answer key biology 1: unit 2 (a dna mastery unit ... · pdf fileanswer key biology 1: unit 2...
Post on 06-Feb-2018
407 Views
Preview:
TRANSCRIPT
ANSWER KEY
Biology 1: Unit 2 (A DNA Mastery Unit) – Worksheet 1: DNA Structure
1. Deoxyribonucleic acid
2. A. James Watson
B. Francis Crick
3. nucleotides
4. sugar (deoxyribose) and phosphates (phosphodiester bonds)
5. thymine (T), adenine (A), guanine (G), cytosine (C)
6. purines: 2 rings; pyrimidines: 1 ring
7. adenine and guanine
8. thymine and cytosine
9. adenine and thymine; cytosine and guanine
10. A pairs with T; C pairs with G
11. hydrogen
12. X-ray crystallography; double helix
13. your drawing should have a phosphate, deoxyribose sugar with the carbons numbered, and a
nitrogenous base
14. TTAAGCGGCCATAATCTGCAA (this questions is missing the 5’ and 3’ designations!! Not a perfect
worksheet!!)
15. the nucleotide contains three parts: you should have circled a black circle (the phosphate), a
pentagon (the sugar), and a rectangle puzzle piece (the base)
Labeling Bases:
left hand column, going down: ATGCAC
Right hand column, going down: TACGTG
top related