7g; dipottasiumorthophosphate – 2.7g; tween
80 – 7.3ml; soluble starch10%. 100 ml of medium was taken in a 250 ml conical flask. The
flasks were sterilized in autoclave at 1210C for 15 min and after cooling the flask was
inoculated with fungal cultures. The inoculated medium was incubated at 270C in shaker
incubator for different incubation time. At the end of the fermentation period, the culture
medium was centrifuged at 5000rpm for 15 min to obtain the crude extract, which served as
enzyme source. The enzyme activity was assayed following the method of using 3, 5-
dinitrosalicylic acid.
Amylase activity was determined by measuring the release of reducing sugar from starch by
DNS method (Miller 1959). The reaction mixture contains 0.2ml of crude enzyme and 0.8ml
14
of 100mM phosphate buffer (pH 7) containing 1% (W/V) of soluble starch. The mixture was
indubated at 550C for the reaction was stopped by adding 2ml of DNSA (3, 5dinitrosalicyclic
acid). The content were boiled exactly for 5 minute in water bath and cooled for 20- 25 minutes
after which 1ml of 40% Rochelle salt (sodium pottassium tartarate) was added. Finally the
colour developed was read at 540nm in a spectrophotometer. The amount of reducing sugar
released in the mixture was determined.
Cellulase assay
The positive fungal strains were used to know their potential for cellulase production and
activities. A volume of 100 ml of Czapek-Dox broth medium amended with 1% cellulose was
distributed into separate 250 ml conical flasks. The pH of the medium was adjusted to 5. After
autoclaving at 121°C and 15 lb. pressure, the fungal spore suspensions were inoculated into the
conical flasks. The flasks were incubated at 27 °C on a rotary shaker at 120 rpm for 3 days.
After 3 days, culture filtrate was collected, centrifuged at 6000 rpm for 15 min and supernatant
was used to the estimation of cellulase source.
Activity of Cellulase in the culture filtrates was determined and quantified by carboxy-methyl
cellulase method (Ghosh 1987). The reaction mixture with 1.0 ml of 1% carboxymethyl
cellulose in 0.2 M acetate buffer (pH 5.0) was pre-incubated at 50°C in a water bath for 20
minutes. An aliquot of 0.5 ml of culture filtrate with appropriate dilution was added to the
reaction mixture and incubated at 50 °C in water bath for one h. Appropriate control without
enzyme was simultaneously run. The reducing sugar produced in the reaction mixture was
determined by dinitro- salicylic acid (DNS) method (Miller 1959). 3, 5-dinitro-salicylic acid
reagent was added to aliquots of the reaction mixture and the color developed was read at
wavelength 510 nm.
Morphological & microscopic identification of selected fungal strain
Morphological characters were studied by inoculating the fungal isolate onto Czapek Solution
Agar (CZA) which contained (g/L): Sucrose, 30.0; NaNO3, 2.0; KH2PO4, 1.0; MgSO4.7H2O,
0.5; KCl, 0.5; FeSO4.7H2O, 0.01; Agar, 15.0; pH 7.3 ± 0.2 and incubated for 5 to 7 days. Every
24 h plates were examined and the colony characteristics like surface and reverse colony
colour, colony margins, elevations, growth rate etc were noted.
Micro-morphological characters were studied by staining the 5-day old fungal colonies with
lactophenol cotton blue. One loopful of culture was aseptically transferred onto a clean glass
slide with the help of sterile inoculating needle. The slide was placed on a staining tray, flooded
with lactophenol cotton blue and left it for 1 min. A clean cover slip was placed onto it with
the help of a needle and excess stain was blotted with bibulous paper and examined under low,
15
high & oil immersion objectives. The selected isolates were maintained on Sabouraud Dextrose
Agar (SDA) slants and stored at 4 °C for further study.
Molecular characterization of selected strains
Molecular characterization was performed by isolating genomic DNA followed by PCR
analysis and sequencing.
DNA isolation
DNA was extracted by modified CTAB method described by Möller et al. (1992). 50 mg of
mycelia was scraped from 10 day old fungal cultures. This was manually ground in 1.5 mL
micro-centrifuge tubes with a micro-pestle adding 500 µL of pre-warmed (60°C) TES lysis
buffer (100 mM Tris pH 8.0; 10 mM EDTA; pH 8.0; 2% SDS). 50 µg of proteinase K were
added to the ground material and incubated at 60 °C for 60 min. To the suspension 140 µL of
5 M NaCl and 64 µL of 10% (w/v) CTAB were added and incubated at 65 °C for 10 min. DNA
was extracted by adding equal amount of phenol: chloroform: isoamyl alcohol (25:24:1) and
centrifuged at 14000 g for 10 min. The supernatant was collected and equal amount of
chloroform: isoamyl alcohol (24:1) was added and centrifuged at 14000 g for 10 min. DNA
was precipitated by adding 0.6 volume of cold isopropanol and 0.1 volume of 3 M sodium
acetate, pH 5.2 and maintained at -20 °C overnight. The DNA was pelleted out by
centrifugation at 12000 rpm for 10 min at 4 °C and washed twice with 70% ethanol and
suspended in 50 µL TE buffer. RNA was digested by adding 10 mg/mL of RNase and incubated
at 37 °C for 45 min and stored at -20 °C for further use.
PCR amplification of ITS region
PCR amplification was carried out in 25 μl reaction mixture containing 2.5 μl of 10X
amplification buffer (100 mM Tris HCl, pH-8 at 25 °C, 15 mM MgCl2, 500 mM KCl and 10%
Triton X-100), 0.2 μl of 25 mM dNTP mixture, 0.74 U of Taq polymerase (Finzyme, Finland),
1μl each of the primer pair ITS4 (5’TCCTCCGCTTATTGATATGC-3’) and ITS5 (5’-
GGAAGTAAAAGTCGT AAC-3’) (Integrated DNA Technologies, Inc., USA) and 40 ng of
genomic DNA.
Bio-rad thermal cycler (S 1000TM) was used for amplification with the following PCR profile:
an initial denaturation for 5 min at 97 °C, followed by 40 cycles of 1 min at 97 °C, 1 min at 48
°C and 2 min at 72 °C and a final extension at 72 °C for 5 min. The amplified products were
resolved in 1.2% agarose gel containing 0.5 mg/mL ethidium bromide.
Sequencing using bigdye terminator v3.1
16
Sequencing reaction was done in a PCR thermal cycler (GeneAmp PCR System 9700, Applied
Biosystems) using the BigDye Terminator v3.1 Cycle sequencing Kit (Applied Biosystems,
USA) following manufactures protocol.
The PCR mix consisted of the following components:
PCR Product (ExoSAP treated) - 10-20 ng Primer - 3.2 pM (either Forward or Reverse)
Sequencing Mix - 0.28 µL 5x Reaction buffer - 1.86 µL Sterile distilled water - make up
to 10 µL. The sequencing PCR temperature profile consisted of a 1st cycle at 96 °C for 2 min
followed by 30 cycles at 96 °C for 30 sec, 50 °C for 40 sec and 60 °C for 4 min for all the
primers.
Sequence analysis
The sequence quality was checked using Sequence Scanner Software v1 (Applied Biosystems).
Sequence alignment and required editing of the obtained sequences were carried out using
Geneious Pro v5.1 (Drummond et al., 2010). The nucleotide sequences obtained were
compared with already available in the databank of the NCBI, using BLAST search tool
(Altschul et al.,1990) for the identification of the 5 isolates. The identification of the species
was determined based on the best score.
Phylogenetic analysis
Homology search of the ITS sequence obtained was performed using BLAST search algorithm.
Alignment of similar sequences was done using CLUSTAL W multiple alignment software
and the phylogenetic tree was constructed using MEGA4 software. Distance estimation was
done following maximum composite likelihood method by Tamura et al. (2007). The stability
of relationship was assessed from bootstrap analysis of the neighbour-joining data.
Different pretreatment methods for fungal growth and enzyme production in microbial
transformation
Physical treatment (P1)
100g of dried tuber were emerged in 3L water for 24 hours and is then cut into slices, grounded
for 40S. the wet powder was suspended and partitioned in a large amount of water to form 3
layers. The top layer is fiber, the middle and bottom layers were combined grounded and
suspended again to remove fiber. The residue was suspended and partitioned. the bottom layer
was starch, the top and middle layers were combined, centrifuged and dried at 60oC and
grounded to pass through a 60-mesh screen thus physically treated tuber was obtained.
Catalytic solvent extraction (P2)
100g of dried tuber were grounded. The dried tuber was mixed with 1.2 L of 60% EtOH, 0.15g
of NaHCO3 and 0.3g of NaOH was then added. The mixture was stirred at 700C for 2 h. the
17
slurry was then filtered. The residue was extracted with 50% EtOH again. the two filtrates
were combined and concentrated.
Enzymatic treatment (P3)
100g of dried tuber were ground for 2 minutes the dried powder was mixed with 600 ml of
water and boiled for 1h. After cooling, the slurry was incubated with 2g amylase at 700C and
p H 6.5 for 1h. The hydrolysate was then centrifuged and washed with water. The residue was
dried at 600C and grounded to pass through a 60- meshscreen.
Complex enzymatic treatment (P4)
100g of dried tuber were grounded for 2 min. the dried powder was mixed with 600ml water
and then incubated with 1.5g of cellulase and 1.5g of amylase at 550C and pH 4.0 for 6 h. the
enzymatic hydrolysate was centrifuged and washed with water. the residue was dried at 600C
and grounded to pass through a 60-mesh screen.
Optimization diosgenin production using most prominent strain by response surface
methodology
The conventional one factor at a time optimization approach is time consuming and not
available to evaluate the effects of independent variables and interactions between different
factors. Therefore RSM has been widely used in the optimization of microbial transformation
process by building models, designing experiments, evaluate the effect of variables and
optimization conditions.
Microbial transformation
Microbial transformation experiments was taken out with pretreated (P4) substrate (10%) and
fermentation medium containing peptone, K2HPO4 and tween 80 with pH 5.8 and incubated
with 300ml of the sub-cultured fungal spore suspension with an agitation rate of 300 rpm for
168h. Optimization of fermentation conditions was carried out using response surface
methodology (RSM). A three factor and five level central composite design, consisting of 20
experimental trials was employed. The design contained three independent variables –
peptone, K2HPO4 and tween 80. The response variable (y)was diosgenin yield (%) resulting
from Pencillium chrysogenum. The experimental data from 20 runs were analyzed with RSM
algorithm of design expert 10 and fitted to a second order polynominal equation.
Y=β0+∑ 𝛽𝑛𝑖=1 iXi+∑ 𝛽𝑛
𝑖=1 ii Xi2+ ∑ ∑ 𝛽𝑛
𝑗=1𝑛𝑖=1 ijXiXj
where Y is the predicted response, β0 is an offset term, βi is the linear effect, βj the quadratic
effect, βij is the interaction effect, and Xi, Xj are the levels of the independent variables.
Design-Expert 10 (Stat- Ease, Inc., Minneapolis, MN, USA), was used for the regression
18
analysis and plotting of graphs. The statistical significance of the model equation and the
model terms were evaluated via the Fisher’s test. The coefficient of determination (R2) and
adjusted R2 determines the quality of fit of the model using a second order regression equation.
The polynomial equation is further expressed in the form of three-dimensional response
surface plots inorder for a better understanding of the relationship between the response of
various levels of each variable in the trial. The combinations of all significant variables which
gave the highest response were also determined from the model.
Experimental Validation of the Response model
In order to validate the response surface model, a random set of experiments were setup
according to conditions predicted by the model. The validation experiments were done for all
the significant variables in the design space. A random set of six combinations of variables
were prepared and analyzed for protease production. The experimental values should be in
close agreement with the statistically predicted ones to confirm the authenticity and
applicability of the statistical model (RSM) for the optimization of process variables.
Diosgenin yield
Sample medium (10ml) in each flask from optimization tests was dried, extracted with 10.0ml
CHCL3 by ultrasonic treatment for 30 min and filtrated. Diosgenin content in filtrate was
analyzed by HPLC and diosgenin yield was calculated as
𝑍 =𝑐𝑚 − 𝑐0𝑐𝑎 − 𝑐0
× 100
Where Z is diosgenin yield (%), Cm and C a are contents of diosgenin in 0.5g substrate after
microbial and acid treatment, Co is content of diosgenin in substrate.
19
CHAPTER -3
RESULTS AND DISCUSSIONS
Morphological description of Dioscorea sp
Dioscorea floribunda
Tubers elongated growing horizondaly upto 15- 50cm long, skin white with brown bark, semi
woody, some what hairy, heavily wrinkled or rectaculate with amorphous establishment. Stems
unarmed but with short stings, twines to the right, terete. Leaves 7.5 × 1.4 × 4-9cm long
triangular ovate or ovate lanceolate to slightly sagitate, exstipulate, 7-9 nerved, the base
truncate to deeply and widely cordate, apex acute to accuminate petiole 4.5 – 8.5cm long.
Pulvinous slightly pinkish spiny. Flowers 44-50 per spike. Flowers in auxillary panicles to
9cm long pedicles 0.5- 1mm long, bracts1.5 – 4mm long, purplish or brown, perianthtube 0.5-
3mm long lobes ovate withwhite or cream margin. Stamens 6, didynamous,3 long ca 1.5mm,
3 short ca 1mm long inserted almost in the center of the disc. Female flower auxillary clusters
30- 35cm long, rachis sharply angled, bracts 1.5- 3mm long purple or dark brown, bracteoles
0.5 – 2mm, style ca 1mmlong, bifid, terete, thin, capsule 21-25 × 17 × 20mm oblanceolate to
obvoate or subquadrate, membraneous, brown to reddish, the base acute to rounded to
emarginated. Seeds 2 per locules 10 -13mm × 7- 9mm oblong to elliptical, winged peripherally,
reddish brown smooth.
Fig: 1 Dioscorea floribunda
Dioscorea composita
Tubers 50- 70cm long with whitish cream, yellow or pik. Stem robust, terete, twins to right.
Leaves alternate ovate or ovate lanceolate or subordicular bloched with white patches, rarely
20
small and ovate – triangular, estipulate and very prominent. Base cordate apex abruptly acute
or shortly acuminate. Nerves 7 -9 , petioles 0.5 -1mm long slightly pulvinous. Flowers 2- 4
spike, pedicle 0.5- 1mm long, bracts 2-3mm brown or brown to purple bracteoles 1.5mm long
ovate, lobed. Stamens 6, inserted in the center of the torus, 3 long eac ca 0.2mm long, triangular
to conical inconspicuous. Female flowers with one clusters ca 17-40cm long, axillary, bracts
1.5- 2mm long brown or purple, bractioles 1mm long, staminode 0.2mm long, triangular,
inserted at the periphery of the torus semi errect. Ovary globose ca 2mm long, stylar column,
1mm long, bifid, terete slender. Capsules 25- 37 × 18 -22mm, oblong to elliptic, semi ligneous,
brown base rounded to oblique, apex rounded. Seeds two per locule 5- 7mm long, oblong,
winged perpherally smooth, reddish brown. Male flower axillary or terminal panicles, 1-2
clusters 30- 70cm long rachis grooved glabrous.
Fig: 2 Dioscorea composita
Dioscorea esculanta
Tubers several, ca-40 in numbers each upto 12cm long and 10cm diameter, weight upto 3-4kg.
the underground parts consisting of a hard knot, feeding roots, which arising from it, protective
thorns, laxs or close bunch of storage tubers arising from the woody base of the stem lying just
beneath the soil surface, shortly stalked tubers oblong ellipsoidor cylindrical, flattened and
lobed covered with root fibers, some raises bearing spines, skin brown to greenish brown, very
thin, flesh soft white edible varying slightly in sweetness. Stem usually one rarely morethan
one arising from the woody knot, not terete at the base but terete in the upper parts. Sometimes
tinged with purple colour towards the base, but usually green, twines to the left, pubescent but
21
glabrescent with age, prickles seen often densely at the base, upto 3mm long, straight or slightly
deflected downwards. Bulbils absent. Leaves alternate cordate, sometimes broadly ovate, blade
cordiform with an obtusesinus, membraneous, acuminate, glabrescentabove, pubescent
beneath, nerves 9-13, the inner 5 veins reaching apex, the outer most pair super basal ,
secondary veins almost parallel margin distinct, petioles almost as long as blade, 4-15cm long
pubescent with a small prickles upon them, stipules prickle like, larger than internodal prickles
upto 7mm long pubscent, directed downwards. Staminate inflorescence solitary axillary
spikes, the rachis firm and ascending, ca 10-14cm long, some what angled, pubscent. Flowers
sterile, 70- 100 per spike covered with thin wightish hairs, opening irregularly along the axis,
2.5-3.5× 3.5 – 5mm shortly pedicelled, bracts ovate, acuminate scarious 1.5 -3.2 × 1- 1.5mm
long, bracteoles similar to bractsouter tepals 0.8- 1.5× 1.5- 3mm, the lobes oblong to ovate,
acute, 1-1.7 × 1- 1.2mm. stames 6, inserted at the rim or half way up the perinath tube, the
filament 0.2 – 0.6mm long with the lobes closely held by a narrow connective, pistillode
conical. Pistillate inflorescence very rare arranged axillary, solitary, spike like racemens, the
axis upto 40- 45cm long, pendent, perbescent. Flowers up to 50-60 per spike, shortly
pedicelled, bracts ovate, acuminate at apex ca. 2mm long, pubescent scarious at the margins,
bracteoles 0.8- 1mm long. Sepals 6 arranged in two whorls of 3 each, each narrowly ovate,
acute, ca 1.5 × 0.5mm, pubscent outside, glabrous within. Slaminodes 6, ovary densely
pubscent, style connate the stimas terminally reflexed as 3 pairs of reflexed hooks. Capsule
oblong, obovoid, basically rounded to turnate, apically retuse, ca 27 × 2.5cm glabrascent,
refluxed upwards. Seeds broadly winged all rouned.
Fig : 3 Dioscorea esculanta
Comparative analysis of diosgenin content in dioscorea esculanta, floribunda and
composite
22
23
24
25
26
27
Soil collection and isolation of fungal culture
In this investigation, we have navigated amylolytic and cellulolytic fungi from different
locations of south Western Ghat mountain rain forest (Ponmudi, Kallar, Kulathupuzha,
Menmutty and Marayoor) and the evergreen forest of Wayanad (Fig:4), which marks the
transition zone between the north and southern ecological region of Western Ghats. The
southern ecological regions are more wetter and species rich and that’s why we have selected
these south Western Ghat regions. pH and EC are the most significant parameters for measuring
soil quality and soil microbial biomass. Soil samples collected from six high land areas were
showed slight variations in PH ranging from 5.6 to 8 (Table :1). Strains from different land
areas were showed significantly wide ranges in cellulase and amylase activity and were more
prominent in regions having neutral pH and electrical conductivity in the range of 43 - 49µs.
Highest EC and pH was recorded in Ponmudi and Wayanad, fungal strains isolated from
Ponmudi and wayanad were not able to produce both cellulase and amylase. However the
number of organisms isolated from both wayanad and Ponmudi were competable with other
sites. Strains isolated from locations with neutral pH and less electrical conductivity (Kallar,
Meenmutty, Kulathupuzha and Marayoor) were able to produce both cellulase and amylase but
the microbial biomass was less.
28
Fig:4 sampling regions
Primary screening of potent amylase and cellulase producing fungi
A total of thirty-two fungal isolates were scraped up from different regions of Western Ghats.
All the selected isolates were primary screened for production of amylase and cellulase using
starch agar plate method and carboxymethyl cellulose plate method. Freshly prepared single
spore cultures of fungal strains were point inoculated on the centre of the plates and incubated
at 300 C for 3 days. In case of amylase producing strains hydrolysis of starch around the
colonies were visualized by flooding the plates with Gram’s iodine solution (Fig: 13). The zone
formation around the colony was due to the hydrolysis of starch by amylolytic enzymes
produced by the strains. For detecting cellulolytic activity CMC agar plates were flooded with
0.1% (w/v) Congo red solution for 15 minutes followed by destaining with 1M NaCl solution
for 15 minutes. Congo red clearing zone assay is suitable for qualitative display of cellulase
activity (Fig: 14). The clearing zone of enzymatic activity will be visible around the batch of
growth. The NaCl solution elutes the dye in the clearing zone where the cellulose has been
degraded into simple sugars by the enzymatic activity. Only eight fungal isolates (Fig: 2 – 12)
were found to be positive for both amylase and cellulase production, as determined by
measuring the width of the clear zone (zone of hydrolysis) formed around the fungal colonies
on starch agar (SA) medium and carboxymethyl cellulose (CMC) agar medium. The fungal
isolate TBGRI-7 isolated from Marayoor showed maximum zone of hydrolysis i.e. 1.7cm and
1.0 cm in starch agar and carboxymethyl cellulose agar medium respectively. Followed by
TBGRI- 4 (1.2 cm, 1.0 cm), TBGRI -1 (1.1 cm, 0.8 cm), TBGRI- 2, 5 & 16 (1.0 cm, 0.72 cm),
TBGRI – 12 (0.8 cm, 1.2 cm) and TBGRI - 14 (0.5 cm, 0.8 cm), respectively in SA and CMC
agar plates respectively.
29
Fig: 5 TBGRI 1 Fig: 6 TBGRI 2
Fig: 7 TBGRI 3 Fig: 8 TBGRI 4
Fig: 9 TBGRI 5 Fig : 10 TBGRI 10
30
Fig: 11 TBGRI 7 Fig: 12 TBGRI 8
Fig:13 Amylolytic activity in starch agar medium Fig: 14 Cellulolytic activity in CMC
medium
Si
no
Sample
collection sites
Number
of fungal
strains
collected
Number and
name of
cellulase and
amylase
positive
strains
PH Organic
carbon
Soil
organic
matter
1 Wayanad 7 0 5.6 3.09% 5.32
2 Ponmudi 6 0 8 1.68% 2.88
3 Kallar 4 3 (TBGRI -5
14 & 16)
6.9 10.02% 17.23
31
4 Kulathupuzha 4 1 (TBGRI-1) 7 3% 5.16
5 Meenmutty 5 2 (TBGRI 2
& 4)
7.11 0.99% 1.70
6 Marayoor 6 2 (TBGRI-, 7
and 12)
7.20 2% 3.44
Table: 1 Soil physiological characters
Secondary screening
Cellulase and amylase assay
Batch fermentation was carried out in triplicate flasks and enzymatic activity was estimated at
regular intervals. The differences among the mean values data to the activity obtained at at
different hours were statistically tested using one way ANOVA. Pre-induced fungal spores
(1×107 spores/mL) were inoculated onto sterilized media and incubated. The culture filtrate
was centrifuged at 12,000 rpm for 30 min at 4 °C and assayed for enzyme activity. The isolate
TBG RI - 14 showed maximum amylase activity of about 56.43 U/mL on 5th day of incubation
followed by TBGRI – 4 (52.25 U/mL), TBGRI-5 (50.69 U/mL), TBGRI – 7 (46.5 U/mL),
TBGRI – 2 (45.35 U/mL), TBGRI – 16 (40.02 U/mL), TBGRI – 12 (37.47 U/mL) and TBGRI
- 1 (35.30 U/mL) (Fig : 11). TBGRI – 1and 14 were the strains showing maximum activity at
5th day the other six strains showing their maximum activity at 4th day. The isolate TBG RI -
5 showed maximum cellulase activity of about 380.19 U/mL on 4th day of incubation followed
by TBGRI – 4 (363.05 U/mL), TBGRI-16 (343.44 U/mL), TBGRI – 14 (336.71 U/mL),
TBGRI – 7 (335 U/mL), TBGRI – 1 (300 U/mL), TBGRI – 12 (273.72 U/mL) and TBGRI -
2 (266.93 U/mL) (Fig: 12). All the strains showed maximum cellulose production on 4th day.
0
10
20
30
40
50
60
70
TBGRI 1 TBGRI 2 TBGRI 4 TBGRI 5 TBGRI 7 TBGRI 12 TBGRI 14 TBGRI 16
Enzy
me
acti
vity
(U/m
l)
DAY 3
DAY 4
DAY 5
DAY 6
DAY 7
32
Fig: 15 Amylase production by different fungal strains
Fig: 16 Cellulase production by different fungal strains
Morphological studies
Colonies on Czapek solution agar attaining 50 mm diameter after seven days, colony
color was initially white becoming deep green to black with conidial production, reverse mostly
pale brown with entire margins and rapid growth
Fig: 17 colony morphology of selected fungal strain
Microscopic studies
Conidia were subglobose, smooth, with length 2.8µm and 2.5µm width. Stipes was smooth
with 258µm length and 3.4 µm width. Phiallides were in flask shaped and following quarte
verticillate pattern.
0
50
100
150
200
250
300
350
400
450
TBGRI -1 TBGRI - 2 TBGRI - 4 TBGRI - 5 TBGRI - 7 TBGRI- 12 TBGRI - 14 TBGRI - 16
DAY -3
DAY -4
DAY- 5
DAY - 6
DAY -7
33
Fig: 18 Microscopic characteristic
Molecular characterization
Molecular characterization of the pencillium was done by extracting genomic DNA followed
by amplification of ITS regions and sequencing. The DNA was extracted by modified CTAB
method (Moller et al., 1992) and the OD260/OD280 ratio was found to be between 1.8 and 2.
The extracted genomic DNA was resolved in 0.8% agarose gel containing 0.5 mg/mL ethidium
bromide.
Amplification of ITS1-5.8S-ITS2 rDNA fragments were done using the primer pair ITS4 and
ITS5 and the molecular size of the product were found to be 821 bp (Figure: 19).
Fig: 19 The amplified product was sequenced using the BigDye Terminator v3.1 Cycle
sequencing Kit (Applied Biosystems, USA) following manufactures protocol and the sequence
obtained as follows.
TBGRI -14
34
CCCGTTAGGGGGGCCCCCCGAAACAACAAGGTAAATTAAAACAAGGGGGGAGTT
GGACCC
AGAGGGCCCTCACTCGGTAATTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGG
TAAAT
CCATACCTGATCCGAGGTCAACCTGGATAAAAATTTGGGTTGATCGGCAAGCGC
CGGCCG
GGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCC
GCCGCT
GCCTTTCGGGCCCGTCCCCCGGGATCGGAGGACGGGGCCCAACACACAAGCCGT
GCTTGA
GGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAAT
GTGCGT
TCAAAGACTCGATGATTCACTGAATTTGCAATTCACATTACGTATCGCATTTCGC
TGCGT
TCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAAATAATTTAT
ATTTT
CACTCAGACTACAATCTTCAGACAGAGTTCGAGGGTGTCTTCGGCGGGCGCGGG
CCCGGG
GGCGTAAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCCGAAGCAACAAGGTAA
AATAAA
CACGGGTGGGAGGTTGGACCCAGAGGGACCACCTCCCCCACTAACGGGGGAGAC
GAGATG
ATCCTTCCGTAACAGGTTCATCGATCAAATGCGGAAGTACCGAGTGAGGGCCCTC
TGGGT
CCACCTCCACCCTGTTTATTTTACTTTGGTGGCTTCGGCGGGCCGGCTAAATGGCC
CGGG
GGGGCTTAAGACCCGGGCCGCACCCAAAAACCCCGAATTTT
Phylogentic Analysis
35
Different pretreatment methods for fungal growth and enzyme production in microbial
transformation
Pretreatments recover the starch and fiber molecules from tuber this releases saponins from
the network of cell wall and may obliging for the production of diosgenin. The effects of
different pretreatment methods on the properties of dried tuber were showed in table :1
Chemical
composition
of Dioscorea
floribunda
Acid
hydrolysis
Physical
treatment
(P1)
Catalytic
solvent
extraction
(P2)
Enzymatic
treatment
(P3)
Complex
enzymatic
treatment
(P4)
Saponin 3.4% 1.3% 1.5% 2.01% 2.8%
Optimization diosgenin production using most prominent strain by response surface
methodology
Optimization of different nutritional fermentation parameters (Tweem 80, K2HPO4 and
peptone were analyzed by using RSM to exploit the production. The addition of peptone offers
the nitrogen source for fungal growth and is the main component of proteins and nucleic acids
(Zhu et al., 2010). According to Doppelbauer et al., 1987 addition of peptone from 0.05 to
0.2% in the medium increased β-glucosidase production. Another factor optimized was the
buffering agent, K2HPO4. It boosts the diosgenin production by supplementing phosphate and
potassium. Phosphate in K2HPO4 plays a title role in electron transport and energy cycle during
oxidative phosphorylation. Pottasium is a key ion involved in the enzyme stereo-inversion
36
reaction (Zhu et al., 2010). Wen et al., 2005 reported that T.reesi reduces the cellulase
production during the purging of phosphate from the medium. Tween 80 is the most
significant component of the medium it provides the transfer of oxygen and nutrients in the
medium to promote fungal growth it alters the membrane surface property and increase the
enzyme production. There by rises the diosgenin production (Zhu et al., 2010).
From the CCD experiments of 20 runs was carried out to optimize medium composition
and the results were presented in table: 2. The design matrix and the corresponding results of
RSM experiments to determine the effect of three independent variables are shown in table: 3
along with mean, predicted values. The NOVA analysis of the study indicated that the model
terms A and C were significant. The effect of Tween 80 (c) was more significant than the other
factors. The effect of peptone (A) was also significant in comparison with effect of K2HPO4
(B). The model F value was 7.40, the value of lack of fit was 2.46 and was not significant.
The higher F value and non-significant lack of fit proves the model to be appropriate.
By applying multiple regression analysis on the experimental coded data and a second order
polynominal equation for diosgenin yield was obtained
Diosgenin yield = 23.48 +1.08*A + 0.50*B + 1.38*C
Where A is peptone concentration, B is Dipottasium hydrogen orthophosphate concentration,
C is Tween 80.
The regression equation obtained from ANOVA showed that R2 (Multiple Correlation
Coefficient) was 0.5169. For a good statistical model, the R2 value should be in range of 0-1.0
and the near to 1.0 value is more fit model is deemed to be. The predicted R2 value is 0.2946
and is not close to the adjacent R2 (0.5160). The difference is more than 0.2. this may indicate
a large block effect. The adequate precision value was 9.781. a ratio grater than 4 is desirable.
So the model an adequate signal and can be used to navigate the design.
Factor 1 Factor 2 Factor 3 Response 1
Std Block Run A:Peptone conc B:K2HPO4 C:Tween 80 Diosgenin yield
% % % %
3 Block 1 1 0.2 1 0.1 21
2 Block 1 2 4 0.1 0.1 23.7
8 Block 1 3 4 1 1 30
11 Block 1 4 2.1 0.55 0.55 22
4 Block 1 5 4 1 0.1 25.3
37
1 Block 1 6 0.2 0.1 0.1 23
10 Block 1 7 2.1 0.55 0.55 22.8
6 Block 1 8 4 0.1 1 27
9 Block 1 9 2.1 0.55 0.55 22.4
7 Block 1 10 0.2 1 1 25
5 Block 1 11 0.2 0.1 1 25.3
12 Block 1 12 2.1 0.55 0.55 24.5
20 Block 2 13 2.1 0.55 0.55 23
18 Block 2 14 2.1 0.55 1.30681 23.7
14 Block 2 15 5.29541 0.55 0.55 23.8
16 Block 2 16 2.1 1.30681 0.55 24
17 Block 2 17 2.1 0.55 -0.206807 21
13 Block 2 18 -1.09541 0.55 0.55 22
19 Block 2 19 2.1 0.55 0.55 22.2
15 Block 2 20 2.1 -0.206807 0.55 21.3
Table :2 central composite design matrix for peptone, K2HPO4 and tween 80 and experimental
designs
Source Sum of
squares
Degree of
freedom
Mean
square
F-value P-value>F
Block 14.01 1 14.01
Model 45.30 3 15.10 7.40 0.0029 significant
A- Peptone
conc 15.88 1 15.88 7.78 0.0138
B-K2HPO4 3.43 1 3.43 1.68 0.2147
C-Tween 80 25.99 1 25.99 12.73 0.0028
Residual 30.62 15 2.04
Lack of fit 26.67 11 2.42 2.46 0.2000 not
significant
Pure error 3.95 4 0.99
Cor.Total 89.93 19
38
Table :3 Box Behnken design matrix for the experimental design and predicted responses for
diosgenin production
R2 = 0.5967; CV = 6.04%; Adj R2 = 0.5160; Pred R2 = 0.2946
Fig:1 Graph showing the predicted vs actual values of the design matrix
Fig:2 Three-dimensional response surface plot for diosgenin production showing the
interactive effects of the K2HPO4 and peptone concentration
Design-Expert® SoftwareDiosgenin yield
Color points by value ofDiosgenin yield:
30
21
Actual
Pred
icted
Predicted vs. Actual
20
22
24
26
28
30
20 22 24 26 28 30
Design-Expert® SoftwareFactor Coding: ActualDiosgenin yield (%)
30
21
X1 = A: Peptone concX2 = B: K2HPO4
Actual FactorC: Tween 80 = 0.306757
0.1 0.2
0.3 0.4
0.5 0.6
0.7 0.8
0.9 1
0.2
1.15
2.1
3.05
4
18
20
22
24
26
28
30
Dio
sgen
in y
ield
(%
)
A: Peptone conc (%)B: K2HPO4 (%)
39
Fig: 3 Three-dimensional response surface plot for diosgenin production showing the
interactive effects of the peptone concentration and tween 80
Fig:4 Three-dimensional response surface plot for diosgenin production showing the
interactive effects of the tween 80 and K2HPO4
validation studies
Design-Expert® SoftwareFactor Coding: ActualDiosgenin yield (%)
Design points above predicted value30
21
X1 = C: Tween 80X2 = A: Peptone conc
Actual FactorB: K2HPO4 = 0.1
0.2
1.15
2.1
3.05
4
0.1 0.2
0.3 0.4
0.5 0.6
0.7 0.8
0.9 1
18
20
22
24
26
28
30
Dio
sge
nin
yie
ld (
%)
C: Tween 80 (%)A: Peptone conc (%)
Design-Expert® SoftwareFactor Coding: ActualDiosgenin yield (%)
Design points above predicted valueDesign points below predicted value30
21
X1 = B: K2HPO4X2 = C: Tween 80
Actual FactorA: Peptone conc = 2.1
0.1 0.2
0.3 0.4
0.5 0.6
0.7 0.8
0.9 1
0.1 0.2
0.3 0.4
0.5 0.6
0.7 0.8
0.9 1
18
20
22
24
26
28
30
Dio
sge
nin
yie
ld (
%)
B: K2HPO4 (%)C: Tween 80 (%)
40
y = 0.9998xR² = 0.9796
25.4
25.5
25.6
25.7
25.8
25.9
26
26.1
26.2
26.3
25.4 25.5 25.6 25.7 25.8 25.9 26 26.1 26.2 26.3 26.4
Chart Title
41
SUMMARY
Diosgenin, obtained from Dioscorea tubers, is the major base chemical for several
steroid hormones and an active ingredient in the oral contraceptive pill. The most promising
source of diosgenin is Dioscorea sp. In the Initial stage of our studies we selected 3 dioscorea
sp (Dioscorea composita, floribunda and esculanta) for diosgenin production. From this only
one sp Dioscoria floribunda was screened for the further studies due to the high concentration
of diosgenin in the tuber. Enzymatically treated floribunda tubers were employed for the
studies. Multienzyme producing fungal strains were for the production of diosgenin from the
treated tubers. During project period we have isolated 32 multienzyme producing fungal
strains. From which the most productive strain was selected through primary and secondary
screening. The strain was identified as pencilium chrysogenum and is deposited in NCBI with
accession number MH201392 and was employed for the diosgenin production from Dioscorea
tuber. This study has demonstrated that treatment with multienzyme producing pencilium
chrysogenum is a very effective and eco-friendly approach for the cleaner production of
diosgenin from the tubers of Dioscorea floribunda. The results show that the novel method
enhances product yield and also reduces the usages of water, acid and organic solvents.
42
SCOPE OF FUTURE WORK
Microorganisms are capable of producing a great variety of enzymes within a short
period of time due to their high rate of cell multiplication. Therefore, microbial treatment has
been studied for centuries for the development of a compound through an environmentally
friendly approach. In our studies it was proven that a multienzyme producing pencilium
chrysogenum is able to produce the diosgenin from Dioscrea floribunda tubers via an
ecofriendly method. In this sense, a reasonable number of compounds of various biological
interests can be furnished by the help of microorganisms- an eco-friendly transformation of
natural products.
43
OUT COMES OF THE PROJECTS
SALIENT FINDINGS:
Isolated multienzyme producing fungal strains
Total of 32 fungal strains were isolated from Western Ghats area, in which 8 strains
were identified as multienzyme producers.
Identified potential fungal strains
Potent multienzyme producing strain (pencillium chrysogenum) was identified based
on the morphological, biochemical and molecular characterisation.
Pencillium chrysogenum was deposited in NCBI with accession number MH201392
Germplasm storage of Dioscoria floribunda and composite collected from Western
Ghats.
An eco-friendly diosgenin production was developed.
PUBLICATIONS:
International
S.R. Reji and N.S. Pradeep. (2019) “Isolation and Selection of Fungal Strains for
Multienzyme Production from Western Ghats” International Journal of Agriculture,
Environment and Biotechnology, Citation: IJAEB: 12(1): 23-32.
Lekshmi K Edison, Vipin Mohan Dan, Reji. S. R & N. S. Pradeep. (2020) “Insilico
Perceptions in Structural Elucidation of Exo-Beeta-1,3 Glucanase (endo 13) from
Streptomyces spp” -Accepted by the journal applied biology and biotechnology with
manuscript number - JABB – 2020-07-209.
CONFERENCES/WORKSHOPS/SEMINARS/ PROCEEDINGS etc..
International:
Reji.S.R and Pradeep N. S., 2017. “Exploring Western Ghats fungal diversity for
cellulase and amylase production”. International conference on frontiers in bioscience,
15 -16th November 2017 at SNGIST Arts and science college, North Paravur.
National :
Reji. S. R and Pradeep N. S, (2017) “Microbial diversity of cellulase and amylase
producing fungal strains from Western Ghats of India”. National symposium on future
of functional genomics, 13 -14th October 2017 at Transdisciplinary University,
Bengaluru.
44
Reji. S. R and N. S. Pradeep, (2016) “Isolation and screening of fungal strains for
multienzyme production from Western Ghats” National seminar on insights into the
interdisciplinary perspectives of chemical and biosciences, 26 -28th February 2018 at
Government arts college, Thiruvananthapuram.
45
REFERENCES
1. Cai B, Zhang Y, Wang Z, Xu D, Jia Y, Guan Y, Liao A, Liu G, Chun C, Li J (2020)
Therapeutic potential of diosgenin and its major derivatives against neurological
diseases: recent advances, Oxidative medicine and cellular longevity, Article ID
3153082, https://doi.org/10.1155/2020/3153082
2. Chen P S, Shih Y W, Huang H C and Cheng H W, Diosgenin – A steroidal sapogenin
inhibits migration and invasion of Human Prostrate cancer PC – 3 cells by reducing
matrix metalloproteinases expression. PloS One; 2011; 6; e20164. doi:
10.1371/journal.pone.oo20164.
3. Cheng P, Zhao H Z, Zhao B, Ni J R (2009) Pilot treatment of wastewater from
Dioscorea zingiberensis C.H. Wright production by anaerobic digestion combined with
a biological aerated filter, Bioresour Technol, 12:2918–2925.
4. Cheng P, Zhao H Z, Zhao B, Ni J R (2009) Pilot treatment of wastewater from
Dioscorea zingiberensis C.H. Wright production by anaerobic digestion combined with
a biological aerated filter, Bioresour Technol, 12:2918–2925.
5. Chiang S.S, Chang S. P and Pan T. M (2011) Osteoprotective effect of Monascus-
fermented Dioscorea in ovariectomized rat model of postmenopausal osteoporosis,
Journal of Agricultural and Food Chemistry, 59 (17) 9150–9157.
6. Correll D G, Schubert B G, Gentry H S, and Hawley W O (1955) The search for plant
precursors of cortisone, Econ. Bot 9, 305- 375.
7. Degras L M (1993) The yam: A tropical root crop. The Technical Centre for
Agricultural and Rural Cooperation (CTA). The McMillan Press, London. 408 pp.
8. Djerassi C. (1992), Steroid research at Syntex: ‘The pill’and cortisone. Steroids 57,
631D641.
9. Drapeau D, Sauvaire Y, Blanch H W, Wilke C R (1986) Improvement of diosgenin
yield from Dioscorea deltoidea plant cell culture by use of a non-traditional hydrolysis
method. Planta Med 6: 474-478.
10. Georg- Alexander Hoyer (1975) Diosgenin saponins from Dioscrea Floribunda,
Phytochemistry 14 (2) 539 -542.
11. Hua S, Li Y, Su L and Liu X (2016) Diosgenin ameliorates gestational diabetes
through inhibition of sterol regulatory element-binding protein-1,” Biomedicine &
Pharmacotherapy, 84, 1460–1465.
46
12. Huang W, Zhao H Z, Ni J R, Zuo H, Qiu L L, Li H (2008) The best utilization of D.
zingiberensis C. H. Wright by an eco-friendly process, Bioresour Technol, l99:7407–
7411
13. Hui Li, Xiangdong Wang, Yang Ma, Nannan Yang, Xiaojuan Zhang, Zhenghong Xu
(2016) Purification and characterization of a glycosidase with hydrolyzing multi 3-0
glycosidase of spirostanol saponins activity from Gibberella intermedia 128: 46- 51.
14. International Institute of Tropical Agriculture (IITA). 1995. Annual Report. Ibadan,
Nigeria. IITA.
15. Jayachandran K S, Vasanthi H R, Rajamanickam G V (2009) Antilipoperoxidative and
membrane stabilizing effect of diosgenin, in experimentally induced myocardial
infarction, Mol Cell Biochem, 327:203–210.
16. Kalailingam P, Kannaian B, Tamilmani E, and Kaliaperumal R (2014) Efficacy of
natural diosgenin on cardiovascular risk, insulin secretion, and beta cells in
streptozotocin (STZ)-induced diabetic rats, Phytomedicine, 21(10) 1154–1161.
17. Kim J E, Go J, Koh E K (2016) Diosgenin effectively suppresses skin inflammation
induced by phthalic anhydride in IL-4/Luc/CNS-1 transgenic mice, Bioscience,
Biotechnology and Biochemistry, 80 (5) 891–901.
18. Kumar S, Anuo Kumar Parida and Padan Kumar Jena (2013) Ethano -Medico-Biology
of Ban- Alu (Dioscorea species): A neglected tuber crops of Odisha, India, International
Journal of Pharmacy and life science, 4 (12) 3143- 3150.
19. Lv Y C, Yang J and Yao F (2015) Diosgenin inhibits atherosclerosis of ATP-binding
cassette transporter A1, Atherosclerosis, 240 (1) 80–89.
20. Ofelia Espejo, Jesus Campos Llavot, Helgi Jung, Francisco Giral (1982) Sprirostanic
diosgenin precursors from Dioscorea composite tubers, Phytochemistry, 21(2) 413-
416.
21. Onwueme I C (1978) Yams, cassava, sweet potato and cocoyams. In: The Tropical
Tuber Crops. John Wiley and Sons, New York, USA 234pp.
22. Osagie A U (1992) The yam tuber in storage, Post-harvest Research Unit. University
of Benin, Benin City, Nigeria. 247 pp.
23. Prain D, Burkill IH. 1936. An account of the Genus Dioscorea in the East. Annals of
the Royal Botanical Gardens, Culcutta. Longman, London , UK . 57
24. Qian S H, Yuan L H, Yang N Y, Ou Yang P K (2006) Study on steroidal compounds
from Dioscorea zingiberensis, Chinese Traditional Herbal Drugs, 29:1174–1176.
47
25. Qian S H, Yuan L H, Yang N Y, Ou Yang P K (2006) Study on steroidal compounds
from Dioscorea zingiberensis, Chinese Traditional Herbal Drugs, 29:1174–1176.
26. Rytas Vigalys and Mark Hester (1990) Rapid genetic identification and mapping of
enzymatically amplified ribosomal DNA from several Cryptococcus Sp, Journal of
bacteriology 172 (8) 4238- 4246.
27. Sethi G, Shanmugam M and Warrier S (2018) Pro-apoptotic and anti-cancer properties
of diosgenin: a comprehensive and critical review, Nutrients,10 (5) 645 -.
28. Yayoi T, Naoko K, Akinori H, Megumi T, Hideyo U, Shinichi W (2009) Novel effects
of diosgenin on skin aging, Steroids, 74:504–511.
29. Yu – Linh Zhu, Wen Huang, Jin- Ren Ni, Wei Liu (2010) Production diosgenin from
Dioscorea zingiberensis tubers through enzymatic saccharification and microbial trans
formation 85: 1409- 1416.
30. Yu- Ling Zhu, Wen Huang, Jin- Ren Ni, Wei Liu, Hui Li, (2010) Production of
diosgenin from Dioscorea zingiberensis tubers through enzymatic saccharification and
microbial transformation, Appl microbial Biotechnol, 85: 1409- 1416.
31. Zhang Q, Lo C M, Ju L K (2007) Factors affecting foaming behavior in cellulase
fermentation by Trichoderma reesei Rut C-30, Bioresour Technol, 98:753–760.
32. Zhao H Z, Cheng P, Zhao B, Ni J R (2008) Yellow ginger processing wastewater
treatment by a hybrid biological process, Process Biochem, 43:1427–1431.
33. Zhao H Z, Cheng P, Zhao B, Ni J R (2008) Yellow ginger processing wastewater
treatment by a hybrid biological process, Process Biochem, 43:1427–1431.
34. Zheng T X, Yu L D, Zhu Y L (2014) Evalution of different pretreatment on microbial
transformation of saponins in Dioscorea zingiberensis for diosgenin production,
Biotechnol Biotechno Equip 28(4) 740- 746.
top related