adme model presentation, september 2011

ADME Studies in Knockout Rats Lacking Key Drug Transporters

Kristen BettingerGlobal Product Manager

Agenda

• Introduction

• ADMET Knockout Rats

• Current R&D Development

• Custom Model Development

• Summary

Historical Use of Animals

384-322 BCE Aristotle among the first to perform experiments on

living animals

1600s William Harvey described the

movement of blood in mammals

1700s Antoine Lavoisier used a guinea pig in a calorimeter to prove that respiration was

a form of combustion

1880s Louis Pasteur demonstrated the

germ theory of medicine by giving anthrax to sheep

1890s Ivan Pavlov used dogs to describe

classical conditioning

1980s Mario Capecchi pioneered

recombinant KO technology in mouse ES cells

ES Cell Targeting in Mice

Mosaic Founder

Pseudopregnant femaleTransfer blastocyst

Inject ES cells into mouse blastocyst

Limitations of ES Cell Targeting

• Mosaic founders

• Long process (12-18 months)

• Limited in strain

• Not widely adapted to other animal species

What about ES Cell Gene Targeting in Rats?

• ES cells have only recently been isolated from rats• Buehr, M. et al., Capture of authentic embryonic stem cells from rat blastocysts. Cell 135:1287–1298

(2008)

• Rat ES cells can be genetically manipulated to produce genetically engineered rats

• Li, P. et al., Germline competent embryonic stem cells derived from rat blastocysts. Cell 135:1299–1310 (2008)

• Tong, C. et al., Production of p53 gene knockout rats by homologous recombination in embryonic stem cells. Nature 467:211-215 (2010)

• Tong, C. et al., Generating gene knockout rats by homologous recombination in embryonic stem cells. Nature Protocols 6:827-844 (2011)

For more than 25 years, the scientific community has looked to expand the breadth of organisms possible and shorten timelines

Overcoming the Limitations: Zinc Finger Nuclease Technology

The Result…• We now have the ability to create targeted knockouts in the most appropriate models, including the rat

Geurts, et al., 2009

Lab Mission

• Focus on modified model organism to address unmet needs

• ADME/Toxicology• Neurobiology• Cardiovascular• Metabolism• Immunology/ Inflammation

• Provide rapid custom services

• Build a repository to develop, acquire, characterize, and distribute knockout rat models

Why The Rat?

• Physiology• More reflective of humans

• Behavior • Rats superior cognitive function over mice

• Technical advantages• Tissue harvest & biological fluid sampling• Surgical manipulations• Better tolerance of longitudinal dosing• Improved resolution of tumor location

in vivo imaging

Agenda

• Introduction

• ADMET Knockout Rats

• Current R&D Development

• Custom Model Development

• Summary

Why ADMET?

• Pressure to reduce costs

• Predict safety issues sooner

Existing transporter assays are non-definitive•Chemical inhibitors

•Non-selective

ADMET Knockout Rats -

Mdr1a, Bcrp, Mrp1, Mrp2, and p53• Improved predictability of assays

• Knockout is preferred over inhibitor assays• Additional models to correlate results • Rat is preferred species

• Enables clinical testing sooner• Faster assessment of the safety of

preclinical compounds • Saves valuable resources

Mdr1a Knockout Rat

• Mdr1a gene encodes for the P-glycoprotein (P-gp)• Efflux transporter across blood/brain barrier and intestine• Implicated in drug resistance

• Homozygous knockout (no functional protein)

• 20 base pair deletion within exon 7• No detectable P-glycoprotein via

western blot• Sprague Dawley background strain

+Mdr1a (+/+) Mdr1a (-/-)

S4 S3 S3 S3 S4 S3 S3 S3

Amount Loaded

Protein Fraction

Mdr1a

Actin

KO:

tggaagctaactcttgtgattttggccatcagc-------------------ctggtatttgggc

WT:

tggaagctaactcttgtgattttggccatcagccctgttcttggactgtcagctggtatttgggc

Mdr1a –

Drugs Known to Interact with P-gp

• Cancer Chemotherapy• Doxorubicin• Daunorubicin• Vinblastine• Vincristine• Paclitaxel• Teniposide• Etoposide

• Immune Response• Cyclosporine A

• Antihistamine• Terfenadine

• Cardiac Drugs• Digoxin• Quinidine• Posicor• Statins

• Others• Ivermectin• Abamectin• Loperamide• Colchicine• Erythromycin

Oral Absorption of Digoxin

in Mdr1a Knockout Rats

Differential Expression Levels of the Drug Transporter Family in Mdr1a Knockout Rats

Liver Kidney

0

50

100

150

200

Mdr1a Mrp1 Mrp2 BCRP

Gene Name

Expression (%

)

WT

KO

020406080100120140160180

Mdr1a Mrp1 Mrp2 BCRP

Gene Name

Expression (%

)

WT

KO

Mdr1a Plays a Significant Role in Several Biosynthetic and Metabolic Pathways in the Liver

WT KO

Up Regulated Pathway P Value Down Regulated Pathway P ValueSterol Biosynthetic Process 1.28E‐23 Pheramone Binding 2.15E‐12Cholesterol Biosynthetic Process 7.41E‐21 Odorant Binding 6.19E‐11Sterol Metabolic Process 6.28E‐18 Carboxylic Acid Metabolic Process 1.58E‐06Cholesterol Metabolic Process 1.81E‐15 Oxoacid Metabolic Process 1.58E‐06Steroid Biosynthetic Process 8.73E‐17 Organic Acid Metabolic Process 1.96E‐06Cell Division 2.38E‐15 Cellular Ketone Metabolic Process 1.96E‐06

Bcrp

Bcrp

Knockout Rat

• Bcrp gene encodes for the Abcg2 transporter• Drug transport across blood/brain barrier, liver, intestine, and placenta• Multiple drug resistance • Chemically induced birth defects

• Homozygous knockout (no functional protein)• 588 base pair deletion • No detectable protein via western blot• Sprague Dawley background strain

• Characteristics• Decreased elimination of substrate drugs

Bcrp

–

Drugs Known to Interact with Bcrp

Substrates• Topotecan• Mitoxantrone• Flavoperidol• Diflomotecan• Methotrexate• Sulfasalazine• Prazosin• Benzoylphenylurea• Cimetidine• Dantrolene

• Inhibitors• Oestrone• 17β-oestradiol• Fumitre-morgin C

Dantrolene

Levels in Bcrp

Knockout and Wild Type Rats

Oral Absorption of Sulfasalazine

in Bcrp Knockout Rat

Jonker, et. al. 2002. PNAS

Mrp1 Knockout Rat

• Mrp1 gene encodes for the Abcc1a transporter• Efflux transporter across liver• Implicated in multiple drug resistance

• Homozygous knockout (no functional protein)• 43 base pair deletion • No detectable protein via western blot• Sprague Dawley background strain

Wild-Type Mrp1 (-/-)

Mrp1

Actin

Anticancer• Doxirubicin• Anthracycline• Etoposide• Methotrexate

Mrp1 –

Drugs Known to Interact with Mrp1

Others• Ritonavir• Saquinavir• Verapamil• Cyclosporin A• Agosterol A• Fluorescein

Plasma Concentration of Fluorescein

in Mrp1 Knockout Rats

Mrp2 Knockout Rat

• Mrp2 gene encodes for the Abcc2 transporter• Efflux transporter across liver, small intestine, kidney• Implicated in multiple drug resistance

• Homozygous knockout (no functional protein)• 726 base pair deletion • No detectable protein via western blot• Sprague Dawley background strain

• Characteristics• Compromised biliary excretion resulting in hyperbilirubinemia

Mrp2 –

Drugs Known to Interact with Mrp2

Substrates• Cisplatin• Doxorubicin• Methotrexate• Glutathione• Etoposide• Valsartan• Mitoxantrone

Inhibitors• Cyclosporine• Delaviridine• Efavirenze• Emtricitabine

Glutathione Levels in Mrp2 Knockout Rats

500.00

600.00

700.00

800.00

900.00

1000.00

1100.00

1200.00

Con

cent

ratio

n of

GSH

(uM

)

Mrp2 (-/-) X. Chu, 2006. PharmacologyWT

Application of p53 Knockout Rat -

Faster Carcinogenicity Screening• FDA requires early carcinogenicity assay

• Mouse and Rat • 2 year study• Multiple doses• Groups of 50 animals• $500,000 or more to conduct for a single compound

• Tp53 Knockout Mouse • Approved by FDA• 6 month assay• Rat still required!

p53 Knockout Rat

• Heterozygous knockout (one allele has mutation)• One copy of Tp53 functions normally• One copy carries a deletion within Tp53 gene

– 14 base pair deletion within exon 3

• Homozygous animals have no detectable p53 protein via western blot

• High degree of early tumor formation and malignancy

• Sprague Dawley background strain

75 kDa

50

37

50

37

p53

Actin

Kidney Liver Kidney Liver

Wild-type P53 (-/-)

p53 Knockout Rat

p53 Rat Kaplan-Meier Curve

n=27

n=31

n=39

Summary of Initial Data

• Drug transporter knockout rats serve as more specific tools to replace existing experiments using wild-type rats and substrate inhibitors

• Selective• More relevant information obtained• Reduce number of animals and experiments needed• Rats are preferred over mice for toxicology studies

Agenda

• Introduction

• ADMET Knockout Rats

• Current R&D Development

• Custom Model Development

• Summary

Models in Development

Nuclear Receptors (Repsonse)• PXR• CAR• PXR/CAR

• Available end of 2011

SLC Transporters• Oat1• Oat3• Oct1• Oct2• Oatp1b3• Oct1/Oct2• Oat1/Oat3

Humanized Transporters• Mdr1a• Mdr1a/b

Agenda

• Introduction

• ADMET Knockout Rats

• Current R&D Development

• Custom Model Development

• Summary

Looking Beyond the Rodent…..

The Rabbit as a Model

• Cardiovascular disease• Ocular• Dermal• Joint• ADMET

*

*

Microinjection StatisticsSession 1 Session 2 Session 3 Session 4 Total

Embryos Collected 207 119 120 111 557

Embryos Microinjected 196 98 96 75 465

Embryos Transferred 122 76 68 60 326

Rabbits Born 9 1 2 4 16

Embryos Collected/Rabbits Born 35Embryos Microinjected/Rabbits Born 29Embryos transferred/Rabbits Born 20Positive Founders Generated 3

Summary

SAGEspeed™ custom model creation platform• Rat/ Mouse/Rabbit• Any strain• Founder animals produced in as little as 5 months

• ADMET• Mdr1a• Mrp1• Mrp2• Bcrp• PXR• p53

Immunodeficiency• Rag1• Rag 2• DNAPK• Foxn1

• Neuroscience• BDNF• DISC1• Lrrk1

• Park2• Park7• DJ-1• Lrrk2

Cardiovascular• Apoe• Leptin• Ldlr

Exclusive catalog of knockout rats• Ready to ship cohorts• Global distribution • AAALAC facility

Acknowledgements

• Xiaoxia Cui, PhD• Diana Ji• Rachel Henry• Iara Carbery• Jason Books• Kevin Gamber, PhD• Michelle Strake• Deb Knoerzer• Phil Simmons• Edward Weinstein, PhD