bacterial assisted phytoremediation of crude oil
Post on 12-Jun-2022
5 Views
Preview:
TRANSCRIPT
Kaneez Fatima
2017
Department of Biotechnology
Pakistan Institute of Engineering and Applied Sciences
Nilore, Islamabad, Pakistan
Bacterial Assisted Phytoremediation of
Crude Oil-Contaminated Soil
This page intentionally left blank.
Bacterial Assisted Phytoremediation of
Crude Oil-Contaminated Soil
Kaneez Fatima
Submitted in partial fulfillment of the requirements
for the degree of Ph.D.
2017
Department of Biotechnology
Pakistan Institute of Engineering and Applied Sciences
Nilore, Islamabad, Pakistan
ii
Acknowledgements
I would like to express my appreciation to everyone who helped me during the long
journey of my PhD.
First and foremost, I am most grateful to Dr. Shahid Mansoor (S.I.), Director
NIBGE, who maintained healthy research-oriented environment in this prestigious
Institute. My sincere thanks go to Dr. M. Sajjad Mirza Head, Soil and Environmental
Biotechnology Division and ex Head; Dr. Qaiser M. Khan, for their valued
suggestions and providing flexible and friendly working environment.
I offer my sincerest gratitude to my supervisor, Dr. Muhammad Afzal, for his
constant encouragement, support, understanding, patience, critical inputs and
continuous help during this research work and thesis write up. His presence has always
been a source of inspiration for me. Without his precious support it would not be
possible to conduct this research. There are no proper words to express thanks to my
co-supervisor, Dr. Asma Imran, for her valuable suggestions towards improving my
work and strengthening my self-confidence. Her skillful advices, sincere cooperation,
and guidance enabled me to learn a lot during this period.
There is no way to express how much it meant to me to have been a member of
Wastewater treatment and phytoremediation group. I am grateful to Ms. Razia Tehseen
and Mr. Shabbir for their time to time valuable suggestions. Special thanks must go to
my brilliant lab fellows Khadeeja, Nain Tara, Rabbia and all other present and former
lab students for their coordination and productive discussions. I am also thankful to Mr.
Sajjad and Mr. Ghulam Hussain, who assisted me in performing green house and
field experiments.
I am deeply grateful to Prof. Dr. Gunter Brader for hosting me at Health and
Environment Department, Austrian Institute of Technology (AIT), Austria during
IRSIP fellowship. He gave me the chance to work with highly skilled people and to
learn a lot from them and the long discussions that helped me sort out the technical
details of microbiological and molecular work.
iii
I deeply thank my dear father and loving mother for their unconditional trust,
motivation, and endless patience. It was their love that raised me up again when I got
exhausted. My lovely sisters, Marriam and Bushra, have also been generous with their
love and always cheered me up despite the long distance between us. I am extremely
thankful to family of my Uncle for their affection and care during my stay in
Faisalabad.
I acknowledge the support of my husband, Uzair Ahmed. He has been my best
friend and great companion who always encouraged, entertained, and helped me get
through this agonizing period in the most positive way.
I would like to thank my lovely friends, Dr. Ambrin, Aamna, Faryal, Uzma,
and Mehvish who went through hard times together, cheered me on and celebrated my
accomplishments.
I am thankful to Dr. Imran Amin for his help and expertise during qPCR
analysis. I am grateful to Ali Imran, Muhammad Asif, and Muhammad Iqbal from
university cell for all paper work during the course of study. I am indebted to Dr. Zahid
Mukhtar, Head, Agricultural Biotechnology Division, for his help, expertise and
suggestions during formatting of my thesis.
I would like to thank Higher Education Commission (HEC) for giving me an
opportunity to visit Austrian Institute of Technology under IRSIP fellowship and to
work in highly competititve environment. Finally, I am grateful to Oil and Gas
Development Company Limited (OGDCL) and its staff for allowing us to perform
field experiment.
Kaneez Fatima
iv
This thesis is dedicated to
My Beloved Parents
&
Husband Thank you for endless love, support, prayers
and advices.
v
Declaration of Originality
I hereby declare that the work contained in this thesis and the intellectual content of this
thesis are the product of my own work. This thesis has not been previously published
in any form nor does it contain any verbatim of the published resources which could be
treated as infringement of the international copyright law. I also declare that I do
understand the terms ‘copyright’ and ‘plagiarism,’ and that in case of any copyright
violation or plagiarism found in this work, I will be held fully responsible of the
consequences of any such violation.
____________
Kaneez Fatima 24 October, 2017
NIBGE,
Faisalabad.
vi
Copyrights Statement
The entire contents of this thesis entitled Bacterial Assisted Phytoremediation of
Crude Oil-Contaminated Soil by Kaneez Fatima are an intellectual property of
Pakistan Institute of Engineering & Applied Sciences (PIEAS). No portion of the thesis
should be reproduced without obtaining explicit permission from PIEAS.
vii
Table of Contents
Acknowledgements ...................................................................................................... ii
Copyrights Statement ................................................................................................. vi Table of Contents ....................................................................................................... vii List of Figures ............................................................................................................... x List of Tables .............................................................................................................. xii List of Publications……………………………………………………………….....xv
1 Introduction and Review of Literature ............................................................ 1
1.1 Background .................................................................................................. 1
1.2 Crude Oil and Environmental Pollution ...................................................... 4
1.3 Fate of PHs in Soil Environment ................................................................. 6
1.4 Soil Remediation: Preserving a Precious Resource ..................................... 7
1.4.1 Physicochemical vs. Biological Methods ............................................... 7
Bioremediation: A Natural Method for the Restoration of Polluted Sites .. 7
1.5.1 Biodegradative Bacteria ......................................................................... 8
1.5.2 Concerns Associated with Bioremediation ............................................ 9
Phytoremediation: Using Green Technology to Restore Contaminated
Environment .............................................................................................. 12
1.6.1 Plant Selection for Phytoremediation ................................................... 14
Microbe-Assisted Phytoremediation: An Optimal Approach to Revitalize
Ecosystem ................................................................................................. 15
1.7.1 Rhizoremediation: Use of Rhizobacteria to Enhance Hydrocarbon
Phytoremediation ................................................................................. 17
1.7.2 Endophyte-Assisted Phytoremediation ................................................ 18
Metabolic Pathways for Biodegradation of PHs ....................................... 20
1.8.1 Aerobic Biodegradation ....................................................................... 21
1.8.2 Anaerobic Biodegradation .................................................................... 21
Enzymatic Biodegradation ........................................................................ 24
2 General Materials and Methods...................................................................... 26
Media and Chemicals ................................................................................ 26
Equipment .................................................................................................. 26
Soil Sample Collection .............................................................................. 26
Seeds and Seedlings................................................................................... 27
Bacterial Strains ......................................................................................... 27
Maintenance and Preservation of Bacteria ................................................ 27
Isolation of Rhizobacteria and Endophytes ............................................... 29
viii
Characterization of Isolated Bacteria ........................................................ 29
2.8.1 Colony and Cell Morphology ............................................................... 29
2.8.2 Molecular Characterization .................................................................. 30
Experimental Setup for Crude Oil and n-Alkanes Biodegradation Studies
................................................................................................................... 31
Screening of Alkane Hydroxylase Genes (alkB and CYP 153) in Isolated
Bacterial Strains ........................................................................................ 32
In vitro Plant Growth-Promoting Potential of Rhizospheric and Endophytic
Bacteria ..................................................................................................... 34
Analysis by Confocal Laser Scanning Microscopy (CLSM) for Biofilm
Formation and Root Colonization ............................................................. 36
Plant Inoculation Studies ........................................................................... 37
Analysis of Residual Crude Oil in Soil ..................................................... 37
Persistence and Survival of Inoculated Bacteria ....................................... 38
3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria ...... 39
3.1 Introduction ............................................................................................... 39
3.2 Materials and Methods .............................................................................. 40
3.2.1 Soil Sampling ....................................................................................... 40
3.2.2 Screening of Crude Oil-Tolerant Plant Species ................................... 40
3.2.3 Isolation and Characterization of Hydrocarbon-Degrading Bacteria ... 41
3.2.4 Growth on Crude Oil, Alkanes and Aromatic Hydrocarbons .............. 41
3.2.5 Detection of Alkane Hydroxylase Genes in Isolated Bacteria ............. 41
3.2.6 In vitro Screening of Plant Growth-Promoting (PGP) Traits ............... 42
3.3 Results ....................................................................................................... 42
3.4 Discussion .................................................................................................. 54
4 Green House Evaluation of Plant-Bacteria Partnership for the Remediation
of Crude Oil-Contaminated Soil ..................................................................... 56
4.1 Introduction ............................................................................................... 56
4.2 Materials and Methods .............................................................................. 57
4.2.1 Bacterial Strains ................................................................................... 57
4.2.2 Tagging of Bacterial Strains with Yellow Fluorescent Protein (YFP) and
Formulation of Bacterial Consortium .................................................. 57
4.2.3 In vitro Biofilm Formation ................................................................... 57
4.2.4 Experimental Setup .............................................................................. 58
4.2.5 Analysis of Crude Oil Residues in Soil and Biostimulant Efficiency .. 59
4.2.6 Persistence of the Inoculated Endophytes ............................................ 59
4.2.7 Quantification of Abundance and Expression of alkB Gene ................ 59
4.3 Results ....................................................................................................... 59
ix
4.4 Discussion .................................................................................................. 69
5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
in an Oil Field.................................................................................................... 72
5.1 Introduction ............................................................................................... 72
5.2 Materials and Methods .............................................................................. 73
5.2.1 Site Description .................................................................................... 73
5.2.2 Bacterial Strains ................................................................................... 74
5.2.3 L. fusca and B. mutica .......................................................................... 75
5.2.4 Experimental Design ............................................................................ 75
5.2.5 Quantification of Inoculated Strains .................................................... 77
5.2.6 Quantification of Abundance and Expression of alkB Gene ................ 77
5.2.7 Crude Oil Analysis in Soil ................................................................... 78
5.2.8 Seed Germination Bioassay for Toxicity Evaluation ........................... 78
5.2.9 Statistical Analysis ............................................................................... 78
5.3 Results ....................................................................................................... 79
5.4 Discussion .................................................................................................. 87
6 General Discussion ........................................................................................... 90 7 References ......................................................................................................... 97
8 Appendices ...................................................................................................... 122
x
List of Figures
Figure 1-1 Chemical structure of some crude oil components ................................... 5
Figure 1-2 Concerns due to crude oil contamination of soil ...................................... 6
Figure 1-3 Bacterial species involved in different types of PHs degradation .......... 11
Figure 1-4 Factors influencing the process of bioremediation of soil contaminated
with PHs ................................................................................................. 12
Figure 1-5 Plant-microbe interactions that lead to remediation of soils contaminated
with PHs ................................................................................................. 20
Figure 1-6 Schematic overview of metabolic pathways for hydrocarbons (aliphatic
and aromatic) utilization by aerobic bacteria. ........................................ 23
Figure 3-1 In vitro crude oil degradation potential of isolated bacterial strains. ..... 46
Figure 3-2 Plant growth promoting-potential of some representative strains .......... 51
Figure 4-1 Attachment of Acinetobacter sp. strain BRSI56-yfp on thin cover slip (22
mm). ........................................................................................................ 60
Figure 4-2 Attachment of pseudomonas aeruginosa strain BRRI54-yfp on thin cover
slip (22 mm) ............................................................................................ 60
Figure 4-3 Biofilm formation on thin cover slip (22 mm) by Acinetobacter sp. strain
BRSI56-yfp. ............................................................................................ 61
Figure 4-4 Biofilm formation on thin cover slip (22 mm) by Pseudomonas
aeruginosa strain BRRI54-yfp ................................................................ 62
Figure 4-5 Colonization of yfp-tagged Pseudomonas aeruginosa BRRI54 and
Acinetobacter sp. BRSI56 on the rhizoplane (a), root cortical cells (b), and
leaf mesophyll cells (c) of Brachiaria mutica. ....................................... 64
Figure 4-6 Colonization of yfp-tagged Pseudomonas aeruginosa BRRI54 and
Acinetobacter sp. BRSI56 inside the roots of L. fusca . ......................... 65
Figure 4-7 Growth responses including root and shoot length (a), fresh and dry
weight (b) of L. fusca and B. mutica, vegetated in crude oil contaminated
soil with and without bacterial augmentation ......................................... 66
Figure 4-8 Effect of bacterial consortia AP (Acinetobacter sp. strain BRSI56 and
Pseudomonas aeruginosa strain BRRI54) inoculation on crude oil
degradation after 93 days of vegetation. ................................................. 68
Figure 4-9 Biostimulant efficiency (%) of treated soil samples collected after 93 days
of bioremediation process ....................................................................... 68
Figure 5-1 Crude oil-contaminated soil in the vicinity of an oil exploration and
production company before start of the experiment ............................... 73
Figure 5-2 Experimental setup for endophyte-assisted phytoremediation of crude oil
contaminated soil in the vicinity of an oil exploration and production
company. ................................................................................................. 76
xi
Figure 5-3 Effect of crude oil contamination and endophytes (Pseudomonas
aeruginosa strain BRRI54, Acinetobacter sp. strain BRSI56, and
Klebsiella sp. LCRI87) inoculation on root and shoot length (a) and fresh
and dry weight (b) of L. fusca and B. mutica. ........................................ 80
Figure 5-4 Effect of vegetation of (L. fusca and B. mutica) and inoculation of
endophytes (Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp.
strain BRSI56, and Klebsiella sp. LCRI87) on crude oil degradation. .. 81
Figure 5-5 Mean values of colony forming unit (CFU), abundance and expression of
alkB gene in rhizosphere, root and shoot interior of B. mutica (a), and L.
fusca (b). ................................................................................................. 83
Figure 5-6 Effect of vegetation (L. fusca and B. mutica) and endophytes inoculation
on the detoxification of crude oil contaminated soil. ............................. 85
Figure 5-7 Correlation between crude oil degradation (%) and colony forming units
(CFU) (g-1 dry weight of soil) (a), gene abundance (copies of alkB g-1 dry
weight of soil) and gene expression (transcripts level of alkB gene g-1 dry
weight of soil) (b), and gene expression and crude oil degradation (%) (c).
................................................................................................................ 86
xii
List of Tables
Table 1.1 Pros and cons of phytoremediation ........................................................... 14
Table 1.2 Bacterial and plant enzymes involved in alkane degradation ................... 25
Table 2.1 List of plants (grasses, trees and edible crops) used in the present work . 28
Table 2.2 Primers used for amplification of alkB and CYP 153 genes in isolated
bacterial strains ......................................................................................... 33
Table 3.1 Physico-chemical properties of soil collected from crude oil-contaminated
site of an oil exploration and production company ................................... 40
Table 3.2 Biomass production of plants vegetated in crude oil-contaminated soil .. 44
Table 3.3 Bacterial strains isolated from rhizosphere (RH), root interior (RI) and
shoot interior (SI) of Brachiaria mutica (BRA), Lolium perenne (LOL),
Leptochloa fusca (LEP), Acacia ampliceps (ACA) and Lecucaena
leucocephala (LEC) .................................................................................. 45
Table 3.4 Degradation abilities of isolated rhizospheric and endophytic bacteria using
different hydrocarbons as substrate ........................................................... 47
Table 3.5 PCR amplification of alkane hydroxylase genes (alkB and CYP 153) ..... 49
Table 3.6 In vitro plant growth-promoting potential of endophyte and rhizosphere
bacterial strains isolated from different grasses and trees ......................... 52
Table 4.1 Experimental design of green house experiment ...................................... 58
Table 4.2 Colony forming unit (CFU), abundance and expression of alkB .............. 69
Table 5.1 Physico-chemical properties of soil from crude oil contaminated site of an
oil exploration and production company where experiment was conducted
................................................................................................................... 74
Table 5.2 Experimental design of field experiment .................................................. 77
Table 5.3 Effect of endophytes (Pseudomonas aeruginosa strain BRRI54,
Acinetobacter sp. strain BRSI56, and Klebsiella sp. strain LCRI87)
inoculation, vegetation (Leptochloa fusca and Brachiaria mutica) and
plant-endophytes partnerships on soil toxicity reduction using wheat
(Triticum aestivum L.) as a model plant ................................................... 84
xiii
Abstract
Petroleum hydrocarbons are recalcitrant compounds and their adverse environmental
and public health effects demand that efficient and eco-friendly remediation
technologies be devised as countermeasures. The synergistic use of plants and bacteria
is considered as one of the efficient technologies for the restoration of crude oil-
contaminated soil. The studies performed in this thesis were aimed to (ⅰ) isolate and
characterize bacteria associated with the plants growing well in crude oil-contaminated
soil, (ⅱ) study the effect of augmentation of hydrocarbon-degrading bacteria on plant
growth and crude oil degradation in vitro and in vivo.
A large number of hydrocarbon degrading bacteria were isolated from the
rhizospheric soil, root and shoot interior of grasses (Lolium perenne, Leptochloa fusca,
Brachiaria mutica) and trees (Leucaena leucocephala and Acacia ampliceps) vegetated
in crude oil-contaminated soil. The rhizospheric soil yielded 22 (59.45%), root interior
yielded 9 (24.32%) and shoot interior yielded 6 (16.21%) hydrocarbon-degrading
bacteria. These bacteria possessed genes encoding alkane hydroxylase and showed
multiple plant growth-promoting activities. Bacillus (48.64%) and Acinetobacter
(18.91%) were dominant genera found in this study.
Green house studies revealed that augmentation with crude oil-degrading
bacteria enhanced plant growth and crude oil degradation. Colonization and metabolic
activity of the endophytes were higher in the rhizosphere and endosphere of B. mutica
than L. fusca. The plant species affected not only colonization pattern and biofilm
formation of the inoculated bacteria in the rhizosphere and endosphere of the host plant,
but also affected the expression of alkane hydroxylase gene, alkB.
The beneficial plant-bacteria partnership was applied in the vicinity of an oil
exploration and production company for the remediation of crude oil-contaminated soil.
Bacterial augmentation improved plant growth, enhanced crude oil degradation, and
reduced soil toxicity and these were significantly (p < 0.05) higher than those where
plants or bacteria were used individually. A positive relationship (r = 0.70) observed
xiv
between alkB gene expression and crude oil reduction indicates that expression of
catabolic gene (alkB) is important for hydrocarbon mineralization.
On the basis of in vitro and in vivo studies, it is concluded that for practical
application, support of potential bacteria combined with the grasses is more effective
approach than the use of plants and bacteria individually. This technology can be
applied for effective remediation of crude oil-polluted sites.
xv
List of Publications
Journal Publications
K. Fatima, M. Afzal, A. Imran, and Q. M. Khan, “Bacterial rhizosphere and
endosphere populations associated with grasses and trees to be used for
phytoremediation of crude oil contaminated soil,” B. Environ. Contam. Toxicol.,
vol. 94, no. 3, pp. 314-320, 2015.
K. Fatima, A. Imran, I. Amin, Q. M. Khan, and M. Afzal, “Plant species affect
colonization patterns and metabolic activity of associated endophytes during
phytoremediation of crude oil-contaminated soil.” Environ. Sci. Pollut. Res., vol.
23, no. 7, pp. 6188-6196, 2016.
K. Fatima, A. Imran, I. Amin, Q. M. Khan, and M. Afzal, “Successful
phytoremediation of crude-oil contaminated soil at an oil exploration and
production company by plants-bacterial synergism” (submitted in Int. J.
Phytorem.)
G. Shabir, M. Arslan, K. Fatima, A. Imran, Q. M. Khan, and M. Afzal, “Effects
of inoculum density on plant growth and hydrocarbon degradation,” Pedosphere,
vol. 26, no. 5, pp. 774-778, 2016.
M. Shehzadi, K. Fatima, A. Imran, M. Mirza, Q. Khan, and M. Afzal, “Ecology
of bacterial endophytes associated with wetland plants growing in textile effluent
for pollutant-degradation and plant growth-promotion potentials,” Plant Biosyst.,
vol. 150, no. 6, pp. 1261-1270, 2016.
M. U. Khan, A. Sessitsch, M. Harris, K. Fatima, A. Imran, M. Arslan, “Cr-
resistant rhizo-and endophytic bacteria associated with Prosopis juliflora and
their potential as phytoremediation enhancing agents in metal-degraded soils,”
Front. Plant Sci., vol. 5, no.1, pp. 755, 2015.
J. Hashmat, K. Fatima, M. A. Haq, Q. M. Khan, M. Afzal, “Characterization of
rhizospheric and endophytic bacteria associated with plants grown in constructed
wetlands to remediate water with crude oil,” (submitted in Ecol. Engg.)
Conference Publications
K. Fatima, M. Afzal, and Q. M Khan, Plant-bacteria partnerships for the
remediation of contaminated soil and water. Oral presentation in 15th
International Congress of Soil Science, National Agricultural Research Centre,
Islamabad, Pakistan, 2014.
M. Afzal, and K. Fatima, Plant-bacteria partnership for the remediation of
hydrocarbon contaminated soil. Poster presented in International Conference on
Biotechnology; Prospects & Challenges in Agriculture, Industry, Health &
xvi
Environment”. National Institute for Biotechnology and Genetic Engineering,
Faisalabad, Pakistan, 2013.
K. Rehman, N. Tara, K. Fatima, S. Ashraf, R. Tahseen, Q. M. Khan, M. Afzal,
Floating wetlands: A new approach to wastewater remediation, poster presented
in 2nd National Students Conference, 2015.
NCBI Submission
K. Fatima, and M. Afzal, “16S rRNA gene sequence submission of 37 bacterial
strains to National Center for Biotechnology Information, 2013.
xvii
List of Abbreviations
PHs Petroleum Hydrocarbons
PAHs Polyaromatic hydrocarbons
Kow Octanol/water partition coefficient
CFU Colony forming unit
LB Luria Bertani
mL Milliliter
GI Germination Index
BE Biostimulant efficiency
M9 Minimal medium
O.D Optical Density
EC Electric Conductivity
SI Shoot interior
RI Root interior
RH Rhizosphere
Rpm Revolution per minute
µg Microgram
µL Micro Liter
g Gram
YFP Yellow fluorescent protein
ISR Induced systemic resistance
PCR Polymerase Chain Reaction
qPCR Quantitative Polymerase Chain Reaction
CLSM Confocal laser scanning microscopy
PGPR Plant growth promoting rhizobacteria
DNA Deoxy Nucleic Acid
DMSO Dimethyl Sulfoxide
1
1 Introduction and Review of Literature
1.1 Background
Soil is an essential life-supporting and fundamental constituent of the biosphere which
offers a numbers of advantages to the surroundings including primary production,
control of biogenic gases, water cycling, preservation of life and biodiversity [1, 2]. In
earlier times, it was believed that our land and its resources are in abundance and will
remain available for centuries. Unfortunately, due to excessive use and now misuse,
half of this natural wealth is either destroyed or is at the verge of depletion [3-5]. The
reasons behind continuous exhaustion of healthy soil ecosystem are the use of chemical
fertilizers, release of other anthropogenic chemicals, and dumping of
industrial/domestic wastes into the environment; all these activities are posing a
significant threat to mankind itself [1, 6]. In addition to other prevalent pollutants,
petroleum hydrocarbons (PHs) are of specific concern because of their structural
complexity, hydrophobicity, toxicity, and persistent nature [7, 8]. Once soil is polluted
with PHs, its recovery may take several years [9].
The world's energy source depends greatly on petroleum oil and its products,
and world-wide energy demand is expected to rise steeply over the next twenty years
[10, 11]. Due to their extreme use, there is a chance that these PHs may release in the
environment and cause severe damage to the ecosystem. Environmental contaminants
enter the environment by both natural and manmade sources leading to contamination
of drinking water, diminishing water and air quality, waste of non-renewable resources,
and loss of soil fertility [12-14]. On the other hand, continual contact with high oil
concentrations may have negative effects on human health and all other life forms as
well. Even at low levels of contamination, residual hydrocarbons cause lethal mutations
in genetic material. Thus due to its mutagenic and neurotoxic effects, the United States
Environmental Protection Agency (US EPA) categorizes crude oil as a significant
pollutant [15-17].
Chapter 1 Introduction and Review of Literature
2
Considering the worldwide problem of soil pollution, more suitable treatments
are necessary as compared to the conventionally used more expensive and
environmentally deleterious ex situ techniques. Conventional technologies, based on
physicochemical methods (soil washing, chemical reduction or oxidation of
contaminants, and incineration), are less practicable due to high cost, environmental
invasion, engineering skills, labor administration, and operational management [18].
Keeping in mind the limitation of conventional technologies, a much better method is
needed to destroy the pollutants or to transform them into nontoxic substances. This
can be achieved by the use of efficient microbes in conjunction with suitable plants i.e.,
microbe-assisted phytoremediation [19, 20]. This technique provides a means of in situ
treatment of contaminated land with high efficiency using natural biological activity.
In plant-microbe partnership, plants offer nutrients and habitat to their associated
bacteria and in return, microbes enhance plant growth and detoxify environmental
pollutants [21-25].
Objectives of the Present Study
The studies undertaken in this thesis address the screening of native plants and their
associated bacteria for the restoration of crude oil-contaminated soil. Moreover, the
survival and colonization of the bacteria in the rhizosphere and different interior
compartments of plant were assessed by cultivation-dependent and -independent
approaches. The primary purpose is to further our understanding of plant-bacteria
partnership that facilitate degradation of hydrocarbons in soil. These aims were pursued
as independent studies:
Study 1: Selection of crude oil tolerant plants and their associated bacteria
Study 2: Green house evaluation of plant-bacteria partnership for the remediation of
crude oil-contaminated soil
Study 3: Bacterial assisted phytoremediation of soil contaminated with crude oil in an
oil field
Preface
The present thesis is organized in seven chapters. Chapter one designates the
background and aims of the study and provides a broad overview of the impact of crude
oil contamination on environment, biological mechanisms used in soil remediation,
Chapter 1 Introduction and Review of Literature
3
phytoremediation, microbial-assisted phytoremediation, and metabolic pathways
involved in hydrocarbon degradation.
Second chapter describes the specific research procedures used in this study. It
illustrates the general experimental designs, sampling procedures, bacterial isolation
and characterization, and growth analysis studies of plants grown in polluted soil.
Third chapter presents the results from an experiment determining the
phytoremediation efficacy of different trees and grasses growing in crude oil-
contaminated soil. We found that grasses are more tolerant to contaminants than trees
and host a variety of hydrocarbon degrading/plant growth-stimulating bacteria.
In chapter four, the colonization behavior and metabolic activity of two strains,
Pseudomonas aeruginosa BRRI54 and Acinetobacter sp. strain BRSI56, were
investigated after applying these strains to Brachiaria mutica and Leptochloa fusca
(grass species) grown in oil-polluted environment. Culture-dependent and -independent
investigation showed that maximum attachment, abundance, and expression of genes is
present in endosphere and rhizosphere of B. mutica than in the endosphere and
rhizosphere of L. fusca. These results suggest that type of plant host affects the
colonization patterns and metabolic activity of bacteria and ultimately the degradation
of hydrocarbons.
Fifth chapter describes the phytoremediation efficacy of B. mutica and L. fusca
inoculated with bacterial consortium in the vicinity of an exploration and production
company for the restoration of crude oil polluted soil. Both grasses, L. fusca and B.
mutica, showed potential to remediate soil contaminated with crude oil and their
remediation potential was further enhanced by bacterial inoculation. Inoculated bacteria
showed not only persistence but also exhibited significant metabolic activity in the soil
and plant tissues.
Chapter six is the general discussion summarizing the results from all the studies
mentioned above. It also presents the conclusions derived from the overall study, and
future prospects for the collective usage of bacteria and plants for the restoration of
polluted soil. Chapter seven is the literature cited in this thesis.
Chapter 1 Introduction and Review of Literature
4
1.2 Crude Oil and Environmental Pollution
Crude oil (naturally occurring raw oil) primarily contains different amounts of carbon,
hydrogen, sulfur, nitrogen, oxygen, and a variety of metal-containing compounds [26-
27]. It is categorized as light, medium, or heavy oil on the basis of heavy molecular
weight components present in it. Its proportion may differ with site, age and depth of
an oil well [28]. On the basis of composition, crude oil is characterized in to four major
elements: 1) aliphatics, 2) aromatics, 3) resins, and 4) asphalthenes. Some of the
constituents of crude oil is shown Fig. 1-1. Each fraction has a distinctive chemical and
physical activity that affects the way it spreads and undergoes biodegradation in the
environment [29]. In structural organization of the aforementioned constituents of
crude oil, aliphatics fraction constitutes the outmost layer while asphalthenes, on the
basis of high molecular weight, constitute the inmost layer of oil [14, 15].
Petroleum hydrocarbon contaminants are one of the most recalcitrant biological
contaminants in the environment. Because of their toxic nature, they cause wide-
ranging and permanent damage to human as well as all other life forms. Although
microbes eradicate soil pollution, when the quantity of impurities surpasses the
buffering capability of soil, it has a lasting adverse effects on its quality and biodiversity
[30].
Contamination of petroleum hydrocarbons is a concern for various reasons (Fig.
1-2). Firstly, once entered into soil, the instability of hydrocarbons can cause fire or
even lethal outbursts, particularly once fumes arrive confined spaces [31]. Furthermore,
pollutants can adsorb on soil and be retained for ages thus leading to land degradation.
Though these waste product may help the soil microflora as source of energy, but they
have lethal and mutagenic effects on microorganisms even at low concentrations [32].
PHs also destroy the aesthetics of land by inducing unpleasant odor, taste in associated
groundwater, or appearance to surroundings. Persistent seepage and continuous runoffs
occur due to their mobile nature which extends their impact to adjacent areas [33].
Chapter 1 Introduction and Review of Literature
5
Figure 1-1 Chemical structure of some crude oil components
Cyclo-alkane
n-alkane
C-C-C-C-C
Iso-alkane
Polyaromatic hydrocarbon Naphthenic acid
Aromatic hydrocarbon
Phenol
Chapter 1 Introduction and Review of Literature
6
Figure 1-2 Concerns due to crude oil contamination of soil
1.3 Fate of PHs in Soil Environment
It is essential to gain knowledge about the fate of PHs within the surroundings in order
to control and combat pollution. The soil rhizosphere helps in structural rearrangement
of hydrocarbons arriving from several sources [34]. When entered in to the soil, the
intricate amalgam of PHs could detach into distinct composites dependent on their
physicochemical characteristics. The environmental fate of these pollutants might be
altered from that of discrete petroleum hydrocarbons due to the structural arrangements
and interactions among hydrocarbons, soil, and microflora [35, 36]. Resistance of these
impurities to soil microflora in water/soil inclines to surge with the form and molecular
weight of hydrocarbons. Crude oil undergoes several processes, for example sorption,
degradation, emulsification, evaporation, photodestruction, or biodegradation, which
naturally degrade its components [37, 38]. Low molecular weight compounds, e.g.
xylenes, toluene, and benzene, can easily travel in the surroundings and are more
probable to evaporate or penetrate towards the groundwater as compared to
hydrocarbons of higher molecular weight [39, 40]. In general, petroleum copmounds
with straight chains are degraded more easily as compared to those having five or six
rings. Compounds with high molecular weight, such as polyaromatic hydrocarbons
(PAHs), have a high tendency to adsorb on soil elements and stay relatively fixed at the
Impact of oil contamination on
environment
Loss of soil fertility
Restricted nutrient &
water availability
Increased soil toxicity
Threat to biodiversity of
soil
Affect soil quality
Reduction in aesthetic
attraction
Chapter 1 Introduction and Review of Literature
7
location where they are trickled till they dispersed into smaller portions and are
degraded by microbes [23, 24, 35, 36].
1.4 Soil Remediation: Preserving a Precious Resource
1.4.1 Physicochemical vs. Biological Methods
Many conventional physical decontamination methods, e.g., soil washing, incineration,
and solvent extraction, are expensive due to excavation and transportation of huge
quantity of polluted material for ex-situ treatment [41]. Other physico-chemical
techniques are the use of dispersants, cleaners, emulsifiers, surfactants, soil oxidizers,
abiotic transformations, and chemical inactivation (potassium permanganate/hydrogen
peroxide are used as chemical oxidants to mineralize non-aqueous hydrocarbons) [42].
But, there is increasing consideration about the usage of these approaches as they have
the possibility to relocate pollutants away from the original site or produce secondary
pollution [43, 44]. Therefore, the increasing cost and limiting efficiency of these
traditional methods have spurred the development of innovative and alternative
technologies for in situ remediation of contaminated lands, particularly based on
biological approaches. On-site operation of biological technology is less expensive and
causes minimal site disruption, therefore, it has greater public acceptance [45-48].
Biological methods are efficient, versatile, cost-effective, and environmentally
safe [49, 50]. Biological methods for soil remediation are: 1) use of microbes
(fungi/bacteria) to decay organic impurities, 2) use of non-edible plants, especially fast-
growing vegetation with huge biomass, 3) soil animals (e.g., earthworms) to gather or
alleviate the recalcitrant contaminants in the soil or in their body, and 4) the combined
usage of plants and bacteria i.e., microbe-assisted phytoremediation [51-53].
Bioremediation: A Natural Method for the Restoration of
Polluted Sites
Bioremediation utilizes biological agents (green plants and microorganisms) or their
metabolic capabilities to degrade or transform many environmental pollutants in both
terrestrial and aquatic ecosystems [54]. Due to the abundance of microorganisms, their
capacity to grow even in anaerobic conditions, and large biomass relative to different
residing organisms inside the earth, they make a suitable means for bioremediation. In
biodegradation, microbes utilize chemical contaminants within soil as sole carbon
Chapter 1 Introduction and Review of Literature
8
source and degrade the desired contaminant into carbon through redox reactions [49,
53-55]. Byproducts are released again into the environment usually in a lesser toxic
form. Microorganisms present in contaminated areas adjust themselves to the
surroundings accordingly. Genetic modifications activated in next generations allow
them to emerge as efficient hydrocarbon degraders [56]. It is a well-known fact that
crude oil-degrading bacteria in uncontaminated ecosystem constitute less than 0.1% of
the total microbes. This quantity may rise up to 1-10% of the overall community in PHs
contaminated environment. However, overall microbial diversity in a polluted
environment is declined [26, 43, 57, 58]. Aerobic environment and suitable
microorganisms are necessary for an optimal rate of bioremediation of soils
contaminated with PHs. Therefore, hydrocarbon-degrading bacteria are the best
candidate to be used in bioremediation of soil contaminated with crude oil because they
can adapt rapidly to the contaminated environment and release variety of enzymes to
detoxify pollutants [20].
1.5.1 Biodegradative Bacteria
Hydrocarbons might be degraded completely within couple of hours, days, or months
by action of microorganisms. Several research reports have indicated that low
molecular weight alkanes are degraded most quickly by soil microorganisms [59, 60].
Petroleum is a combination of various compounds and no individual bacterial strain can
utilize all components found inside petroleum because single bacterium can degrade
only a narrow range of hydrocarbons [61, 62]. Bioremediation requires the dynamic
synergy of different microbes to treat wide ranging environmental contaminants such
as pesticides and complex hydrocarbons [63-65]. It has been suggested that certain
microorganisms may make PHs more bioavailable. This could happen through the
development of a bacterial biofilm specifically on PHs [66, 67]. Several microbes have
the tendency to form multi-cellular aggregates joined together to form biofilms [68].
Biofilms can be formed by single type of bacteria or even by different species of
bacteria. The potential of microbial aggregates in the biofilm communities for
bioremediation is always a safer method than free-living microorganisms as the biofilm
protects them during stress giving the bacterial cells a better chance of adaptation to
harsh environments [69, 70].
Chapter 1 Introduction and Review of Literature
9
Some microorganisms have the capability to degrade monoaromatics, other can
degrade aliphatics, while others degrade resins. Petroleum hydrocarbon degrading
microorganisms and the type of hydrocarbons degraded by them is enlisted in Fig. 1-3.
1.5.2 Concerns Associated with Bioremediation
Bioremediation of PHs is thought to be a complicated phenomenon due to the lethal
and hydrophobic nature of the contaminants, changes in microbial surroundings, and
certain biotic and abiotic factors of soil including temperature, pH, composition, and
moisture [69, 71]. Certain factors modify the rate of uptake and movement of
contaminant to the bacteria (bioavailability) [42, 70-72]. Important factors that have a
significant impact on the effectiveness of bioremediation process are shown in Fig. 1-
4.
Concentration and Characteristics of Contaminant: The type and concentration of
environmental contaminants have a strong influence on microbial growth and activity.
When the concentration is too high, it may have a toxic effect on bacteria. On the other
hand, low concentrations may prevent induction of pollutant-degrading genes present
in bacteria [73, 74].
Bioavailability of Contaminants: Bioremediation efficiency to a great extent relies
upon the degree of the bioavailability of the contaminant and consequent metabolism
by the microorganisms. It is generally believed that bioavailability of hydrocarbons
decreases with increasing molecular mass. Moreover, the rate of bioremediation in soil
decreases with rise in residence period of PHs. Aging hinders the movement of
pollutants into soil leading to the alteration and/or adsorption of pollutants on soil
particles [75].
Soil Properties: Another significant aspect that affects the rate of biodegradation is the
chemical/physical/biological properties of soil. Due to the hydrophobic nature of PHs,
they become hypothetically inaccessible for microbial degradation. Their degradation
occurs when they come in contact with aqueous material as only small fraction of these
mixtures become in water-dissolved condition. Additionally, the rate of biodegradation
largely depends upon the soil type. Low fractions of clay and slit in soil have been
associated with higher availability of hydrocarbon [76].
Chapter 1 Introduction and Review of Literature
10
Temperature: It also influences the biodegradation of hydrocarbons. The rate of
biodegradation generally drops with the diminishing temperature. It also has a major
effect on microbial growth and consequently on microbial activity in the environment
[77].
Nutrients: Nutrients (nitrogen, phosphorus and/or iron) play an essential role in
biodegradation of PHs. Appropriate amounts of these nutrients are already present in
the soil but with high concentrations of pollutants there, they become limiting factors
thus effecting the process of biodegradation. To overcome this limitation, nutrients can
be added in useable form or with organic amendments [78].
Moisture Content: For efficient microbial activity, optimum amount of water in soil
environment is essential. For optimal growth and development, microorganisms require
approximately 25% of moisture contents in the soil [79].
Redox Potential: It is influenced by the presence of electron acceptors including
manganese and iron oxides in soil. It is suggested that redox potential increases the
degradation of PHs by expanding their bioavailability thus increasing microbial
metabolism [34].
Chapter 1 Introduction and Review of Literature
11
•Vibrio sp.
•Moraxella sp.
•Pseudomonas sp.
•Bacillus sp.
•Cycloclastics sp.
•Achromobacter sp.
•Pseudomonas sp.
•Acinetobacter sp.
•Rhodococus sp.
•Bacillus sp.
•Halomonas sp.
•Acinetobacter sp.
•Alcanivorax sp.
•Brevibacterium
•Marinobacter sp.
•Pseudomonas sp.
Aliphatics Monoaromatics
ResinsPolyaromatics
Figure 1-3 Bacterial species involved in different types of PHs degradation
Chapter 1 Introduction and Review of Literature
12
Phytoremediation: Using Green Technology to Restore
Contaminated Environment
In general, it was believed that plants can only supply fiber, energy, and food. However,
their promising role in eliminating contaminants from environment have been
documented in the past two eras [20]. Phytoremediation is a promising phenomenon
where green plants are used to diminish, eliminate, detoxify, and immobilize toxins
with the purpose of restoration of a site to a condition that can be used for private or
public applications [80]. It provides a solution to the problem of sites contaminated
with organic and inorganic contaminants which includes metals, insecticides, solvents,
explosives, and PHs. Growth of plants and their capacity to tolerate high concentrations
pH
Porosity
Temperature
Soil properties
Moisture content
Availability of nutrients
Organic matter content
Diversity
Substrate range
Substrate affinity
Species abundance
Metabolic pathways
Bioremediation
Toxicity
Structure
Concentration
Bioavailability
Hydrohobicity
Molecular weight
Soil characteristics
Figure 1-4 Factors influencing the process of bioremediation of soil contaminated
with PHs
Chapter 1 Introduction and Review of Literature
13
of pollutants are the factors responsible for their efficiency in phytoremediation [81].
The advantages and limitations of phytoremediation are listed in Table 1.1.
Plants use various mechanisms to remove and/or uptake organic and inorganic
contaminants that forms the basis of phytoremediation technology. For removal of
environmental contaminants, they utilize dynamic processes including rhizofiltration,
phytovolatilization, phytostabilization, phytodegradation, and rhizodegradation [82,
83]. The initial step of efficient phytoremediation is plant uptake of hydrocarbons.
Contaminant uptake and transport takes place in the two-vessel system of xylem and
phloem for subsequent accumulation and degradation within the plant [81, 84, 85]. The
pathway by which pollutants enter the plants depends upon their physicochemical
properties including hydrophobicity, water solubility, and vapor pressure.
Hydrophobicity is usually expressed as coefficient of octanol/water partition (Kow),
wherein a log of Kow value (0.5-3.5) make sure take-up of pollutants by plants whereas
higher values mainly result in sorption to roots and insignificant translocation in aerial
parts of plants [86-88].
Once the pollutant enters the plant, it might have several fates: (i) complete
degradation/mineralization of organic pollutant into carbon dioxide and water, (ii)
phytochemical complexation of inorganic pollutant in root cells thus minimizing the
mobility of contaminant to water, soil, and air, (iii) contaminant is detoxified via
number of reactions in plant: conversion, conjugation, and compartmentation [87].
Chapter 1 Introduction and Review of Literature
14
Table 1.1 Pros and cons of phytoremediation
1.6.1 Plant Selection for Phytoremediation
Selection of appropriate plant species is critical consideration for implementing
phytoremediation strategies [89]. Common factors for selection of trees or grasses
generally include: 1) resistance to contaminants, 2) tolerance to environmental
conditions, 3) high productivity, 4) low bioaccumulation, 5) suitability for various soil
types, and 6) native to avoid the introduction of invasive species [90-92]. Several
reports indicated that shrubs, grasses, herbs, and trees are suitable candidates that can
be utilized for phytoremediation [93]. Legumes (e.g. alfalfa, clover, peas, and reed
canary grass), grasses (e.g. ryegrass, kallar grass, and para grass), and trees (e.g.
Populus sp., Conocarpus erectus and Acacia nilotica) have been proven to be tolerant
to hydrocarbon pollutants [94].
Benefits of Grasses, Legumes, and Trees in Phytoremediation
Grasses are excellent contenders for phytoremediation because of their widespread
fibrous root structure that result in increased rhizosphere and ultimately abundant area
for microbial activity and growth [93]. Additionally, grasses can proficiently eradicate
Advantages Limitations
In situ, proficient and environment
friendly technology
Technology is limited to shallow ground water
and soils. Highly dependent on soil properties
and environmental conditions
Applicable on moderate and low
levels of contamination
Not applicable in high concentrations of
contaminants
Fast and beneficial for breaking down
diverse organic pollutants
Slower than physico-chemical treatments and
often in need of supplementary treatments such
as nutrient supply
High public acceptance Toxicity and nature of biodegradation products
are not known
Aesthetically pleasant Results are variable
Reduces landfill wastes Effects to food web might be unknown
Harvestable plant material Contaminant fates might be anonymous
Chapter 1 Introduction and Review of Literature
15
hydrocarbons from polluted environment. They do not require any nutrient, and show
wide application to the complications that are linked with crude oil pollution [89].
The other important factor to be considered in phytoremediation is the level of
nutrients in polluted soils. Soils polluted with elevated amounts of petroleum are
frequently deficient in nitrogen. Legumes might be utilized in phytoremediation
because of their symbiotic-association with nitrogen fixers (bacteria and fungi) [92, 95].
The root system of leguminous plants generally is not as flourished as grasses to reach
deeper soil layers [96]. Legumes have preference over non-leguminous plants on
account of their inherent capacity. Moreover, legumes do not require to contend with
microbes and different vegetation for accessible soil nitrogen at oil-contaminated sites;
they additionally stimulate attached microorganisms by discharging nutrients into the
rhizosphere [97]. Legumes, such as Vulpia myuros, Medicago sativa, Elymus sp.,
Phalris arundinacea and Trifolium sp. have been effectively used to restore
contaminated places, particularly hydrocarbon-polluted soils [98].
Trees additionally play an essential role in the process of phytoremediation.
Proper selection of tree species and variety/genotype is an important criterion to predict
the phytoremediation efficacy [99, 100]. Trees typically have greater root biomass and
deeper root systems than grasses, thereby occupying a greater soil volume than grasses.
Common reasons behind the excessive use of trees in phytoremediation are their easy
propagation, fast growth, deep root systems that stretch out to the water table, high
water take-up rates, maximum absorption surface areas, perennial growth, and/or
tolerance to contaminants [101]. For instance, poplar and willows have been selected
as prospective candidates in phytoremediation of both organic and inorganic
contaminants [102].
Microbe-Assisted Phytoremediation: An Optimal
Approach to Revitalize Ecosystem
The efficacy of plant-based remediation is often restricted by two factors: (1) the toxic
nature of environmental contaminants, and (2) loss of soil fertility in the form of
unavailability of nutrients and modification of soil texture. In contrast, microbial
degradation often faces difficulty due to the inability of existing microflora to degrade
the contaminants, insufficient nutrients in contaminated soil, and low bioavailability of
pollutants [90, 103]. Therefore, an optimal system is obligatory in order to overcome
Chapter 1 Introduction and Review of Literature
16
these constraints. Dynamic synergy between plant roots and soil microorganisms has
received great attention due to the possible role of bacteria in plant development and
degradation of PHs [104, 105]. The inoculation of specific bacteria increases plant
resistance to contaminant stress and enhances plant biomass. In response, vegetation,
through its rhizospheric effects, supports the proliferation of hydrocarbon degrading
microbes, which results in the degradation of recalcitrant biological contaminants [23,
106]. The combined use of phytoremediation and microbial augmentation techniques
develop a more effective strategy for the restoration of recalcitrant pollutants,
predominately polyaromatic hydrocarbons [107-109].
While it is broadly accepted that bacteria and fungi are chief mediators in
hydrocarbon degradation, bacteria have been revealed to be more versatile than fungi
[19, 20, 24]. Bacteria are ubiquitous; residing in the rhizosphere, plant interior
rhizoplane/ phyllosphere, and, thus can be considered active players in the cleanup
strategy for hydrocarbon remediation [110, 111]. Microbes having both hydrocarbon-
degrading and plant growth promoting (PGP) abilities more actively reduce stress
symptoms in plants and detoxify soil pollutants as compared to microorganisms having
just contaminant degrading/PGP capabilities [112]. Plant growth promoting bacteria
actively stimulate the growth via different mechanisms, such as fixation of N2, P-
solubilization, siderophores, and production of 1-amino cyclopropane 1-carboxylate
ACC deaminase, thus assisting plants to overcome stress, enhance plant defense
towards pathogens, and stimulate biodegradation process (Fig. 1-5) [22]. Ethylene
(plant hormone) assumes a vital part in root extension, fruit ripening, and in stress
signaling too. The inhibition of growth that take place as a result of surrounding strain
is the outcome of the plant reaction to elevated amounts of ethylene [113]. However,
bacteria producing ACC deaminase can bring down the levels of ethylene by cleaving
the ACC and mitigate stress in developing plant [114]. Numerous bacteria produce IAA
which shows an essential part in the development of extensive root system and
prompting enhanced uptake of nutrient that, thus, stimulates bacterial propagation in
root zone [114]. It has been recommended that bacteria producing IAA might prevent
the deleterious impacts of stresses. Thus, the combined use of vegetation and such
microorganisms may be an important alternative for remediation of oil-contaminated
soils [115-117].
Chapter 1 Introduction and Review of Literature
17
The adequacy of plant-bacteria partnership relies upon to a great extent on the
persistence and metabolic capability of strain harboring catabolic genetic factor
necessary for the enzymatic cessation of PHs [21, 22]. Additionally, it is significant to
screen the expression and abundance of specific DNA during remediation of oil-
polluted soil to acquire proof of metabolic action of the inoculated microorganisms [45,
46, 107]. Culture-dependent techniques are classical means of evaluating microbial
population changes. However, less than 1% of ecological bacteria can be cultured [118].
Metagenomic approaches have opened new horizons for a profounder knowledge of
bacterial population enlightening information about gene abundance and expression
[119]. DNA based approaches provide molecular knowledge of the bacteria existing in
a particular environment at a certain time [120, 121]. Nucleic acids are also analyzed
by way of fingerprinting of functional genes (e.g., alkB gene) or a quantitative PCR
(qPCR) to reveal the presence of specific bacteria in an environment [122].
1.7.1 Rhizoremediation: Use of Rhizobacteria to Enhance
Hydrocarbon Phytoremediation
The usage of vegetation and their root-associated microbes to decontaminate oil-
polluted soils is termed as rhizoremediation. This beneficial association relies on the
fact that bacteria increase the bioavailability and degradation of organic pollutants, in
turn, plants provide residency and food to the bacteria [19, 123]. Despite the fact that
rhizoremediation happens naturally, but through deliberate manipulation (inoculating
the soil with contaminant degrading and/or PGP bacteria) in rhizosphere it can be
enhanced [124, 125].
The rhizosphere is a densely-populated zone wherein enhanced microbial
activities are witnessed and plant roots have interaction with soil-borne microorganisms
by exchange of essential supplements, growth factors and so forth [126, 127]. Increased
biodegradation of persistent pollutants in the rhizosphere is perhaps the outcome of
higher microbial populations around the roots of plants. Growing plants release a
various chemicals in form of root exudates. Following root exudation, the proliferation
of specific group of bacteria is 10-1000 folds more prominent in the plant rhizosphere
as compared to loose soil; this occurs due to excessive level of nutrients found in
exudates [128-130]. The properties, amount and timing of root exudation are critical
for rhizoremediation process [131]. In soil, plants may react to chemical stress with the
aid of changing the composition of nutrients that, thus, adjust the metabolic potential
Chapter 1 Introduction and Review of Literature
18
of microorganisms. The microbial activity in the close vicinity of the root seems to offer
a promising environment for degradation of obstinate chemicals [53, 132]. These
activities also increase the bioavailability of soil-bound nutrients and degradation of
phytotoxic soil contaminants in the rhizosphere [133].
Rhizobacteria with plant growth-promoting potential have been conventionally
applied in agricultural science to improve crop yields. Their potential role in the
remediation of environmental pollutants have been explored recently [134-136].
Organic compounds including PHs, pesticides, chlorinated compounds
(polychlorinated biphenyl), explosives, organophosphate insecticides (diazinon and
parathion), and surfactants (detergents) are more rapidly degraded by rhizospheric
bacteria [137, 138].
The successful application of rhizoremediation largely depends upon survival
and establishment of bacteria in the rhizosphere. This phenomenon has been widely
studied, but the complete mechanism is as yet not clear; It has been suggested that it
may be because of the secretion of certain compounds (e.g. polysaccharides) and other
phenomenon such as chemotaxis [107, 139]. It is supposed that a plant and its related
bacteria establish bacterial colonization on root surface through complex chemical
signals which includes hydrogen peroxide, superoxide anion and especially flavonoids
[140-142]. This communication is of extreme significance for the persistence and
establishment of applied microbes in the plant rhizosphere. Numerous studies have
been executed to observe persistence of inoculated bacteria, especially through
labelling of augmented bacteria with a indicator gene, for example gfp encoding green
fluorescent protein, gusA encoding ß-glucuronidase and so forth. [143].
1.7.2 Endophyte-Assisted Phytoremediation
In addition to rhizobacteria, plants are internally colonized by bacteria, fungi, and
actinomycetes. Endophytes can be defined as pathogenic and nonpathogenic microbes
living inside plant organs (root/shoot). They are ubiquitous (found in all plant species),
diverse in nature, and residing in a dormant or active state in the plant tissues [22].
Endophytes interact more closely with the host while savoring a less competitive
environment which has high amount of nutrients and is highly protective against wide-
ranging fluctuations than the environment that rhizo- or phyllospheric bacteria usually
face. Endophytes gain entry in plant tissue through the roots, followed by habitation in
Chapter 1 Introduction and Review of Literature
19
the root cortex or aerial parts of plants via plant vascular system. Additionally, cell
wall-degrading enzymes favor the entrance of such microbe into plants. Endophytes
have to proliferate in the rhizosphere before entering the plant [122, 144]. During
endophytic colonization, bacteria travel to the plant interior by soil water oscillations
or dynamically through particular stimulation of flagella. In addition, root exudates, act
as indicators for chemotactic movements and provide a nutrient-rich environment for
active colonization [139, 145].
Despite the fact that rhizoremediation seems promising, the contaminant is not
accessible to the rhizospheric microflora because its residence time is very much lower
in the rhizosphere [146-148]. Here, endophytic bacteria get the chance to breakdown
the contaminants with the assistance of their intracellular enzymes before than the
contaminants are evapotranspired. Additionally, a most important benefit of endophytic
bacteria above rhizobacteria is that they are living inside host plant and consequently
have lesser struggle for nutrients and space [145, 149].
Endophytes assumes a key role in plant’s adaptation to contaminated
surroundings and furthermore improve phytoremediation by transforming
contaminants, stimulating plant growth, subsiding phytotoxicity, and improving overall
plant’s health [150, 151]. Many endophytic bacteria exhibit PGP activities, for example
nitrogen fixation, production of phytoharmones (IAA & ACC deaminase) and
hydrolytic enzymes (HCN & siderophores) [19]. These PGP actions of endophytes
improves the plant health in contaminated soils and eventually phytoremediation
efficiency. Further to modify the growth harmones concentartions in plants, some
endophytes can speed up plant development via biological nitrogen fixation [152]. An
outstanding illustration is the sugarcane isolated nitrogen-fixing bacteria, which
provides ample nitrogen to the host plant and enhance plant progress. Moreover, some
endophytes enhance plant growth by enhancing mineral nutrition or increasing
resilience to biotic and abiotic stresses [153]
Chapter 1 Introduction and Review of Literature
20
Metabolic Pathways for Biodegradation of PHs
Most microbial species do not contain all the appropriate enzymes so degradation is a
collective function of a consortium of microorganisms belonging to different genera.
Microorganisms either catabolize organic pollutants to obtain energy or integrate them
into cell biomass [25].
Hydrocarbon-degrading bacteria may be categorized into two groups: 1)
aerobic, and 2) anaerobic. Aerobic conditions facilitate the fastest and complete
degradation of most hydrocarbons because during metabolic activities oxygen is
available as an electron acceptor [29, 154]. Possible peripheral pathways for aerobic
biodegradation of n-alkanes and aromatic hydrocarbons are described in Fig. 1-6.
Figure 1-5 Plant-microbe interactions that lead to remediation of soils
contaminated with PHs
Chapter 1 Introduction and Review of Literature
21
1.8.1 Aerobic Biodegradation
In aliphatic hydrocarbons, the crucial step for aerobic degradation involves the addition
of oxygen by oxygenases and peroxidases [8]. Peripheral degradation pathways
(terminal/sub-terminal oxidation) convert activated molecules to intermediates in a
step-by-step process followed by conversion into a fatty acid. This molecule is then
conjugated to coenzyme A which forms an acyl-CoA which is then converted into
acetyl-CoA (final product). Acetyl-CoA enters in the Krebs cycle and eventually
completely oxidized to CO2 [26]. Additional pathways include oxidation of di- and sub-
terminal side of n-alkanes. In di-terminal pathway, by x-hydroxylation, oxidation of
both sides of alkane molecule occurs (x position signifies terminal methyl set) of fatty
acids. It is at that point additionally converted into dicarboxylic acid and processed by
ß-oxidation pathway. Cell biomass is produced from the central precursor metabolites
(acetyl-CoA and pyruvate).
Polyaromatic hydrocarbons such as biphenyls and naphthalene are more
persistent in the environment than saturated hydrocarbons [155]. Due to their toxic
nature, they are the priority pollutants in bioremediation programs. For initial
activation, four different enzymes are involved; 1) the non-heme iron oxygenases, 2)
the soluble di-iron multicomponent, 3) the flavoprotein monooxygenases, and 4) the
CoA ligases [156]. Unlike aliphatic hydrocarbon degradation, activated molecule is not
transformed to alkanol but rather to intermediates of phenol (catechol) [157]. Intradiol
or extradiol dioxygenases will further convert these phenol intermediates to di‐ or tri-
hydroxylated aromatic compounds that may enter into the Krebs cycle and completely
metabolized into CO2 [158]. Hydrocarbon degrading bacteria cleave benzene ring in
diverse ways by appropriate enzymes. In PAHs, benzene rings are degraded one after
the other. But in case of cyclic alkanes, transition from alkane to alcohol takes place
which is further dehydrogenated to ketones by an oxidase system. Alkenes may be
degraded by (a) sub-terminal (b) terminal, and (c) oxidation of double bond to resultant
epoxide/diol [156].
1.8.2 Anaerobic Biodegradation
Microbial degradation of various substrates, specifically obstinate hydrocarbons, is
restricted under anaerobic conditions because O2 is prerequisite for this process [159].
Understanding of the mechanism of anaerobic degradation is more recent as compared
Chapter 1 Introduction and Review of Literature
22
to aerobic degradation. Therefore, less information is available about the genes and
enzymes involved in these pathways. During degradation of PHs, anaerobic bacteria
offers nutrients required for the growth of other catabolizing bacteria [34]. A large
variety of microorganisms (bacteria and archaea) have been identified with the
capability to degrade hydrocarbon molecules anaerobically. These bacteria exploit
anaerobic respiration via nitrate, nitrite, and metal ions or fermentation during substrate
catabolism [160, 161].
For anaerobic bacteria, alkanes with smaller chain length are difficult to degrade
than alkanes having mid- to long-chain lengths. In anaerobic conditions, short-length
hydrocarbons (up to n-C17) do not dissipate easily, so these compounds can develop
and exert a harmful effect on the cell wall of bacteria, thus inhibiting their growth.
Moreover, sulphate reducing bacteria degrade branched alkanes more efficiently than
straight chain alkanes [162, 163].
Anaerobic degradation is commonly established in deep and anoxic
environments for example natural oil seeps on land/ocean and the sites polluted with
oil. Likewise, this kind of biodegradation can happen beneath the surface of areas where
aerobic biological activity has been ceased as all the oxygen is used. After oxygen
exhaustion, there may be a consecutive employment of the electron acceptors (nitrate,
ferric iron, sulphate, and hydrogen) to supply energy from the hydrocarbon degradation
[161-164].
Chapter 1 Introduction and Review of Literature
23
Figure 1-6 Schematic overview of metabolic pathways for hydrocarbons
(aliphatic and aromatic) utilization by aerobic bacteria. Ortho: ortho cleavage
pathway, meta: meta cleavage pathway, CoA: coenzyme A.
Chapter 1 Introduction and Review of Literature
24
Enzymatic Biodegradation
In order to explore functional genes involved in degradation of hydrocarbons, one must
have knowledge about the enzymes involved in biodegradation. Though there are few
bacteria that can fully mineralize the particular organic pollutant, single species usually
do not have the capability to degrade PHs or lack entire degradation pathways [165].
However, consortium of heterogeneous bacterial strains can effectively degrade these
recalcitrant compounds fully. Details of bacterial and plant based degradative enzymes
[161] are depicted in Table 1.2.
The prokaryotic monooxygenases isolated are catalogued into two sets on the
basis of their electron transport system and the microorganisms in which they are
available: (a) enzyme dependent on rubredoxin (2FeO), in most of bacteria this enzyme
is encoded by alkB gene and alkM specifically in Acinetobacter sp., (b) cytochrome
P450 monooxygenase belonging to CYP153 family of microbes. Alkane hydroxylase
enzyme was firstly described in Pseudomonas putida GPo1 where it was positioned on
the plasmid names as OCT and was reported to be organized in two operons:
alkBFGHJKL and alkST [166].
The cytochrome P450 enzymes are set of heme (iron protoporphyrin IX)
comprising monooxygenase enzymes that work in association with sub-atomic oxygen,
and an electron-transfer system to oxidize diverse range of compounds [167]. Rather
than eukaryotes, the bacterial cytochrome P450 are soluble in the cytoplasm. The
structures of these enzymes vary from species to species.
Moving on, with wide-ranging distribution and satisfactory earlier research
findings, alkane hydroxylase (alkB) gene is deliberated a favorable functional
biomarker to monitor potential of bioremediation at a site of oil contamination.
Numerous studies attempted to narrate the degradation processes or contaminant
mineralization, diversity of alkB gene, richness, and its expression in situ [165, 167].
Chapter 1 Introduction and Review of Literature
25
Table 1.2 Bacterial and plant enzymes involved in alkane degradation
Enzymes Catalytic action Origin/Reference
Dehalogenase Involved in release of chlorine
and fluorine from halogenated
straight chain and ring
compounds
Xanthobacter autotrophicus,
Populus spp., and
Protobacteria [22]
Lacasse Degrade numerous aromatic
hydrocarbons
Alfalfa, Trametes versicolor
and Coriolopsis polyzona [2,
3]
Dioxygenase Degrade specific aromatic rings Pseudomonas sp.,
Mycobacterium sp. [76]
Peroxidase Involves in degradation of
several aromatic compounds;
dehalogenation of various n-
alkanes
Armoracia rusticana,
Phanerochaete
chrysosporidium,
Phanerochaete laevis,
Medicago sativa [176, 78]
Nitrilase Cleaves cyanide group from
aliphatic and aromatic nitriles
Salix spp., Aspergillus niger
[23, 67]
Nitroreductase Reduces nitro groups on nitro-
aromatic compounds; removes N
from ring structures
Comamonas sp.,
Pseudomonas putida, Populus
spp.[80]
Phosphatase Cleaves phosphate groups from
pesticides
Spirodela polyrhiza [74]
Cytochrome
p450
monooxygenase
Hydroxylation of ring and
straight chain hydrocarbons
Bacteria, fungi and plants
[101]
26
2 General Materials and Methods
Media and Chemicals
Luria Bertani (LB), Dworkin and Foster (DF), M9 minimal medium, Pikovskaya's, LG1
and Sabouraud dextrose agar (SDA) medium were used in present study (appendix A-
E). For solid media preparation, 15 g L-1 agar was used and all media were autoclaved
at 120 °C for 15 minutes before use.
The chemicals were purchased from LAB-SCAN (Thailand), Merck
(Germany), and Sigma (USA) or Sigma-Aldrich (Germany). Molecular biology
chemicals were purchased from Thermo Fisher Scientific (USA), Fermentas Life
Sciences (UK) and Invitrogen (USA). All hydrocarbons, for example hexane (C6),
octane (C8), decane (C10), dodecane (C12), hexadecane (C16), 1-decanol, naphthalene,
phenolphthalein, methanol, ethanol, benzene and toluene, were however 98-99% pure
and procured from Sigma-Aldrich (Germany).
Equipment
All the equipment used in the present work was availed from National Institute for
Biotechnology and Genetic Engineering (NIBGE), e.g., confocal laser scanning
microscope (CLSM), centrifuges, spectrophotometer and thermal cycler. 16s rRNA
gene sequencing of the isolated bacterial strains was done by Macrogen (Seoul, South
Korea).
Soil Sample Collection
Soil was collected from the crude oil-contaminated sites of an oil production company,
Oil and Gas Development Company Limited (OGDCL) situated in Chakwal (32.55 °N
72.51 °E), Pakistan. Soil contamination was a result of accidental release of crude oil
in the environment.
Soil samples were collected from 10 different points at a depth of 0-25 cm, and
mixed together. Subsequently, soil was dried in air and sieved through 2 mm sieve to
Chapter 2 General Materials and Methods
27
remove root debris, pebbles and large fragments. Soil was separated into two portions
for biological and chemical analysis, and stored at 4 °C.
Seeds and Seedlings
The seeds and seedlings of different trees and grasses used in different experimentations
were obtained from local plant market of Faisalabad and Biosaline Research Station
(BSRS), Pakka Anna, Faisalabad, Pakistan (Table 2.1). Seeds of edible crops (Zea
mays, Glycine Max, Helianthus annus L. and Brassica rapa) were obtained from
NIBGE.
Bacterial Strains
Rhizospheric soil, root and shoot interior of the plants (showing better growth in crude
oil-contaminated soil) were used to isolate the hydrocarbon-degrading bacteria.
Biosensor/reporter strain, Chromobacterium violaceum CV026, was used in quorum
sensing bioassay and Escherichia coli (DH5 α) carrying a broad host range plasmid
(pBBRIMCS-4) which comprise yellow fluorescent protein (yfp) was collected from
NIBGE, Faisalabad.
Maintenance and Preservation of Bacteria
Individual culture of hydrocarbon-degrading rhizospheric and endophytic bacteria were
maintained in minimal medium (M9) amended with 1% filter-sterilized diesel. To
prepare the glycerol stocks, bacterial cultures were mixed with 50% sterile glycerol.
The stocks were preserved at -80 °C until used further.
Chapter 2 General Materials and Methods
28
Table 2.1 List of plants (grasses, trees and edible crops) used in the present
work
Scientific name Common name Abbreviation Source/origin
Grasses
Axonopus fissifolius Carpet grass AF BSRS, Faisalabad
Brachiaria mutica Para grass BRA BSRS, Faisalabad
Camelina sativa Falseflex CS BSRS, Faisalabad
Hordeum vulgare Barley HV NIBGE, Faisalabad
Leptochloa fusca Kallar grass LEP BSRS, Faisalabad
Lolium perenne Rye grass LOL Local market, Faisalabad
Medicago sativa Alfalfa MS Local market, Faisalabad
Sorghum bicolor Sorghum SB Local market, Faisalabad
Sporobolus indicus Sporobolus SI Local market, Faisalabad
Trifolium alexandrium Egyptian clover TA Local market, Faisalabad
Edibe crops
Brassica rapa Brassica BR NIBGE, Faisalabad
Glycine max Soybean GM NIBGE, Faisalabad
Helianthus annuus L. Sunflower HA NIBGE, Faisalabad
Zea mays Maize ZM NIBGE, Faisalabad
Trees
Acacia ampliceps Acacia ACA BSRS, Faisalabad
Acacia eburnean Pahari kikar AE BSRS, Faisalabad
Acacia nilotica Egyptian thorn AN BSRS, Faisalabad
Azadirachta indica Indian lilac AI Local market, Faisalabad
Bambusa
dolichomerithalla
Bamboo BD Local market, Faisalabad
Conocarpus erectus Conocarpus CE Local market, Faisalabad
Eucalyptus camaldulensis Himalyan poplar EC Local market, Faisalabad
Leucaena leucocephala Ipple ipple LEC BSRS, Faisalabad
Moringa oleifera Horseradish MO Local market, Faisalabad
Pongamia pinnata L. Sukh chain PL Local market, Faisalabad
Populus nigra Popular PN Local market, Faisalabad
Terminalia arjuna Arjun TA Local market, Faisalabad
Terminalia bellirica Bohera TB Local market, Faisalabad
Chapter 2 General Materials and Methods
29
Isolation of Rhizobacteria and Endophytes
Rhizosphere, root and shoot interior of Leptochloa fusca, Brachiaria mutica, Acacia
ampliceps, Lolium pernne and Leucaena leucocephala were used for the isolation of
hydrocarbon-degrading bacteria. These plants showed more growth in crude oil-
contaminated soil than other tested plants. After 3 months of vegetation, the plants were
uprooted carefully and mixed to eliminate the excessive soil adhered to roots. Roots
with adhered soil were placed in Erlenmeyer flask containing 10 mL of sterile 0.9%
normal saline (w/v) and centrifuged at 2000 rpm for 40 min. Root samples were
carefully removed and sediment was permissible to resolve down. The supernatant was
serially diluted and plated on M9 medium mixed with 1% filter sterilized diesel as
individual basis of energy that was incubated at 37 ± 2 °C. Prominent single colonies
that appeared after 3 days were picked and streaked two to three times on freshly
prepared M9 medium plates (containing 1% diesel) to obtain the pure colonies.
For endophytic bacterial isolation, stems and roots of each plant were washed
carefully with tap water followed by 2 min wash with sterile distilled water.
Furthermore, plant parts were surface sterilized with 70% ethanol [roots (10 min),
shoots (5 min)]. Afterwards, plant samples were washed with 1% NaOCl for 60s and
formerly a last rinse in autoclaved distilled water (at least 3 times). To check the surface
sterility of plants, water from the final rinse was spread on M9 medium having glucose
as only source of carbon. The plates were placed at 37 ± 2 °C for 72 h, no bacterial or
fungal colonies were observed. One gram of shoots / roots were even out independently
by pestle and mortar and mixed with 0.9% normal saline (NaCl). Dilutions were spread
on M9 medium agar plates comprising 1% filter-sterilized diesel. To avoid any fungal
contamination, medium was mixed with cyclohexamide (100 mg L-1). The plates were
positioned in incubator at 37 °C ± 2 for 2 days [168]. Diesel resistant colonies were
randomly picked and streaked on same media to obtain pure colonies. Bacterial isolates
growing well on sub-culturing were selected and stored at 4 °C for further use.
Characterization of Isolated Bacteria
2.8.1 Colony and Cell Morphology
Isolated strains were differentiated on the basis of their colony size, cell morphology,
shape, pigmentation and motility using standard protocols [169, 170].
Chapter 2 General Materials and Methods
30
2.8.2 Molecular Characterization
Genomic DNA Extraction and PCR Amplification of Intergenic Spacer (IGS) Region
Genomic DNA extraction of each pure isolate was performed by genomic DNA
purification kit (Invitrogen) as suggested by the company. The PCR amplification of
IGS region was performed using already published set of primers: pHr_F
(TGCGGCTGGATCACCTCCT) and P23SR01_R (GGCTGCTTCTAAGCCAAC)
[171]. Reaction mixture (20 µL) contained green PCR master mix (Thermo Fisher
Scientific) (10 µL), forward/reverse primer (1 µL), of DNA (2 µL) and of nuclease free
water (6 µL) [171]. Reactions were executed in a thermal cycler (Bio-Rad) with primary
step of denaturation for 5 min at 95 °C, 35 runs of [for 30 s at 95 °C, for 30 s at 53 °C,
for 1.5 min at 72 °C] and ultimate extension for 10 min at 72 °C. Genomic DNA of
Pseudomonas sp. (ITRI22) was used as a positive control [94]. The resulting amplicons
were examined for size (approximately 1500 bp) in 1% agarose (w/v) gel mixed with
ethidium bromide (0.5 µg mL-1). To confirm the size of amplicons, one Kb DNA ladder
(Fermentas) was used.
Analysis of Restriction Fragment Length Polymorphism (RFLP)
IGS PCR product (10 µL) was digested with restriction endonucleases, Hind III and
EcoR1 (Thermo Fischer Scientific), for 3 h at 37 °C. To analyze the digested PCR
products, 2.5% agarose gel (w/v) containing 0.5 µg mL-1 EthBr was used.
Bacterial 16S rRNA Gene Amplification by Conventional PCR
On the basis of RFLP analysis, isolates were separated into different groups, and those
sharing identical restriction profile were classified into the same group. The
representative of each group was recognized by investigation of partial 16s rRNA gene
with respective set of primers, 8f (AGAGTTTGCTCAG) and 1520rev
(AAGGAGGTGATCGGA) [168]. Reaction mixture (50 µL) was consisted green PCR
master mix 2X (25 µL) (Thermo Fisher Scientific), 1 µL of both primer, 2 µL of DNA
and 21 µL of PCR water. Reaction was done in PCR (Bio-Rad) with denaturation at 94
°C for 10 min; 35 cycles [94 °C, 30 s, 54 °C, 1 min, and 72 °C, 90 s] trailed by absolute
extension at 72 °C 10 min [2]. The DNA isolated from Pseudomonas sp. strain ITRI22,
at a concentration of 5-10 ng, was served as a positive control. Amplified PCR products
(≈1500 bp) were then resolved on 1% agarose gel amended with 0.5 µg mL-1 ethidium
Chapter 2 General Materials and Methods
31
bromide. The 1 kb DNA ladder (Fermentas) was used to confirm the size of amplified
PCR products.
16S rRNA Gene Sequencing and Nucleotide Accession Numbers
Sequencing of amplified PCR products was done by Macrogen (Seoul, South Korea)
using 8f and 1520rev primers. The 16s rRNA gene sequences were matched to the
previously known nucleotide sequences using BLAST
(https://blast.ncbi.nlm.nih.gov/Blast.cgi) tool in NCBI database and sequences were
submitted in GenBank to obtained accession numbers.
Experimental Setup for Crude Oil and n-Alkanes
Biodegradation Studies
2.9.1 In vitro Crude Oil Biodegradation Assay in Shake-Flask Culture
For initial activation, single colony of each strain was transferred to LB broth and
placed in incubator shaker at 37 °C for 24 h at 120 rpm. Afterwards, 3 mL (about 2
×108 cells/mL) of microbial suspension was added in 100 mL M9 media comprising
2% (w/v) of crude oil. Flasks were placed in incubator shaker at 37 °C and 120 rpm for
10 days. Control culture medium (non-inoculated) containing 2% (w/v) crude oil was
incubated under the same conditions. Later, flasks were taken out and growth of
bacteria was stopped by adding 1% 1.0 N HCl to particular flasks [34].
2.9.2 Residual Crude Oil Estimation
Gravimetric method was used to determine the amount of residual crude oil in soil
samples [172-174]. Briefly, in a separating funnel, bacterial culture was mixed with
equivalent volume of petroleum ether and shaken forcefully to obtain two phases. Top
layer containing oil-solvent mixture was decanted into container. Extraction was
performed twice to ensure complete recovery of residual oil followed by addition of 0.4
g of anhydrous sodium sulfate (Na2SO4) in extracted oil to remove any moisture and
transferred into round bottom flask leaving behind Na2SO4. Oil-solvent mixture was
evaporated to dryness in rotavapour (Büchi, Switzeland) under reduced pressure.
Afterwards, flasks were incubated in an oven (at 60 °C) to take out any remaining
petroleum ether. The flasks were cooled down in desiccators and weighed. The
percentage of oil degradation was calculated by the following formula:
Chapter 2 General Materials and Methods
32
Oil biodegradation (%) =Weight of oil (control)−Weight of oil (sample)
Weight of oil (control)× 100 (2-1)
2.9.3 In vitro Utilization of Hydrocarbons
To study the utilization of different hydrocarbons by isolated bacteria, their growth was
tested on various straight chain alkanes and aromatic hydrocarbons (1-decanol,
naphthalene, phenolphthalein, methanol, ethanol, benzene and toluene). The inoculum
of each isolate was prepared and subsequently 10 mL (2×108 cells/ mL) of the inoculum
of individual strain was inoculated into 100 mL M9 medium containing 2% (w/v) of
different hydrocarbons individually. Strains grown on M9 medium having 0.2% (w/v)
glucose were used for instance control. Flasks were placed in an orbital shaker at 120
rpm and 37 °C for 7 days. Experiment was performed in triplicates and all the
hydrocarbons used were 98% pure (Sigma-Aldrich).
Screening of Alkane Hydroxylase Genes (alkB and CYP
153) in Isolated Bacterial Strains
2.10.1 PCR Amplification of alkB and CYP 153 Genes
Diverse set of already reported primers were used to amplify the potential genes
encoding alkane hydroxylases (alkB and CYP 153) in bacterial isolates (Table 2.2). The
PCR reaction mixture (20 µL) contained 1 µL of each alkB-3F/alkB-3R (for alkB gene)
and CYPF/R primers (for CYP 153 gene), 10 µL of PCR master mix (Thermo Fisher
Scientific) 2 µL of template DNA and 6 µL of PCR water. Thermal cycling was
performed (Bio-Rad) using initial denaturation at 95 °C for 4 min, afterwards 30 cycles
of [30s at 94 °C, 30s at 55 °C and 45s at 72 °C] and final extension at 72 °C for 10 min.
For the amplification of alkB and CYP 153 genes, all conditions were same except
annealing temperature, for alkB and CYP 153 were 54 °C and 53 °C for 30 s,
respectively. PCR products were resolved on 1.5 % agarose gel (w/v).
Chapter 2 General Materials and Methods
33
Table 2.2 Primers used for amplification of alkB and CYP 153 genes in bacterial
isolates
F specifies forward primer, and R specifies reverse primer.
2.10.2 Real-Time PCR Quantification of alkB Gene
DNA and RNA Extraction from Rhizosphere and Plant Tissues
Rhizosphere soil (0.5 g) was used for the extraction of DNA and RNA (Soil FastDNA
Spin Kit) and FastRNA Spin Kit (MP Biomedical, USA), individually, as designated
by the manufacturer, and were measured photometrically (Nanodrop 2000C
spectrophotometer, Thermo Fisher Scientific). Root and shoot samples were briefly
crushed in liquid N2 and bead-beater was used for the microbial cell lysis [3]. Plant’s
DNA and RNA were extracted with FastDNA Spin Kit and FastRNA Spin Kit for Plant
(MP Biomedical, USA). During RNA extraction, DNA was completely removed by
digestion using enzyme (DNase I) and possible presence of DNA was screened by PCR.
Quantification of Abundance and Expression of alkB Gene
RNA (20 ng) was used for reverse transcription (RT) including alkB-3(f) primer and
Superscript II Reverse Transcriptase (Invitrogen) as suggested by manufacturer. Real-
time PCR was carried out in iCycler (IQ) (Bio-Rad) with initial denaturation for 4 min
at 95 °C trailed by 45x [30 s at 94 °C, 30s at 60 °C, and 45s at 72 °C] and ultimate step
for 10 min at 72 °C. In addition to analysis of melt curve, amplified PCR products were
also checked on 2.5% agarose gel (w/v). No primer-dimers were noticed on gel.
Reaction mixture (25 µL) contained 12.5 µL of SYBER green PCR master
mix(Invitrogen), 2 µL of 10 mg/mL BSA, 1 µL DMSO, 1 µL of each primer, 50-100
ng of template DNA/cDNA and PCR water.
Purified PCR product of alkB gene was cloned in TA vector pTZ57R/T (Thermo
Fisher Scientific). The presence of alkB gene in the plasmid was confirmed by plasmid
digestion via restriction enzymes (PstI and EcoR1). The plasmid DNA concentration
was calculated by using Nanodrop 2000C spectrophotometer (Thermo Fisher
Primer Sequence (5’-3’) Size (bp) /annealing
temp.
Target
gene/Ref.
alkB-3 (F) TCGAGCACATCCGCGGCCACCA 330/54 °C Alkane
hydroxylase
[175]
alkB-3 (R) CCGTAGTGCTCGACGTAGTT
CYP (F) TGTCGGTTGAAATGTTCATYGCNMTGGAYCC 864/53 °C Alkane
hydroxylase
[176, 177] CYP (R) TGCAGTTCGGCAAGGCGGTDCCSRYRCAVCKRTG
Chapter 2 General Materials and Methods
34
Scientific). Standard curve was created (with ten-fold serial dilution of plasmid DNA
ranging from 101 to 106 copies per reaction) for relative quantification of alkB gene
[118].
In vitro Plant Growth-Promoting Potential of
Rhizospheric and Endophytic Bacteria
2.11.1 Phosphate-Solubilizing Capacity
Bacterial phosphate-solubilizing capability was tested on Pikovskaya’s agar medium
comprising tri-calcium phosphate as a mineral phosphate source [178]. Test strains
were separately spotted on Pikovskaya’s agar plates and nurtured at 37 ± 2 °C for 7-10
days. Plates were observed for halo zone formation nearby the colonies because of the
inorganic phosphate solubilization by the test bacteria.
2.11.2 Assay for Indole 3-Acetic Acid (IAA) Production
The capability of bacterial strains to secrete IAA was investigated using the method
outlined previously [179]. Briefly, bacteria were fully grown in LB broth inoculated
with 0.1 g L-1 tryptophan as IAA precursor, in an incubator shaker for 7 days at 37 ± 2
°C. After centrifugation, cells were collected and mixed with Salkowski reagent (100
µL) of in 96 well plate culture supernatant was mixed with 100 µL of Salkowski
reagent; placed at room temperature for half hour and checked for production of pink
color as compared to control (bacterial culture grown without tryptophan).
2.11.3 Antagonistic Activity Against Plant Pathogenic Fungus
Antifungal ability of bacterial strains was tested against pathogenic fungus, Fusarium
oxysporum. A 6 mm fungal disc was positioned in the middle of Sabouraud dextrose
agar plates and bacterial strains were streaked around the four corners of disc [180].
Plates were placed at 28 ± 2 °C for 7 days and antifungal activity was tested by
measuring the growth inhibition zone between bacteria and fungus as compared to
control (fungus without any bacterial strain).
2.11.4 Siderophore Production
Bacteria were screened for their siderophore secretion using agar plates amended with
chrome azurol S (CAS) dye as described earlier [181]. Briefly, bacteria were streaked
Chapter 2 General Materials and Methods
35
on CAS agar medium and placed for 24 h at 37 ± 2 °C. Orange color around the colonies
was the indicator of siderophore excretion.
2.11.5 Screening of 1-Aminocyclopropane 1-Carboxylate (ACC)
Deaminase Activity
Bacterial ACC deaminase activity was determined on their capacity to consume ACC
as sole source of nitrogen. Test strains were spot inoculated on DF salts minimal
medium containing 0.7 g ACC L-1 [182]. A clear zone around the colonies confirms the
positive ACC deaminase activity. Plates without ACC were used as negative control.
2.11.6 Assay for n-Acyl-Homoserine Lactone (AHL) Production
For the screening of acyl-homoserine lactone (AHL) activity in the strains, a cross
streak bioassay was performed [183]. Chromobacterium violaceum CV026 was used
as biosensor/indicator strain. Test strains were horizontally streaked adjacent to reporter
strain, C. violaceum CV026, on the LB agar plates and placed for 24 h at 28 ± 2 °C.
AHL activity was specified by blue area around the test strains. For positive control,
Rhizobium leguminosarum (pRL1J1) was used and plates without indicator strain
served as negative control.
2.11.7 Zinc Solubilization Assay
To study zinc solubilization activity of the isolated bacterial strains, LG1 medium was
used [184]. Medium was supplemented with zinc compounds (zinc oxide and zinc
carbonate) at a final concentration of 0.1% and 0.2%. The test microorganisms were
inoculated and plates were incubated at 37 ± 2 °C for 48 h. The halo zones around the
bacterial colonies were the indicative of zinc solubilization.
2.11.8 In vitro Compatibility of Bacteria
The growth inhibition by one bacterial specie on the growth of the other bacterial
species was checked as described earlier [185]. Briefly, a loopful of one bacterial strain
was spot inoculated onto the LB plates pre-seeded with test strain. Plates were
incubated at 37 ±2 °C for 48 h. The absence and presence of clearing zone around the
colonies were witnessed for 2 days and antibiosis was confirmed by the presence of
clearing zone.
Chapter 2 General Materials and Methods
36
Analysis by Confocal Laser Scanning Microscopy
(CLSM) for Biofilm Formation and Root Colonization
2.12.1 Bacterial Strain, Plasmid, Media and Growth Conditions
A broad host range plasmid PBBRMCS-1 encoding ampR and harboring a yellow
fluorescent protein gene (yfp) was extracted from E. coli by plasmid isolation kit
(Invitrogen) as per manufacturer’s instructions. Plasmid concentration was measured at
wavelength of 260 nm using Nanodrop spectrophotometer (Thermo Fisher Scientific).
Plasmid DNA was separated through electrophoresis on 1% agarose gel.
2.12.2 Preparation of Electro-Competent Cells
The reagent bottles and solutions were pre-chilled to 4 °C before starting this procedure.
A single colony from overnight grown pure bacterial culture was inoculated to LB broth
(20 mL) and placed in incubator shaker for 24 h at 37 °C, 130 rpm. Five mL culture
was transferred to 500 mL LB medium and incubated until optical density reache up to
0.5-0.8 at 600 nm. Afterwards, culture was shifted to pre-chilled falcon tubes (50 mL)
and placed on ice for at least 30 min. Cells were collected by centrifugation (1000 g)
for 10 min at 4 °C and culture supernatant was decanted and cells were gently mixed
with ice cold sterilized distilled water (200 mL). In next step, after centrifugation,
bacterial cells were collected at 4 °C for 5 minutes and supernatant was removed from
culture tubes and pellets were re-suspended in ice cold sterilized distilled water (100
mL). Afterwards, supernatant was removed and bacterial pellet was re-dissolved in ice
cold 10% glycerol (40 mL). After final centrifugation step, pellets were re-dissolved in
1000 µL ice cold glycerol (10%) by tender mixing and cell aliquots (50 µL) were stored
at -80 °C [186].
2.12.3 Transformation by Electroporation
The electro-competent cells were gradually thawed by incubating them on ice. Twenty
ng of plasmid DNA, harboring yfp gene, was added to cells and mixed properly by
gentle pipetting. Mixture was transferred to a pre-chilled electroporation cuvette (0.2
cm electrode gap) aseptically. Electroporation was performed on electroporator with
following parameters: capacitance 25 µF, voltage 12.5 KV/cm field strength and
resistance 129 Ω. Desired pulse length was 5-6 m/sec [186]. Following a short electric
impulse, the aliquot was instantly re-suspended in LB medium (1 mL) and incubated
for 2 h at 37 °C with continual shaking.
Chapter 2 General Materials and Methods
37
The suspension was plated on ampicillin containing LB plates and incubated
overnight at 37 °C. Transformants were selected under confocal laser scanning
microscope (CLSM) at 530 nm. In controls, the plasmid DNA was not added, and no
fluorescence was detected under CLSM.
Plant Inoculation Studies
2.13.1 Preparation of Bacterial Consortium
Pure colony of each bacterium was transferred to M9 media containing 1% filter
sterilized diesel (v/v) and flasks were kept for 24 h at 37 ± 2 ºC, 200 rpm. Afterwards,
bacterial cells were gathered at 6000 rpm and re-dissolved in NaCl solution (0.9%) to
have a cell density (OD) of 0.7 via UV-Visible spectrophotometer (Labomed, Inc.
USA) at wavelength set at 600 nm. Bacterial consortium was prepared by mixing equal
concentrations of respective cultures (OD600nm = 0.7) and used in further
experimentations.
2.13.2 Green House Study
Fifty kg crude oil-contaminated soil was air dried, and passed through a 2 mm mesh.
Soil was thoroughly mixed and equal amount (1.5 kg) of soil was transferred to plastic
pots. Before sowing, soil was amended with 3% of bacterial inoculum. Afterwards, ten-
day old seedlings of plants were vegetated in each pot depending upon the treatment.
The plants were grown for 90 days and given equal amount of water when needed. The
details of greenhouse experimental setup are described in chapter 3 and 4.
2.13.3 Field Experiment
Experiment was carried out in situ i.e. at an operational field of an oil exploration and
production company, Oil and Gas Development Company (OGDCL), located in district
Chakwal, (32.55 °N 72.51 °E) Pakistan. Soil contamination was due to accidental
release of oil. The plants were grown for three months (March-May, 2015).
Experimental details of field experiment are stated in chapter 5.
Analysis of Residual Crude Oil in Soil
The concentration of residual oil was estimated gravimetrically by solvent extraction
method [174, 187, 188]. Soil sample (5 g) was mixed with petroleum ether (20 mL) and
shaken vigorously for 30 min at room temperature. This mixture was separated into two
Chapter 2 General Materials and Methods
38
layers while the top layer containing oil/petroleum ether mixture was decanted in a
clean flask. The process was repeated twice to ensure the complete recovery of oil. The
extract was passed through 0.4 g anhydrous sodium sulfate (Na2SO4) to remove the
moisture and decanted into round bottom flasks leaving behind Na2SO4. Petroleum
ether was evaporated in rotary evaporator at 60 °C under reduced pressure. The %
biodegradation was determined as described in section 2.9.2.
Persistence and Survival of Inoculated Bacteria
Root, shoot, rhizosphere soil and non-rhizosphere soil were sampled at 90 days after
plant harvesting. The samples were processed as mentioned in section 2.7, and plated
on M9 medium supplemented with 1% diesel. Following incubation, individual
colonies were counted and expressed as log10 of the total number of colony forming
units (CFU/ g-1 dry soil).
Bacteria were selected on the basis of their colony appearance on M9 medium
plates amended with 1% (v/v) filter-sterilized diesel. From each treatment, fifty
colonies were indiscriminately selected and confirmed by RFLP analysis as described
in section 2.8.2.
39
3 Selection of Crude Oil Tolerant Plants and
Their Associated Bacteria
3.1 Introduction
The release of petroleum oil in soil and water, due to various human activities, is posing
serious threats to our environment. Petroleum hydrocarbons are considered very
hazardous to living organisms due to their toxicity, mutagenicity and carcinogenicity
[189, 190]. The collective use of plants and hydrocarbon-degrading microbes is a
promising strategy for the cleanup of environment polluted with petroleum
hydrocarbons [20, 191, 192]. During phytoremediation of soil polluted with
hydrocarbons, plant-associated rhizobacteria largely participate in the mineralization of
these contaminants. The proliferation and activity of pollutant-degrading rhizobacteria
are maintained through the release of root exudates. For instance plants can take up and
gather organic chemicals in their shoots, roots, and leaves, endophytes appear to be the
best candidate for their degradation in planta. Beneficial endophytic bacteria colonize
different parts of without showing any superficial signs of disease [193].
Both grasses and trees have been found to be suitable for the cleanup of crude oil
polluted soil [94, 194]. Grasses have wide-ranging root system which offers a high root
surface capacity for the toxin-degrading bacterial colonization and uptake of nutrients
[195]. Trees show fast growth and high biomass production and also enhance microbial
mineralization of organic pollutants [194]
The microbial ability to degrade hydrocarbons is mainly accredited to enzymes
for instance alkB encoded alkane monooxygenase and CYP 153 encoded by
cytochrome P450 alkane hydroxylase [196]. In addition to degrading organic
pollutants, bacteria can also improve plant growth due to their plant growth-promoting
actions, such as phosphorous solubilization, 1-amino-cyclopropane-1-carboxylic acid
(ACC) deaminase, and siderophore production and [152].
Regarding bacterial-assisted phytoremediation of hydrocarbon polluted soil, less
knowledge exists on the diversity and distribution of rhizospheric and endophytic
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
40
bacteria associated with grasses and trees and their hydrocarbon-degrading and plant
growth-stimulating activities. Therefore, the objective of the present study was to assess
whether grasses and trees growing in crude oil-contaminated soil were hosting distinct
hydrocarbon-degrading bacteria, which might affect the phytoremediation efficacy.
Moreover, plant growth stimulating and crude oil utilizing activities were checked.
3.2 Materials and Methods
3.2.1 Soil Sampling
Crude oil polluted samples of soil were collected from an oil pumping site sited in
Chakwal, Pakistan. Soil was homogenized manually by thorough mixing and sieved
with a 2 mm sieve and subsequently transferred into pots. The physico-chemical
characteristics of soil are listed in Table 3.1.
Table 3.1 Physico-chemical properties of soil collected from
crude oil-contaminated site of an oil exploration and
production company
3.2.2 Screening of Crude Oil-Tolerant Plant Species
One hundred seeds of grass/one seedling of tree of 27 different plant species (Chapter
2, Table 2.1) were sown/planted in these pots in triplicates. Seeds/seedlings were also
planted in uncontaminated agricultural soil (pH 7.2, electrical conductivity 3.9 ds m-1,
clay 28.6%, silt 19.3%, sand 52.1%, total bacterial population 6.7 × 105 cfu g-1 soil,
total N 0.033%, P 0.08% and organic matter 0.34%). The biomass of each plant species
Parameters Concentration
pH 7.4
Electrical conductivity (EC) 3.7 ds m-1
Oil content 25.6 g kg-1 soil
Total bacterial population 2.7 × 105 cfu g-1 soil
Clay 26.5%
Silt 19.7%
Sand 53.8%,
Total Nitrogen 0.02%
Available phosphorus 0.02%
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
41
vegetated in the crude oil-contaminated soil was determined and compared with that
produced in the uncontaminated soil. Grasses and trees were grown for about 3 and 6
months, respectively. The grasses have shorter life span than trees, therefore, the growth
period of grasses was shorter than trees.
3.2.3 Isolation and Characterization of Hydrocarbon-Degrading
Bacteria
The plants were uprooted carefully, the soil closely attached to roots was collected and
the shoots were cut 2 cm above the soil surface. The isolation of hydrocarbon degrading
rhizospheric and endophytic bacteria was performed on minimal medium (1% filtered-
sterilized diesel as only source of carbon) as described previously [94]. Restriction
fragment length polymorphism (RFLP) investigation was used to distinguish among all
the isolates [107]. RFLP analysis showed that 37 isolates were separated and recognized
by sequencing of 16S rRNA gene as described in Chapter 2, Section 2.8.
Nucleotide Sequence Accession Numbers
Sequences were subjected to BLAST analysis with NCBI database and submitted to
GenBank (accession numbers KF478211-KF478226, KF478228-KF478231,
KF478235-KF478236, KF478238-KF478241, KF318035-KF318040, KJ620868-
KJ620869, KJ620860, KJ620863 and KF312211).
3.2.4 Growth on Crude Oil, Alkanes and Aromatic Hydrocarbons
Strains were confirmed for their capacity to use alkanes and crude oil as only carbon
source by growing them in flasks comprising liquid minimal medium mixed with either
2% (w/v or v/v) of crude oil and n-alkanes ranging from C6-C16 and aromatic
hydrocarbons (1-decanol, naphthalene, phenolphthalein, methanol, ethanol, benzene
and toluene). The flasks were placed for one week at 37 ± 2 °C. The amount of residual
hydrocarbons/crude oil was analyzed as described earlier [175].
3.2.5 Detection of Alkane Hydroxylase Genes in Isolated Bacteria
The presence of two different alk genes (alkB and CYP 153) in hydrocarbon-degrading
bacterial strains was determined as demonstrated previously [94]. The details of primers
and PCR conditions are mentioned in Chapter 2, Section 2.10.
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
42
3.2.6 In vitro Screening of Plant Growth-Promoting (PGP) Traits
Different plant growth-promoting activities were determined using the protocols as
described earlier [152]. Briefly, solubilization of phosphate was detected by
development of clear reigon nearby bacterial colony on Pikovskaya’s agar medium.
Siderophore production was assessed on the Chrome azurol S (CAS) agar medium.
ACC deaminase capability of the isolates was confirmed on minimal medium
comprising 0.8 g ACC L-1 as single source of nitrogen. The IAA production was
checked using Salkowski reagent. The AHL production and Zn solubilzation activity
was determined by the methods explained in Chapter 2, Section 2.11.
3.3 Results
3.3.1 Screening of Crude Oil-Tolerant Plants Species
All plant species tested in the present study exhibited reduced growth and less biomass
production as compared to plants vegetated in uncontaminated soil. Among others,
Sorghum bicolor, Terminalia bellirica, Camelina sativa, Trifolium alexandrium and
Conocarpus erectus plant species showed reduced growth (83.15, 67.69, 62.60, 62.18
and 59.13%, respectively) in hydrocarbon-contaminated soil as compared to plants
vegetated in uncontaminated soil, hence were considered as more hydrocarbon-
sensitive plants. Biomass production of L. perenne, L. fusca, B. mutica, L.
leucocephala, and A. ampliceps was least affected by the crude oil-contamination as
compared to the respective plants vegetated in uncontaminated soil (Table 3.2) and
were selected for the isolation of rhizo- and endophytic bacteria.
3.3.2 Diversity of Crude Oil-Degrading Bacteria
All cultured rhizospheric and endophytic bacterial strains showed 99% sequence
similarity to known 16S rRNA genes when subjected to BLAST analysis. Thirty-seven
different hydrocarbon-degrading rhizospheric and endophytic bacteria were obtained
that can utilize crude oil as sole carbon source. On the whole, the rhizosphere soil
yielded 22 (59.45%), root interior yielded 9 (24.32%) and shoot interior yielded 6
(16.21%) hydrocarbon-degrading bacterial isolates (Table 3.3). The maximum numbers
(29.72%) of the diesel-utilizing bacteria were found to be associated with L. perenne
plant (both rhizo- and endophytes), of which Bacillus species were dominant (54.54%).
Besides Bacillus sp., some Staphylococus and Oceanimonas sp. strains were also
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
43
detected in the rhizosphere and root/shoot interior of L. perenne. Bacterial population
associated with the other plants was more limited in terms of diversity as compared to
L. perenne. Higher numbers of bacteria were isolated from the rhizosphere, root and
shoot of both B. mutica (24.32%) and L. leucocephala (21.62%) as compared to A.
ampliceps and L. fusca. On the whole, two bacterial genera i.e., Bacillus (48.64%) and
Acinetobacter (18.91%) were found dominant both in the rhizosphere as well as in
endosphere.
3.3.3 Biodegradation Studies and Amplification of alkB and CYP 153
Genes
The highest percentage of crude oil was degraded by Acinetobacter sp. strain BRSI56
followed by Acinetobacter sp. strain ACRH77, Acinetobacter sp. strain LCRH81 and
Pseudomonas aeruginosa strain BRRI54 with 78, 77, 72 and 71%, respectively (Fig.
3-1). Among all isolated bacterial strains, only Acinetobacter sp. strain LCRH81,
isolated from the rhizosphere of L. leucocephala, could utilize all tested alkanes (Table
3.4), and also possessed alkane hydroxylase (alkB and CYP 153) genes (Table 3.5).
However, 8 strains could not utilize any of the tested alkanes although they showed
growth on crude oil. They were possibly involved in the utilization of other crude oil
components such as low molecular weight alkanes and/or aromatic hydrocarbons.
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
44
Table 3.2 Biomass production of plants vegetated in crude oil-contaminated and
uncontaminated (healthy) soil
Control pots contained agricultural soil whereas treatment pots contained crude-oil contaminated soil.
n = 3; ± indicates the standard error of three replicates. Grasses and trees were harvested after 3 and 6
months, respectively.
Plant name
Biomass (dry weight, g) Oil reduction
(%) Control
(healthy soil)
Contaminated
soil
Trees
Acacia ampliceps 25.13 ± 1.64 22.74 ± 1.38 9.51
Acacia eburnea 8.9 ± 0.56 6.37 ± 0.51 28.42
Acacia nilotica 8.52 ± 0.63 3.56 ± 0.18 58.21
Azadirachta indica 22.24 ± 1.28 13.56 ± 0.62 58.21
Bambusa dolichomerithalla 4.4 ± 0.26 2.83 ± 0.35 35.68
Conocarpus erectus 2.3 ± 0.16 0.94 ± 0.17 59.13
Eucalyptus camaldulensis 30.35 ± 1.47 24.36 ± 1.28 19.73
Leucaena leucocephala 18.48 ± 1.34 16.92 ± 1.08 8.44
Moringa oleifera 1.99 ± 0. 26 1.02 ± 0.13 48.74
Pongamia pinnata L. 10.77 ± 1.02 6.28 ± 0.45 41.68
Populus nigra 30.56 ± 1.08 20.17 ± 1.16 33.99
Terminalia arjuna 21.44 ± 0.89 12.26 ± 0.74 42.81
Terminalia bellirica 4.86 ± 0.18 1.57 ± 0.15 67.69
Grasses
Axonopus fissifolius 17.92 ± 1.17 12.82 ± 0.79 28.45
Brachiaria mutica 17.40 ± 1.46 15.83 ± 1.06 9.02
Camelina sativa 6.98 ± 0.19 2.61 ± 0.15 62.60
Hordeum vulgare 1.18 ± 0.45 0.62 ± 0.09 47.41
Leptochloa fusca 15.30 ± 1.20 13.67 ± 0.94 10.65
Lolium perenne 12.40 ± 0.65 10.52 ± 0.83 15.16
Medicago sativa 1.77 ± 0.25 0.92 ± 0.10 47.45
Sorghum bicolor 7.30 ± 0.64 1.23 ± 0.26 83.15
Sporobolus indicus 10.11 ± 0.73 6.73 ± 0.58 33.43
Trifolium alexandrium 6.40 ± 0.36 2.42 ± 0.14 62.18
Edible crops
Brassica rapa 5.80 ± 0.68 3.62 ± 0.29 37.58
Glycine max 11.52 ± 0.67 7.36 ± 0.68 36.11
Helianthus annuus L. 11.14 ± 0.56 5.85 ± 0.28 47.48
Zea mays 18.45 ± 1.05 10.32 ± 0.71 44.06
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
45
Table 3.3 Bacterial strains isolated from rhizosphere (RH), root interior (RI) and
shoot interior (SI) of Brachiaria mutica (BRA), Lolium perenne (LOL),
Leptochloa fusca (LEP), Acacia ampliceps (ACA) and Leucaena leucocephala
(LEC)
IGS type Host plant Identification based on 16S
rRNA gene sequencing
Accession number/
homology (%)
ACRH76 ACA / RH Acinetobacter lwofii KF478224 / 99
ACRH77 ACA / RH Acinetobacter sp. KF478226 / 99
ACRH80 ACA / RH Acinetobacter sp. KF478228 / 99
ACRH82 ACA / RH Acinetobacter sp. KF478231 / 99
ACSI85 ACA / SI Bacillus niabensis KF478230 / 99
BRRI53 BRA / RI Bacillus amyloquefaciens KF478213 / 99
BRRI54 BRA / RI Pseudomonas aeruginosa KJ620860 / 99
BRSI56 BRA / SI Acinetobacter sp. KF318036 / 99
BRSI57 BRA / SI Bacillus cereus KF478211 / 99
BRSI58 BRA / SI Bacillus licheniformis KF478218 / 99
BRRH59 BRA / RH Bacillus megaterium KF478219 / 99
BRRH60 BRA / RH Bacillus sp. KF478225 / 99
BRRH61 BRA / RH Acinetobacter sp. KJ620863 / 99
BRRH63 BRA / RH Shinella granuli KF318040 / 99
LCRI86 LEC / RI Enterobacter cloacae KF478236 / 99
LCRI87 LEC / RI Klebsiella sp. KF478220 / 99
LCRH88 LEC / RH Bacillus sp. KF478212 / 99
LCRH90 LEC / RH Pseudomonas sp. KF478222 / 99
LCRH92 LEC / RH Pseudomonas brassicacearum KF478229 / 99
LCRH93 LEC / RH Bacillus cereus KF478221 / 99
LCRH94 LEC / RH Pseudomonas brassicacearum KF318038 / 99
LCRH81 LEC / RH Acinetobacter sp. KJ620868 / 99
LERI70 LEP / RI Bacillus endophyticus KF318037 / 99
LERI71 LEP / RI Bacillus flexus KJ620869 / 99
LERH73 LEP / RH Bacillus frimus KF478215 / 99
LERH74 LEP / RH Bacillus megaterium KF478217 / 99
LORI64 LOL / RI Bacillus cereus KF478235 / 99
LORI65 LOL / RI Bacillus megaterium KF478214 / 99
LORI66 LOL / RI Bacillus subtilis KF478216 / 99
LOSI67 LOL / SI Staphylococus vitulinus KF318035 / 99
LOSI68 LOL / SI Bacillus pumilus KF318039 / 99
LORH69 LOL / RH Oceanimonas denitrificans KF478223 / 99
LORH95 LOL / RH Bacillus cereus KF478239 / 99
LORH96 LOL / RH Bacillus firmus KF478238 / 99
LORH97 LOL / RH Bacillus cereus KF478239 / 99
LORH98 LOL / RH Oceanimonas denitrificans KF478240 / 99
LORH99 LOL / RH Oceanimonas denitrificans KF478241 / 99
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
46
Figure 3-1 In vitro crude oil degradation potential of isolated bacterial strains. Values with same letter are not
different at 5% level of significance. Comparisons between treatments were carried out by one-way analysis of
variance (ANOVA). Error bar indicates standard error among three replicates.
QR
S
AB
CD
E
A
FGH
IJK
PQ
R
OP
Q
FGH
IJK
HIJK
L LMN
CD
EFGH
BC
DEF
BC
DEF
KL
RS
FGH
IJKL
IJKL
S
GH
IJKL
JKL
DEFG
HI
RS RS
JKL
OP
Q
AB
CD
E
AB
C
B
CD
EFG
EFGH
IJ
AB
CD
CD
EFG
MN
O
CD
EFG
OP
NO
P
KL
AB
CD
0
10
20
30
40
50
60
70
80
90
Cru
de
oil
deg
rad
ati
on
(%
)
Bacterial strains
Figure 3-1 In vitro crude oil degradation potential of isolated bacterial strains.
Values with same letter are not different at 5% level of significance. Assessments among treatments
were performed by one-way analysis of variance (ANOVA). Error bar indicates standard error among
three replicates.
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
47
Table 3.4 Degradation abilities of isolated rhizospheric and endophytic bacteria using different hydrocarbons as
substrate
Continued…….
Bacterial
strains
Utilization of hydrocarbons
C8 C10 C12 C16 1-dec. Meth. Eth. Ben. Phen. Phenop. Tol. Naph.
BRRI53 - - ++ - - - - - + - + -
BRRI54 - ++ - - + + + - ++ - + -
BRSI56 + ++ - ++ ++ + + + + + + -
BRSI57 - - - - - - - - + - - -
BRSI58 - - ++ - ++ - - - - - + -
BRRH59 + - - - ++ - - - - - - -
BRRH60 - ++ - + - - - - - - - -
BRRH61 + - - ++ - + + + ++ + - ++
BRRH63 - - - - - - - + - - + -
LORI64 - + - - - + + - + - +
LORI65 + - - - - - - - + - - -
LORI66 - + - - - - - - - - +
LOSI67 + - - ++ + - - - + + - -
LOSI68 - - - - - - - - - - - -
LORH69 - ++ - ++ - - - - - - + -
LORH95 - ++ - ++ - - - - + + - -
LORH96 - - ++ - - - - - - - - -
LORH97 + - - - - - - - - - + -
LORH98 - - ++ - - - - - + - - -
LORH99 - ++ - - - - - - - - - -
Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
48
Abbreviations: C6: Hexane, C8: Octane, C10: Decane, C12: Dodecane, C16: Hexadecane, 1-dec: 1 decanol, Meth:
Methanol, Eth: Ethanol, Ben: Benzene, Phen: Phenanthrene, Phenop: Phenolphthalein, Tol: Toluene, Naph:
Naphthalene. + = good activity, ++ = very good activity, -ve = absence of characteristics
Bacterial
strains
Utilization of hydrocarbons
C8 C10 C12 C16 1-dec. Meth. Eth. Ben. Phen. Phenop. Tol. Naph.
LERI70 - - - - - - + - + + + +
LERI71 - - - - - - + - + + - -
LERH73 - - - + - - - - - + - -
LERH74 - + - - - - - - + + + -
ACRH76 - - - ++ - - - - + - + -
ACRH77 - ++ - - - - - - - - - -
ACRH80 - - - - - - - - - - - -
ACRH82 - ++ - - - - - - - - - -
ACSI85 ++ - - - - - - - + + + -
LCRI86 - + - + - - - - + + - -
LCRI87 - + ++ + - - - - - + - -
LCRH88 - - - - - - - - - - + -
LCRH90 - + - + - - - - + + - +
LCRH92 - - - - - - - - - + + -
LCRH93 + ++ - - - - - - + - - -
LCRH94 - + - - - - - - - - + -
LCRH81 + ++ + ++ - + + + ++ + + -
Chapter 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
49
Table 3.5 PCR amplification of alkane hydroxylase genes (alkB and CYP
153)
Presence of gene (+), absence of gene (-)
IGS type Bacterial strains PCR amplification
alkB CYP 153
ACRH76 Acinetobacter lwofii + +
ACRH77 Acinetobacter sp. - +
ACRH80 Acinetobacter sp. - -
ACRH82 Acinetobacter sp. + -
ACSI85 Bacillus niabensis + -
BRRI53 Bacillus amyloquefaciens + +
BRRI54 Pseudomonas aeruginosa + +
BRSI56 Acinetobacter sp. + +
BRSI57 Bacillus cereus - -
BRSI58 Bacillus licheniformis + -
BRRH59 Bacillus megaterium - +
BRRH60 Bacillus sp. + +
BRRH61 Acinetobacter sp. + +
BRRH63 Shinella granuli - -
LCRI86 Enterobacter cloacae + +
LCRI87 Klebsiella sp. - -
LCRH88 Bacillus sp. - -
LCRH90 Pseudomonas sp. - +
LCRH92 Pseudomonas brassicacearum - -
LCRH93 Bacillus cereus + -
LCRH94 Pseudomonas brassicacearum + +
LCRH81 Acinetobacter sp. + +
LERI70 Bacillus endophyticus - +
LERI71 Bacillus flexus + -
LERH73 Bacillus frimus + -
LERH74 Bacillus megaterium + -
LORI64 Bacillus cereus - +
LORI65 Bacillus megaterium + -
LORI66 Bacillus subtilis + -
LOSI67 Staphylococus vitulinus + +
LOSI68 Bacillus pumilus - +
LORH69 Oceanimonas denitrificans - -
LORH95 Bacillus cereus - +
LORH96 Bacillus firmus + +
LORH97 Bacillus cereus - +
LORH98 Oceanimonas denitrificans - -
LORH99 Oceanimonas denitrificans + +
Chapter 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
50
3.3.4 Plant Growth-Promoting Potential of Isolated Bacteria
Majority of the isolated rhizo/endophytic bacteria showed the in vitro PGP activities or
mechanisms (Fig. 3-2a-g). Most of the strains showed the ability to produce IAA and
ACC deaminase showing that these two mechanisms are more common among the
hydrocarbon-degrading bacteria. Phosphorus solubilization activity was found to be
relatively less common. One strain, Klebsiella sp. strain LCRI87, isolated from the root
of L. leucocephala exhibited multiple plant growth-promoting activities.
Chapter 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
51
Figure 3-2 Plant growth promoting-potential of some representative strains
a: P- solubilization, b: Zn-solubilization, c: Siderophore secretion, d: AHL
production, e: IAA production, f: Antifungal activity, g: ACC deaminase production.
C 1 2 3 4 5 6 7 8 9 10
Chapter 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
52
Table 3.6 In vitro plant growth-promoting potential of endophyte and rhizosphere bacterial strains
isolated from different grasses and trees
Continued….
Bacteria IAA Sider. P-solub. ACC Biocontrol Zn- solub. AHL
BRRI53 - - - + - - -
BRRI54 - ++ - - + + +
BRSI56 - - - + - + -
BRSI57 - + - - - - -
BRSI58 - - ++ - + - -
BRRH59 - + - - - - -
BRRH60 + ++ ++ - - - -
BRRH61 - - - ++ - - -
BRRH63 - - - - - - +
LORI64 - - - - - - -
LORI65 - + - - - - -
LORI66 - + ++ - - + -
LOSI67 - + ++ - - - -
LOSI68 - - - ++ - - -
LORH69 - ++ - - - - -
LORH95 - - - - - - -
LORH96 - - - + - - -
LORH97 - - - ++ + - -
Chapter 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
53
IAA: Indole 3-acetic acid production, P-solub.: Phosphate solubilization, ACC: 1-aminocyclopropane-1-
carboxylic acid (ACC) deaminase, Zn-solub.: Zinc solubilization, AHL: n-acylhomoserine lactone production
Bacteria IAA Sider P-Solub. ACC Biocontrol Zn-solub. AHL
LORH 98 - - - ++ - - -
LORH99 - - - + - - -
LERI70 - - ++ ++ - - -
LERI71 ++ + - ++ - + +
LERH73 ++ - - - + - -
LERH74 ++ + - + - - -
ACRH76 - - - - - - -
ACRH77 - - ++ - - - -
ACRH80 - - - - - - -
ACRH82 - - - - - - -
ACSI85 ++ - - - + - -
LCRI86 ++ + + + - -
LCRI87 + + ++ + + + -
LCRH88 - - - ++ - - -
LCRH90 ++ + ++ ++ - - -
LCRH92 ++ + - ++ + - -
LCRH93 ++ - - + - - -
LCRH94 ++ + - ++ - - -
LCRH81 ++ - - - - + +
Chapter 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
54
3.4 Discussion
Crude oil inhibits plant growth and biomass production due to the toxic nature of its
low molecular weight components. Often, contaminants for example petroleum
hydrocarbons modify the physical and chemical properties of the soil. Hydrophobic
nature of contaminants can alter the water/soil interactions that would normally take
place, thus potentially affecting oxygen transfer, available water uptake, and nutrient
mobility [108, 197].
We observed that grasses and trees vegetated in the crude oil contaminated soil
hosted versatile, heterogeneously distributed rhizospheric and endophytic bacteria,
which may influence the efficiency of plants to stimulate the mineralization of organic
pollutants. Regarding the application of vegetation for phytoremediation of
hydrocarbon-polluted soil, where a large number of hydrocarbon degraders is
essentially needed for the maximum degradation of pollutants, three grass species, L.
perenne, B. mutica and L. fusca and two tree species, L. leucocephala, and A. ampliceps
seem to be more appropriate than other plants investigated in this study.
It has been reported that grasses can host a large number of microorganisms
because of their fibrous root system providing a large surface area for microbial
colonization [94]. The fact that Bacillus sp. strains are frequent colonizers of the
rhizosphere of grasses and trees further shows that the members of this genus might be
dominant among hydrocarbon degrading bacterial community [198]. Root exudates and
other plant metabolites determine the potential, density and diversity of
microorganisms in the rhizosphere or endosphere [199]. Moreover, grasses are known
to release alkanes in soil, which might favor the number of hydrocarbon-utilizing
bacteria in the vicinity [200]. Only Bacillus cereus was found in the root, shoot and
rhizospheric soil of 3 different plants, showing that mostly distinct plant species host
different hydrocarbon degraders. Several reports indicated that the colonization of
diesel-utilizing microbes in the endosphere and rhizosphere depends on plant species
[94, 201]. It was important to note that in the shoot interior and rhizosphere of A.
ampliceps, 4 out of 5 strains were Acinetobacter spp., showing that strains of this
genus form tight endophytic association with A. ampliceps. A large number of bacteria
were unable to proliferate in contaminated soil, and possibly were outcompeted by the
pollutant-degrading bacteria. Moreover, it might be due to the toxicity of low molecular
Chapter 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria
55
weight alkanes and aromatic compounds present in crude oil [194]. Generally,
endophytic bacteria were different from rhizospheric bacteria and also shoot and root
possessed different hydrocarbon-degrading bacteria. The reason that a higher number
of endophytes were isolated from root than shoot supports the theory that the number
of the endophytic bacteria decreases with the expanse from their entry points such as
root tip and/or the site of the emergence of lateral roots [20]. These endophytes may
play a great role in reducing the toxicity of the hydrocarbons that are taken up by plants
[107].
Many rhizospheric and endophytic bacteria have been reported to be tolerant of
crude oil/ hydrocarbons, and some of these can even utilize them as sole carbon source
[202]. In this study, we observed that majority of bacteria were able to degrade crude
oil/ hydrocarbons (Table 3.4). Though most of the bacterial strains showed potential to
degrade hydrocarbons, only 54.05% of them showed the amplification of alkB and
CYP153 genes with the primers used in this study (Table 3.5). Most of the strains
isolated from the grasses possessed alkB and CYP153 genes, as revealed by PCR. The
occurrence of numerous alkane hydroxylases with overlying substrate series is a
common occurrence among hydrocarbon degraders [196]. Several degrading strains in
which alkane hydroxylase genes could not be identified indicated that these bacteria
might host novel alkane degradation genes.
Plant growth-promoting activities such as ACC deaminase activity plays a key
role in plant-microbe partnerships especially under stress conditions including
contaminant stress. This bacterial ACC deaminase enzyme regulates ethylene levels in
plants and consequently contributes to the production of longer roots [194]. In present
study majority of bacteria showed various PGP activities that facilitate plant growth
and improve phytoremediation efficiency. One strain Klebsiella sp. LCRI87 showed
multiple PGP traits. In most studied cases, a single strain revealed multiple modes of
action including biological control [152, 203, 204].
4 Green House Evaluation of Plant-Bacteria
Partnership for the Remediation of Crude
Oil-Contaminated Soil
4.1 Introduction
The insatiable reliance of the progressing world on oil and petrochemicals has increased
during the past few decades that has resulted in extensive release of hydrocarbon
pollutants in the environment. The adverse ecological and socioeconomic effects of oil
pollution demand that eco-friendly and proficient remediation technologies be devised
as countermeasures. The synergistic use of plants and endophytes has gained
acknowledgment as one of these efficient green technologies [25, 205, 206]. Plants
provide a niche and essential nutrients for habitation and survival of endophytes while
endophytic bacteria improve plant growth directly by producing beneficial metabolites
or indirectly by reducing the amount of pollutants [80, 207].
The association of inoculated bacteria with the host plant can occur in multiple
ways, one of which is the biofilm formation, which is an important mode of microbial
colonization in certain environments, ultimately affecting overall functioning of
microbes [66, 208, 209]. The presence of oil-degrading microorganisms in biofilm
enhances the degradation of toxic hydrocarbon pollutants [210-212]. In addition,
colonization, survival, and activity of inoculated oil-degrading bacterial strains in
rhizosphere and endosphere of host plants are crucial for sustainable growth of the host
and mitigation of recalcitrant hydrocarbon contaminants in its vicinity [20, 132, 213].
The plant hosts employed in this investigation are grasses, B. mutica and L.
fusca, that are well-known for salt tolerance, thus are used for the rehabilitation of saline
soil [80, 214]. However, the potential of B. mutica and L. fusca for remediation of crude
oil-contaminated soil has been rarely evaluated in association with endophytes.
Although several studies showed that plant species affect the community structure in
rhizosphere and endosphere, information on the effect that plants species may incur on
biofilm formation, colonization, and metabolic activity of the inoculated endophytic
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
57
bacteria is scarce in scientific literature. Therefore, this study evaluates the effect of
plant species on colonization pattern and metabolic activity of the inoculated
endophytes during the phytoremediation of crude oil-contaminated soil. Occurrence of
inoculated endophytes as biofilm in various compartments (rhizoplane, root, and shoot)
of the plants was studied by confocal laser scanning microscope (CLSM). The
persistence and metabolic activity of the inoculated endophytic bacteria in rhizosphere
and endosphere were evaluated by culture-dependent and -independent approaches.
4.2 Materials and Methods
4.2.1 Bacterial Strains
Bacteria used in present work were selected from a wide collection of hydrocarbon-
utilizing bacteria previously isolated (Table 3.3) from plants vegetated in crude oil-
contaminated soil. The strains included Pseudomonas aeruginosa BRRI54 (isolated
from the root of B. mutica) and Acinetobacter sp. strain BRSI56 (isolated from the shoot
of B. mutica). Both strains were able to degrade a variety of straight chain alkanes as
well as aromatic compounds and showed the presence of alkane hydroxylase gene
(alkB). These strains were also positive for plant growth promoting traits e.g.,
siderophore production, and 1-aminocyclopropane-1-carboxylate (ACC) deaminase/
AHL activity, and Zn-solubilization.
4.2.2 Tagging of Bacterial Strains with Yellow Fluorescent Protein
(YFP) and Formulation of Bacterial Consortium
To monitor the colonization patterns, both strains were tagged with yfp gene as
described earlier [215, 216]. These labelled strains were used as inoculum in the form
of consortium AP (Pseudomonas aeruginosa BRRI54 and Acinetobacter sp. BRSI56),
which was prepared by mixing equal portions of pure bacterial cultures (≈108 cells/mL).
4.2.3 In vitro Biofilm Formation
BRRI54-yfp and BRSI56-yfp were first tested for biofilm formation on 22 mm thin
cover slips immersed in 50 mL sterile culture tubes containing 15 mL minimal medium
(M9) with 1% crude oil or glucose [211]. The bacterial strains were inoculated and
incubated for 4 days at 37 °C. The cover slips were removed from the culture tubes
carefully, washed thoroughly with 1X phosphate buffer saline (PBS) solution
aseptically and air-dried [69]. Formation of biofilm was viewed under 100X oil
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
58
immersion objective lens using CLSM (Fluo view, FV 1000, Olympus). The samples
were excited at 514 nm using argon single laser.
4.2.4 Experimental Setup
Crude oil-contaminated soil (crude oil 25.6 g kg-1 soil) was collected from oil pumping
site located in Chakwal, Pakistan. Soil was sieved through stainless 2 mm screen and
thoroughly mixed. Equal amount (1.5 kg) of soil was transferred into 7 × 3 pots, for
seven treatments to be performed in triplicates. Before sowing, the soil was amended
with 50 mL AP consortium (≈ 108 cfu/mL).
This ex-situ experiment was designed to study: 1) the effect of oil contamination
on plant growth; 2) the effect of vegetation on oil degradation; 3) the effect of bacterial
augmentation on oil degradation; 4) the effect of plant species on colonization pattern
and activity of the inoculated bacterial strains; 5) the effect of colonization pattern and
activity on plant growth and oil degradation.
Table 4.1 Experimental design of green house experiment
Thirty cuttings of L. fusca or B. mutica with similar weight and size were
vegetated in each pot depending upon the treatment. The plants were grown in green
house and given equal amounts of water when needed. Plants were harvested after 3
months of planting and data on growth parameters was recorded. Rhizosphere soil was
obtained by sampling the soil loosely attached to roots while bulk soil (non-
rhizospheric soil) was collected by thoroughly mixing the rest of the soil in pot. Root
Sr. No. Treatments Experimental Design
1 Treatment-1 Agricultural (uncontaminated) soil with vegetation
2 Treatment-2 Crude oil-contaminated soil without vegetation
3 Treatment-3 Crude oil-contaminated soil with AP augmentation
4 Treatment-4 Crude oil-contaminated soil with L. fusca vegetation
5 Treatment-5 Crude oil-contaminated soil with L. fusca vegetation
and AP inoculation
6 Treatment-6 Crude oil-contaminated soil with B. mutica vegetation
7 Treatment-7 Crude oil-contaminated soil with B. mutica vegetation
and AP inoculation
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
59
and shoot length and dry weight were recorded. Samples were than stored at -80 °C
until further analysis. The colonization pattern of inoculated bacteria was also
determined in the rhizosphere and endosphere of the plants using CLSM as described
earlier [66].
4.2.5 Analysis of Crude Oil Residues in Soil and Biostimulant
Efficiency
After plant harvesting, the level of residual crude oil in the soil samples was determined
gravimetrically as described previously [217-219] and biostimulant efficiency (BE%)
was calculated as reported earlier [220].
4.2.6 Persistence of the Inoculated Endophytes
The abundance of inoculated strains in rhizosphere soil, shoot, and root interior of L.
fusca and B. mutica was checked by plate count method [45].
4.2.7 Quantification of Abundance and Expression of alkB Gene
The abundance and expression of catabolic genes encoding alkane hydroxylase (alkB)
were estimated by real-time PCR as explained earlier [46, 118, 150].
4.3 Results
4.3.1 In vitro Attachment and Colonization of Bacteria on Solid
Substratum
The ability of bacterial strains BRRI54-yfp and BRSI56-yfp to attach and colonize to
solid substrate (glass) in the presence of crude oil and glucose (1%) was studied by
biofilm formation. The biofilm formation was observed under CLSM (Fig. 4-1 & 4-2).
The initial occurrence of bacterial attachment occurred in the initial 24 h of
development (Fig. 4-3a). Bacterial cells consequently gathered on the solid slip and
after 48 h of growth, bacteria were surfaced in the form of groups near oil-water
interface (Fig. 4-3b). As the cells grew, the bacteria utilized the oil as energy source
and oil contents reduced with time. After 72 and 96 h of incubation (Figs. 4-3c & d),
bacterial cells were fully grown-up and more gathered to form a precise biofilm with
very few oil droplets visible on the surface of glass. Biofilm formation of strain
Acinetobacter sp. BRSI56-yfp was more obvious as compared to that of BRRI54-yfp
strain under these experimental conditions (Fig 4-4a & b).
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
60
Figure 4-1 Attachment of Acinetobacter sp. strain BRSI56-yfp on thin
cover slip (22 mm)
12 h (a) and 96 h (b) of growth in minimal medium amended with glucose
as sole energy source (magnification = 100X).
Figure 4-2 Attachment of Pseudomonas aeruginosa strain BRRI54-yfp
on thin cover slip (22 mm)
12 h (a) and 96 h (b) of growth in minimal medium amended with glucose as
sole energy source (magnification = 100X).
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
61
Figure 4-3 Biofilm formation on thin cover slip (22 mm) by Acinetobacter sp.
strain BRSI56-yfp
24 h (a), 48 h (b), 72 h (c), and 96 h (d) of growth in minimal medium amended
with 1% crude oil as sole energy source (magnification = 100X).
a
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
62
Figure 4-4 Biofilm formation on thin cover slip
(22 mm) by Pseudomonas aeruginosa strain
BRRI54-yfp
12 h (a) and 96 h (b) of growth in minimal medium
amended with 1% crude oil as sole energy source
(magnification = 100X).
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
63
4.3.2 Colonization and Distribution of Endophytes within Host Plants
Observations under CLSM confirmed that the inoculated bacteria were efficient plant
colonizers indicating their capacity to inhabit host plants (L. fusca and B. mutica) (Figs.
4-5 & 4-6). Bacteria first colonized the rhizoplane followed by establishment of
aggregates/biofilms on the entire root surface which indicated the possible entry of
these bacteria into roots through these points (Fig. 4-5a). Following rhizoplane
colonization, strains entered the roots and after translocation localized as single cell in
the stems and leaves of the host plants (Figs. 4-5b & c). Maximum colonization of
inoculated bacteria was observed in rhizoplane and inside the root as compared to the
aerial tissues of the plant. No fluorescence was detected in uninoculated (control) plants
(Fig. 4-5d to f).
4.3.3 Plant Growth Responses to Bacterial Inoculation
Growth parameters (root and shoot length, root dry weight, and stem dry mass) were
detected to assess the influence of inoculation of bacteria on plant (Fig. 4-7a & b). In
soil contaminated with crude oil, endophytes inoculation improved root length (21-
26%), shoot length (11-18%), root dry weight (25-38%), and shoot dry weight (11-
18%) of both L. fusca and B. mutica. Among the two types of endophytes inoculated
plants, B. mutica showed more increase in root length (19%), shoot length (39%), root
dry weight (34%) and shoot dry weight (38%) than L. fusca plants. However, oil-
contamination in uninoculated soil significantly reduced root length (32-40%), shoot
length (29-32%), root dry weight (37-46%), and shoot dry weight (26-36%). Of the two
grasses, B. mutica plants were least affected under crude oil-contamination than L. fusca
plants.
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
64
Figure 4-5 Colonization of yfp-tagged Pseudomonas aeruginosa BRRI54
and Acinetobacter sp. BRSI56 on the rhizoplane (a), root cortical cells (b),
and leaf mesophyll cells (c) of Brachiaria mutica
The root samples of non-inoculated plants of B. mutica (d & e), and leaf (f) do
not show any colonization. Arrow indicates the presence of bacteria. The tissue
was observed (magnification = 100X) under CLSM.
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
65
Figure 4-6 Colonization of yfp-tagged Pseudomonas aeruginosa BRRI54 and
Acinetobacter sp. BRSI56 inside the roots of L. fusca (a)
No bacterial colonization was observed inside stem and leaf of inoculated plant.
The root samples of non-inoculated plants of L. fusca (d & e), and leaf (f) do not
show any colonization. Arrow indicates the presence of bacteria. The tissue was
observed (magnification = 100X) under CLSM.
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
66
c
a
b
a
e
cd
d
cd
d
b
cdc
0
20
40
60
80
100
L. fusca B. mutica L. fusca B. mutica
Root length Shoot length
Root
an
d s
hoot
len
gth
(cm
)
Uncontaminated (healthy) soil
Crude oil-contaminated soil
Crude oil-contaminated soil with bacteria
b
a
ab
a
d d
c c
c c
bb
0
10
20
30
40
50
L. fusca B. mutica L. fusca B. mutica
Root biomass Shoot biomass
Pla
nt
bio
mass
(g)
Uncontaminated (healthy) soil
Crude oil-contaminated soil
Crude oil-contaminated soil with bacteria
a
b
Figure 4-7 Growth responses including root and shoot length
(a), fresh and dry weight (b) of L. fusca and B. mutica,
vegetated in crude oil contaminated soil with and without
bacterial augmentation
Values with same letter are not different at 5% level of
significance. Evaluations amongst treatments were done by
analysis of variance (ANOVA). Error bar indicates standard error
among three replicates.
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
67
4.3.4 Effect of Plant Species on Crude Oil Degradation
B. mutica exhibited 9% more crude oil degradation than L. fusca while synergistic
action of B. mutica and endophytes exhibited maximum (78%) crude oil-degradation.
Maximum crude oil-degradation (71-78%) was observed in treatments having plants
inoculated with endophytes; it was significantly higher than what was observed for
plants and bacteria individually (Fig. 4-8). Vegetated soil exhibited more crude oil
degradation (60-66%) than unvegetated soil, whereas the augmentation of unvegetated
soil with endophytes consortium resulted in 52% crude oil degradation. On the other
hand, least degradation (40%) of crude oil was detected in the control soil that was
uninoculated and unvegetated.
The biostimulants efficiency (BE) analysis showed that the highest BE value
(95%) was observed with B. mutica inoculated with AP consortium while the lowest
BE value (30%) was observed in the unvegetated soil inoculated with hydrocarbon-
degrading consortium (Fig. 4-9).
4.3.5 Effect of Plant Species on Persistence and Metabolic Activity of
Inoculated Endophytes
The ability of inoculated endophytes to colonize unvegetated soil as well as the
rhizosphere and endosphere of B. mutica and L. fusca was estimated. Among the two
types of grasses in this investigation, B. mutica hosted more numbers of the inoculated
bacteria than L. fusca: both in the rhizosphere and endosphere (Table 4.2). Furthermore,
bacterial cell count in the roots of both grasses was significantly greater as compared
to those in rhizosphere and shoots. However, relatively lower numbers of the inoculated
endophytes were recovered from unvegetated soil than the rhizosphere soil.
Likewise, rhizosphere and endosphere of B. mutica showed higher levels of
alkB gene and its expression than that of L. fusca. Maximum alkB gene abundance and
expression were observed within the root tissue of B. mutica; which was significantly
higher than expression and abundance of specific gene and in the rhizosphere and shoot
interior (Table 4.2). Moreover, the inoculated AP consortium showed greater intensities
of alkB gene was detected in the rhizo- and endosphere of the plants where bacteria
were added than in the unvegetated soil.
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
68
e
dc
bbc
a
0
20
40
60
80
100
Control Bacteria L. fusca L. fusca with
bacteria
B. mutica B. mutica with
bacteria
Cru
de
oil
deg
rad
ati
on
(%
)
Treatments
f
e
d
b
c
a
0
20
40
60
80
100
Control Bacteria L. fusca L. fusca with
bacteria
B. mutica B. mutica with
bacteria
Bio
stim
ula
nt
effi
cien
cy (
%)
Treatments
Figure 4-8 Effect of bacterial consortia AP (Acinetobacter sp. strain
BRSI56 and Pseudomonas aeruginosa strain BRRI54) inoculation on
crude oil degradation after 93 days of vegetation
Values with same letter are not significantly different at 5% level of
significance. Error bar indicates standard error among three replicates. One-
way analysis of variance (ANOVA) was used to differentiate between
different treatments
Figure 4-9 Biostimulant efficiency (%) of treated soil samples
collected after 93 days of bioremediation process
Values with same letter are not significantly different at 5% level of
significance
Error bar indicates standard error among three replicates. Comparisons
between treatments were carried out by one-way analysis of variance
(ANOVA).
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
69
Table 4.2 Colony forming unit (CFU), abundance and expression of alkB
in the bulk soil, rhizosphere soil and endosphere of Leptochloa fusca and
Brachiaria mutica inoculated with bacterial consortium
Average values in the similar column trailed by the similar letter are not significantly dissimilar at 5%
significance level. In parentheses, the standard error of triplicates are mentioned. One-way analysis of
variance (ANOVA) was used to compare between treatments.
4.4 Discussion
Due to rapid industrialization and increasing anthropogenic activities, contamination of
soil and groundwater with hydrocarbons poses a greater threat not only to microflora
but also to human and animals [109, 221]. Microbial biofilms are highly efficient and
successful ecological communities that may contribute in remediation of oil-
contaminated soils [66, 222, 223]. In this study, we have evaluated the ex-situ potential
of specifically-designed bacterial consortium AP (two endophytes) in association with
two grass species for the restoration of crude oil-polluted environment. CLSM analysis
indicated that the inoculated endophytes were able to form biofilm on solid substratum;
the capability appeared to be maximum in the close proximity of oil-water interface
(Fig. 4-3 & 4-4). Several earlier studies have demonstrated that natural oil degrading
bacteria can accumulate in the vicinity of oil and other pollutants and efficiently evade
the limitation of low bioavailability of hydrocarbons in remediation process [224].
Successful root colonization by hydrocarbon-degrading bacteria is an essential
criterion to ensure beneficial effects of endophytes on phytoremdiation process [22,
Treatments CFU
(g-1 dry weight × 103)
Gene abundance
(copies g-1 dry weight × 103)
Gene expression
(copies g-1 dry weight × 103)
Soil (Bulk) 12g (1.5) 0.79g (0.27) 0.31f (0.11)
Rhizosphere
Brachiaria mutica 910b (24) 23.6b (0.40) 2.1c (0.34)
Leptochloa fusca 327f (14) 10.8d (0.16) 1.4d (0.18)
Root
Brachiaria mutica 1272a (54) 91.8a (1.46) 7.4a (0.15)
Leptochloa fusca 523d (21) 12.3c (1.05) 2.9b (0.37)
Shoot
Brachiaria mutica 656c (34) 6.3e (0.64) 1.5d (0.34)
Leptochloa fusca 460e (10) 4.5f (0.50) 1.0e (0.16)
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
70
213, 225]. In this study, bacterial cells were visualized as single cell as well as
aggregated colonies on the rhizoplane that later on colonized the interior of the root and
stem cells (Fig. 4-5 & 4-6). Earlier reports corroborate this translocation of bacteria by
indicating that endophytic bacteria are able to translocate through the xylem vessels
from roots to aerial parts of the host plant via transpiration flow or by colonizing
intercellular spaces [150, 151, 226, 227].
In phytoremediation, the foremost issue is development of plant tissue, which
reflects the adaptation of plants to various stresses. In this study, the presence of crude
oil in soil repressed plant development and development. This can be accredited to the
lethal fractions of the crude oil [228, 229]. However, AP augmentation enhanced shoot
and root dimension and tissue development of both grass species (L. fusca and B.
mutica). It might be because of the oil degrading and ACC deaminase action of the
injected endophytes. This activity of microbes lowers the ethylene level in plants during
stress conditions, such as crude oil-contamination in soil, thus improving plant's
adaptation and growth [25, 230, 231].
Uninoculated and unvegetated soil showed lower reduction (40%) of crude oil
(Fig. 4-8) as compared to inoculated and vegetated soil. This degradation of crude oil
is performed by native microbes and/or natural physicochemical processes (e.g.,
volatilization or photo-oxidation) [213, 232]. The augmentation of AP consortium in
the unvegetated soil resulted in 52% reduction in oil concentration. Several earlier
studies demonstrated the same trend, whereby augmentation of hydrocarbon polluted
soil with hydrocarbon-degrading bacteria lead to decline in the contaminant
concentrations [233]. Moreover, vegetation enhanced the mineralization of
hydrocarbons up to 60-66%. Instead of using either plant or bacteria alone, their
bipartite association i.e. augmentation of plants with bacterial inoculation is superior
strategy in the degradation process. Plants provide nutrients to indigenous microbial
population hence improving their capability to degrade organic pollutants [20, 234].
The augmentation of AP consortium in combination with L. fusca and B. mutica
resulted in 71 and 78% of crude oil degradation, respectively, and this degradation was
significantly higher than either sole bacterial augmentation or vegetation. Maximum
(78%) crude oil-degradation was exhibited by B. mutica and the AP consortium. These
results are in agreement with earlier reports that plant-endophyte association is a more
Chapter 4 Green House Evalaution of Plant-Bacteria Partnership
71
effective methodology for the clean-up of soil polluted with petroleum hydrocarbons
than vegetation or microbial augmentation alone [21, 118, 192, 234]
Different plants host different microorganisms in their rhizosphere and
endosphere, but little is known about the colonization patterns and metabolic activities
of the inoculated bacteria in the endosphere and rhizosphere of host plants. Inoculated
bacteria showed not only colonization but also expressed alkane-degrading genes
demonstrating their dynamic character in the mineralization of crude oil (Table 4-2).
Contrary to the high abundance and activity of the endophytes in vegetated soil, rather
less persistence and activity were seen in unvegetated soil. This reveals that vegetation
improved the persistence and activity of the endophytes in the soil. Vegetation offers
nutrients and habitat to associated microorganisms and ultimately the numbers of
pollutant-degrading microorganisms increases in the vicinity of the root as well as the
plant interior [19, 118].
Furthermore, among the two tested plants, higher persistence of inoculated
endophytes and better expression and abundance of gene (alkB) were observed in the
rhizo- and inerior of B. mutica as compared to L. fusca. This shows that diverse plants
host variety of microbes in their rhizosphere and aerial tissues and also stimulate their
activity differently. It might be the reason that dissimilar plants release a variety of
nutrients in different amounts in their rhizosphere and endosphere and subsequently
stimulate a variety of microorganisms in their components [22, 25, 234].
Moreover, maximum concentration of alkB gene and its expression were
witnessed in the roots of both plants as compared to the rhizosphere soil and shoot
interior. Previous studies corroborate that inoculated endophytes exhibit better
persistence and activity inside root as compared to rhizosphere soil or shoot interior
[46, 118, 234]. In our investigation, the presence of alkB exhibited positive
relationships with expression of gene (r = 0.74) and hydrocarbon removal (r = 0.87).
During the phytoremediation of hydrocarbon-contaminated soil, positive relationships
have been formerly described between hydrocarbon-degradation, gene abundance, and
gene expression [20, 234]. This represents that the occurrence and activity of catabolic
genes is directly associated with hydrocarbon degradation.
5 Bacterial Assisted Phytoremediation of Soil
Contaminated with Crude Oil in an Oil
Field
5.1 Introduction
The presence of petroleum hydrocarbons in soil and water is of worldwide concern due
to their high carcinogenic, mutagenic, and deleterious effects on environment and
human health [195, 213, 235]. Phytoremediation, established on the synergistic
activities of plants and their related microorganisms, has been acknowledged as a
powerful method for the restoration of sites contaminated with hydrocarbons [19, 234,
236, 237]. In phytoremdiation, vegetation offers nutrients and habitation; while in
return, the bacteria improve plant health and pollutant tolerance [20, 24, 48, 238].
A crucial constituent of effective phytoremediation of soil contaminated with
organic compounds is the usage of vegetation capable to grow in the extraordinary
concentrations of pollutants, in grouping with favorable plant associated rhizospheric
and endophytic bacteria proficient in degrading organic pollutants [239-241].
Rhizospheric bacteria inhabit the close locality of roots while endophytic bacteria found
in in the root and shoot. It has been presented that plants vegetated in hydrocarbon-
polluted soil can selectively enrich the occurrence of favorable endophytic bacteria
containing enzymes encoding genes liable for hydrocarbon degradation [242, 243].
Endophytes possessing contaminant degradation genes and metabolic actions can
reduce equally evapotranspiration and toxicity of unstable hydrocarbons [118, 234,
242-244]. Furthermore, the use of endophytes keeping plant growth-stimulating events
may improve the plant’s endurance and development in contaminated environment. As
endophytes reside in the plant they can intermingle with their host plant than
rhizobacteria [118, 234]. Quantitative examination of contaminat-degrading genes in
rhizo- and plant’s endosphere provides a valuable means for reviewing the correlation
between a particular bacterial community and the degradation proces [141].
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
73
Different plants, Lolium multiflorum, Medicago sativa, Lotus corniculatus,
Cynodon dactylon, Bidens cernua, and Zea mays, have been used to remediate
hydrocarbon-contaminated soil [20]. However, grasses, Brachiaria mutica (Forsk.)
Stapf and Leptochloa fusca (L.) Kunth, have not been estimated for the remediation of
crude oil-polluted soil to date. Furthermore, the potential of combined application of
grasses, L. fusca and B. mutica, and endophytic bacteria has not been assessed for the
remediation of crude oil mixed soil. Thus, the purpose of this study was to evaluate the
effect of inoculation of endophytes on the phytoremediation of crude oil-polluted
topsoil in the surrounding area of oil exploration and production company.
Hydrocarbon degradation and toxicity reduction were observed alongside with
quantitative investigation of functional gene, alkB, which is an important gene in crude
oil degradation.
5.2 Materials and Methods
5.2.1 Site Description
The experiment was performed at an oil production and exploration company situated
in Chakwal district (32.55°N 72.51°E). Contamination of the location was a result of
accidental spill of crude oil (Fig. 5-1). The soil was polluted with high concentration of
crude oil (46.8 g kg-1 soil) and other characteristics are given in Table 5.1.
Figure 5-1 Crude oil-contaminated soil in the vicinity of an oil
exploration and production company before start of the experiment
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
74
Table 5.1 Physico-chemical properties of soil from crude oil
contaminated site of an oil exploration and production company
where experiment was conducted
Every number is the mean of triplicates, the standard error of triplicates is
mentioned in parentheses. *Oil contents were determined before drying the soil.
All analysis data is presented on a dry weight basis unless otherwise stated.
5.2.2 Bacterial Strains
Three endophytic bacterial strains, previously isolated from the endosphere of B. mutica
and L. fusca, were used in this study (Table 3.3). These included Pseudomonas
aeruginosa BRRI54 (isolated from the root of B. mutica), Acinetobacter sp. strain
BRSI56 (isolated from the shoot of B. mutica) and Klebsiella sp. strain LCRI87
(isolated from the root of L. leucocephala). These strains possessed alkane hydroxylase
(alkB) gene. They were grown independently at 37 °C in LB liquid medium
accompanied with 1% raw oil for adaptation. Bacterial cells were collected by
centrifugation at 8,000 × g and re-collected at equal amounts in sterilized 0.9% normal
saline. The quantity of each pure bacterial mixture was determined by a turbidimetric
technique [245] before adding them to the mixture.
Parameters Concentrations
pH 7.4 (0.14)
Electrical conductivity 3.7 (0.12) ds m-1
Oil contents* 46.8 (1.6) g kg-1 soil
Total carbon 50.2 (2.5) g kg-1 soil
Total nitrogen 2.3 (0.04) g kg-1 soil
Available phosphorus 0.2 (0.02) mg kg-1 soil
Available nitrogen 0.2 (0.02) g kg-1 soil
Potassium 0.1 (0.01) g kg-1 soil
Sodium 1.2 (0.06) g kg-1 soil
Clay 26.5%
Silt 19.7%
Sand 53.8%
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
75
5.2.3 L. fusca and B. mutica
L. fusca can be easily proliferated through stem cutting, seed, rhizomes, or root stumps.
The grass can propagate to a pinnacle of 1-1.5 meters with a great leaf production
percentage. The grass cultivates healthy for the period of March to September with
greatest production during rainy season. The expansion of widespread and thick fibrous
root system has been witnessed. The diffusion of roots in soil can improve organic
matter, hydraulic conductivity, and microbial activity, and [246].
B. mutica is a land-dwelling plant selected from among those that are able to
endure and propagate in the harsh climatic conditions of Pakistan. It is a perennial grass
with long, coarse stolons up to 5 m. Its reproduces generally by vegetative methods.
This fast-growing plant has been used extensively around the globe for restoration of
contaminated soils [247].
5.2.4 Experimental Design
The experimental area was separated into seven plots and further sectioned into three
equal subplots/macrocosms (length = 3 ft., width = 3 ft., height = 1 ft.). Neighboring
plots were divided with polyethylene sheeting/soil to circumvent leaching. Soil (100
kg) was added in each macrocosm equally. The experiment was conducted at ambient
conditions of temperature (average temperature 23, 27 and 32 °C in April, May, and
June, respectively). Plots were covered with plastic sheet in the case of rain.The
experiment was conducted in triplicate with Completely Randomized Design (CRD) in
each.
Seven different treatments were designed to observe 1) the effect of crude oil
contamination on plant health; 2) the influence of vegetation on degradation of crude
oil; 3) the effect of bacterial augmentation on crude oil degradation; and 4) the effect
of bacterial augmentation on crude oil degradation and plant growth.
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
76
a b
a
c
Figure 5-2 Experimental setup for endophyte-assisted phytoremediation of
crude oil contaminated soil in the vicinity of an oil exploration and
production company.
Vegetation of Leptochloa fusca and Brachiaria mutica (a), inoculation of endophytes
(Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp. strain BRSI56, and
Klebsiella sp. LCRI87) (b), and growth of the plants after 90 days of vegetation (c).
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
77
Fifteen days old seedlings (100) of these two grass species with similar weight
and size were planted in each macrocosm depending upon the treatment (Fig 5-2).
Immediately after planting the seedlings, approximately 500 ml of 24 h aged inocula
(5.3×108 CFU ml-1) was applied in each macrocosm by spraying. The plants were
watered when needed and allowed to grow for 3 months (10th March-10th June, 2015).
Subsequently, plants were collected and samples of shoot and root were collected. Plant
biomass was detected. After harvesting, the soil of each macrocosm was collected and
thoroughly mixed as bulk non-rhizospheric soil. Rhizosphere soil was attained by
gentle collection of the soil loosely present on roots. Samples were taken to laboratory
and put in storage at -80 °C till further analysis.
Table 5.2 Experimental design of field experiment
5.2.5 Quantification of Inoculated Strains
The survival of inoculated strains in the non-rhizosphere soil, rhizosphere soil, root and
shoot samples was determined as mentioned in Chapter 2, Section 2.15.
5.2.6 Quantification of Abundance and Expression of alkB Gene
Rhizosphere soil was used for the extraction of DNA with the help of FastDNA Spin
Kit for soil (Qbiogene), however FastRNA Pro Soil-Direct Kit (MP Biochemicals) was
used for the isolation of RNA, and were measured photometrically (Nanodrop ND-
Sr. No. Treatments Experimental design
1 Treatment-1 Agricultural (uncontaminated) soil with vegetation
2 Treatment-2 Crude oil-contaminated soil without vegetation
3 Treatment-3 Crude oil-contaminated soil with endophytes
4 Treatment-4 Crude oil-contaminated soil with L. fusca vegetation
5 Treatment-5 Crude oil-contaminated soil with L. fusca vegetation
and endophytes
6 Treatment-6 Crude oil-contaminated soil with B. mutica vegetation
7 Treatment-7 Crude oil-contaminated soil with B. mutica vegetation
and endophytes
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
78
1000, Nanodrop Technologies, Wilmington, DE, USA). Plant DNA and RNA were
isolated using the DNeasy Plant Mini Kit and RNeasy Plant Mini Kit (Qiagen),
respectively. Reverse transcription was accomplished with RNA (10-20 ng), the
specific primer alkB-3f and Superscript II Reverse Transcriptase (Invitrogen). Gene’s
(alkB) persistence and expression of gene was calculated by real-time PCR using an
iCycler IQ (Bio-Rad). Standards for qPCR were generated as designated in Chapter 2,
Section 2.10.2.
5.2.7 Crude Oil Analysis in Soil
Soil samples were assessed gravimetrically to determine the remaining crude oil. The
details of method are mentioned in Chapter 2, Section 2.14.
5.2.8 Seed Germination Bioassay for Toxicity Evaluation
Seed germination bioassay was performed with wheat (Triticum aestivum L.), to assess
the toxicity of soil under different treatments. Wheat was selected for this bioassay
because of its agriculture importance and chemical sensitivity. The agricultural
uncontaminated (control) and treated soil (300 g) was put in 180 mm diameter petri
plates and 20 seeds of wheat were placed with equal distance. Seeds were exposed to
12 h light/dark cycles at room temperature (varied from 23 to 25 °C). Soil was kept
moist (50% water holding capacity) by spraying the soil surface with sterilized water.
Seed germination, and root and shoot length were measured after 72 h. The germination
index (GI%) was calculated using below mentioned ormula:
GI% =Gs×Ls
Gc×Lc× 100 … … …(5-1)
Where Gs and Gc are numbers of germinated seeds in the treated and control
(uncontaminated agricultural) soil, separately, and Ls and Lc are the average of root
length in the treated and control soil, respectively [248, 249].
5.2.9 Statistical Analysis
Statistix Version 8.1 (Statistix, Tallahasee, Florida, USA) was used for investigating
the root and shoot length, and plant biomass data. The data (triplicates of each
treatment) was exposed to Analysis of Variance (ANOVA) and post-hoc Tukey test for
multiple comparisons.
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
79
5.3 Results
5.3.1 Effect of Crude Oil-Contamination and Endophytes Inoculation
on Plant Growth
Growth measurements (root/shoot height, and root and shoot biomass) were estimated
to assess the influence of hydrocarbon pollution and bacterial application on vegetation
(Fig. 5-3a & b). Oil contamination in soil significantly (p < 0.05) reduced root length
(37-46%), shoot length (30-34%), root dry weight (35-39%), and shoot dry weight (37-
39%) than the plants grown in uncontaminated soil. Between the two grasses, crude oil-
contamination inhibited more root and shoot growth (dry weight and length) of L. fusca
than B. mutica. However, endophytes augmentation improved root length (33-39%),
shoot length (18-27%), root dry weight (28-34%), and shoot dry weight (29-31%) of
both grasses. Endophytes augmentation exhibited more increase in root height (6%),
shoot height (9%), root dry mass (6%) and stem dry mass (2%) of B. mutica than L.
fusca.
5.3.2 Hydrocarbon Degradation
The initial crude oil concentration in the soil was 46.8 ± 1.6 g oil kg-1 soil. Very minor
reduction (12%) of crude oil was detected in the control soil (unvegetated and without
endophytes augmentation) (Fig. 5-4). The augmentation of unvegetated soil with
endophytes exhibited 40% crude oil degradation. Only vegetation reduced crude oil
concentration in the soil from 51 to 61%, it was significantly (p < 0.05) higher when
compared to the sole use of bacterial augmentation. B. mutica exhibited more (10%)
crude oil degradation than L. fusca. Maximum crude oil degradation (78-85%) was
observed by the plants inoculated with endophytes; it was significantly higher than what
was observed for plants and bacteria individually. The combined use of B. mutica and
endophytes exhibited 7% more crude oil degradation than the combined use of L. fusca
and endophytes. A positive correlation (r = 0.71) was observed between bacterial
colonization and crude oil removal.
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
80
Figure 5-3 Effect of crude oil contamination and endophytes
(Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp.
strain BRSI56, and Klebsiella sp. LCRI87) inoculation on root
and shoot length (a) and fresh and dry weight (b) of L. fusca
and B. mutica.
Values with same letters (a, b, c, d, e, f, g, h) are not significantly
different at a 5% level of significance. Treatment comparisons were
performed by one-way analysis of variance (ANOVA). Error bars
indicate standard error of three replicates.
c
a
c
a
f
d
f
d
e
b
e
b
0
20
40
60
80
100
L. fusca B. mutica L. fusca B. mutica
Root length Shoot length
Ro
ot
an
d s
ho
ot
len
gth
(cm
)
Uncontaminated (healthy) soil
Crude oil-contaminated soil
Crude oil-contaminated soil with bacteria
d
a
b
a
f
c
d
c
e
b
c
b
0
10
20
30
40
50
L. fusca B. mutica L. fusca B. mutica
Root biomass Shoot biomass
Pla
nt
bio
mass
(k
g)
Uncontaminated (healthy) soil
Crude oil-contaminated soil
Crude oil-contaminated soil with bacteria
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
81
Figure 5-4 Effect of vegetation of (L. fusca and B. mutica) and inoculation of
endophytes (Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp.
strain BRSI56, and Klebsiella sp. LCRI87) on crude oil degradation.
Values with same letters (a, b, c, d, e and f) are not significantly different at a
5% level of significance. Comparisons between treatments were carried out by
one-way analysis of variance (ANOVA). Error bars indicate standard error of
three replicates.
5.3.3 Persistence of the Inoculated Endophytes and Expression of
alkB Gene
The ability of inoculated endophytes to persist in the unvegetated soil as well as in the
rhizosphere and endosphere of B. mutica and L. fusca was assessed using cultivation-
dependent (plate count method) and cultivation-independent (use of real-time PCR for
the quantification of abundance and transcription levels alkB gene in DNA and RNA,
respectively, extracted from soil and plant samples) approaches. The survival of the
inoculated strains was relatively lower in the soil without vegetation as compared to
soil with vegetation (Fig. 5-4). The endophytes showed more persistence in the root of
both plants than in the rhizosphere and shoot interior. Between the two tested plants,
higher numbers of the inoculated endophytes were found in the rhizosphere and
endosphere of B. mutica as compared to L. fusca.
e
d
c
a
b
a
0
20
40
60
80
100
Without
vegetation
Endophytes L. fusca L. fusca with
bacteria
B. mutica B. mutica
with bacteria
Cru
de
oil
rem
oval
(%)
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
82
The inoculated endophytes showed more alkB gene profusion and expression in
inoculated plant’s rhizo- and endosphere than in the unvegetated soil. Maximum alkB
gene expression and abundance were detected in the roots, which were significantly (p
< 0.05) higher than the alkB gene numbers and expression in rhizosphere and shoot
(Fig. 5-5). Moreover, greater levels of alkB gene number and expression were seen in
the rhizosphere and endosphere of B. mutica than that of L. fusca.
5.3.4 Seed Germination Bioassay and Toxicity Evaluation
The toxicity of the soil was estimated by observing the seed germination, and root and
shoot length of wheat (T. aestivum L.) vegetated in the soil after harvesting plants from
different treatments. The seeds sown in unvegetated soil with no bacterial augmentation
showed significantly (p < 0.05) less germination, root length, and shoot length than the
seeds grown in soil treated with plants and/or bacteria. More seed germination, root and
shoot length were observed in the soil treated with the plants and endophytes in
combination than in the soil treated with plants or bacteria individually. Moreover, the
soil treated with B. mutica in combination with endophytes allowed more seed
germination (8%), root length (17%), and shoot length (28%) of wheat than the soil
treated with L. fusca in the presence of endophytes. Germination index (GI) values
indicated that toxicity of the soil decreased by endophytes augmentation and vegetation
(Fig. 5-6). Maximum GI value (95%) was observed for the soil treated with B. mutica
and inoculated with endophytes.
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
83
Figure 5-5 Mean values of colony forming unit (CFU), abundance and
expression of alkB gene in rhizosphere, root and shoot interior of B. mutica
(a), and L. fusca (b).
Error bars represent standard error. Means followed by the same letters are not
significantly different according to post-hoc Tukey test (P < 0.05)
.
c
b
a
d
c
b
a
d
c
b
a
d
0.0E+00
4.0E+02
8.0E+02
1.2E+03
1.6E+03
2.0E+03
2.4E+03
Unvegetated soil Rhizosphere Root Shoot
CF
U/a
bu
nd
an
ce a
nd
exp
ress
ion
of
alk
Bg
ene g
-1so
il,
roo
t a
nd
sh
oo
t
CFU Gene abundance Gene expression
a
c
b
a
dcb
a
dcb
a
d
0.0E+00
4.0E+02
8.0E+02
1.2E+03
1.6E+03
2.0E+03
2.4E+03
Unvegetated soil Rhizosphere Root Shoot
CF
U/a
bu
nd
an
ce a
nd
exp
ress
ion
of
alk
Bg
ene
g-1
soil
, ro
ot
an
d s
ho
ot
CFU Gene abundance Gene expression
b
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
84
Table 5.3 Effect of endophytes (Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp.
strain BRSI56, and Klebsiella sp. strain LCRI87) augmentation, vegetation (Leptochloa fusc
and Brachiaria mutica) and plant-endophytes partnerships on soil toxicity reduction using
wheat (Triticum aestivum L.) as a model plant
Numbers in the identical column followed by the identical letter are not significantly different at a 5% level of
significance. The standard error of each value is documented in parentheses. Comparisons among treatments were
done by ANOVA.
Treatments Germination
(%)
Root length
(cm)
Shoot length
(cm)
Untreated soil
Control (healthy soil) 85a (3) 4.31a (0.30) 4.85a (0.15)
Crude oil contaminated soil 25e (4) 1.66f (0.38) 1.30f (0.16)
Treated soil
Endophytes augmentation 35de (5) 2.60e (0.31) 3.10d (0.21)
Leptochloa fusca 40d (4) 3.13d (0.25) 3.26cd (0.32)
L. fusca with endophytes augmentation 60bc (5) 3.19d (0.72) 3.03e (0.20)
Brachiaria mutica 50c (6) 3.43c (0.32) 3.46c (0.25)
B. mutica with endophytes augmentation 65b (4) 3.86b (0.25) 4.20b (0.26)
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
85
Figure 5-6 Effect of vegetation (L. fusca and B. mutica) and endophytes
inoculation on the detoxification of crude oil contaminated soil.
The seed germination test was performed with wheat (Triticum aestivum L.) and
germination index (%) was calculated. Comparisons among treatments were done by
one-way analysis of variance (ANOVA). Error bars indicate standard error of three
replicate
f
e
d
b
c
a
0
20
40
60
80
100
Contaminated
soil
Endophytes L.fusca L.fusca and
endophytes
B. mutica B. mutica and
endophytes
Ger
min
ati
on
in
dex
(%
)
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
86
R² = 0.9888
0
20
40
60
80
100
0 2 4 6 8 10
Hy
dro
carb
on
deg
rad
ati
on
(%
)
Gene expression × 103
R² = 0.7138
0
20
40
60
80
100
0 5 10 15 20
Cru
de
oil
deg
rad
ati
on
(%
)
CFU × 105
R² = 0.9794
0
2
4
6
8
10
0 20 40 60 80 100 120
Gen
e ex
pre
ssio
n ×
10
3
Gene abundance × 103
b
a
Figure 5-7 Correlation between crude oil degradation
(%) and colony forming units (CFU) (g-1 dry weight of
soil) (a), gene abundance (copies of alkB g-1 dry weight
of soil) and gene expression (transcripts level of alkB
gene g-1 dry weight of soil) (b), and gene expression and
crude oil degradation (%) (c).
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
87
5.4 Discussion
Crude oil-contamination in soil inhibited plant growth and biomass production [234].
The primary inhibiting factors includes toxic nature of low molecular weight
compounds. Hydrophobicity also limit the mobility of water and nutrients to plants
[250-252]. This study showed that in the soil contaminated with crude oil, both L. fusca
and B. mutica showed considerably a reduced amount of root and shoot height and
biomass as compared to plants grown in uncontaminated soil (Fig. 5-3a & b). However,
endophytic bacterial inoculation improved plant growth and biomass production. This
might be due to the plant growth-promotion and ACC-deaminase activities of the
inoculated endophytes. In principle, bacterial ACC deaminase activity reduces the
contaminant induced stress symptoms in developing plants and improves plant health
and development [19, 20, 23, 63].
Unvegetated soil without endophytes inoculation showed less reduction (12%)
of crude oil (Fig. 5-4) as compared to inoculated and vegetated soil. This might be due
to degradation of crude oil by indigenous microorganisms and/or physicochemical
processes (e.g. soil adsorption, volatilization or photo-oxidation of hydrocarbons) [232,
253]. The inoculation of endophytes in the unvegetated soil resulted in 40% reduction
in oil concentration. Several earlier studies also demonstrated that bacterial consortia
containing Pseudomonas sp., Acinobactor sp. and Klebsiella sp. strains degrade crude
oil present in soil [218, 252, 254]. Crude oil is a combination of alkanes and other
combinations, so the consortia of different bacterial strains could work more efficiently
than the sole use of bacteria [254]. However, vegetation in contaminated soil resulted
in 51 and 61% of crude oil degradation by L fusca and B. mutica, respectively, and this
degradation was significantly (p < 0.05) higher than sole bacterial augmentation. Plants
can remove organic pollutants from soil through different mechanisms including
phytoextraction in which plant directly uptake oil components from soil resulting in
sequestration and degradation of pollutants inside the plant [255]. Moreover, vegetation
can enhance the mineralization of hydrocarbons by stimulating indigenous microbial
population to degrade organic pollutants [25, 234, 241, 256]. The maximum crude oil
reduction (85%) was achieved with the endophytes inoculated plants of B. mutica,
which was higher than that found with uninoculated plants. This improved crude oil
degradation was possibly the result of persistence and metabolic events of the
inoculated endophytes in the plant environment. In an earlier study, where Italian
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
88
ryegrass was grown for 152 days in a diesel-spiked soil (1.8%), hydrocarbons contents
were decreased to 58% of the initial value [257].
In the past few years it has been apprehended to investigate the toxicity and
status of remediated soil [258]. The seeds of wheat sown in crude oil contaminated soil
without vegetation and endophytes augmentation exhibited significantly (p < 0.05) less
growth shoot and root height than the seeds sown in contaminated soil treated using
plants and bacteria (Table 5.3). These outcomes are similar with earlier conclusions,
which reported that the germination of seed, root and shoot growth of Sorghum bicolor
was highly affected by crude oil contamination in soil [248]. The reduction of
germination could be due to damaging of the germinating seeds by the oil or due to
reduction of gaseous exchange by the oil which can lead to death of the seeds. In present
study, seed germination, root and shoot length were significantly (p < 0.05) increased
in soil that was vegetated and/or inoculated with endophytes and maximum values for
these parameters were observed in soil treated with plant-endophyte partnership. In an
earlier study, the collective usage of vegetation and endophytes reduced pollutants level
in soil and also promoted seed development and root and shoot improvement [259].
Many other studies also demonstrated that the inoculation of endophytic bacteria
degrade the organic pollutants and lessen the harmfulness of soil [63, 260, 261].
Inoculated bacteria showed not only colonization but also expressed alkane
degrading genes demonstrating their dynamic character in the mineralization of crude
oil (Fig. 5-5a & b). Contrary to the high abundance (alkB gene copy number) and
activity (alkB gene expression) of the endophytes in the vegetated soil, rather less
survival and activity were seen in the unvegetated soil. It reveals that vegetation
improved the persistence and activity of the endophytes in the soil. Vegetation offers
nutrients and habitat to their associated microorganisms and ultimately the numbers of
pollutant-degrading microorganisms are increased in the rhizosphere and endosphere
[22, 63, 262].
Interestingly, greater levels of alkB gene abundance and expression were seen
in the roots of both plants than in the rhizosphere soil and shoot interior. This might be
due to the reason that these bacteria were endophytic and could colonize more
efficiently in the endosphere of plant than rhizosphere. Previous studies also described
that inoculated endophytes exhibit better persistence and activity in the root than in the
Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil
89
rhizosphere soil and shoot interior [46, 118, 263]. The abundance of gene (alkB)
exhibited positive relationship (r = 0.97) with gene expression (Fig. 5-7). Similarly, a
positive correlation (r= 0.9) was also observed between gene expression and
hydrocarbon removal. During the phytoremediation of hydrocarbon-contaminated soil,
strong positive relationships have been reported previously between hydrocarbon
degradation, gene abundance, and gene expression [118, 234].
90
6 General Discussion
Due to rapid industrialization and increasing anthropogenic activities, contamination of
soil and groundwater with crude oil poses a serious threat to health of humans, animals
and plants [264, 265]. Plants can be used to remove, sequester or decontaminate
hydrocarbon pollutants present in soil and water. But, different plant species are not
equally suitable for microbe-assisted phytoremediation; in which they ideally show
better growth and produce significant biomass in crude oil-contaminated soil [257, 266,
267]. The major reasons behind the inhibited growth of plants in hydrocarbon polluted
soil are toxic and hydrophobic nature of PHs. Hydrophobicity can change the water/soil
interfaces that would generally happen, thus affecting aeration, uptake of water, and
mobility of nutrient to plants [268, 269]. In this study, the analysis of phytotoxicity
assay revealed that different plants species showed considerable growth variations in
crude oil-contaminated soil. Among 27 tested plants, three grasses (L. perenne, L. fusca,
and B. mutica), and two trees (A. ampliceps and L. leucocephala) were least effected
by crude oil-contamination in soil, and created additional biomass than other plants
vegetated in crude oil-contaminated soil (Table 3.1). Therefore, it suggested that these
plants might have developed PHs tolerant approaches which enable them to detoxify
hydrocarbons so as to survive and grow in oil-contaminated soils [270].
In this study, the plant species, L. perenne, L. fusca, B. mutica, A. ampliceps and
L. leucocephala, not only showed tolerance towards crude oil but also hosted different
oil degrading rhizo- and endophytes (Table 3.1). Higher numbers of bacteria were
isolated from the root, rhizosphere, and shoot of L. perenne (29.72%), B. mutica
(24.32%) and L. fusca (21.62%) as compared to A. ampliceps and L. leucocephala. It
has been reported that grasses can host a large number of microorganisms due to their
extensive root system provided that a large surface area for microbial establishment
[271, 272]. In this study, we found that hydrocarbon-degrading bacteria belong to eight
different genera. Among them, Bacillus, Acinetobacter and Pseudomonas were
frequent colonizers of the rhizosphere of grasses and trees. Generally, endophytic
bacteria were different from rhizospheric bacteria and more bacteria were found in
Chapter 6 General Discussion
91
rhizosphere and root interior as compared to aerial parts of both plants. The fact that a
higher number of bacterial endophytes were isolated from root as compared to shoot. It
supports the notion that the number of the bacterial population drops with the expanse
from their points such as root tip and/or the spot of the development of lateral roots
[21]. Previous studies have also shown that roots release nutrients and organic
compounds in the form of exudates that facilitate microbial growth in rhizosphere and
inside roots [273, 274].
In present work, selected 37 isolates were capable to grow on crude oil but the
highest (78%) of crude oil degradation was shown by Acinetobacter spp. strain BRSI56
and Pseudomonas aeruginosa strain BRRI54 (Fig. 3-1). Acinetobacter species are
universally dispersed in the environment even isolated from oil-polluted soils and water
where they utilize crude oil as only source of energy [275]. Crude oil consists of various
types of alkanes, aromatic compounds and other substrates [276]. In present study, the
growth of Pseudomonas aeruginosa strain BRRI54 and Acinetobacter sp. strain
BRSI56 on crude oil confirmed that these strains could utilize a broad range of
hydrocarbons for their growth. It was also observed that amongst different hydrocarbon
substrates, straight chain alkanes were the most degradable fractions while aromatic
hydrocarbons were the most recalcitrant. Previous reports also indicated that
hydrocarbons having short chain length (C8-C16) can easily be degraded by most
bacteria when compared to degradation of PAHs [277, 278]. This investigation showed
that Acinetobacter sp. strain LCRH81, was able to utilize various hydrocarbon
substrates even some aromatics. Acinetobacter species strains, able to utilize alkanes
with longer chain lengths (C10 to C44) and aromatics have been described earlier [276].
Some strains although showed growth on crude oil but could not utilize any of the tested
alkanes probably due to the reason that differences in hydrocarbon structure and chain-
length which require different degradative enzymes can also hinder the biodegradation
process [279].
Experimental findings from different research reports revealed that the
degradation of crude oil depend on catabolic genes of hydrocarbon utilizing bacteria
and chemical composition of crude oil [174, 202, 280]. Bacterial hydrocarbon
degradation takes place through complex array of redox mechanisms, which are
catalyzed by set of enzymes such as monooxygenases and dioxygenases. In bacteria
Chapter 6 General Discussion
92
these enzymes are encoded by alkB/ alkM and CYP 153 genes [46, 234]. In this study,
majority of the bacterial strains showed potential to degrade crude oil and
hydrocarbons, only 54.05% of them possessed alkB and CYP153 genes. This suggests
that the genes or the mechanism involved in hydrocarbon degradation in bacteria
associated with plants might be different so different set of degenerate primers may be
used for the amplification of genes involved in the phenomenon.
The beneficial effects of rhizospheric and endophytic bacteria on their host plant
have been widely described [20, 151, 281]. This study reveals that many of the isolated
rhizospheric and endophytic bacterial strains showed the in vitro PGP activities or
mechanisms that are behind in plant growth advancement (Table 3.5). It might be one
of the main reasons of the persistence and growth of the five selected plants (L. perenne,
L. fusca, and B. mutica), and two trees (A. ampliceps and L. leucocephala) in oil
polluted soil. Most of the strains showed the ability to produce IAA and ACC
deaminase, and both these mechanisms are more common among the hydrocarbon-
degrading bacteria. One strain, Klebsiella sp. LCRI87, exhibited multiple PGP
activities such as P/Znsolubilization, ACC deaminase, IAA, and production of
siderophore. Earlier studies shows that ACC deaminase shows a chief role in plant-
bacteria partnerships especially under stress conditions including oil-contamination
[109, 282]. This bacterial ACC deaminase enzyme adjusts ethylene concentartions in
plants and consequently contributes to the improved development of root.
Microbial biofilms are highly efficient and successful ecological communities
that may contribute in remediation of oil-contaminated soils [66, 211, 256]. In this
study, CLSM analysis indicated that yfp transformed bacterial strains, Pseudomonas
aeruginosa BRRI54 and Acinetobacter sp. BRSI56, were able to form biofilm on solid
substratum; the capability appeared to be maximum in the close proximity of oil-water
interface (Fig. 4-3 & 4-4). Several previous studies have also demonstrated that
hydrocarbon-degrading microbes can accumulate in the vicinity of oil and other
pollutants and efficiently evade the limitation of low bioavailability of hydrocarbons in
remediation process [66, 224, 283-285].
Successful root colonization by hydrocarbon-degrading bacteria is an essential
criterion to ensure beneficial effects of bacteria on phytoremediation process [286,
287]. CLSM observations also showed the endophytic strains, Acinetobacter sp.
Chapter 6 General Discussion
93
BRSI56 and Pseudomonas aeruginosa BRRI54, colonized in the close vicinity of roots
of inoculated plants, L. fusca and B. mutica. Bacterial cells were visualized as single
cell as well as aggregated colonies on the rhizoplane that later on colonized the interior
of the root and stem cells. Earlier reports corroborate this translocation of bacteria by
indicating that bacteria are able to translocate through the xylem vessels from roots to
stem of the host plant via transpiration flow or by colonizing intercellular spaces [25,
152, 213]. In this study, observations under CLSM provided the proof of strong
association between tested bacteria and root system of both grasses (L. fusca and B.
mutica).
In green house experiment of this research work, a significant reduction in
biomass of both plants (L. fusca and B. mutica) was caused by the presence of crude oil
in soil (Fig. 4-7b) which can be attributed to the toxic compounds present in crude oil,
especially low molecular weight components. Hydrocarbons can alter soil properties
because of their hydrophobicity, which may affect availability of nutrient/water and,
therefore, in plant growth [3, 11]. However, inoculation of endophytes (Pseudomonas
aeruginosa strain BRRI54 and Acinetobacter sp. strain BRSI56) with ability to degrade
crude oil along with PGP traits showed potential to increase growth of both grasses (L.
fusca and B. mutica) as compared to uninoculated (control) plants. It might be because
of the crude oil-degrading and ACC deaminase secretion of the augmented bacteria.
ACC deaminase activity decreases stress-induced ethylene and improve adaptation of
plants and growth in contaminated environments [109].
In present work, the inoculation of bacteria in combination with L. fusca and B.
mutica resulted in 71 and 78% of crude oil degradation, respectively, and this
degradation was significantly higher than either sole bacterial augmentation or
vegetation. These findings are similar with former reports that plant-bacteria
association is a more effective method for the clean-up of soil contaminated with
petroleum hydrocarbons than vegetation or microbial augmentation alone [20, 80]. In
this study, un-inoculated and un-vegetated soil showed lower reduction (40%) of crude
oil as compared to inoculated and vegetated soil (Fig. 4-8). This degradation of crude
oil is performed by native microbes and/or natural physicochemical processes (e.g.,
volatilization or photo-oxidation) [109, 217, 220].
Chapter 6 General Discussion
94
Field experiment was executed in the surrounding area of an oil exploration and
drilling company. This company is situated in chakwal district. This study showed that
in the soil contaminated with crude oil, both L. fusca and B. mutica showed significantly
lesser biomass, root and shoot length than the plants grown in uncontaminated soil (Fig.
5-3 a & b). However, endophytic bacterial augmentation in the form of consortium had
a positive effect on both plants. Un-vegetated soil without endophytes augmentation
showed less reduction (12%) of crude oil as compared to inoculated and vegetated soil.
Only bacterial augmentation in soil enhanced crude oil degradation (40%) and it was
significantly higher than in the soil without bacterial augmentation. Several earlier
studies also demonstrated that the augmentation of soil with hydrocarbon-degrading
bacterial strains, harbouring broad enzymatic capacities, can degrade hydrocarbons
efficiently [217, 220, 266, 288]. However, vegetation in contaminated soil resulted in
51 and 61% of crude oil degradation by L fusca and B. mutica, respectively, and this
degradation was significantly (p < 0.05) higher than sole bacterial augmentation. Plants
can remove organic pollutants from soil through different mechanisms including
phytoextraction in which plant directly uptake oil components from soil resulting in
sequestration and degradation of the pollutants inside the plant [289, 290]. The
maximum crude oil reduction (85%) was achieved with the bacterial inoculated plants
of B. mutica, which was far higher than those obtained with un-inoculated plants.
Maximum crude oil degradation was probably the consequence of survival and
functional activity of the inoculated bacteria. In previous study, where Italian ryegrass
was grown for 3 months in a diesel-contaminated soil, hydrocarbons contents were
reduced to 58% of the original value [168].
In present investigations, quantitative analysis by qPCR revealed that inoculated
strains expressed alkB gene in rhizosphere, root and shoot of both plants. In green house
and field experiment, contrary to the high abundance and activity of the inoculated
bacteria in vegetated soil, rather less persistence and activity were seen in unvegetated
soil. This indicates that vegetated soils support bacterial population and diversity. This
might be due to the rhizodeposits that are utilized by bacteria as carbon and energy
source [291, 292]. Furthermore, higher persistence of inoculated endophytes was
observed in root interior and rhizosphere as compared to shoot interior of both grasses.
Similarly, for both inoculants, abundance and expression of alkB gene was higher in
Chapter 6 General Discussion
95
the roots of both plants as compared to the rhizosphere and shoot interior. This might
be because of the reason that these bacteria were endophytes and could colonize more
proficiently in plant endosphere than rhizosphere. Previous findings also described that
inoculated endophytes exhibited better persistence and activity in the root as compared
to rhizosphere and shoot interior [118]. In this study, the abundance of gene (alkB)
exhibited positive relationship (r = 0.97) with gene expression. Similarly, a positive
correlation (r = 0.7) was also witnessed between hydrocarbon removal and gene
expression. During the phytoremediation of hydrocarbon-contaminated soil, strong
positive relationships have been reported previously between hydrocarbon degradation,
gene abundance, and gene expression [118, 280].
In the previous couple of years, it has been realized to evaluate the
health/condition of remediated soil. In this thesis research work, the seeds of wheat
sown in untreated crude oil-contaminated soil showed considerably (p < 0.05) less
germination and root and shoot length than the seeds sown in the contaminated soil
treated with plants and/ or bacteria. Various earlier findings reported that the seed
germination and growth of Sorghum bicolor was highly affected by crude oil
contamination in soil [293]. The reduction in seed germination and seedlings growth
might be due to the hydrophobicity of hydrocarbons. Hydrocarbons may act as a
physical obstacle around the seeds, thus preventing or reducing both oxygen and water
uptake [294]. In this work, seed germination, root and shoot length were significantly
(p < 0.05) increased in soil that was treated with plants/bacteria and maximum values
for these parameters were observed in soil treated with plant-endophyte partnership.
Many other studies also demonstrated that the augmentation of endophytic bacteria
degraded the organic pollutants and lessen the harmfulness of soil [293, 295]. On the
basis of our findings it can be concluded that the use of bacteria in combination with
grasses is more promising approach than the sole use of plants and bacteria. For
practical applications, the importance of plant type should also be considered in the
design of efficient phytoremediation applications.
Future prospects
Soil contamination might increase in future due to rapid population growth and
consequently a boost in industrialization, urbanization and intensive agriculture world-
Chapter 6 General Discussion
96
wide. To alleviate the harsh effects of soil contamination by organic chemicals,
phytoremediation might be an effective and affordable approach to clean-up polluted
soils. However, various aspects still need to be investigated to make this technology
successful. In particular, consideration should be paid to following aspects:
The exploitation of plant-endophyte associations for the restoration of polluted
groundwater and soils is a favorable area. During phytoremediation of organic
pollutants, endophyes containing the suitable degradation pathway(s) can help
their host by degrading toxins that are eagerly taken up by plants.
To investigate the whole microbial diversity in a particular environment, the
isolation and identification of microorganisms is not an appropriate technique.
The modern metagenomic approach facilitate scientists to analyze the entire
microbial popoulation, and the genetic ability for the active metabolic ways
present in a specified location. This procedure is particularly effective for the
study of the micobial population and whole genome examination of composite
environmental samples where microbes cannot be cultivated under normal
laboratory conditions.
97
7 References
[1] C. R. Kuske, L. O. Ticknor, M. E. Miller, J. M. Dunbar, J. A. Davis, S. M.
Barns, and B. Jayne, "Comparison of soil bacterial communities in rhizospheres
of three plant species and the interspaces in an arid grassland," Appl. Environ.
Microbiol., vol. 68, no. 4, pp. 1854-1863, 2002.
[2] M. Alexander, "Introduction to Soil Microbiology," Soil Sci., vol. 125, no. 5, p.
331, 1978.
[3] A. B. Reda and T. Ashraf, "Optimization of bacterial biodegradation of toluene
and phenol under different nutritional and environmental conditions," J. Appl.
Sci. Res., vol. 6, no. 7, pp. 1086-1095, 2010.
[4] M. Balba, N. Al-Awadhi, and R. Al-Daher, "Bioremediation of oil-
contaminated soil: Microbiological methods for feasibility assessment and field
evaluation," J. microbiol. Methods, vol. 32, no. 32, pp. 155-164, 1998.
[5] V. Andreoni, L. Cavalca, M. Rao, G. Nocerino, S. Bernasconi, E. D. Amico, M.
Colombo, and L. Gianfreda, "Bacterial communities and enzyme activities of
PAHs polluted soils," Chemosphere, vol. 57, no. 5, pp. 401-412, 2004.
[6] K. Srogi, "Monitoring of environmental exposure to polycyclic aromatic
hydrocarbons: A review," Environ. Chem. Lett., vol. 5, no. 4, pp. 169-195,
2007.
[7] J. Pinedo, R. Ibanez, J. Lijzen, and A. Irabien, "Assessment of soil pollution
based on total petroleum hydrocarbons and individual oil substances," J.
Environ. Manage., vol. 130, no. 130, pp. 72-79, 2013.
[8] I. Tolosa, S. D. Mora, M. R. Sheikholeslami, J. P. Villeneuve, J. Bartocci, and
C. Cattini, "Aliphatic and aromatic hydrocarbons in coastal Caspian Sea
sediments," Marine Pollut. B., vol. 48, no. 1, pp. 44-60, 2004.
[9] E. Brevik, A. Cerdà, J. M. Solera, L. Pereg, J. Quinton, J. Six, "The
interdisciplinary nature of soil," Soil, vol. 1, no. 1, p. 117, 2015.
[10] R. Siddiqui, "Energy and economic growth in Pakistan," Pak. Dev. Rev., vol.
43, no. 2, pp. 175-200, 2004.
[11] A. Aqeel and M. S. Butt, "The relationship between energy consumption and
economic growth in Pakistan," Asia-Pacific Devel. J., vol. 8, no. 2, pp. 101-110,
2001.
[12] A. Janbandhu and M. Fulekar, "Biodegradation of phenanthrene using adapted
microbial consortium isolated from petrochemical contaminated environment,"
J. hazard. Mater., vol. 187, no. 1, pp. 333-340, 2011.
Chapter 7 References
98
[13] A. Sebiomo, S. Bankole, and A. Awosanya, "Determination of the ability of
microorganisms isolated from mechanic soil to utilise lubricating oil as carbon
source," Afr. J. Microbiol. Res., vol. 4, no. 21, pp. 2196-2201, 2010.
[14] R. C. Prince, K. M. McFarlin, J. D. Butler, E. J. Febbo, F. C. Wang, and T. J.
Nedwed, "The primary biodegradation of dispersed crude oil in the sea,"
Chemosphere, vol. 90, no. 2, pp. 521-526, 2013.
[15] L. W. Robertson and L. G. Hansen, PCBs: Recent Advances in Environmental
Toxicology and Health Effects, 4th edition. USA: The University Press of
Kentucky, 2015.
[16] B. Ordinioha and S. Brisibe, "The human health implications of crude oil spills
in the Niger delta, Nigeria: An interpretation of published studies," Niger. Med.
J., vol. 54, no. 1, pp. 10-16, 2013.
[17] F. Aguilera, J. Méndez, E. Pásaro, and B. Laffon, "Review on the effects of
exposure to spilled oils on human health," J. Appl. Toxicol., vol. 30, no. 4, pp.
291-301, 2010.
[18] V. C. Pandey, P. Abhilash, and N. Singh, "The Indian perspective of utilizing
fly ash in phytoremediation, phytomanagement and biomass production," J.
Environ. Manage., vol. 90, no. 10, pp. 2943-2958, 2009.
[19] N. Weyens, D. V. Lelie, S. Taghavi, and J. Vangronsveld, "Phytoremediation:
Plant-endophyte partnerships take the challenge," Curr. Opin. Biotechnol., vol.
20, no. 2, pp. 248-254, 2009.
[20] S. Khan, M. Afzal, S. Iqbal, and Q. M. Khan, "Plant-bacteria partnerships for
the remediation of hydrocarbon contaminated soils," Chemosphere, vol. 90,
no.4, pp. 1317-1332, 2013.
[21] Q. Chaudhry, M. Blom-Zandstra, S. K. Gupta, and E. Joner, "Utilising the
synergy between plants and rhizosphere microorganisms to enhance breakdown
of organic pollutants in the environment," Environ. Sci. Pollut. Res., vol. 12,
no. 1, pp. 34-48, 2005.
[22] S. Compant, C. Clement, and A. Sessitsch, "Plant growth-promoting bacteria in
the rhizo-and endosphere of plants: Their role, colonization, mechanisms
involved and prospects for utilization," Soil Biol. Biochem., vol. 42, no. 5, pp.
669-678, 2010.
[23] B. R. Glick, "Using soil bacteria to facilitate phytoremediation," Biotechnol.
Adv., vol. 28, no. 3, pp. 367-374, 2010.
[24] A. Sessitsch, M. Kuffner, P. Kidd, J. Vangronsveld, W. W. Wenzel, K.
Fallmann, and M. Puschenreiter, "The role of plant-associated bacteria in the
mobilization and phytoextraction of trace elements in contaminated soils," Soil
Biol. Biochem., vol. 60, no. 2, pp. 182-194, 2013.
Chapter 7 References
99
[25] M. Afzal, Q. M. Khan, and A. Sessitsch, "Endophytic bacteria: Prospects and
applications for the phytoremediation of organic pollutants," Chemosphere, vol.
117, no. 1, pp. 232-242, 2014.
[26] S. Chandra, R. Sharma, K. Singh, and A. Sharma, "Application of
bioremediation technology in the environment contaminated with petroleum
hydrocarbon," Ann. Microbiol., vol. 63, no. 2, pp. 417-431, 2013.
[27] J. G. Speight, The Chemistry and Technology of Petroleum, 5th edition. USA:
Taylor and Francis, 2014.
[28] R. T. Bachmann, A. C. Johnson, and R. G. Edyvean, "Biotechnology in the
petroleum industry: An overview," Int. Biodeter. Biodegr., vol. 86, no. 3, pp.
225-237, 2014.
[29] F. Abbasian, R. Lockington, M. Mallavarapu, and R. Naidu, "A comprehensive
review of aliphatic hydrocarbon biodegradation by bacteria," Appl. Biochem.
Biotechnol., vol. 176, no. 3, pp. 670-699, 2015.
[30] S. Gan, E. Lau, and H. Ng, "Remediation of soils contaminated with polycyclic
aromatic hydrocarbons (PAHs)," J. Hazard. Mater., vol. 172, no. 2, pp. 532-549,
2009.
[31] E. C. Souza, T. C. Vessoni-Penna, and R. P. de Souza Oliveira, "Biosurfactant-
enhanced hydrocarbon bioremediation: An overview," Int. Biodeter. Biodegr.,
vol. 89, no. 1, pp. 88-94, 2014.
[32] C. H. Walker, R. Sibly, S. Hopkin, and D. B. Peakall, Principles of
Ecotoxicology, 4th edition, USA: Taylor and Francis, 2012.
[33] J. Albaigés, Ecotoxicology: Effects of Pollutants on the Natural Environment,
2014 edition, USA: Taylor Francis, 2014.
[34] S. J. Varjani and V. N. Upasani, "Biodegradation of petroleum hydrocarbons by
oleophilic strain of Pseudomonas aeruginosa NCIM 5514," Bioresour.
Technol., vol. 222, no. 32, pp. 195-201, 2016.
[35] J. P. Salanitro, "Bioremediation of petroleum hydrocarbons in soil," Adv.
Agron., vol. 72, no. 1, pp. 53-105, 2001.
[36] R. M. Atlas, "Microbial degradation of petroleum hydrocarbons: An
environmental perspective," Microbiol. Rev., vol. 45, no. 1, p. 180, 1981.
[37] A. A. Al-Majed, A. R. Adebayo, and M. E. Hossain, "A sustainable approach
to controlling oil spills," J. Environ. Manage., vol. 113, no. 3, pp. 213-227,
2012.
[38] G. Wu and F. Coulon, "Modelling the Environmental Fate of Petroleum
Hydrocarbons During Bioremediation," in Hydrocarbon and Lipid
Microbiology Protocols, DE: Springer, 2016. pp. 165-180.
[39] Y. Huang, J. Wei, J. Song, M. Chen, and Y. Luo, "Determination of low levels
of polycyclic aromatic hydrocarbons in soil by high performance liquid
Chapter 7 References
100
chromatography with tandem fluorescence and diode-array detectors,"
Chemosphere, vol. 92, no. 8, pp. 1010-1016, 2013.
[40] S. Li, U. Turaga, B. Shrestha, T. A. Anderson, S. Ramkumar, M. J. Green, S.
Das, and J. E. Canas-Carrell, "Mobility of polyaromatic hydrocarbons (PAHs)
in soil in the presence of carbon nanotubes," Ecotoxicol. Environ. Saf., vol. 96,
no. 2, pp. 168-174, 2013.
[41] S. Kuppusamy, T. Palanisami, M. Megharaj, K. Venkateswarlu, and R. Naidu,
"Ex-situ Remediation Technologies for Environmental Pollutants: A Critical
Perspective," in Reviews of Environmental Contamination and Toxicology,
SUI: Springer, 2016. pp. 117-192.
[42] F. Z. Ferradji, S. Mnif, A. Badis, S. Rebbani, D. Fodil, K. Eddouaouda, and S.
Sayadi, "Naphthalene and crude oil degradation by biosurfactant producing
Streptomyces spp. isolated from Mitidja plain soil (North of Algeria)," Int.
Biodeter. Biodegr., vol. 86, no. 3, pp. 300-308, 2014.
[43] M. T. Bao, L. N. Wang, P. Y. Sun, L. X. Cao, J. Zou, and Y. M. Li,
"Biodegradation of crude oil using an efficient microbial consortium in a
simulated marine environment," Marine Pollut. B., vol. 64, no. 6, pp. 1177-
1185, 2012.
[44] B. Chen, M. Yuan, and L. Qian, "Enhanced bioremediation of PAH-
contaminated soil by immobilized bacteria with plant residue and biochar as
carriers," J. Soils Sedim., vol. 12, no. 9, pp. 1350-1359, 2012.
[45] M. Afzal, S. Yousaf, T. G. Reichenauer, and A. Sessitsch, "The inoculation
method affects colonization and performance of bacterial inoculant strains in
the phytoremediation of soil contaminated with diesel oil," Int. J. Phytorem.,
vol. 14, no. 1, pp. 35-47, 2012.
[46] M. Afzal, S. Yousaf, T. G. Reichenauer, M. Kuffner, and A. Sessitsch, "Soil
type affects plant colonization, activity and catabolic gene expression of
inoculated bacterial strains during phytoremediation of diesel," J. Hazard.
Mater., vol. 186, no. 2, pp. 1568-1575, 2011.
[47] P. Abhilash, J. R. Powell, H. B. Singh, and B. K. Singh, "Plant-microbe
interactions: Novel applications for exploitation in multipurpose remediation
technologies," Trends Biotechnol., vol. 30, no. 8, pp. 416-420, 2012.
[48] P. Abhilash and M. Yunus, "Can we use biomass produced from
phytoremediation?" Biomass Bioenerg., vol. 35, no. 3, pp. 1371-1372, 2011.
[49] S. Banwart, "Save our soils," Nature, vol. 474, no. 3530, pp. 151-152, 2011.
[50] M. E. Hodson, "The need for sustainable soil remediation," Elements, vol. 6,
no. 6, pp. 363-368, 2010.
[51] B. K. Singh, "Organophosphorus-degrading bacteria: Ecology and industrial
applications," Nature Rev. Microbiol., vol. 7, no. 2, pp. 156-164, 2009.
Chapter 7 References
101
[52] E. Z. Ron and E. Rosenberg, "Enhanced bioremediation of oil spills in the sea,"
Curr. Opin. Biotechnol., vol. 27, no. 4, pp. 191-194, 2014.
[53] M. Hassanshahian, G. Emtiazi, and S. Cappello, "Isolation and characterization
of crude oil-degrading bacteria from the Persian Gulf and the Caspian Sea,"
Marine Pollut. B., vol. 64, no. 1, pp. 7-12, 2012.
[54] V. P. Beskoski, S. Miletic, M. Ilic, G. G. Cvijovic, P. Papic, N. Maric, T. S.
Knudsen, B. S Jovancicevic, T. Nakano, and M. M. Vrvic, "Biodegradation of
isoprenoids, steranes, terpanes, and phenanthrenes during in situ bioremediation
of petroleum‐contaminated groundwater," Clean Soil Air Water, vol. 45, no. 2,
pp. 1-8, 2017.
[55] T. N. Nazina, D. S. Sokolova, A. A. Grigoryan, N. M. Shestakova, E. M.
Mikhailova, A. B. Poltaraus, T. P. Tourova. A. M. Lysenko, G. A Osipov, and
S. S. Belyaev, "Geobacillus jurassicus sp. nov., a new thermophilic bacterium
isolated from a high-temperature petroleum reservoir, and the validation of the
Geobacillus species," Sys. Appl. Microbiol., vol. 28, no. 1, pp. 43-53, 2005.
[56] S. Mnif, S. Sayadi, and M. Chamkha, "Biodegradative potential and
characterization of a novel aromatic-degrading bacterium isolated from a
geothermal oil field under saline and thermophilic conditions," Int. Biodeter.
Biodegr., vol. 86, no. 7, pp. 258-264, 2014.
[57] M. S. Fuentes, J. M. Saez, C. S. Benimeli, and M. J. Amoroso, "Lindane
biodegradation by defined consortia of indigenous Streptomyces strains," Water
Air Soil Pollut., vol. 222, no. 4, pp. 217-231, 2011.
[58] A. Hamzah, C. W. Phan, N. F. Abu Bakar, and K. K. Wong, "Biodegradation
of crude oil by constructed bacterial consortia and the constituent single bacteria
isolated from Malaysia," Biorem. J., vol. 17, no. 1, pp. 1-10, 2013.
[59] A. M. Mukred, A. A. Hamid, A. Hamzah, and W. W. Yusoff, "Development of
three bacteria consortium for the bioremediation of crude petroleum-oil in
contaminated water," J. Biol. Sci, vol. 8, no. 4, pp. 73-79, 2008.
[60] M. A. F. Alkhatib, Z. Alam, S. A. Muyibi, and A. Husain, "An isolated bacterial
consortium for crude oil biodegradation," Afr. J. Biotech., vol. 10, no. 81, pp.
18763-18767, 2011.
[61] K. V. Sajna, R. K. Sukumaran, L. D. Gottumukkala, and A. Pandey, "Crude oil
biodegradation aided by biosurfactants from Pseudozyma sp. NII 08165 or its
culture broth," Bioresour. Technol., vol. 191, no. 78, pp. 133-139, 2015.
[62] S. J. Varjani and V. N. Upasani, "Comparative studies on bacterial consortia for
hydrocarbon degradation," Int. J. Inn. Res. Sci. Engg. Technol., vol. 2, no. 10,
pp. 5377-5383, 2013.
[63] A. Mittal and P. Singh, "Isolation of hydrocarbon degrading bacteria from soils
contaminated with crude oil spills," Indian J. Exp. Biol., vol. 47, no. 6, pp. 760-
765, 2009.
Chapter 7 References
102
[64] H. C. Flemming and J. Wingender, "The biofilm matrix," Nature Rev.
Microbiol., vol. 8, no. 9, pp. 623-633, 2010.
[65] R. S. Norman, R. F. Suau, and P. J. Morris, "Variability in Pseudomonas
aeruginosa lipopolysaccharide expression during crude oil degradation," Appl.
Environ. Microbiol., vol. 68, no. 10, pp. 5096-5103, 2002.
[66] D. Dasgupta, R. Ghosh, and T. K. Sengupta, "Biofilm-mediated enhanced crude
oil degradation by newly isolated Pseudomonas species," ISRN Biotechnol.,
vol. 2013, no. 7, pp. 250749, 2013.
[67] B. Klein, P. Bouriat, P. Goulas, and R. Grimaud, "Behavior of Marinobacter
hydrocarbonoclasticus SP17 cells during initiation of biofilm formation at the
alkane-water interface," Biotech. Bioengg., vol. 105, no. 3, pp. 461-468, 2010.
[68] A. W. Decho, "Microbial biofilms in intertidal systems: An overview," Cont.
Shelf Res., vol. 20, no. 10, pp. 1257-1273, 2000.
[69] R. Boopathy, "Factors limiting bioremediation technologies," Bioresour.
Technol., vol. 74, no. 1, pp. 63-67, 2000.
[70] G. Adams, P. T. Fufeyin, and E. Igelenyah, "Bioremediation of spent oil
contaminated soils using poultry litter," Res. J. Eng. Appl. Sci., vol. 3, no. 7, pp.
124-130, 2014.
[71] G. O. Adams, P. T. Fufeyin, S. E. Okoro, and I. Ehinomen, "Bioremediation,
biostimulation and bioaugmention: A review," Int. J. Environ. Biorem.
Biodegr., vol. 3, no. 1, pp. 28-39, 2015.
[72] K. P. Shukla, N. K. Singh, and S. Sharma, "Bioremediation: Developments,
current practices and perspectives," Genet. Engg. Biotechnol. J, vol. 3, no. 8,
pp. 1-20, 2010.
[73] M. Nandal, P. Solanki, M. Rastogi, and R. Hooda, "Bioremediation: A
sustainable tool for environmental management of oily sludge," Nature Environ.
Pollut. Technol., vol. 14, no. 1, p. 181, 2015.
[74] S. Bhatnagar and R. Kumari, "Bioremediation: A sustainable tool for
environmental management, a-review., Ann. Rev. Res. Biol. " vol. 3, no. 9, pp.
974-993, 2013.
[75] J. Tang, M. Carroquino, B. Robertson, and M. Alexander, "Combined effect of
sequestration and bioremediation in reducing the bioavailability of polycyclic
aromatic hydrocarbons in soil," Environ. Sci. Technol., vol. 32, no. 22, pp.
3586-3590, 1998.
[76] S. V. Mohan, T. Kisa, T. Ohkuma, R. A. Kanaly, and Y. Shimizu,
"Bioremediation technologies for treatment of PAH-contaminated soil and
strategies to enhance process efficiency," Rev. Environ. Sci. Biotech., vol. 5,
no. 4, pp. 347-374, 2006.
Chapter 7 References
103
[77] J. Srivastava, R. Naraian, S. Kalra, and H. Chandra, "Advances in microbial
bioremediation and the factors influencing the process," Int. J. Environ. Sci.
Technol., vol. 11, no. 6, pp. 1787-1800, 2014.
[78] J. M. Foght, D. W. Westlake, W. M. Johnson, and H. F. Ridgway,
"Environmental gasoline-utilizing isolates and clinical isolates of Pseudomonas
aeruginosa are taxonomically indistinguishable by chemotaxonomic and
molecular techniques," Microbiology, vol. 142, no. 4, pp. 2333-2340, 1996.
[79] N. Das and P. Chandran, "Microbial degradation of petroleum hydrocarbon
contaminants: An overview," Biotechnol. Res. Int., vol. 2011, no. 2011, pp. 1-
13, 2010.
[80] A. Ijaz, A. Imran, M. A. ul Haq, Q. M. Khan, and M. Afzal, "Phytoremediation:
Recent advances in plant-endophytic synergistic interactions," Plant Soil, vol.
405, no. 1, pp. 179-195, 2015.
[81] Z. X. Chen, H. G. Ni, X. Jing, W. J. Chang, J. L. Sun, and H. Zeng, "Plant
uptake, translocation, and return of polycyclic aromatic hydrocarbons via fine
root branch orders in a subtropical forest ecosystem," Chemosphere, vol. 131,
no. 7, pp. 192-200, 2015.
[82] R. B. Meagher, "Phytoremediation of toxic elemental and organic pollutants,"
Curr. Opin. Plant Biol., vol. 3, no. 2, pp. 153-162, 2000.
[83] X. Liang, C. Guo, C. Liao, S. Liu, L. Y. Wick, D. Peng, Xi. Yi, G. Lu, H. Yin,
and Z. Lin, "Drivers and applications of integrated clean-up technologies for
surfactant-enhanced remediation of environments contaminated with polycyclic
aromatic hydrocarbons (PAHs)," Environ. Pollut., vol. 225, no. 67, pp. 129-140,
2017.
[84] R. Wei, J. Ni, X. Li, W. Chen, and Y. Yang, "Dissipation and phytoremediation
of polycyclic aromatic hydrocarbons in freshly spiked and long-term field-
contaminated soils," Environ. Sci. Pollut. Res., vol. 24, no. 9, pp. 7994-8003,
2017.
[85] R. Patowary, K. Patowary, A. Devi, M. C. Kalita, and S. Deka, "Uptake of total
petroleum hydrocarbon (TPH) and polycyclic aromatic hydrocarbons (PAHs)
by Oryza sativa L. Grown in Soil Contaminated with crude oil," B. Environ.
Contam. Toxicol. vol. 98, no. 1, pp. 120-126, 2017.
[86] K. E. Gerhardt, G. J. MacNeill, P. D. Gerwing, and B. M. Greenberg,
"Phytoremediation of Salt-Impacted Soils and Use of Plant Growth-Promoting
Rhizobacteria (PGPR) to Enhance Phytoremediation," in Phytoremediation,
CA: Springer, 2017, pp. 19-51.
[87] S. Kuppusamy, P. Thavamani, K. Venkateswarlu, Y. B. Lee, R. Naidu, and M.
Megharaj, "Remediation approaches for polycyclic aromatic hydrocarbons
(PAHs) contaminated soils: Technological constraints, emerging trends and
future directions," Chemosphere, vol. 168, no. 7, pp. 944-968, 2017.
Chapter 7 References
104
[88] J. C. Thomas, D. K. Russell, and C. L. Rugh, "Polyaromatic hydrocarbon
phytoremediation stimulated by root exudates," Int. J., vol. 5, no. 1, pp. 1-7,
2017.
[89] H. Yi and D. E. Crowley, "Biostimulation of PAH degradation with plants
containing high concentrations of linoleic acid," Environ. Sci. Technol., vol. 41,
no. 12, pp. 4382-4388, 2007.
[90] A. Patel and D. Patra, "A Sustainable Approach to Clean Contaminated Land
Using Terrestrial Grasses," in Phytoremediation Potential of Bioenergy Plants,
SG: Springer, 2017, pp. 305-331.
[91] L. P. Singha and P. Pandey, "Glutathione and glutathione-S-transferase activity
in Jatropha curcas in association with pyrene degrader Pseudomonas
aeruginosa PDB1 in rhizosphere, for alleviation of stress induced by
polyaromatic hydrocarbon for effective rhizoremediation," Ecol. Engg., vol.
102, no.7, pp. 422-432, 2017.
[92] H. Farraji, N. Q. Zaman, M. A. Zahed, and H. Faraji, "Role of Rhizoremediation
in Decontaminating Some Hazardous Pollutants," in Handbook of Research on
Inventive Bioremediation Techniques, MY: IGI Global, 2017, pp. 213-246.
[93] E. Shahsavari, A. Aburto-Medina, M. Taha, and A. S. Ball, "Phytoremediation
of PCBs and PAHs by Grasses: A Critical Perspective," in Phytoremediation,
USA: Springer, 2016, pp. 3-19.
[94] S. Yousaf, V. Andria, T. G. Reichenauer, K. Smalla, and A. Sessitsch,
"Phylogenetic and functional diversity of alkane degrading bacteria associated
with Italian ryegrass (Lolium multiflorum) and Birdsfoot trefoil (Lotus
corniculatus) in a petroleum oil-contaminated environment," J. Hazard. Mater.,
vol. 184, no. 1, pp. 523-532, 2010.
[95] P. McIntosh, C. P. Schulthess, Y. A. Kuzovkina, and K. Guillard, "Bio-and
phytoremediation of total petroleum hydrocarbons (TPH) under various
conditions," Int. J. Phytorem., doi.org/10.1080/15226514.2017.1284753, 2017.
[96] V. Safronova, G. Piluzza, S. Bullitta, and A. Belimov, "Use of Legume-Microbe
Symbioses for Phytoremediation of Heavy Metal Polluted Soils: Advantages
and Potential Problems," Handbook of Phytoremediation. USA: Nova Science,
Inc, 2011, pp. 443-469
[97] C. Brigido and B. R. Glick, "Phytoremediation Using Rhizobia," in
Phytoremediation, USA: Springer, 2015, pp. 95-114.
[98] S. Minoui, D. Minai-Tehrani, and M. H. Shahriari, "Phytoremediation of Crude
Oil-Contaminated Soil by Medicago sativa (Alfalfa) and the Effect of Oil on its
Growth," in Phytoremediation for Green Energy, NL: Springer, 2015. pp. 123-
129.
[99] S. Hussain, M. Akram, G. Abbas, B. Murtaza, M. Shahid, N. S. Shah, I. Bibi,
and N. K. Niazi, "Arsenic tolerance and phytoremediation potential of
Chapter 7 References
105
Conocarpus erectus L. and Populus deltoides L.," Int. J. Phytorem.,
doi.org/10.1080/15226514.2017.1303815. 2017.
[100] J. Luo, S. Qi, L. Peng, and X. Xie, "Enhanced phytoremediation capacity of a
mixed-species plantation of Eucalyptus globulus and Chickpeas," J. Geochem.
Explor., doi.org/10.1016/j.gexplo.2017.01.006, 2017.
[101] V. Iori, F. Pietrini, D. Bianconi, G. Mughini, A. Massacci, and M. Zacchini,
"Analysis of biometric, physiological, and biochemical traits to evaluate the
cadmium phytoremediation ability of eucalypt plants under hydroponics,"I.
Forest, vol. 10, no. 2, p. 416, 2017.
[102] N. Mathur, J. Singh, S. Bohra, A. Bohra, and A. Vyas, "Phytoremediation
potential of some multipurpose tree species of Indian Thar Desert in oil
contaminated soil," Adv. Environ. Biol., vol. 3. no. 1, pp. 131-138, 2010.
[103] M. Noroozi, M. A. Amozegar, R. Rahimi, S. A. S. Fazeli, and G. B. Khaniki,
"The isolation and preliminary characterization of native cyanobacterial and
microalgal strains from lagoons contaminated with petroleum oil in Khark
Island," Biol. J. Microorganism, vol. 5, no. 20, pp. 33-41 2017.
[104] A. Vaziri, E. Panahpour, and M. M. Beni, "Phytoremediation: A method for
treatment of petroleum hydrocarbon contaminated soils," Int. J. Farm. Alli. Sci.,
vol. 2, no. 21, pp. 909-913, 2013.
[105] R. Kamath, J. Rentz, J. L. Schnoor, and P. Alvarez, "Phytoremediation of
hydrocarbon-contaminated soils: Principles and applications," Stud. Surf. Sci.
Catal., vol. 151, no. 20, pp. 447-478, 2004.
[106] I. Kuiper, E. L. Lagendijk, G. V. Bloemberg, and B. J. Lugtenberg,
"Rhizoremediation: A beneficial plant-microbe interaction," Mol. Plant
Microbe. Interact., vol. 17, no. 1, pp. 6-15, 2004.
[107] M. Afzal, S. Khan, S. Iqbal, M. S. Mirza, and Q. M. Khan, "Inoculation method
affects colonization and activity of Burkholderia phytofirmans PsJN during
phytoremediation of diesel-contaminated soil," Int. Biodeter. Biodeger., vol. 85,
no. 1, pp. 331-336, 2013.
[108] S. Khan, M. Afzal, S. Iqbal, M. S. Mirza, and Q. M. Khan, "Inoculum
pretreatment affects bacterial survival, activity and catabolic gene expression
during phytoremediation of diesel contaminated soil," Chemosphere, vol. 91,
no. 5, pp. 663-668, 2013.
[109] M. Arslan, M. Afzal, I. Amin, S. Iqbal, and Q. M. Khan, "Nutrients can enhance
the abundance and expression of alkane hydroxylase CYP153 gene in the
rhizosphere of ryegrass planted in hydrocarbon-polluted soil," PloS One, vol. 9,
no. 10, p. e111208, 2014.
[110] P. Pandey, H. Pathak, and S. Dave, "Microbial ecology of hydrocarbon
degradation in the Soil: A Review," Res. J. Environ. Toxicol., vol. 10, no. 1, p.
1, 2016.
Chapter 7 References
106
[111] J. Truu, M. Truu, M. Espenberg, H. Nolvak, and J. Juhanson, "Phytoremediation
and plant-assisted bioremediation in soil and treatment wetlands: A review,"
Open. Biotech. J., vol. 9, no. 4, pp. 85-92, 2015.
[112] Y. Ma, M. Prasad, and M. Rajkumar, and H. Freitas, "Plant growth promoting
rhizobacteria and endophytes accelerate phytoremediation of metalliferous
soils," Biotechnol. Adv., vol. 29, no. 8, pp. 248-258, 2011.
[113] A. A. Belimov, V. I. Safronova, T. A. Sergeyeva, T. N. Egorova, V. A.
Matveyeva, and V. E. Tsyganov, "Characterization of plant growth promoting
rhizobacteria isolated from polluted soils and containing 1-aminocyclopropane-
1-carboxylate deaminase," Can. J. Microbiol., vol. 47, no. 2, pp. 642-652, 2001.
[114] M. Saleem, M. Arshad, S. Hussain, and A. S. Bhatti, "Perspective of plant
growth promoting rhizobacteria (PGPR) containing ACC deaminase in stress
agriculture," J. Ind. Microbiol. Biotechnol., vol. 34, no. 10, pp. 635-648, 2007.
[115] V. Spada, P. Iavazzo, R. Sciarrillo, and C. Guarino, "Successful Integrated
Bioremediation System of Hydrocarbon-Contaminated Soil at a Former Oil
Refinery Using Autochthonous Bacteria and Rhizo-microbiota," in
Phytoremediation, USA: Springer, 2017, pp. 53-76.
[116] J. A. Salam, M. A. Hatha, and N. Das, "Microbial-enhanced lindane removal by
sugarcane (Saccharum officinarum) in doped soil-applications in
phytoremediation and bioaugmentation," J. Environ. Manage., vol. 193, no. 56,
pp. 394-399, 2017.
[117] A. Benson, G. Ram, A. John, and M. Melvin Joe, "Inoculation of 1-
aminocyclopropane-1-carboxylate deaminase-producing bacteria along with
biosurfactant application enhances the phytoremediation efficiency of
Medicago sativa in hydrocarbon-contaminated soils," Biorem. J., vol. 21, no. 1,
pp. 20-29, 2017.
[118] V. Andria, T. G. Reichenauer, and A. Sessitsch, "Expression of alkane
monooxygenase (alkB) genes by plant-associated bacteria in the rhizosphere
and endosphere of Italian ryegrass (Lolium multiflorum L.) grown in diesel
contaminated soil," Environ. Pollut., vol. 157, no. 12, pp. 3347-3350, 2009.
[119] L. Yan, H. Sinkko, P. Penttinen, and K. Lindström, "Characterization of
successional changes in bacterial community composition during
bioremediation of used motor oil-contaminated soil in a boreal climate," Sci.
Total Environ., vol. 542, no. 13, pp. 817-825, 2016.
[120] B. Wang, W. Liu, X. Liu, A. E. Franks, Y. Teng, and Y. Luo, "Comparative
analysis of microbial communities during enrichment and isolation of DDT-
degrading bacteria by culture-dependent and-independent methods," Sci. Total
Environ., vol. 590, no. 13, pp. 297-303, 2017.
[121] I. Gandolfi, C. Canedoli, V. Imperato, I. Tagliaferri, P. Gkorezis, J.
Vangronsveld,E. P. Schioppa, M, Papacchini, G. Bestetti, and A. Franzetti,
"Diversity and hydrocarbon-degrading potential of epiphytic microbial
Chapter 7 References
107
communities on Platanus x acerifolia leaves in an urban area," Environ. Pollut.,
vol. 220, no. 67, pp. 650-658, 2017.
[122] J. Li, C. Luo, M. Song, Q. Dai, L. Jiang, D. Zhang, and G. Zhang,
"Biodegradation of phenanthrene in polycyclic aromatic hydrocarbon-
contaminated wastewater revealed by coupling cultivation-dependent and-
independent approaches," Environ. Sci. Technol., vol. 51, no. 12, pp. 3391-
3401, 2017.
[123] A. Y. Muratova, O. Turkovskaya, T. Hübner, and P. Kuschk, "Studies of the
efficacy of alfalfa and reed in the phytoremediation of hydrocarbon-polluted
soil," Appl. Biochem. Microbiol., vol. 39, no. 6, pp. 599-605, 2003.
[124] L. Vergani, F. Mapelli, E. Zanardini, E. Terzaghi, A. Di Guardo, C. Morosini,
G. Raspa, and S. Borin, "Phyto-rhizoremediation of polychlorinated biphenyl
contaminated soils: An outlook on plant-microbe beneficial interactions," Sci.
Total Environ., vol. 575, no. 7, pp. 1395-1406, 2017.
[125] J. C. Hernández-Vega, B. Cady, G. Kayanja, A. Mauriello, N. Cervantes, A.
Gillespie, L. Lavia, J. Trujillo, M Alkio, and A. C. Colon, "Detoxification of
polycyclic aromatic hydrocarbons (PAHs) in Arabidopsis Thaliana involves a
putative flavonol synthase," J. Hazard. Mater., vol. 321, no. 12, pp. 268-280,
2017.
[126] O. Abioye, U. Ijah, and S. Aransiola, "Phytoremediation of Soil Contaminants
by the Biodiesel Plant Jatropha curcas," in Phytoremediation Potential of
Bioenergy Plants, USA: Springer, 2017, pp. 97-137.
[127] Z. Kong and B. R. Glick, "The Role of Bacteria in Phytoremediation," in
Applied. Bioengineering, Germany: T. Yoshida, 2017, pp. 263-278.
[128] M. Adam, "Biodegradation of marine crude oil pollution using a salt-tolerant
bacterial consortium isolated from Bohai Bay, China," Marine pollut. B., vol.
105, no. 1, pp. 43-50, 2016.
[129] N. R. Maddela, R. Burgos, V. Kadiyala, A. R. Carrion, and M. Bangeppagari,
"Removal of petroleum hydrocarbons from crude oil in solid and slurry phase
by mixed soil microorganisms isolated from Ecuadorian oil fields," Int.
Biodeter. Biodegr., vol. 108, no. 7, pp. 85-90, 2016.
[130] M. Wu, X. Ye, K. Chen, W. Li, J. Yuan, and X. Jiang, "Bacterial community
shift and hydrocarbon transformation during bioremediation of short-term
petroleum-contaminated soil," Environ. Pollut., vol. 223, no. 5, pp. 657-664,
2017.
[131] J. W. Kang, "Removing environmental organic pollutants with bioremediation
and phytoremediation," Biotechnol. Lett., vol. 36, no. 6, pp. 1129-1139, 2014.
[132] M. Hassanshahian, M. S. Zeynalipour, and F. H. Musa, "Isolation and
characterization of crude oil degrading bacteria from the Persian Gulf
(Khorramshahr provenance)," Marine Pollut. B., vol. 82, no. 1, pp. 39-44, 2014.
Chapter 7 References
108
[133] P. Gkorezis, M. Daghio, A. Franzetti, J. D. Van Hamme, W. Sillen, and J.
Vangronsveld, "The interaction between plants and bacteria in the remediation
of petroleum hydrocarbons: An environmental perspective," Front. Microbiol.,
vol. 7, no. 1, p. 1836, 2016.
[134] R. Dong, L. Gu, C. Guo, F. Xun, and J. Liu, "Effect of PGPR Serratia
marcescens BC-3 and AMF Glomus intraradices on phytoremediation of
petroleum contaminated soil," Ecotoxicology, vol. 23, no. 4, pp. 674-680, 2014.
[135] C. A. Ajuzieogu, A. A. Ibiene, and H. O. Stanley, "Laboratory study on
influence of plant growth promoting rhizobacteria (PGPR) on growth response
and tolerance of Zea mays to petroleum hydrocarbon," Afr. J. Biotechnol., vol.
14, no. 43, pp. 2949-2956, 2015.
[136] J. Hou, W. Liu, B. Wang, Q. Wang, Y. Luo, and A. E. Franks, "PGPR enhanced
phytoremediation of petroleum contaminated soil and rhizosphere microbial
community response," Chemosphere, vol. 138, no. 12, pp. 592-598, 2015.
[137] P. Pizarro‐Tobias, J. L. Niqui, A. Roca, J. Solano, M. Fernández, F. Bastida, C
Garcia, and J. L Ramos, “Field trial on removal of petroleum‐hydrocarbon
pollutants using a microbial consortium for bioremediation and
rhizoremediation," Environ. Microbiol. Rep., vol. 7, no. 1, pp. 85-94, 2015.
[138] S. Thijs and J. Vangronsveld, "Rhizoremediation," in Principles of Plant-
Microbe Interactions, SUI: Springer, 2015, pp. 277-286.
[139] T. Fester, J. Giebler, L. Y. Wick, D. Schlosser, and M. Kästner, "Plant-microbe
interactions as drivers of ecosystem functions relevant for the biodegradation of
organic contaminants," Curr. Opinion Biotech., vol. 27, no. 12, pp. 168-175,
2014.
[140] S. D. Weert, H. Vermeiren, I. H. Mulders, I. Kuiper, N. Hendrickx, G. V.
Bloemberg, V. Jos, D. M, Rene, and B. J. J. Lugtenberg, "Flagella-driven
chemotaxis towards exudate components is an important trait for tomato root
colonization by Pseudomonas fluorescens," Mol. Plant Microbe Interact., vol.
15, no. 11, pp. 1173-1180, 2002.
[141] B. J. Lugtenberg, L. Dekkers, and G. V. Bloemberg, "Molecular determinants
of rhizosphere colonization by Pseudomonas," Ann. Rev. Phytopathol., vol. 39,
no. 1, pp. 461-490, 2001.
[142] F. Kamilova, L. V. Kravchenko, A. I. Shaposhnikov, T. Azarova, N. Makarova,
and B. Lugtenberg, "Organic acids, sugars, and L-tryptophane in exudates of
vegetables growing on stonewool and their effects on activities of rhizosphere
bacteria," Mol. Plant Microbe Interact., vol. 19, no. 3, pp. 250-256, 2006.
[143] M. K. Swamy, M. S. Akthar, and U. R. Sinniah, "Root Exudates and Their
Molecular Interactions with Rhizospheric Microbes," in Plant, Soil and
Microbes, USA: Springer, 2016, pp. 59-77.
[144] V. Oliveira, N. C. Gomes, M. Santos, A. Almeida, A. I. Lillebø, J. Ezequiel, J
Serôdio, A. M. S., Silva, M. M. Q. Simões, and S. M. Rocha, "Effects of the
Chapter 7 References
109
inoculant strain Pseudomonas sp. SPN31 nah+ and of 2-methylnaphthalene
contamination on the rhizosphere and endosphere bacterial communities of
Halimione portulacoides," Curr. Microbiol., vol. 74, no. 3, pp. 575-583, 2017.
[145] M. Shehzadi, K. Fatima, A. Imran, M. Mirza, Q. Khan, and M. Afzal, "Ecology
of bacterial endophytes associated with wetland plants growing in textile
effluent for pollutant-degradation and plant growth-promotion potentials," Plant
Biosyst., vol. 150, no. 6, pp. 1261-1270, 2016.
[146] P. K. Pandey, S. Singh, A. K. Singh, R. Samanta, R. N. S. Yadav, and M. C.
Singh, "Inside the plant: Bacterial endophytes and abiotic stress alleviation," J.
Appl. Natural Sci., vol. 8, no. 4, pp. 1899-1904, 2016.
[147] X. Zhu, W. Wang, K. Sun, X. Lin, S. Li, M. G. Waigi, and W. Ling, "Inoculating
wheat (Triticum aestivum L.) with the endophytic bacterium Serratia sp. PW7
to reduce pyrene contamination," Int. J. Phytorem.,
doi.org/10.1080/15226514.2017.1284747. 2017.
[148] J. Su, W. Ouyang, Y. Hong, D. Liao, S. Khan, and H. Li, "Responses of
endophytic and rhizospheric bacterial communities of salt marsh plant (Spartina
alterniflora) to polycyclic aromatic hydrocarbons contamination," J. Soils
Sediments, vol. 16, no. 2, pp. 707-715, 2016.
[149] P. Goodwin and W. Gao, "Increased bacterial endophyte populations in
Nicotiana benthamiana with a branched‐chain alkane mixture," Plant Pathol.,
doi.org/10.1111/ppa.12680, 2017.
[150] S. Compant, H. Kaplan, A. Sessitsch, J. Nowak, E. A. Barka, and C. Clément,
"Endophytic colonization of Vitis vinifera L. by Burkholderia phytofirmans
strain PsJN: from the rhizosphere to inflorescence tissues," FEMS Microbiol.
Ecol., vol. 63, no. 1, pp. 84-93, 2008.
[151] S. Compant, B. Reiter, A. Sessitsch, J. Nowak, C. Clément, and E. A. Barka,
"Endophytic colonization of Vitis vinifera L. by plant growth-promoting
bacterium Burkholderia sp. strain PsJN," Appl. Environ. Microbiol., vol. 71,
no. 4, pp. 1685-1693, 2005.
[152] M. Naveed, B. Mitter, S. Yousaf, M. Pastar, M. Afzal, and A. Sessitsch, "The
endophyte Enterobacter sp. FD17: A maize growth enhancer selected based on
rigorous testing of plant beneficial traits and colonization characteristics," Biol.
Fertil. Soils, vol. 50, no. 2, pp. 249-262, 2014.
[153] S. Compant, K. Saikkonen, B. Mitter, A. Campisano, and J. Mercado-Blanco,
"Editorial special issue: Soil, plants and endophytes," Plant Soil, vol. 405, no.
1-2, pp. 1-11, 2016.
[154] A. Pugazhendi, H. Abbad Wazin, H. Qari, J. M. Basahi, J. J. Godon, and J.
Dhavamani, "Biodegradation of low and high molecular weight hydrocarbons
in petroleum refinery wastewater by a thermophilic bacterial consortium,"
Environ. Technol., vol. 38, no. 3, pp.1-11, 2016.
Chapter 7 References
110
[155] J. A. Field, A. J. Stams, M. Kato, and G. Schraa, "Enhanced biodegradation of
aromatic pollutants in cocultures of anaerobic and aerobic bacterial consortia,"
Anton. Leeuw., vol. 67, no. 1, pp. 47-77, 1995.
[156] S. F. Nishino, J. C. Spain, and Z. He, "Strategies for Aerobic Degradation of
Nitroaromatic Compounds by Bacteria: Process Discovery to Field
Application," in Biodegradation of Nitroaromatic Compounds and Explosives,
UK: CRC press, 2000, pp. 7-61.
[157] M. Kulkarni and A. Chaudhari, "Microbial remediation of nitro-aromatic
compounds: An overview," J. Environ. Manage., vol. 85, no. 2, pp. 496-512,
2007.
[158] D. A. Abramowicz, "Aerobic and anaerobic biodegradation of PCBs: A
review," Crit. Rev. Biotechnol., vol. 10, no. 3, pp. 241-251, 1990.
[159] S. J. Varjani and V. N. Upasani, "A new look on factors affecting microbial
degradation of petroleum hydrocarbon pollutants," Int. Biodeterior. Biodegr.,
vol. 120, no. 3, pp. 71-83, 2017.
[160] F. S. Portugal, J. M. Dias, H. Ribeiro, C. Magalhães, A. P. Mucha, and A. S.
Danko, "Anaerobic biodegradation of ethylic and methylic biodiesel and their
impact on benzene degradation," Clean Soil Air Water,
doi:10.1002/clen.201600264, 2017.
[161] T. Lueders, "The ecology of anaerobic degraders of BTEX hydrocarbons in
aquifers," FEMS Microbiol. Ecol., vol. 93, no. 1, p. 220, 2017.
[162] P. Arulazhagan, S. Mnif, J. R. Banu, Q. Huda, and M. Jalal, "HC-0B-01:
Biodegradation of Hydrocarbons by Extremophiles," in Biodegradation and
Bioconversion of Hydrocarbons, Germany: Springer, 2017, pp. 137-162.
[163] A. K. Ghattas, F. Fischer, A. Wick, and T. Ternes, "Anaerobic biodegradation
of (emerging) organic contaminants in the aquatic environment," Water Res.,
vol. 116, no. 3, pp. 268-295, 2017.
[164] D. F. Aktas, K. R. Sorrell, K. E. Duncan, B. Wawrik, A. V. Callaghan, and J.
M. Suflita, "Anaerobic hydrocarbon biodegradation and biocorrosion of carbon
steel in marine environments: The impact of different ultra-low sulfur diesels
and bioaugmentation," Int. Biodeter. Biodegr., vol. 118, no. 2, pp. 45-56, 2017.
[165] R. Peixoto, A. Vermelho, and A. Rosado, "Petroleum-degrading enzymes:
Bioremediation and new prospects," Enzyme Res., vol. 2011, no. 1, pp. 1-7,
2011.
[166] M. Throne-Holst, A. Wentzel, T. E. Ellingsen, H. K. Kotlar, and S. B. Zotchev,
"Identification of novel genes involved in long-chain n-alkane degradation by
Acinetobacter sp. strain DSM 17874," Appl. Environ. Microbiol., vol. 73, no.
10, pp. 3327-3332, 2007.
[167] C. Muangchinda, S. Chavanich, V. Viyakarn, K. Watanabe, S. Imura, A.
Vangnai, and O. Pinyakong, "Abundance and diversity of functional genes
Chapter 7 References
111
involved in the degradation of aromatic hydrocarbons in Antarctic soils and
sediments around Syowa station," Environ. Sci. Pollut. Res., vol. 22, no. 6, pp.
4725-4735, 2015.
[168] S. Yousaf, K. Ripka, T. Reichenauer, V. Andria, M. Afzal, and A. Sessitsch,
"Hydrocarbon degradation and plant colonization by selected bacterial strains
isolated from Italian ryegrass and birdsfoot trefoil," J. Appl. Microbiol., vol.
109, no. 1, pp. 1389-1401, 2010.
[169] M. C. Deng, J. Li, F. R. Liang, M. Yi, X. M. Xu, J. P. Yuan, C. F. Wu, and J.
H. Wang, "Isolation and characterization of a novel hydrocarbon-degrading
bacterium Achromobacter sp. HZ01 from the crude oil-contaminated seawater
at the Daya Bay, southern China," Marine Pollut. B., vol. 83, no.1, pp. 79-86,
2014.
[170] M. Udgire, N. Shah, and M. Jadhav, "Enrichment, isolation and identification
of hydrocarbon degrading bacteria," Int. J. Curr. Microbiol. Appl. Sci, vol. 4,
no. 6, pp. 708-13, 2015.
[171] F. Rasche, H. Velvis, C. Zachow, G. Berg, J. D. Van Elsas, and A. Sessitsch,
"Impact of transgenic potatoes expressing anti‐bacterial agents on bacterial
endophytes is comparable with the effects of plant genotype, soil type and
pathogen infection," J. Appl. Ecol., vol. 43, no. 3, pp. 555-566, 2006.
[172] A. K. Yadav, S. Manna, K. Pandiyan, A. Singh, M. Kumar, H. Chakdar, P. L.
Kashyap, and A. K. Srivastava, "Isolation and characterization of biosurfactant
producing Bacillus sp. from diesel fuel-contaminated site," Microbiology, vol.
85, no. 1, pp. 56-62, 2016.
[173] T. Ichor, P. Okerentugba, and G. Okpokwasili, "Biodegradation of total
petroleum hydrocarbon by a consortium of cyanobacteria isolated from crude
oil polluted brackish waters of Bodo Creeks in Ogoniland, Rivers State," Res.
J. Environ. Toxicol., vol. 10, no. 1, pp. 1-16, 2016.
[174] R. Tahseen, M. Afzal, S. Iqbal, G. Shabir, Q. M. Khan, Z. M. Khalid, and I. M.
Banat, "Rhamnolipids and nutrients boost remediation of crude oil-
contaminated soil by enhancing bacterial colonization and metabolic activities,"
Int. Biodeter. Biodegr., vol. 115, no. 4, pp. 192-198, 2016.
[175] M. Hassanshahian, M. Ahmadinejad, H. Tebyanian, and A. Kariminik,
"Isolation and characterization of alkane degrading bacteria from petroleum
reservoir waste water in Iran (Kerman and Tehran provenances)," Marine
Pollut. B., vol. 73, no. 1, pp. 300-305, 2013.
[176] S. Min, L. Qun, S. Xian-rong, H. Deng-yong, H. Ying, and S. Zhan, "Isolation
and identification of biodegradation ability of alkane-degrading bacteria:
Molecular detection and analysis of alkane hydroxylase genes," Afr. J.
Microbiol. Res., vol. 6, no. 17, pp. 3936-3943, 2012.
[177] D. Hou, Z. Shi, X. Shen, Y. He, M. Sun, and Q. Wang, "Isolation, identification
and alkane hydroxylase genes detection of a marine diesel-degrading bacterial
strain (F9)," Afr. J. Microbiol. Res., vol. 7, no. 3, pp. 2794-2802, 2013.
Chapter 7 References
112
[178] R. Pikovskaya, "Mobilization of phosphorus in soil in connection with vital
activity of some microbial species," Mikrobiologiya, vol. 17, no. 362, p. e370,
1948.
[179] S. A. Gordon and R. P. Weber, "Colorimetric estimation of indoleacetic acid,"
Plant Physiol., vol. 26, no. 1, pp. 192-5, 1951.
[180] A. K. Reddy, R. Ashok, M. Majety, M. Chitta, and N. Narayen, "Fungal keratitis
due to Schizophyllum commune: An emerging pathogenic fungus," Mycoses.
vol. 59, no. 12, pp. 757-759, 2016.
[181] B. Schwyn and J. B. Neilands, "Universal chemical assay for the detection and
determination of siderophores," Anal. Biochem., vol. 160, no. 1, pp. 47-56,
1987.
[182] M. Dworkin and J. W. Foster, "Experiments with some microorganisms which
utilize ethane and hydrogen," J. Bacteriol., vol. 75, no. 5, pp. 592-603, 1958.
[183] A. Imran, M. J. A. Saadalla, S. U. Khan, M. S. Mirza, K. A. Malik, and F. Y.
Hafeez, "Ochrobactrum sp. Pv2Z2 exhibits multiple traits of plant growth
promotion, biodegradation and N-acyl-homoserine-lactone quorum sensing,"
Ann. Microbiol., vol. 64, no. 4, pp. 1797-1806, 2014.
[184] V. A. Cavalcante and J. Dobereiner, "A new acid-tolerant nitrogen-fixing
bacterium associated with sugarcane," Plant Soil, vol. 108, no. 1, pp. 23-31,
1988.
[185] J. M. Wilkinson and H. Cavanagh, "Antibacterial activity of essential oils from
Australian native plants," Phytother. Res., vol. 19, no. 7, pp. 643-646, 2005.
[186] M. F. Gonzales, T. Brooks, S. U. Pukatzki, and D. Provenzano, "Rapid protocol
for preparation of electrocompetent Escherichia coli and Vibrio cholerae," J.
Vis. Exp., vol. 8, no. 80, pp. e50684-e50684, 2013.
[187] R. S. Al-Wasify and S. R. Hamed, "Bacterial biodegradation of crude oil using
local isolates," Int. J. Bacteriol., vol. 2014, no. 12. pp. 1-8, 2014.
[188] W.T. Chen, Y. Zhang, J. Zhang, L. Schideman, G. Yu, P. Zhang, M. Minaric,
"Co-liquefaction of swine manure and mixed-culture algal biomass from a
wastewater treatment system to produce bio-crude oil," Appl. Energy, vol. 128,
no. 23, pp. 209-216, 2014.
[189] J. H. Cohen, L. R. McCormick, and S. M. Burkhardt, "Effects of dispersant and
oil on survival and swimming activity in a marine copepod," B. Environ.
Contam. Toxicol., vol. 92, no. 4, pp. 381-387, 2014.
[190] J. A. Anderson, A. J. Kuhl, and A. N. Anderson, "Toxicity of oil and dispersed
oil on juvenile mud crabs, Rhithropanopeus harrisii," B. Environ. Contam.
Toxicol., vol. 92, no. 4, pp. 375-380, 2014.
[191] X. Lin, X. Li, P. Li, F. Li, L. Zhang, and Q. Zhou, "Evaluation of plant-
microorganism synergy for the remediation of diesel fuel contaminated soil," B.
Environ. Contam. Toxicol., vol. 81, no. 1, pp. 19-24, 2008.
Chapter 7 References
113
[192] M. Afzal, S. Yousaf, T. G. Reichenauer, and A. Sessitsch, "Ecology of alkane-
degrading bacteria and their interaction with the plant," Mol. Microbial. Ecol.
Rhizosphere, vol. 2, no. 5, pp. 975-989, 2013.
[193] A. Sessitsch, B. Reiter, U. Pfeifer, and E. Wilhelm, "Cultivation-independent
population analysis of bacterial endophytes in three potato varieties based on
eubacterial and Actinomycetes-specific PCR of 16S rRNA genes," FEMS
Microbiol. Ecol., vol. 39, no. 1, pp. 23-32, 2002.
[194] M. Tesar, T. G. Reichenauer, and A. Sessitsch, "Bacterial rhizosphere
populations of black poplar and herbal plants to be used for phytoremediation
of diesel fuel," Soil Biol. Biochem., vol. 34, no. 12, pp. 1883-1892, 2002.
[195] A. Frank and W. Dugas, "Carbon dioxide fluxes over a northern, semiarid,
mixed-grass prairie," Agric. For. Meteorol., vol. 108, no. 4, pp. 317-326, 2001.
[196] J. B. Van Beilen and E. G. Funhoff, "Alkane hydroxylases involved in microbial
alkane degradation," Appl. Microbiol. Biotechnol., vol. 74, no. 1, pp. 13-21,
2007.
[197] E. O. Nwaichi, E. N. Onyeike, and M. O. Wegwu, "Characterization and safety
evaluation of the impact of hydrocarbon contaminants on ecological receptors,"
B. Environ. Contam. Toxicol., vol. 85, no. 2, pp. 199-204, 2010.
[198] A. Peng, J. Liu, Y. Gao, and Z. Chen, "Distribution of endophytic bacteria in
Alopecurus aequalis Sobol and Oxalis corniculata L. from soils contaminated
by polycyclic aromatic hydrocarbons," PloS One, vol. 8, no. 12, p. e83054,
2013.
[199] R. Costa, M. Götz, N. Mrotzek, J. Lottmann, G. Berg, and K. Smalla, "Effects
of site and plant species on rhizosphere community structure as revealed by
molecular analysis of microbial guilds," FEMS Microbiol. Ecol., vol. 56, no. 2,
pp. 236-249, 2006.
[200] F. Marseille, J. Disnar, B. Guillet, and Y. Noack, "Alkanes and free fatty acids
in humus and A1 horizons of soils under beech, spruce and grass in the Massif‐
Central (Mont‐Lozère), France," Eur. J. Soil Sci., vol. 50, no. 3, pp. 433-441,
1999.
[201] S. D. Siciliano, N. Fortin, A. Mihoc, G. Wisse, S. Labelle, D. Beaumier, D.
Ouellette, R. Roy, L. G. Whyte, M. K. Banks, "Selection of specific endophytic
bacterial genotypes by plants in response to soil contamination," Appl. Environ.
Microbiol., vol. 67, no. 6, pp. 2469-2475, 2001.
[202] T. Tourova, D. S. Sokolova, E. Semenova, E. Shumkova, A. Korshunova, T.
Babich, A. B. Poltaraus, and T. N. Nazina, "Detection of n-alkane
biodegradation genes alkB and ladA in thermophilic hydrocarbon-oxidizing
bacteria of the genera Aeribacillus and Geobacillus," Microbiology, vol. 85, no.
6, pp. 693-707, 2016.
[203] J. K. Vessey, "Plant growth promoting rhizobacteria as biofertilizers," Plant
Soil, vol. 255, no. 2, pp. 571-586, 2003.
Chapter 7 References
114
[204] M. Ahemad and M. Kibret, "Mechanisms and applications of plant growth
promoting rhizobacteria: Current perspective," J. King Saud Univ. Sci., vol. 26,
no. 2, pp. 1-20, 2014.
[205] H. S. Auta, U. Ijah, and M. Mojuetan, "Bioaugumentation of crude oil
contaminated soil using bacterial consortium," Adv. Sci. Focus, vol. 2, no. 2,
pp. 26-33, 2014.
[206] C. Jidere, F. Akamigbo, and J. Ugwuanyi, "Phytoremediation potentials of
cowpea (Vigina unguiculata) and maize (Zea mays) for hydrocarbon
degradation in organic and inorganic manure-amended tropical typic
paleustults," Int. J. Phytorem., vol. 14, no. 4, pp. 362-373, 2012.
[207] F. P. Moore, T. Barac, B. Borremans, L. Oeyen, J. Vangronsveld, D. Van der
Lelie, C. D. Cambell, and R. B. E. Moore, "Endophytic bacterial diversity in
poplar trees growing on a BTEX-contaminated site: The characterisation of
isolates with potential to enhance phytoremediation," Syst. Appl. Microbiol.,
vol. 29, no. 7, pp. 539-556, 2006.
[208] D. B. Kearns, F. Chu, S. S. Branda, R. Kolter, and R. Losick, "A master
regulator for biofilm formation by Bacillus subtilis," Mol. Microbiol., vol. 55,
no. 3, pp. 739-749, 2005.
[209] T. Das, H. Gohel, M. Panchal, S. Ghosh, and V. Braganza, "Determination of
crude oil degradation efficiency of glass biofilm of isolated bacterium and
fungus," Int. Res. J. Biol. Sci, vol. 3, no. 2, pp. 67-69, 2014.
[210] S. J. Pamp and T. Tolker-Nielsen, "Multiple roles of biosurfactants in structural
biofilm development by Pseudomonas aeruginosa," J. bacteriol., vol. 189, no.
6, pp. 2531-2539, 2007.
[211] P. M. Tribelli, C. Di Martino, N. I. López, and L. J. R. Iustman, "Biofilm
lifestyle enhances diesel bioremediation and biosurfactant production in the
Antarctic polyhydroxyalkanoate producer Pseudomonas extremaustralis,"
Biodegradation, vol. 23, no. 5, pp. 645-651, 2012.
[212] R. Singh, D. Paul, and R. K. Jain, "Biofilms: Implications in bioremediation,"
Trends Microbiol., vol. 14, no. 9, pp. 389-397, 2006.
[213] K. Sun, J. Liu, Y. Gao, L. Jin, Y. Gu, and W. Wang, "Isolation, plant
colonization potential, and phenanthrene degradation performance of the
endophytic bacterium Pseudomonas sp. Ph6-gfp," Sci. Rep., vol. 4, pp. 345-
352, no. 1, 2014.
[214] M. Y. Ashraf, A. R. Awan, and K. Mahmood, "Rehabilitation of saline
ecosystems through cultivation of salt tolerant plants," Pak. J. Bot., vol. 44, no.
3, pp. 69-75, 2012.
[215] M. Shahid, S. Hameed, A. Imran, S. Ali, and J. D. V. Elsas, "Root colonization
and growth promotion of sunflower (Helianthus annuus L.) by phosphate
solubilizing Enterobacter sp. Fs-11," World J. Microbiol. Biotechnol., vol. 28,
no. 8, pp. 2749-2758, 2012.
Chapter 7 References
115
[216] N. Wu, K. Matand, B. Kebede, G. Acquaah, and S. Williams, "Enhancing DNA
electrotransformation efficiency in Escherichia coli DH10B electrocompetent
cells," Electron. J. Biotechnol., vol. 13, no. 5, pp. 21-22, 2010.
[217] S. J. Varjani, D. P. Rana, A. K. Jain, S. Bateja, and V. N. Upasani, "Synergistic
ex-situ biodegradation of crude oil by halotolerant bacterial consortium of
indigenous strains isolated from on shore sites of Gujarat, India," Int.
Biodeterior. Biodegr., vol. 103, no. 1, pp. 116-124, 2015.
[218] K. Das and A. K. Mukherjee, "Crude petroleum-oil biodegradation efficiency
of Bacillus subtilis and Pseudomonas aeruginosa strains isolated from a
petroleum-oil contaminated soil from North-East India," Bioresour. Technol.,
vol. 98, no. 7, pp. 1339-1345, 2007.
[219] S. Shankar, C. Kansrajh, M. Dinesh, R. Satyan, S. Kiruthika, and A.
Tharanipriya, "Application of indigenous microbial consortia in bioremediation
of oil-contaminated soils," Int. J. Environ. Sci. Technol., vol. 11, no. 2, pp. 367-
376, 2014.
[220] A. A. Burghal, N. A. Al-Mudaffarand, and K. H. Mahdi, "Ex situ
bioremediation of soil contaminated with crude oil by use of actinomycetes
consortia for process bioaugmentation," Eur. J. Exp. Biol., vol. 5, no. 5, pp. 24-
30, 2015.
[221] Y. Hong, D. Liao, J. Chen, S. Khan, J. Su, and H. Li, "A comprehensive study
of the impact of polycyclic aromatic hydrocarbons (PAHs) contamination on
salt marsh plants Spartina alterniflora: Implication for plant-microbe
interactions in phytoremediation," Environ. Sci. Pollut. Res., vol. 22, no. 9, pp.
7071-7081, 2015.
[222] T. J. McGenity, B. D. Folwell, B. A. McKew, and G. O. Sanni, "Marine crude-
oil biodegradation: A central role for interspecies interactions," Aquat. Biosyst.,
vol. 8, no. 1, pp. 10.-12, 2012.
[223] U. Deppe, H. H. Richnow, W. Michaelis, and G. Antranikian, "Degradation of
crude oil by an arctic microbial consortium," Extremophiles, vol. 9, no. 6, pp.
461-470, 2005.
[224] P. S. Stewart and M. J. Franklin, "Physiological heterogeneity in biofilms,"
Nature Rev. Microbiol., vol. 6, no. 3, pp. 199-210, 2008.
[225] E. Benizri, E. Baudoin, and A. Guckert, "Root colonization by inoculated plant
growth-promoting rhizobacteria," Biocontrol Sci. Technol., vol. 11, no. 5, pp.
557-574, 2001.
[226] K. L. Newman, R. P. Almeida, A. H. Purcell, and S. E. Lindow, "Use of a green
fluorescent strain for analysis of Xylella fastidiosa colonization of Vitis
vinifera," Appl. Environ. Microbiol., vol. 69, no. 12, pp. 7319-7327, 2003.
[227] T. C. Lin, P. T. Pan, and S. S. Cheng, "Ex situ bioremediation of oil-
contaminated soil," J. Hazard. Mater., vol. 176, no. 1, pp. 27-34, 2010.
Chapter 7 References
116
[228] N. Tara, M. Afzal, T. M. Ansari, R. Tahseen, S. Iqbal, and Q. M. Khan,
"Combined use of alkane-degrading and plant growth-promoting bacteria
enhanced phytoremediation of diesel contaminated soil," Int. J. Phytorem., vol.
16, no. 12, pp. 1268-1277, 2014.
[229] F. Fernández-Luqueño, C. Valenzuela-Encinas, R. Marsch, C. Martínez-Suárez,
E. Vázquez-Núñez, and L. Dendooven, "Microbial communities to mitigate
contamination of PAHs in soil-possibilities and challenges: A review," Environ.
Sci. Pollut. Res., vol. 18, no. 1, pp. 12-30, 2011.
[230] B. Mitter, A. Petric, M. W. Shin, P. S. Chain, L. Hauberg-Lotte, B. Reinhold-
Hurek, J. Nowak, and A. Sessitsch, "Comparative genome analysis of
Burkholderia phytofirmans PsJN reveals a wide spectrum of endophytic
lifestyles based on interaction strategies with host plants," Front. Plant Sci., vol.
4, no. 12, p. 120, 2013.
[231] X. Sheng, X. Chen, and L. He, "Characteristics of an endophytic pyrene-
degrading bacterium of Enterobacter sp. 12J1 from Allium macrostemon
Bunge," Int. Biodeterior. Biodegr., vol. 62, no. 2, pp. 88-95, 2008.
[232] E. Joner, S. Corgie, N. Amellal, and C. Leyval, "Nutritional constraints to
degradation of polycyclic aromatic hydrocarbons in a simulated rhizosphere,"
Soil Biol. Biochem., vol. 34, no. 6, pp. 859-864, 2002.
[233] G. Shabir, M. Afzal, F. Anwar, R. Tahseen, and Z. M. Khalid, "Biodegradation
of kerosene in soil by a mixed bacterial culture under different nutrient
conditions," Int. Biodeter. Biodegr., vol. 61, no. 2, pp. 161-166, 2008.
[234] S. Yousaf, M. Afzal, T. G. Reichenauer, C. L. Brady, and A. Sessitsch,
"Hydrocarbon degradation, plant colonization and gene expression of alkane
degradation genes by endophytic Enterobacter ludwigii strains," Environ.
Pollut., vol. 159, no. 10, pp. 2675-2683, 2011.
[235] F. Ghazisaeedi, M. M. Zamani, S. Ghadbeigi, S. H. Mortazavi, M. Fallahpour,
H. Ghazisaidi, M. Zamani, A. Bakhtiarian, N. A. K, Sima, and M. Amini,
"Bioremediation of the crude oil contamination of soil by the indigenous,
herbaceous Slant salicorniaeuropea in Iran," Thrita, vol. 3, no. 2, p. e17409,
2014.
[236] M. Andreolli, S. Lampis, M. Poli, G. Gullner, B. Biró, and G. Vallini,
"Endophytic Burkholderia fungorum DBT1 can improve phytoremediation
efficiency of polycyclic aromatic hydrocarbons," Chemosphere, vol. 92, no. 6,
pp. 688-694, 2013.
[237] R. Marecik, Ł. Chrzanowski, A. Piotrowska-Cyplik, W. Juzwa, and R.
Biegańska-Marecik, "Rhizosphere as a tool to introduce a soil-isolated
hydrocarbon-degrading bacterial consortium into a wetland environment," Int.
Biodeter. Biodegr., vol. 97, no. 3, pp. 135-142, 2015.
[238] X. Zhu, X. Ni, J. Liu, and Y. Gao, "Application of endophytic bacteria to reduce
persistent organic pollutants contamination in plants," Clean Soil Air Water,
vol. 42, no. 3, pp. 306-310, 2014.
Chapter 7 References
117
[239] J. Pandey, A. Chauhan, and R. K. Jain, "Integrative approaches for assessing
the ecological sustainability of in situ bioremediation," FEMS Microbiol. Rev.,
vol. 33, no. 2, pp. 324-375, 2009.
[240] M. Tyagi, M. M. R. da Fonseca, and C. C. D. Carvalho, "Bioaugmentation and
biostimulation strategies to improve the effectiveness of bioremediation
processes," Biodegradation, vol. 22, no. 2, pp. 231-241, 2011.
[241] A. S. Roy, R. Baruah, M. Borah, A. K. Singh, H. P. D. Boruah, N. Saikia, M.
Deka, N, Dutta, and T. C. Bora, "Bioremediation potential of native
hydrocarbon degrading bacterial strains in crude oil contaminated soil under
microcosm study," Int. Biodeter. Biodegr., vol. 94, no. 2, pp. 79-89, 2014.
[242] C. B. Smith, B. B. Tolar, J. T. Hollibaugh, and G. M. King, "Alkane hydroxylase
gene (alkB) phylotype composition and diversity in northern Gulf of Mexico
bacterioplankton," Front. Microbiol., vol. 4, no. 1, p. 370, 2013.
[243] G. F. Enrique, F. T. Wakida, D. D. Rodríguez-Mendivil, and H. Espinoza-
Gomez, "Polycyclic aromatic hydrocarbons in road deposited sediments and
roadside soil in Tijuana, Mexico," Soil Sedim. Contam., vol. 25, no. 3, pp. 235-
239, 2016.
[244] L. A. Farahat and N. S. El-Gendy, "Biodegradation of Baleym mix crude oil in
soil microcosm by some locally isolated Egyptian bacterial strains," Soil Sedim.
Contam., vol. 17, no. 3, pp. 150-162, 2008.
[245] S. Sutton, "Measurement of microbial cells by optical density," J. Validation
Technol., vol. 17, no. 1, p. 46, 2011.
[246] F. Ahmad, "Leptochloa fusca cultivation for utilization of salt-affected soil and
water resources in Cholistan Desert," Soci. Nature, vol. 22, no. 1, pp. 141-149,
2010.
[247] M. Mohanty and H. K. Patra, "Phytoremediation potential of para grass: An in
situ approach for chromium contaminated soil," Int. J. of Phytorem, vol. 14, no.
1, pp. 796-805, 2012.
[248] J. Tang, M. Wang, F. Wang, Q. Sun, and Q. Zhou, "Eco-toxicity of petroleum
hydrocarbon contaminated soil," J. Environ. Sci., vol. 23, no. 3, pp. 845-851,
2011.
[249] J. P. Salanitro, P. B. Dorn, M. H. Huesemann, K. O. Moore, I. A. Rhodes, L. M.
Rice Jackson, T. M. Vipnod, M. M. Western, and H. L. Wisniewski, "Crude oil
hydrocarbon bioremediation and soil ecotoxicity assessment," Environ. Sci.
Technol., vol. 31, no. 6, pp. 1769-1776, 1997.
[250] L. A. Phillips, J. J. Germida, R. E. Farrell, and C. W. Greer, "Hydrocarbon
degradation potential and activity of endophytic bacteria associated with prairie
plants," Soil Biol. Biochem., vol. 40, no. 12, pp. 3054-3064, 2008.
Chapter 7 References
118
[251] J. L. Kirk, J. N. Klironomos, H. Lee, and J. T. Trevors, "The effects of perennial
ryegrass and alfalfa on microbial abundance and diversity in petroleum
contaminated soil," Environ. Pollut., vol. 133, no. 3, pp. 455-465, 2005.
[252] B. Gogoi, N. Dutta, P. Goswami, and T. K. Mohan, "A case study of
bioremediation of petroleum-hydrocarbon contaminated soil at a crude oil spill
site," Adv. Environ. Res., vol. 7, no. 4, pp. 767-782, 2003.
[253] N. J. Pino, L. M. Muñera, and G. A. Peñuela, "Bioaugmentation with
immobilized microorganisms to enhance phytoremediation of PCB-
contaminated soil," Soil Sedim. Contam., vol. 25, no. 3, pp. 419-430, 2016.
[254] Y. Xu and M. Lu, "Bioremediation of crude oil-contaminated soil: Comparison
of different biostimulation and bioaugmentation treatments," J. Hazard. Mater.,
vol. 183, no. 1, pp. 395-401, 2010.
[255] T. G. Reichenauer and J. J. Germida, "Phytoremediation of organic
contaminants in soil and groundwater," ChemSusChem, vol. 1, no. 1-2, pp. 708-
717, 2008.
[256] K. Fatima, M. Afzal, A. Imran, and Q. M. Khan, "Bacterial rhizosphere and
endosphere populations associated with grasses and trees to be used for
phytoremediation of crude Oil contaminated soil," B. Environ. Contam.
Toxicol., vol. 94, no. 3, pp. 314-320, 2015.
[257] E. Kaimi, T. Mukaidani, and M. Tamaki, "Screening of twelve plant species for
phytoremediation of petroleum hydrocarbon-contaminated soil," Plant Prod.
Sci., vol. 10, no. 2, pp. 211-218, 2007.
[258] B. Kołwzan, "Effect of bioremediation on genotoxicity of soil contaminated
with diesel oil," Environ. Prot. Engg., vol. 35, no. 1, pp. 95-103, 2009.
[259] K. J. Germaine, E. Keogh, D. Ryan, and D. N. Dowling, "Bacterial endophyte-
mediated naphthalene phytoprotection and phytoremediation," FEMS
Microbiol. Lett., vol. 296, no. 2, pp. 226-234, 2009.
[260] J. M. Ayotamuno, R. B. Kogbara, E. A. Agele, and O. S. Agoro, "Composting
and phytoremediation treatment of petroleum sludge," Soil Sedim. Contam.,
vol. 19, no. 6, pp. 686-695, 2010.
[261] K. Fatima, A. Imran, I. Amin, Q. Khan, and M. Afzal, "Plant species affect
colonization patterns and metabolic activity of associated endophytes during
phytoremediation of crude oil-contaminated soil," Environ. Sci. Pollut. Res.,
vol. 23, no. 7, pp. 6188-6196, 2016.
[262] S. H. Lee, W. S. Lee, C. H. Lee, and J. G. Kim, "Degradation of phenanthrene
and pyrene in rhizosphere of grasses and legumes," J. Hazard. Mater., vol. 153,
no. 1, pp. 892-898, 2008.
[263] M. Rosenblueth and E. Martínez-Romero, "Bacterial endophytes and their
interactions with hosts," Mol. Plant Microbe. Interact., vol. 19, no. 8, pp. 827-
837, 2006.
Chapter 7 References
119
[264] A. S. Costa, L. Romão, B. Araújo, S. Lucas, S. Maciel, and A. Wisniewski,
"Environmental strategies to remove volatile aromatic fractions (BTEX) from
petroleum industry wastewater using biomass," Bioresour. Technol., vol. 105,
no. 3, pp. 31-39, 2012.
[265] B. Anifowose, D. Lawler, D. van der Horst, and L. Chapman, "A systematic
quality assessment of environmental impact statements in the oil and gas
industry," Sci. Total Environ., vol. 572, no. 1, pp. 570-585, 2016.
[266] M. Smith, T. Flowers, H. Duncan, and J. Alder, "Effects of polycyclic aromatic
hydrocarbons on germination and subsequent growth of grasses and legumes in
freshly contaminated soil and soil with aged PAHs residues," Environ. Pollut.,
vol. 141, no. 3, pp. 519-525, 2006.
[267] P. A. Kulakow, A. Schwab, and M. Banks, "Screening plant species for growth
on weathered, petroleum hydrocarbon-contaminated sediments," Int. J.
Phytorem., vol. 2, no. 4, pp. 297-317, 2000.
[268] I. M. Banat, A. Franzetti, I. Gandolfi, G. Bestetti, M. G. Martinotti, and L.
Fracchia, "Microbial biosurfactants production, applications and future
potential," Appl. Microbiol. Biotech., vol. 87, no. 2, pp. 427-444, 2010.
[269] W. W. Wenzel, "Rhizosphere processes and management in plant-assisted
bioremediation (phytoremediation) of soils," Plant Soil, vol. 321, no. 1-2, pp.
385-408, 2009.
[270] S. M. Nardeli, C. F. Saad, P. de Barros Rossetto, V. S. Caetano, M. Ribeiro-
Alves, and J. E. S. Paes, "Transcriptional responses of Arabidopsis thaliana to
oil contamination," Environ. Exp. Bot., vol. 127, no. 3, pp. 63-72, 2016.
[271] J. Rezek, C. I. D. Wiesche, M. Mackova, F. Zadrazil, and T. Macek, "The effect
of ryegrass (Lolium perenne) on decrease of PAH content in long term
contaminated soil," Chemosphere, vol. 70, no. 9, pp. 1603-1608, 2008.
[272] S. Gaskin, K. Soole, and R. Bentham, "Screening of Australian native grasses
for rhizoremediation of aliphatic hydrocarbon-contaminated soil," Int. J.
Phytorem., vol. 10, no. 5, pp. 378-389, 2008.
[273] A. Hartmann, M. Schmid, D. Van Tuinen, and G. Berg, "Plant-driven selection
of microbes," Plant Soil, vol. 321, no. 1-2, pp. 235-257, 2009.
[274] M. S. Olson, R. M. Ford, J. A. Smith, and E. J. Fernandez, "Quantification of
bacterial chemotaxis in porous media using magnetic resonance imaging,"
Environ. Sci. Technol., vol. 38, no. 14, pp. 3864-3870, 2004.
[275] C. Zou, M. Wang, Y. Xing, G. Lan, T. Ge, and X. Yan, "Characterization and
optimization of biosurfactants produced by Acinetobacter baylyi ZJ2 isolated
from crude oil-contaminated soil sample toward microbial enhanced oil
recovery applications," Biochem. Engg. J., vol. 90, no. 2, pp. 49-58, 2014.
[276] S. J. Varjani, "Microbial degradation of petroleum hydrocarbons," Bioresour.
Technol., vol. 223, no.2, pp. 277-286, 2017.
Chapter 7 References
120
[277] A. Rajasekar, S. Maruthamuthu, Y. Ting, R. Balasubramanian, and P. K.
Rahman, "Bacterial Degradation of Petroleum Hydrocarbons," in Microbial
Degradation of Xenobiotics, USA: Springer, 2012, pp. 339-369.
[278] M. Nurul, "Microbial Degradation of Petroleum Hydrocarbon," Banglad. Soci.
Microbiol. vol. 27, no. 4, pp. 10-13, 2011.
[279] F. Ahamed, M. Hasibullah, J. Ferdouse, and M. N. Anwar, "Microbial
degradation of petroleum hydrocarbon," Banglad. J. Microbiol., vol. 27, no. 1,
pp. 10-13, 2010.
[280] H. Long, Y. Wang, S. Chang, G. Liu, T. Chen, and G. Huo, "Diversity of crude
oil-degrading bacteria and alkane hydroxylase (alkB) genes from the Qinghai-
Tibet Plateau," Environ. Monitor., vol. 189, no. 3, p. 116, 2017.
[281] J. Gurska, W. Wang, K. E. Gerhardt, A. M. Khalid, D. M. Isherwood, and X.
D. Huang, "Three-year field test of a plant growth promoting rhizobacteria
enhanced phytoremediation system at a land farm for treatment of hydrocarbon
waste," Environ. Sci. Technol., vol. 43, no. 12, pp. 4472-4479, 2009.
[282] H. Saleem, "Plant-bacteria partnership: Phytoremediation of hydrocarbons
contaminated soil and expression of catabolic genes," B. Environ. Stud. J., vol.
1, no. 1, p. 19, 2016.
[283] C. E. Morris and J. M. Monier, "The ecological significance of biofilm
formation by plant-associated bacteria," Ann. Rev. Phytopathol., vol. 41, no. 1,
pp. 429-453, 2003.
[284] J. Wimpenny, W. Manz, and U. Szewzyk, "Heterogeneity in biofilms," FEMS
Microbiol. Rev., vol. 24, no. 5, pp. 661-671, 2000.
[285] H. Al-Awadhi, R. Al-Hasan, N. Sorkhoh, S. Salamah, and S. Radwan,
"Establishing oil-degrading biofilms on gravel particles and glass plates," Int.
Biodeter. Biodegr., vol. 51, no. 3, pp. 181-185, 2003.
[286] X. Zhu, W. Wang, D. E. Crowley, K. Sun, S. Hao, and M. G. Waigi, "The
endophytic bacterium Serratia sp. PW7 degrades pyrene in wheat," Environ.
Sci. Pollut. Res., vol. 24, no. 4, pp. 6648-6656, 2017.
[287] N. P. Blain, B. Helgason, and J. Germida, "Endophytic root bacteria associated
with the natural vegetation growing at the hydrocarbon contaminated
Bitumount Provincial Historic site," Can. J. Microbiol., doi/10.1139/cjm-2017-
0039, 2017.
[288] K. Rahman, T. J. Rahman, Y. Kourkoutas, I. Petsas, R. Marchant, and I. Banat,
"Enhanced bioremediation of n-alkane in petroleum sludge using bacterial
consortium amended with rhamnolipid and micronutrients," Bioresour.
Technol., vol. 90, no. 1, pp. 159-168, 2003.
[289] B. Cai, J. Ma, G. Yan, X. Dai, M. Li, and S. Guo, "Comparison of
phytoremediation, bioaugmentation and natural attenuation for remediating
Chapter 7 References
121
saline soil contaminated by heavy crude oil," Biochem. Engg. J., vol. 112, no.
4, pp. 170-177, 2016.
[290] B. Basumatary and S. Bordoloi, "Phytoremediation of Crude Oil-Contaminated
Soil Using Cynodon dactylon (L.) Pers," in Phytoremediation, SUI: Springer,
2016, pp. 41-45.
[291] M. Guo, Z. Gong, R. Miao, D. Su, X. Li, and C. Jia, "The influence of root
exudates of maize and soybean on polycyclic aromatic hydrocarbons
degradation and soil bacterial community structure," Ecol. Engg., vol. 99, pp.
22-30, 2017.
[292] M. Balseiro-Romero, P. Gkorezis, P. S. Kidd, J. Vangronsveld, and C.
Monterroso, "Enhanced degradation of diesel in the rhizosphere of after
inoculation with diesel-degrading and plant growth-promoting bacterial
strains," J. Environ. Qual., vol. 45, no. 3, pp. 924-932, 2016.
[293] H. Ikeura, Y. Kawasaki, E. Kaimi, J. Nishiwaki, K. Noborio, and M. Tamaki,
"Screening of plants for phytoremediation of oil-contaminated soil," Int. J.
Phytorem., vol. 18, no.1, pp. 460-466, 2016.
[294] S. Ambreen, M. Javed, M. Hina, S. Rasul, Z. U. Zafar, and H. Manzoor,
"Influence of sub-lethal crude oil concentration on growth, water relations and
photosynthetic capacity of maize (Zea mays L.) plants," Environ. Sci. Pollut.
Res., vol. 23, no. 18, pp. 18320-18331, 2016.
[295] H. S. Alotaibi, A. R. Usman, A. S. Abduljabbar, Y. S. Ok, A. I. Al-Faraj, and
A. S. Sallam, "Carbon mineralization and biochemical effects of short-term
wheat straw in crude oil contaminated sandy soil," Appl. Geochem.,
doi.org/10.1016/j.apgeochem.2017.02.017, 2017.
122
8 Appendices
Appendix A: Luria Bertani medium
Tryptone 5g/L, Yeast extract 2.5 g/L, Sodium cholride 2.5 g/L, Agar 15g/L
Appendix B: M9 medium
KH2PO4 100 mL/L, Na2HPO4. 2H2O 40 mL/L, Agar, 15 g/L, NaCl 5 mL/L, NH4Cl 5
mL/L, 1M CaCl2 100 µL/mL, 1000x Fe. EDTA 1000 µL/mL, 1000x Trace elements
1000 µL/mL, 1000x Vitamins 1000 µL/mL, Crude oil/ diesel 1 mL/mL,
Cyclohexamide 1 mL/mL
Appendix C: Sabouraud Dextrose agar
Peptone 10 g/L, Glucose 20 g/L, Agar 15 g/L
Appendix D: LG1 medium
Sucrose 5.0 g/L, K2HPO4 0.2 g/L, KH2PO4. 0.6 g/L, MgSO4. 7H2O 0.2 g/L, CaCl2.
2H2O 0.02 g/L, Na2MoO4. 2H2O 0.002 g/L, Fe (III) EDTA (1.64%) 4.0 mL/L, Vitamin
solution 1.0 mL/L
Appendix E: DF salts minimal medium
KH2PO4 10.8 g/L, K2HPO4, 42 g/L, MgSO4. 7H2O 7.5 g/L, CaCl2. 2H2O 0.6 g/L, NaCl
6.0 g/L, FeCl3. 6H2O 1.1 g/L, EDTA 15 mg/L, Glucose 10 mL/L, Agar 15 g/L, ACC
0.7 g/L
top related