1 research area: environmental stress and adaptation 2€¦ · 2015-04-13 · 40 pil joon seo 41...
Post on 31-Oct-2020
1 Views
Preview:
TRANSCRIPT
1
Research area: Environmental Stress and Adaptation 1
2
Running head: Role of MYB96 in Seed Germination 3
4
5
6
Pil Joon Seo 7
8
Corresponding author; e-mail pjseo1@jbnu.ac.kr; Tel 82-63-270-3423; fax 82-63-270-3408. 9
Department of Chemistry, Chonbuk National University, Jeonju 561-756, Republic of Korea 10
11
12
13
Plant Physiology Preview. Published on April 13, 2015, as DOI:10.1104/pp.15.00162
Copyright 2015 by the American Society of Plant Biologists
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
2
The Arabidopsis MYB96 Transcription Factor Is a Positive Regulator of 14
ABI4 in the Control of Seed Germination 15
16
Kyounghee Lee1, Hong Gil Lee1, Seongmun Yoon, Hyun Uk Kim, and Pil Joon Seo* 17
18
Department of Bioactive Material Sciences and Research Center of Bioactive Materials, 19
Chonbuk National University, Jeonju 561-756, Republic of Korea (K.L., H.G.L., P.J.S.); 20
Department of Agricultural Biotechnology, National Academy of Agricultural Science, Rural 21
Development Administration, Jeonju 560-500, Republic of Korea (S.Y., H.U.K.); Department 22
of Chemistry and Research Institute of Physics and Chemistry, Chonbuk National University, 23
Jeonju 561-756, Republic of Korea (P.J.S.) 24
25
26
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
3
1These authors contributed equally to this work. 27
28
2This work was supported by the Basic Science Research (NRF-2013R1A1A1004831) and 29
Global Research Network (NRF-2014S1A2A2028392) programs provided by the National 30
Research Foundation of Korea and by the Next-Generation BioGreen 21 Program (SSAC, 31
Project No. PJ009484012014) provided by the Rural Development Administration (H.-U.K). 32
K.L. and H.G.L. were supported by the BK21 PLUS program in the Department of Bioactive 33
Material Sciences. 34
35
36
37
Corresponding author 38
39
Pil Joon Seo 40
The author responsible for distribution of materials integral to the findings presented in this 41
article in accordance with the policy described in the Instructions for Authors 42
(www.plantphysiol.org) is: Pil Joon Seo (pjseo1@jbnu.ac.kr). 43
44
45
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
4
ABSTRACT 46
47
Seed germination is a key developmental transition that initiates the plant life cycle. The 48
timing of germination is determined by coordinated action of two phytohormones, gibberellin 49
(GA) and abscisic acid (ABA). In particular, ABA plays a key role in integrating 50
environmental information and inhibiting the germination process. Utilization of embryonic 51
lipid reserves contributes to seed germination by acting as an energy source, and ABA 52
suppresses lipid degradation to modulate the germination process. Here, we report that the 53
ABA-responsive R2R3-type MYB transcription factor MYB96, which is highly expressed in 54
embryo, regulates seed germination by controlling the expression of ABA-INSENSITIVE 4 55
(ABI4). In the presence of ABA, germination was accelerated in MYB96-deficient myb96-1 56
seeds, whereas the process was significantly delayed in MYB96-overexpressing activation-57
tagging myb96-ox seeds. Consistently, myb96-1 seeds degraded a larger extent of lipid 58
reserves even in the presence of ABA, while reduced lipid mobilization was observed in 59
myb96-ox seeds. MYB96 directly regulates ABI4, which acts as a repressor of lipid 60
breakdown, to define its spatial and temporal expression. Genetic analysis further 61
demonstrated that ABI4 is epistatic to MYB96 in the control of seed germination. Taken 62
together, the MYB96-ABI4 module regulates lipid mobilization specifically in the embryo to 63
ensure proper seed germination under suboptimal conditions. 64
65
66
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
5
INTRODUCTION 67
68
Seeds are products of plant sexual reproduction and facilitate the spread of offspring. Since 69
plants are sessile organisms with a limited ability to seek favorable growth conditions, seed 70
dispersal is an evolutionary adaptive trait to disseminate their offspring to optimal locations 71
(Bewley, 1997; Nonogaki, 2014). Thus, seeds enable plants to endure environmental 72
disadvantages and confine growth until they encounter favorable environmental conditions 73
(Bewley, 1997). 74
Seed embryogenesis is initiated by double fertilization (Gehring et al., 2004; Berger 75
et al., 2008). While the zygote divides asymmetrically to form the diploid embryo, the triploid 76
endosperm constantly proliferates inside the maternal ovule (Natesh and Rau, 1984; West and 77
Harada, 1993). At the end of embryonic growth phase, cell cycle activities in the embryo are 78
arrested (Raz et al., 2001), and storage molecules, such as proteins, carbohydrates, and lipids, 79
accumulate particularly in the cotyledons (Goldberg et al., 1989; Huang et al., 1992; Raz et al., 80
2001). This phase is referred to as seed maturation. Mature seeds become dehydrated and 81
enter a quiescent state that is tolerant to desiccation (Crouch, 1987; Harada et al., 1988; 82
Kermode, 1990; McCarty and Carson, 1991), establishing primary dormancy. 83
Seed dormancy can be broken, when seeds experience stratification and/or after-84
ripening (Vleeshouwers et al., 1995; Bewley, 1997; Nonogaki, 2014). Germination is a key 85
developmental transition to determine when to initiate the plant life cycle. Since it is an 86
irreversible transition, seeds have to precisely monitor external environmental factors, such as 87
light, temperature, water and nutrient availability, and high salinity (Huang et al., 2003; Qu et 88
al., 2008; Joosen et al., 2013; Lim et al., 2013). These environmental signals are integrated 89
into internal developmental programs in seeds, which are operated primarily by antagonistic 90
actions of two phytohormones: ABA and GA (Holdsworth et al., 1999; Finch-Savage and 91
Leubner-Metzger, 2006; Seo et al., 2006). GA promotes germination, whereas ABA 92
suppresses completion of the developmental transition (Garciarrubio et al., 1997; Debeaujon 93
and Koornneef, 2000; Finkelstein et al., 2002; Peng and Harberd, 2002; Ogawa et al., 2003; 94
Lau and Deng, 2010). 95
Transcriptional regulation is a fundamental regulation scheme for the seed 96
germination process (Thomas, 1993; Nakabayashi et al., 2005). The GA function in 97
promoting seed germination is accomplished partly through the action of central GA signaling 98
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
6
repressors, DELLA-domain proteins, including GA INSENSITIVE (GAI), REPRESSOR OF 99
GA1-3 (RGA), RGA-LIKE 1 (RGL1), RGL2, and RGL3, all of which act as transcriptional 100
regulators (Hussain and Peng, 2003; Tyler et al., 2004; Cao et al., 2006; Park et al., 2013). 101
They interact with transcription factors to allow DELLAs to regulate gene expression by 102
targeting specific gene promoters (de Lucas et al., 2008; Feng et al., 2008; Arnaud et al., 2010; 103
Gallego-Bartolomé et al., 2010; Hong et al., 2012). Indeed, DELLAs bind to promoters of GA 104
INSENSITIVE DWARF1 (GID1), WRKY27, and SCARECROW-LIKE 3 (SCL3) to control seed 105
germination (Zentella et al., 2007; Gallego-Bartolomé et al., 2011; Zhang et al., 2011; Stamm 106
et al., 2012). The DELLA proteins are rapidly degraded in response to GA and are thus 107
considered as repressors of seed germination in the absence of GA (Dill et al., 2001; Tyler et 108
al., 2004). 109
ABA regulation of seed germination also requires ABA-responsive transcription 110
factors. ABA INSENSITIVE 3 (ABI3), ABI4, and ABI5, which encode transcription factors 111
with the B3 domain, APETALA2 (AP2) domain, and basic leucine zipper (bZIP) domain, 112
respectively, are expressed highly in seeds and are involved in regulating sensitivity to ABA 113
(Giraudat et al., 1992; Finkelstein et al., 1998; Finkelstein and Lynch, 2000). Indeed, genetic 114
mutants at these loci exhibit reduced ABA sensitivity as well as accelerated seed germination 115
in the presence of exogenous ABA (Finkelstein and Somerville, 1990). They act in concert 116
with each other and form combinatorial networks to determine proper time to germinate 117
(Söderman et al., 2000; Nakamura et al., 2001). 118
In addition to their overlapping roles in ABA-dependent seed germination, ABI3, 119
ABI4, and ABI5 have their own unique functions. ABI4 is particularly interesting in that it 120
plays a unique role in embryonic lipid catabolism during the germination process (Penfield et 121
al., 2006). Seeds utilize lipid reserves to fuel postgerminative seedling growth (Penfield et al., 122
2005; Quettier and Eastmond, 2009), but the lipid catabolic process is inhibited in the 123
presence of ABA in order to delay seed germination, thereby minimizing environmental 124
damage of early seedlings. Notably, ABA specifically represses embryonic lipid breakdown 125
(Penfield et al., 2006). The differential responses of embryo and endosperm to ABA are 126
accomplished by confined expression of ABI4 in the embryo (Penfield et al., 2006). However, 127
the mechanism by which ABI4 is expressed specifically in the embryo and which specific 128
regulator(s) participate in defining its spatial and temporal expression remain unknown. 129
We previously showed that the MYB96 transcription factor mediates a variety of 130
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
7
plant responses to ABA, including drought resistance, stomatal conductance, lateral root 131
development, anthocyanin accumulation, and cuticular wax biosynthesis (Seo et al., 2009, 132
2011; Seo and Park, 2010, 2011). Expression of MYB96 is considerably induced by drought 133
stress and ABA (Seo et al., 2009), and it activates expression of many ABA-responsive genes 134
through direct binding to gene promoters to optimize plant growth and fitness under 135
environmentally unfavorable conditions (Seo et al., 2009, 2011; Seo and Park, 2010). 136
Here, we report that MYB96 also plays a key role in ABA control of seed 137
germination. The MYB96 gene was significantly expressed in the embryo and conferred 138
embryonic ABA sensitivity in seed germination as well as triacylglycerol (TAG) breakdown. 139
In the presence of ABA, myb96-ox seeds exhibited delayed germination with reduced lipid 140
breakdown, whereas myb96-1 seeds showed accelerated seed germination and lipid 141
breakdown. The MYB96 regulation of seed germination was largely dependent on ABI4, a 142
key repressor of embryonic lipid mobilization during the germination process. Together, our 143
findings provide evidence that MYB96 is an unequivocal transcriptional regulator of ABI4 144
and defines spatial and temporal specificity of its expression to fine-tune seed germination 145
under unfavorable environmental conditions. 146
147
148
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
8
RESULTS 149
150
MYB96 Is Expressed in Embryos 151
MYB96 mediates ABA signal transduction in a variety of physiological processes, such as 152
drought response, lateral root development, and cuticular wax accumulation (Seo et al., 2009, 153
2011). Since seed germination is also a key developmental transition governed by ABA 154
(Bewleyl, 1997; Nakashima and Yamaguchi-Shinozaki, 2013), it was highly plausible that 155
MYB96 may also regulate seed germination in an ABA-dependent manner. 156
To explore the role of MYB96 in seed germination, we first determined its expression 157
patterns in seeds. Quantitative RT-PCR (qRT-PCR) analysis revealed that MYB96 transcripts 158
accumulated at high levels in dry seeds (Fig. 1A), and its transcript accumulation was 159
drastically reduced after cold stratification and imbibition. The transcript levels of MYB96 160
were reduced by 98% after stratification compared to those in dry seeds (Fig. 1A) and 161
recovered at seedling stages (Supplemental Fig. S1), implying an inhibitory role of MYB96 in 162
seed germination. 163
Spatial expression patterns of MYB96 were further examined using pMYB96:GUS 164
transgenic seeds, in which a promoter sequence covering an approximately 2-kb region 165
upstream of the MYB96 transcription start site was transcriptionally fused to a β-166
glucuronidase (GUS)-coding sequence. In agreement with the qRT-PCR results, GUS 167
activities were strongly detected in dry seeds (Fig. 1B) and reduced after stratification and 168
imbibition (Supplemental Fig. S2). Moreover, dissection of seeds showed that high levels of 169
GUS expression were observed only in the embryo (Fig. 1B). GUS activity was undetectable 170
in the endosperm and seed coat (Fig. 1B). 171
172
MYB96 Is Induced by ABA in Seeds but not by GA 173
MYB96 is transcriptionally induced by ABA in seedlings (Seo et al., 2009). Considering that 174
ABA content decreases in seeds following stratification and imbibition (Grappin et al., 2000; 175
Shu et al., 2013), decreased expression of MYB96 during seed germination seemed likely to 176
correlate with endogenous ABA levels in seeds. We therefore asked whether ABA induction 177
of MYB96 is also relevant in seeds. 178
To examine the effect of ABA on MYB96 expression in germinating seeds, stratified 179
wild-type seeds were plated on Murashige and Skoog (MS)-medium supplemented with or 180
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
9
without ABA. qRT-PCR analysis showed that transcript levels of MYB96 were significantly 181
increased 3.5-fold by exogenous ABA treatment in wild-type seeds (Fig. 1C) (Seo et al., 182
2009). Histochemical analysis also revealed that the ABA induction of MYB96 was mainly 183
observed in the embryo (Supplemental Fig. S3). 184
Seed germination is tightly regulated by antagonistic interactions between ABA and 185
GA (Yano et al., 2009; Yaish et al., 2010). Thus, we next asked whether the promotive action 186
of GA in seed germination is also associated with MYB96 expression. Contrary to ABA, 187
MYB96 was unaffected by exogenous GA treatment (Fig. 1C). Furthermore, MYB96 188
expression was also unchanged in quadruple-DELLA (gai-t6 rga-t2 rgl1-1 rgl2-1) and GA-189
deficient ga1-3 mutants (Supplemental Fig. S4). These observations suggest that MYB96 190
plays a primary role in ABA signal transduction in seeds. 191
192
MYB96 Regulates ABA-Dependent Seed Germination 193
Our observation that seed-expressed MYB96 was regulated by ABA suggested that it might 194
have a physiological role in ABA-dependent seed germination. We therefore measured the 195
germination rate of seeds of wild-type, the MYB96-overexpressing activation-tagging line 196
(myb96-ox; Seo et al., 2009), and the T-DNA insertional MYB96-deficient mutant (myb96-1; 197
Seo et al., 2009) at various concentrations of ABA. 198
Germination rate of myb96-ox and myb96-1 seeds was similar to that of wild-type 199
seeds in the absence of ABA (Fig. 2A). However, in the presence of ABA, the germination 200
rate was substantially reduced in myb96-ox seeds but elevated in myb96-1 seeds compared 201
with wild-type seeds (Fig. 2A). The differential ABA responses of myb96-ox and myb96-1 202
seeds were more evident at higher concentrations of ABA (Fig. 2A). 203
For ABA dose-response assays, seeds were germinated on MS-medium plates 204
supplemented with different concentrations of ABA, and germination percentages were scored 205
2 days after cold stratification. These assays clearly revealed that the myb96-ox seeds 206
exhibited increased sensitivity to exogenous ABA, and the myb96-1 seeds were hyposensitive 207
to ABA relative to wild-type seeds (Fig. 2B). 208
Cotyledon opening is also sensitive to exogenous ABA treatment in the association 209
with seed germination. Cotyledon opening of myb96-ox and myb96-1 seeds was 210
indistinguishable from that of wild-type seeds in the absence of ABA (Supplemental Fig. S5). 211
However, in agreement with seed germination rates, cotyledon opening of myb96-ox was 212
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
10
hypersensitive to ABA, whereas the myb96-1 mutants were hyposensitive (Supplemental Fig. 213
S5 and S6). These observations indicate that MYB96 determines ABA sensitivity and 214
regulates ABA-dependent seed germination. 215
216
ABI4 Is Up-Regulated in myb96-ox 217
To establish the molecular networks underlying the MYB96 regulation of seed germination, 218
we monitored expression patterns of genes associated with ABA-dependent seed germination, 219
such as ABA INSENSITIVE 1 (ABI1), ABI2, ABI3, ABI4, ABI5, ACYL-COA BINDING 220
PROTEIN 1 (ACBP1), ARABIDOPSIS HISTIDINE KINASE1 (AHK1), BEL1-LIKE 221
HOMEODOMAIN 1 (BLH1), FY, RING-H2 FINGER A2A (RHA2a), SNF1-RELATED 222
PROTEIN KINASE 2.2 (SnRK2.2), and SnRK2.3 (Finkelstein and Somerville, 1990; 223
Söderman et al., 2000; Carles et al., 2002; Fujii et al., 2007; Tran et al., 2007; Moes et al., 224
2008; Li et al., 2011; Jiang et al., 2012; Du et al., 2013; Kim et al., 2013), in wild-type, 225
myb96-ox, and myb96-1, in the absence of ABA. In seeds, many genes were differentially 226
expressed in myb96-ox and myb96-1, but MYB96 regulation of ABI4 was most likely relevant 227
(Fig. 3A). Expression of ABI4 was reduced in myb96-1 seeds, whereas myb96-ox increased 228
ABI4 expression. To further support the observation, we also analyzed expression of these 229
genes in wild-type, myb96-ox, and myb96-1 seedlings. Most of the genes examined were 230
transcriptionally unchanged in the mutants, but expression of ABI4 was elevated 231
approximately 12-fold in the myb96-ox mutant (Fig. 3B). The ABI3 and ABI5 genes were also 232
slightly up-regulated in myb96-ox (Fig. 3B). However, their expression was not down-233
regulated in myb96-1, possibly due to extremely low expression levels of the genes in wild-234
type seedlings under normal growth condition. 235
Transcript levels of the same set of genes were analyzed in myb96-1 seeds in the 236
presence of ABA. Most of the genes, except for AHK1, FY, and RHA2a, were induced by 237
ABA. Notably, the ABA induction of ABI4 and BLH1 genes was significantly reduced in the 238
myb96-1 seeds compared with wild-type seeds (Fig. 4), while the ABA induction of the others 239
were not influenced. Expression of two genes was also analyzed in germinating myb96-ox 240
seeds in the presence of ABA. Accordingly, their ABA induction was slightly hypersensitive 241
in myb96-ox (Supplemental Fig. S7). While expression of BLH1 seems to be dependent upon 242
MYB96, based on the close correlation between ABI4 expression and MYB96 activity (Fig. 3 243
and 4), we hypothesized that MYB96 is intimately required for proper expression of ABI4 in 244
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
11
the control of ABA-mediated seed germination. Consistent with this, expression patterns of 245
ABI4 in seeds were similar to those of MYB96. The ABI4 gene was highly expressed in dry 246
seeds, particularly embryo (Söderman et al., 2000; Penfield et al., 2006; Bossi et al., 2009), 247
and its expression was reduced after stratification and imbibition as the transcript 248
accumulation patterns of MYB96 (Supplemental Fig. S8). Their spatial expression patterns 249
were also similar (Supplemental Fig. S9), further supporting the positive regulation of ABI4 250
by MYB96. 251
252
MYB96 Binds Directly to the ABI4 Promoter 253
MYB96 is an R2R3-type MYB transcription factor (Seo et al., 2009). Plant R2R3 MYB-DNA 254
binding domain-containing proteins are known to bind directly to consensus DNA elements 255
that are enriched in adenosine and cytosine residues (Seo et al., 2011; Prouse and Campbell, 256
2013). We therefore asked whether MYB96 binds directly to the consensus motifs on the 257
ABI4 promoter. Sequence analysis revealed that the ABI4 promoter contains five conserved 258
sequence motifs that are analogous to the R2R3-type MYB-binding consensus sequences (Fig. 259
5A). The presence of MYB-binding cis-elements led us to examine whether MYB96 is 260
targeted to the ABI4 promoter. 261
To perform chromatin immunoprecipitation (ChIP) assays, we generated 262
pMYB96:MYB96-MYC transgenic plants. Total protein extracts from control pBA002 and 263
pMYB96:MYB96-MYC transgenic seeds were immunoprecipitated with anti-MYC-antibody. 264
DNA bound to epitope-tagged MYB96 proteins was analyzed by quantitative real-time PCR 265
(qPCR) assays. The ChIP analysis showed that the A region of the ABI4 promoter was 266
enriched by MYB96 (Fig. 5B). In contrast, two other genomic fragments containing MYB-267
binding cis-elements, B and C, were not enriched (Fig. 5B), supporting the specific 268
interaction of MYB96 with the A region of the ABI4 promoter. In addition, control ChIP with 269
resin alone did not enrich the A fragment (Fig. 5B). To convince the direct binding of MYB96 270
to the ABI4 promoter, we also generated the transgenic plants expressing the R2R3-MYB 271
DNA binding domain (BD) of MYB96 fused with the MYC-coding sequences (35S:96BD-272
MYC). ChIP analysis revealed that the MYB-DNA binding domain was sufficient to bind to 273
the ABI4 promoter (Supplemental Fig. S10). 274
To confirm the MYB96 binding to core sequences of ABI4 promoter, we performed 275
transient expression analysis using Arabidopsis protoplasts. Two core elements on the ABI4 276
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
12
promoter, A-1 (-264, CAAGTAACTTATGA) and A-2 (-335, GCTATAGTTACCCA), were 277
fused to the 35S minimal promoter. A recombinant reporter plasmid and an effector plasmid 278
p35S:MYB96 were cotransformed into Arabidopsis protoplasts. Cotransformation with the 279
reporter A-1 increased the GUS activity by two- to three-fold, but cotransformation with A-2 280
did not affect reporter gene expression (Fig. 5C). These results indicate that MYB96 281
specifically targets proximal sequences upstream of the ABI4 gene to activate its expression. 282
283
MYB96 Contributes to Inhibiting TAG Degradation during Germination 284
Seed germination is elaborately regulated by discrete actions of the embryo and endosperm 285
(Lafon-Placette and Köhler, 2014). An intriguing example is ABA-controlled lipid breakdown 286
and mobilization in the embryo under suboptimal growth conditions (Penfield et al., 2006). 287
Seed TAG degradation is triggered to fuel embryonic growth during germination but is 288
antagonized by ABA specifically in the embryo (Penfield et al., 2006). It is noteworthy that 289
the ABI4 transcription factor is a well-known regulator of this process, which confers 290
differential sensitivity of lipid catabolism to ABA in the embryo and endosperm (Penfield et 291
al., 2006). 292
Since ABI4 is a major regulatory target of the MYB96 transcription factor, we 293
hypothesized that MYB96 may also be responsible for ABA regulation of lipid breakdown 294
during seed germination, similar to the action of ABI4 (Penfield et al., 2006; Wind et al., 295
2013). To falsify the hypothesis, we measured levels of total fatty acid and eicosenoic acid 296
(20:1) in wild-type, myb96-ox, and myb96-1 seeds for 3 days after cold imbibition in the 297
absence or presence of exogenous ABA. In the absence of ABA, the levels of total fatty acid 298
and eicosenoic acid (20:1) were largely indistinguishable in myb96-ox and myb96-1 compared 299
with wild-type seeds (Supplemental Fig. S11). However, in the presence of ABA, the levels of 300
total fatty acid and eicosenoic acid were noticeably altered in myb96-ox and myb96-1. Total 301
fatty acid levels were reduced by approximately 30-35% 3 days after cold imbibition in wild-302
type seeds. However, TAG breakdown was largely repressed in the myb96-ox seeds, whereas 303
43% of total TAG was catabolized in the myb96-1 seeds (Fig. 6A). The levels of eicosenoic 304
acid displayed similar degradation kinetics to total fatty acid (Fig. 6B). These observations 305
demonstrate that MYB96 plays a role in regulating lipid breakdown during seed germination. 306
307
ABI4 Is Epistatic to MYB96 308
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
13
Our results indicated that the MYB96-ABI4 transcriptional cascade is crucial for ABA 309
regulation of seed germination, probably through lipid mobilization. To confirm the genetic 310
relationship between MYB96 and ABI4, we genetically crossed myb96-ox to the abi4-1 mutant. 311
We investigated the ABA sensitivity of myb96-ox/abi4-1 seeds during germination. 312
Delayed germination was observed in myb96-ox seeds, whereas the abi4-1 mutation led to 313
accelerated seed germination, in the presence of ABA (Fig. 7A). The germination rate of 314
myb96-ox/abi4-1 seeds was comparable to that of abi4-1 (Fig. 7A), indicating that MYB96 is 315
an upstream regulator of ABI4 and that both genes act in the same pathway. 316
In agreement with seed germination rate, eicosenoic acid catabolism of myb96-317
ox/abi4-1 was also indistinguishable from that of abi4-1 (Fig. 7B). A significant amount of the 318
stored TAG was degraded in both genotypes, even in the presence of ABA. Therefore, we 319
conclude that ABI4 is genetically epistatic to MYB96 with respect to the control of ABA-320
dependent seed germination as well as TAG catabolism. 321
Taken together, our observations demonstrate that the MYB96 transcription factor 322
serves as an ABA signaling mediator in modulating seed germination through ABI4-323
dependent embryonic lipid breakdown (Fig. 7C). MYB96 directly regulates ABI4, a key 324
regulator of embryonic lipid mobilization during seed germination, by binding to its gene 325
promoter. Genetic analyses further bolster this genetic hierarchy in the control of seed 326
germination. 327
328
329
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
14
DISCUSSION 330
331
MYB96 Regulation of ABI4 332
ABA is perceived by receptor protein complexes that are composed of PYRABACTIN 333
RESISTANCE (PYR)/PYR1-LIKE (PYL)/REGULATORY COMPONENT OF ABA 334
RECEPTOR (RCAR), type 2C protein phosphatases (PP2Cs), and SNF1-related protein 335
kinase 2 proteins (SnRK2s) (Raghavendra et al., 2010; Weiner et al., 2010). In the presence of 336
ABA, PYR/PYL/RCAR proteins lead to suppression of PP2C activities, derepressing SnRK2 337
protein kinases to activate ABA-responsive binding factors/ABA-responsive element-binding 338
proteins (ABFs/AREBs) (Fujii et al., 2009; Nishimura et al., 2010; Gonzalez-Guzman et al., 339
2012). Subsequent ABA responses are mediated by a large number of transcription factors, 340
indicating that transcriptional cascades are a fundamental framework in ABA signal 341
transduction (Giraudat et al., 1992; Busk and Pagès, 1998; Finkelstein et al., 1998; Finkelstein 342
and Lynch, 2000; Abe et al., 2003; Pandey et al., 2005; Seo et al., 2009). 343
In particular, the ABI3, ABI4, and ABI5 transcription factors all play a common role 344
in ABA regulation of seed germination by constituting combinatorial networks (Söderman et 345
al., 2000; Nakamura et al., 2001). However, despite their functional similarities, the 346
regulatory mechanisms of ABI3, ABI4, and ABI5 differ markedly. The ABI3 protein is 347
proteolytically degraded by a RING E3 ligase ABI3-INTERACTING PROTEIN 2 (AIP2), a 348
negative regulator of ABA signaling (Zhang et al., 2005). Controlled protein degradation also 349
underlies ABI5 activity regulation. The KEEP ON GOING (KEG) E3 ligase executes ABI5 350
degradation under normal growth conditions (Stone et al., 2006; Liu et al., 2010). In the 351
presence of ABA, KEG is rapidly degraded, promoting accumulation of high levels of ABI5. 352
Additional E3 ligases, such as DWD HYPERSENSITIVE TO ABA1 (DWA1), DWA2, and 353
SIZ1, further fine-tune protein accumulation of ABI5 (Miura et al., 2009; Lee et al., 2010). 354
Compared with ABI3 and ABI5, relatively less is known regarding how ABI4 activity 355
is regulated at the molecular level. This study demonstrates that the MYB96 transcription 356
factor regulates ABI4 expression by binding directly to the gene promoter and defines its 357
spatial and temporal expression. Both MYB96 and ABI4 genes are strongly expressed in the 358
embryo and are responsive to exogenous ABA (Penfield et al., 2006). Furthermore, the 359
promotive effect of ABA on ABI4 expression is largely impaired in the myb96-1 mutant, 360
indicating that MYB96 is an unequivocal transcriptional regulator required for proper 361
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
15
expression of ABI4 in an ABA signaling pathway. 362
The raising question is how MYB96 activity is regulated by ABA. Given the myriad 363
targets of MYB96, it is likely that MYB96 acts on upstream of ABA signaling pathways. It is 364
probable that controlled protein turnover and/or posttranslational modifications mediated by 365
ABA receptor-like complex might underlie ABA regulation of MYB96 activity, and the ABA 366
induction of MYB96 transcription may be a result of feedback regulation. Further works are 367
required to get the comprehensive view of the signaling network built up from MYB96. 368
369
TAG Degradation during Seed Germination 370
Utilization of seed storage reserves, such as carbohydrates, proteins, and lipids, is crucial for 371
driving germination and postgerminative seedling growth (Penfield et al., 2004, 2006; 372
Quettier and Eastmond, 2009), albeit controversial (Pritchard et al., 2002; Kelly et al., 2011). 373
Arabidopsis seeds mainly store TAG as the major carbon reserves, which accumulate at the 374
later stages of seed maturation (Lu and Hills, 2002; Maeo et al., 2009). Following seed 375
imbibition, fatty acids are degraded through β-oxidation (Footitt et al., 2002) and primarily 376
consumed as a form of soluble carbohydrates that are converted by the glyoxylate cycle and 377
gluconeogenesis (Penfield et al., 2005; Pracharoenwattana et al., 2010). In agreement with 378
this, mutants with defective TAG hydrolysis exhibit delayed germination and perturbed 379
postgerminative seedling growth (Penfield et al., 2005, 2006; Quettier and Eastmond, 2009; 380
Kelly et al., 2011). 381
Exogenous ABA provokes delayed germination in part by reducing lipid breakdown 382
(Penfield et al., 2006). Genes involved in conversion of TAG into soluble sugars are down-383
regulated in response to ABA (Pritchard et al., 2002), and thus the levels of fatty acid-derived 384
sugars in ABA-treated seeds are markedly decreased (Pritchard et al., 2002). Notably, the 385
ABA regulation of lipid breakdown is relevant particularly in embryos (Penfield et al., 2006), 386
indicating the differential sensitivity of embryo and endosperm to ABA. The ABI4 387
transcription factor is a major regulator in this process. Embryo-expressed ABI4 negatively 388
regulates lipid mobilization and thus seed germination in the presence of ABA (Penfield et al., 389
2006). 390
In this study, we discover the MYB96-ABI4 signaling module that regulates ABA-391
dependent seed germination process possibly through the control of lipid mobilization. 392
MYB96 not only confers ABA sensitivity to embryos, but also participates in embryonic lipid 393
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
16
mobilization to properly regulate seed germination, similar to the role of ABI4 in seed 394
germination (Penfield et al., 2006). The myb96-1 seeds degrade a significant content of TAG 395
even in the presence of ABA, whereas TAG breakdown is largely impaired in myb96-ox seeds. 396
Given that the MYB96-mediated physiological responses in seeds largely depend on ABI4, 397
MYB96 appears to be an explicit transcriptional regulator of ABI4 to define its expression 398
pattern in seeds and to ensure proper seed germination. 399
400
Importance of MYB96-ABI4 Transcriptional Cascades in Seed Germination 401
The MYB96 transcription factor modulates a variety of plant developmental processes in 402
response to ABA, including shoot development, root architecture remodeling, stomatal 403
closure, cuticular wax accumulation, and hormone biosynthesis (Seo et al., 2009, 2011; Seo 404
and Park, 2010). Based on this study, MYB96 also appears to play a role in ABA-dependent 405
seed germination. 406
Multiple functions of MYB96 are achieved by regulating a myriad of transcriptional 407
target genes that underlie a variety of signaling pathways. For example, ABA-induced 408
cuticular wax biosynthesis is mediated by MYB96 regulation of 3-KETOACYL-COENZYME 409
A SYNTHASE (KCS) genes encoding rate-limiting enzymes of the very long chain fatty acid 410
(VLCFA) elongation process (Seo et al., 2011). MYB96-GRETCHEN HAGEN3s (GH3s) 411
transcriptional cascades regulate lateral root development under water-deficient conditions by 412
reestablishing auxin homeostasis (Seo et al., 2009). The RESPONSIVE TO DESSICATION 22 413
(RD22) gene is probably one of regulatory targets of MYB96 that functions in the control of 414
drought tolerance (Seo et al., 2009). LIPID TRANSFER PROTEIN 3 (LTP3) is responsible in 415
part for MYB96 regulation of freezing and drought tolerance (Guo et al., 2013). In addition, 416
the MYB96-ABI4 transcriptional module is crucial for ABA-dependent seed germination. 417
Genetic analysis reveals that delayed germination of myb96-ox is fully suppressed by the abi4 418
mutation, indicating that ABI4 is the principle target of MYB96 in the control of seed 419
germination. Collectively, MYB96 is an important ABA signaling mediator that globally links 420
multiple signaling pathways and thus facilitates plants to trigger efficient physiological and 421
cellular reprogramming for environmental adaptation. 422
Meanwhile, ABI4 integrates a variety of external and internal signals, such as light, 423
ABA, reactive oxygen species (ROS), and soluble sugars (Pesaresi et al., 2007; Shkolnik-424
Inbar and Bar-Zvi, 2010; Kerchev et al., 2011; Yang et al., 2011; Foyer et al., 2012), and 425
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
17
regulates hormone biosynthesis and sugar and lipid metabolism (Kerchev et al., 2011; Shu et 426
al., 2013; Wind et al., 2013). Thus, ABI4 coordinates developmental programs with 427
environmental signals to optimize plant growth and development processes. MYB96 is 428
particularly relevant in ABA signal transduction to ABI4, and other signaling regulators are 429
likely responsible for transcriptional regulation of ABI4 with respect to other input signals. 430
Taken together, the MYB96-ABI4 signaling module is important for the control of 431
ABA-dependent seed germination. MYB96 precisely conveys ABA signaling to ABI4 in 432
embryos during seed germination, and ABI4 in turn integrates multitude environmental and 433
developmental information to determine proper timing for germination. Multiple 434
transcriptional cascades allow not only for signal amplification, but also enable plants to make 435
integrative decisions. 436
437
438
MATERIALS AND METHODS 439
440
Plant Materials and Growth Conditions 441
Arabidopsis thaliana (Columbia-0 ecotype) was used for all experiments described, unless 442
specified otherwise. Plants were grown under long day conditions (16-h light/8-h dark cycles) 443
with cool white fluorescent light (100 μmol photons m-2 s-1) at 23 °C. The myb96-ox and 444
myb96-1 mutants (GABI_120B05) were previously reported (Seo et al., 2009). The abi4-1 445
mutant (CS8104) was obtained from the Arabidopsis Biological Resource Center 446
(http://abrc.osu.edu/). The myb96-ox/abi4-1 double mutant was generated by genetic cross of 447
myb96-ox and abi4-1 mutants. Identification of abi4-1 was performed as previously described 448
(Finkelstein et al., 1998). 449
450
Quantitative Real-Time RT-PCR Analysis 451
Total RNA was extracted using TRI agent (TAKARA Bio, Singa, Japan) according to the 452
manufacturer’s recommendations. Reverse transcription (RT) was performed using Moloney 453
Murine Leukemia Virus (M-MLV) reverse transcriptase (Dr. Protein, Seoul, South Korea) 454
with oligo(dT18) to synthesize first-strand cDNA from 2 μg of total RNA. Total RNA samples 455
were pretreated with an RNAse-free DNAse. cDNAs were diluted to 100 μL with TE buffer, 456
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
18
and 1 μL of diluted cDNA was used for PCR amplification. 457
Quantitative RT-PCR reactions were performed in 96-well blocks using the Step-One 458
Plus Real-Time PCR System (Applied Biosystems). The PCR primers used are listed in 459
Supplemental Table S1. The values for each set of primers were normalized relative to 460
EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1 (eIF4A) (At3g13920). All qRT-461
PCR reactions were performed in triplicate using total RNA samples extracted from three 462
independent biological replicates. The comparative ΔΔCT method was employed to evaluate 463
relative quantities of each amplified product in the samples. The threshold cycle (CT) was 464
automatically determined for each reaction by the instrument software using default 465
parameters. The specificity of the qRT-PCR reactions was determined by melt curve analysis 466
of the amplified products using the standard method installed in the system. 467
468
Measurement of GUS Activity 469
Seeds were dissected into embryo and endosperm surrounded with seed coat. For 470
histochemical staining of GUS activity, plant materials were fixed by immersing in 90% 471
acetone for 20 min on ice, washed twice with rinsing solution [50 mM sodium phosphate, pH 472
7.0, 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6], and subsequently incubated in staining solution 473
containing 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc) (Duchefa, Harlem, 474
The Netherlands) at 37oC for 18-24 h, depending on staining intensity (Padmanaban et al., 475
2007). 476
477
Seed Germination Assays 478
All genotypes were grown at 23°C under long-day conditions, and seeds were collected at the 479
same time. Harvested seeds were dried at room temperature at least 1 month before 480
germination assays. For seed germination assays, 40-50 seeds for each line were sterilized and 481
plated on Murashige and Skoog medium (half-strength MS salts, 0.05% MES, pH 5.7, and 0.7% 482
agar) supplemented with various concentrations of ABA (0, 0.5, 1, 3 μM). Plates were 483
stratified in darkness for 3 days at 4oC and transferred to a culture room set at 23oC with a 16-484
h light/8-h dark cycle. Germination was scored at the indicated time points by counting the 485
frequency of radicle emergence from the seed coat and endosperm. For each germination 486
assay, biological triplicates were performed. 487
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
19
For investigating the effects of ABA on cotyledon greening, the percentage of 488
cotyledon greening was scored after the end of stratification. Cotyledon greening was defined 489
as complete expansion of cotyledon and greening. 490
491
Chromatin Immunoprecipitation (ChIP) Assays 492
ChIP assays were performed as previously described (Yang et al., 2011). pMYB96:MYC-493
MYB96 transgenic plants, anti-MYC antibodies (Millipore, Billerica, USA) and salmon sperm 494
DNA/protein A agarose beads (Millipore, Billerica, USA) were used for ChIP. DNA was 495
purified using phenol/chloroform/isoamyl alcohol and sodium acetate (pH 5.2). The level of 496
precipitated DNA fragments was quantified by quantitative real-time PCR using specific 497
primer sets (Supplemental Table S2). Values were normalized with the level of input DNA. 498
The values in pBA002 control plants were set to 1 after normalization against eIF4a for 499
quantitative PCR analysis. 500
501
Transient Gene Expression Assays 502
For transient expression assays using Arabidopsis protoplasts, reporter and effector plasmids 503
were constructed. The reporter plasmid contains a minimal 35S promoter sequence and the 504
GUS gene. The core elements on ABI4 promoter were inserted into the reporter plasmid. To 505
construct the p35S:MYB96 effector plasmid, the MYB96 cDNA was inserted into the effector 506
vector containing the CaMV 35S promoter. Recombinant reporter and effector plasmids were 507
cotransformed into Arabidopsis protoplasts by polyethylene glycol–mediated transformation 508
(Yoo et al., 2007). The GUS activities were measured by a fluorometric method. A CaMV 35S 509
promoter-luciferase construct was also cotransformed as an internal control. The luciferase 510
assay was performed using the Luciferase Assay System kit (Promega, Madison, WI). 511
512
Fatty Acid Determinations 513
The total fatty acid content and amount of eicosenoic acid (20:1 n-9) in seeds were measured 514
by gas chromatographic analysis with a known amount of 15:0 fatty acid as an internal 515
standard. Samples were transmethylated at 90°C for 90 min in 0.3 mL of toluene and 1 mL of 516
5% H2SO4 (v/v methanol). After transmethylation, 1.5 mL of 0.9% NaCl solution was added, 517
and the fatty acid methyl esters (FAMEs) were transferred to a new tube for three sequential 518
extractions with 1.5 mL of n-hexane. FAMEs were analyzed by gas chromatography using a 519
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
20
GC-2010 plus instrument (Shimadzu, Japan) with a 30 m x 0.25 mm (inner diameter) HP-520
FFAP column (Agilent, USA), during which the oven temperature was increased from 170°C 521
to 180 °C at 1°C/min. 522
523
Accession Numbers 524
Sequence data from this article can be found in the Arabidopsis Genome Initiative or 525
GenBank/EMBL databases under the following accession numbers: ABI1 (At4g26080), ABI2 526
(At5g57050), ABI3 (At3g24650), ABI4 (At2g40220), ABI5 (At2g36270), MYB96 527
(At5g62470), ACBP1 (At5g53470), AHK1 (At2g17820), BLH1 (At2g35940), FY 528
(At5g13480), RHA2a (At1g15100), SnRK2.2 (At3g50500), SnRK2.3 (At5g66880), and eIF4a 529
(At3g13920). 530
531
532
Supplemental Data 533
The following materials are available in the online version of this article. 534
535
Supplemental Figure S1. Temporal expression of MYB96. 536
Supplemental Figure S2. Expression of MYB96 in embryo after cold imbibition. 537
Supplemental Figure S3. ABA induction of MYB96 in embryo. 538
Supplemental Figure S4. Expression of MYB96 in quadruple-DELLA and GA-deficient 539
mutants. 540
Supplemental Figure S5. Cotyledon opening of myb96-ox and myb96-1 in the presence of 541
ABA. 542
Supplemental Figure S6. ABA dose-response assays. 543
Supplemental Figure S7. Expression of ABI4 and BLH1 in myb96-ox mutant in the presence 544
of ABA. 545
Supplemental Figure S8. ABI4 expression in dry seeds and during seed germination. 546
Supplemental Figure S9. Spatial expression of MYB96 and ABI4. 547
Supplemental Figure S10. Chromatin immunoprecipitation using 35S:96BD-MYC transgenic 548
plants. 549
Supplemental Figure S11. Lipid breakdown in wild-type, myb96-ox, and myb96-1 seeds 550
during seed germination in the absence of ABA. 551
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
21
Supplemental Table S1. Primers used in qRT-PCR. 552
Supplemental Table S2. Primers used in ChIP assays. 553
554
555
FIGURE LEGENDS 556
557
Figure 1. Expression of MYB96 in Seeds. 558
A, MYB96 expression in dry seeds and during seed germination. Wild-type seeds were kept in 559
darkness at 4oC for 72 h (stratification) and transferred to long day (LD) conditions at 22
oC 560
for germination. Transcript accumulation was analyzed by quantitative RT-PCR (qRT-PCR). 561
The eIF4a gene (At3g13920) was used as an internal control. Biological triplicates were 562
averaged. Bars indicate the standard error of the mean. DAC, days after cold stratification. 563
B, Histochemical staining analysis. The pMYB96:GUS transgenic seeds, in which a promoter 564
sequence covering an approximately 2-kb region upstream of the MYB96 transcription start 565
site was transcriptionally fused to a β-glucuronidase (GUS)-coding sequence, were subject to 566
GUS staining. Scale bars = 0.7 μm. 567
C, Induction of MYB96 by ABA in seeds. Stratified wild-type seeds were transferred to MS-568
medium supplemented with 5 μM ABA or GA and incubated for 1 day under LD conditions. 569
Transcript accumulation was analyzed by qRT-PCR. Biological triplicates were averaged. 570
Bars indicate the standard error of the mean. 571
572
Figure 2. ABA Sensitivity of myb96-ox and myb96-1 in Seed Germination. 573
A, Germination rate of myb96-ox and myb96-1. Seed germination percentage of the indicated 574
genotypes grown on different concentrations of ABA was quantified after the end of 575
stratification. Radicle emergence was used as a morphological marker for germination. At 576
least 40 seeds per genotype were measured in each replicate. Biological triplicates were 577
averaged. Bars indicate the standard error of the mean. Statistically significant differences 578
between the wild-type and mutants are indicated by asterisks (Student’s t-test, *P<0.05). 579
B, ABA dose-response assay. Wild-type, myb96-ox, and myb96-1 seeds were germinated on 580
an increasing concentration of ABA. Germination percentages were scored 2 days after cold 581
stratification. Biological triplicates were averaged. Bars indicate the standard error of the 582
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
22
mean. Statistically significant differences between the wild-type and mutants are indicated by 583
asterisks (Student’s t-test, *P<0.05). 584
585
Figure 3. Expression of Genes Involved in ABA-Dependent Seed Germination in myb96-ox 586
and myb96-1 mutants. 587
Germinating seeds (A) and 10-day-old seedlings (B) grown under LD conditions were 588
harvested for total RNA isolation. Transcript accumulation was analyzed by qRT-PCR. The 589
eIF4a gene was used as an internal control. Biological triplicates were averaged. Bars indicate 590
the standard error of the mean. Statistically significant differences between the wild-type and 591
mutants are indicated by asterisks (Student’s t-test, *P<0.05). 592
593
Figure 4. Compromised Expression of ABI4 in myb96-1 upon Exogenous ABA Treatment. 594
Germinating seeds were plated on MS-medium supplemented with or without 5 μM ABA and 595
incubated for 1 day. Transcript accumulation was analyzed by qRT-PCR. Biological triplicates 596
were averaged. Bars indicate the standard error of the mean. 597
598
Figure 5. Binding of MYB96 to Consensus Sequences in the ABI4 Promoter. 599
A, R2R3-MYB binding consensus sequences on the ABI4 promoter. Core binding sequences 600
are marked with arrowheads. Underbars represent amplified genomic regions. The numbers 601
below the underbars indicate amplification product size (bp). 602
B, ChIP assays. Total protein extracts from pMYB96:MYB96-MYC transgenic seeds were 603
immunoprecipitated with an anti-MYC antibody. Fragmented genomic DNA was eluted from 604
the protein-DNA complexes and subjected to quantitative PCR (qPCR) analysis. Biological 605
triplicates were averaged and statistical significance of the measurements was determined 606
using a Student’s t-test (*P <0.05). Bars indicate the standard error of the mean. In each 607
experiment, the measurement values in pBA002 were set to 1 after normalization against 608
eIF4a for quantitative PCR analysis. 609
C, Transient expression analysis using Arabidopsis protoplasts. The core promoter sequence 610
elements of ABI4, A-1 (CAAGTAACTTATGA) and A-2 (GCTATAGTTACCCA), were 611
constructed into the reporter plasmid. The recombinant reporter and effector constructs were 612
coexpressed transiently in Arabidopsis protoplasts, and GUS activities were determined 613
fluorimetrically. Luciferase gene expression was used to normalize the GUS activities. The 614
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
23
normalized values in control protoplasts were set to 1 and represented as relative activation. 615
Three independent measurements were averaged. Statistical significance was determined by a 616
Student’s t-test (*P<0.05). Bars indicate the standard error of the mean. 617
618
Figure 6. Lipid Breakdown in Wild-type, myb96-ox, and myb96-1 Seeds during Seed 619
Germination in the Presence of ABA. 620
Seeds were germinated on MS-plates supplemented with 1 μM ABA and incubated at 23oC 621
under LD conditions for 3 days. Lipid breakdown was determined by measuring the 622
abundance of total fatty acid (A) and eicosenoic acid (20:1) (B). Fatty acid content was 623
expressed as the percentage of the amount present in dry seeds of the indicated genotypes. At 624
least 30 seeds per genotype were measured in each replicate. Biological triplicates were 625
averaged. Bars indicate the standard error of the mean. 626
627
Figure 7. Genetic Hierarchy of ABI4 and MYB96. 628
A, Germination rate of myb96-ox/abi4-1. Seed germination percentage of each genotype on 1 629
μM ABA was scored at indicated time points after cold stratification. At least 50 seeds per 630
genotype were measured in each replicate. Biological triplicates were averaged. Bars indicate 631
standard error of the mean. 632
B, Lipid breakdown of myb96-ox/abi4-1. Seeds were germinated on MS-plates supplemented 633
with 1 μM ABA and incubated at 23oC under LD conditions for 3 days. Eicosenoic acid (20:1) 634
content was expressed as a percentage of the amount in dry seeds of indicated genotypes. At 635
least 30 seeds per genotype were measured in each replicate. Biological triplicates were 636
averaged. Bars indicate the standard error of the mean. 637
C, Proposed role of MYB96 during seed germination. The ABA-inducible R2R3-type 638
MYB96 transcription factor regulates ABI4 expression by binding directly to its gene 639
promoter. The MYB96-ABI4 module inhibits lipid mobilization specifically in the embryo, 640
thereby contributing to delaying seed germination under suboptimal conditions. 641
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Figure 1
Figure 1. Expression ofMYB96 in Seeds.
A, MYB96 expression in dry seeds and during seed germination. Wild-type seeds were kept in darkness at 4oC for 72 h
(stratification) and transferred to long day (LD) conditions at 22oC for germination. Transcript accumulation was analyzed
by quantitative RT-PCR (RT-qPCR). The eIF4a gene (At3g13920) was used as an internal control. Biological triplicates
were averaged. Bars indicate the standard error of the mean. DAC, days after cold stratification.
B, Histochemical staining analysis. The pMYB96:GUS transgenic seeds, in which a promoter sequence covering an
approximately 2-kb region upstream of the MYB96 transcription start site was transcriptionally fused to a -glucuronidase
(GUS)-coding sequence, were subject to GUS staining. Scale bars = 0.7 m.
C, Induction of MYB96 by ABA in seeds. Stratified wild-type seeds were transferred to MS-medium supplemented with 5
M ABA or GA and incubated for 1 day under LD conditions. Transcript accumulation was analyzed by RT-qPCR.
Biological triplicates were averaged. Bars indicate the standard error of the mean.
B -GUS +GUS +GUS
A
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Dry seed DAC0 DAC1
MYB96R
elat
ive
expr
essi
on
0
1
2
3
4
5
6
Mock ABA GA
MYB96
C
Embryo Embryo Endosperm/seed coat
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Figure 2
0
20
40
60
80
100
0 0.5 1.0 3.0 (M)
0 12 24 36 48 60 72 84 96 108 120 132(h)
0
20
40
60
80
100
Ger
min
atio
n(%
)
0M ABA
0
20
40
60
80
1000.5M ABA
0
20
40
60
80
1001.0M ABA
0
20
40
60
80
1003.0M ABA
Ger
min
atio
n(%
)G
erm
inat
ion(
%)
Ger
min
atio
n(%
)
Col-0
myb96-ox
myb96-1
A
B
Ger
min
atio
n(%
)
*
*
*
*
*
*
*
*
*
*
**
* *
*
* *
*
*
*
*
*
*
*
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Figure 2. ABA Sensitivity of myb96-ox and myb96-1 in Seed Germination.A, Germination rate of myb96-ox and myb96-1. Seed germination percentage of the indicatedgenotypes grown on different concentrations of ABA was quantified after the end of stratification.Radicle emergence was used as a morphological marker for germination. At least 40 seeds pergenotype were measured in each replicate. Biological triplicates were averaged. Bars indicate thestandard error of the mean. Statistically significant differences between the wild-type and mutants areindicated by asterisks (Student’s t-test, *P<0.05).B, ABA dose-response assay. Wild-type, myb96-ox, and myb96-1 seeds were germinated on anincreasing concentration of ABA. Germination percentages were scored 2 days after cold stratification.Biological triplicates were averaged. Bars indicate the standard error of the mean. Statisticallysignificant differences between the wild-type and mutants are indicated by asterisks (Student’s t-test,*P<0.05).
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Figure 3
Col-0
myb96-ox
myb96-1
0
2
4
6
8
10
12
14
Rel
ativ
e ex
pres
sion
ABI1 ABI2 ABI3 ABI4 ABI5 ACBP1 BLH1 FY RHA2a SnRK2.2 SnRK2.3AHK1
*
*
*
0
0.5
1
1.5
2
2.5
Rel
ativ
e ex
pres
sion
B
A
ABI1 ABI2 ABI3 ABI4 ABI5 ACBP1 BLH1 FY RHA2a SnRK2.2 SnRK2.3AHK1
**
*
** *
*
*
*
*
Figure 3. Expression of Genes Involved in ABA-Dependent Seed Germination in myb96-ox and myb96-1 mutants.
Germinating seeds (A) and 10-day-old seedlings (B) grown under LD conditions were harvested for total RNA isolation.
Transcript accumulation was analyzed by RT-qPCR. The eIF4a gene was used as an internal control. Biological triplicates
were averaged. Bars indicate the standard error of the mean. Statistically significant differences between the wild-type and
mutants are indicated by asterisks (Student’s t-test, *P<0.05).
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Figure 4
0
5
10
15
20
25
30
35ABI1
0
1
2
3
4ABI3
0
10
20
30
40
50
60ABI5
0
20
40
60
80ABI2
0
1
2
3
4BLH1
0
0.5
1
1.5
2
2.5ACBP1
0
0.5
1
1.5
2
2.5SnRK2.2
0
0.5
1
1.5
2
2.5
3
3.5SnRK2.3
Mock ABA Mock ABA
Col-0 myb96-1
Mock ABA Mock ABA
Col-0 myb96-1
0
1
2
3ABI4
0
0.5
1
1.5AHK1
0
1
2FY
0
0.5
1
1.5
2
2.5RHA2a
Mock ABA Mock ABA
Col-0 myb96-1
Mock ABA Mock ABA
Col-0 myb96-1
Rel
ativ
e ex
pres
sion
Rel
ativ
e ex
pres
sion
Rel
ativ
e ex
pres
sion
Figure 4. Compromised Expression of ABI4 in myb96-1 upon Exogenous ABA Treatment.
Germinating seeds were plated on MS-medium supplemented with or without 5 M ABA and incubated for 1 day.
Transcript accumulation was analyzed by RT-qPCR. Biological triplicates were averaged. Bars indicate the standard error
of the mean.
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Figure 5
Figure 5. Binding of MYB96 to Consensus Sequences in the ABI4 Promoter.
A, R2R3-MYB binding consensus sequences on the ABI4 promoter. Core binding sequences are marked with arrowheads.
Underbars represent amplified genomic regions. The numbers below the underbars indicate amplification product size (bp).
B, ChIP assays. Total protein extracts from pMYB96:MYB96-MYC transgenic seeds were immunoprecipitated with an anti-
MYC antibody. Fragmented genomic DNA was eluted from the protein-DNA complexes and subjected to quantitative PCR
(qPCR) analysis. Biological triplicates were averaged and statistical significance of the measurements was determined using
a Student’s t-test (*P <0.05). Bars indicate the standard error of the mean. In each experiment, the measurement values in
pBA002 were set to 1 after normalization against eIF4a for quantitative PCR analysis.
C, Transient expression analysis using Arabidopsis protoplasts. The core promoter sequence elements of ABI4, A-1
(CAAGTAACTTATGA) and A-2 (GCTATAGTTACCCA), were constructed into the reporter plasmid. The recombinant
reporter and effector constructs were coexpressed transiently in Arabidopsis protoplasts, and GUS activities were
determined fluorimetrically. Luciferase gene expression was used to normalize the GUS activities. The normalized values in
control protoplasts were set to 1 and represented as relative activation. Three independent measurements were averaged.
Statistical significance was determined by a Student’s t-test (*P<0.05). Bars indicate the standard error of the mean.
A
eIF4a
B
0
1
2
3
- +
Rel
ativ
e en
richm
ent
- + -(anti-MYC) + +
A B C
ABC
ABI4-264
360358300
-335-1321-1887-1980
*
pBA002
pMYB96:MYB96-MYC
C
Min 35S GUS Nos-T
Min 35S GUS Nos-T
Min 35S GUS Nos-T
CaMV 35S MYB96 Nos-T
A-1
A-2
pMin35S
p35S:MYB96
A-1
A-2
Reporter
Effector
0
1
2
3
pMin35S A-1 A-2R
elat
ive
expr
essi
on
*
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Figure 6
0
20
40
60
80
100
120
24h 48h 72h
0
20
40
60
80
100
120
24h 48h 72h
Tot
al F
A c
onte
nt (
% o
f se
ed)
20:1
con
tent
(%
of
seed
)
Col-0
myb96-ox
myb96-1
Col-0
myb96-ox
myb96-1
A
B
*
*
*
*
Figure 6. Lipid Breakdown in Wild-type, myb96-ox, and myb96-1 Seeds during Seed Germination in the Presence of ABA.
Seeds were germinated on MS-plates supplemented with 1 M ABA and incubated at 23oC under LD conditions for 3 days.
Lipid breakdown was determined by measuring the abundance of total fatty acid (A) and eicosenoic acid (20:1) (B). Fatty
acid content was expressed as the percentage of the amount present in dry seeds of the indicated genotypes. At least 30
seeds per genotype were measured in each replicate. Biological triplicates were averaged. Bars indicate the standard error
of the mean.
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Figure 7
Figure 7. Genetic Hierarchy of ABI4 andMYB96.
A, Germination rate of myb96-ox/abi4-1. Seed germination percentage of each genotype on 1 M ABA was scored at
indicated time points after cold stratification. At least 50 seeds per genotype were measured in each replicate. Biological
triplicates were averaged. Bars indicate standard error of the mean.
B, Lipid breakdown of myb96-ox/abi4-1. Seeds were germinated on MS-plates supplemented with 1 M ABA and incubated
at 23oC under LD conditions for 3 days. Eicosenoic acid (20:1) content was expressed as a percentage of the amount in dry
seeds of indicated genotypes. At least 30 seeds per genotype were measured in each replicate. Biological triplicates were
averaged. Bars indicate the standard error of the mean.
C, Proposed role of MYB96 during seed germination. The ABA-inducible R2R3-type MYB96 transcription factor regulates
ABI4 expression by binding directly to its gene promoter. The MYB96-ABI4 module inhibits lipid mobilization specifically in
the embryo, thereby contributing to delaying seed germination under suboptimal conditions.
A
ABA
MYB96
ABI4
TAG degradation
Seed germination0
10
20
30
40
50
60
Col-0 myb96-ox abi4-1 myb96-ox/abi4-1
20:1
con
tent
(%
of
seed
)
a
b
c
c
B C
0
20
40
60
80
100
Ger
min
atio
n(%
)
0 12 24 36 48 60 72 84 96 108 120 132 (h)
0
20
40
60
80
100
Ger
min
atio
n(%
)
0M ABA
Col-0
myb96-ox
abi4-1
myb96-ox/abi4-1
1.0M ABA
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figures
Supplemental Data. Lee et al. (2015)
Supplemental Figure S1. Temporal expression of MYB96Wild-type seeds were germinated and grown at 23oC under long day conditions (LDs). Whole plant materials were harvested at indicated time points. Transcript accumulation was analyzed by quantitative real-time RT-PCR (qRT-PCR). The EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1 (eIF4a) gene (At3g13920) was used as an internal control. Biological triplicates were averaged. Bars indicate standard error of the mean. DAC, days after cold imbibition.
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Dry seed 0 2 4 7 14
MYB96
Rel
ativ
e ex
pres
sion
(DAC)
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S2. Expression of MYB96 in embryo after cold imbibition The pMYB96:GUS transgenic seeds, in which a promoter sequence covering an approximately 2-kb region upstream of the MYB96 transcription start site was transcriptionally fused to a -glucuronidase(GUS)-coding sequence, were subject to GUS staining after cold imbibition. Scale bars = 1 m.
+GUS +GUS
Cold ImbibitionDry seed
Embryo Embryo
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S3. ABA induction of MYB96 in embryo Stratified pMYB96:GUS transgenic seeds were plated on Murashige and Skoog (MS)-medium supplemented with or without 1 M abscisic acid (ABA) and incubated for 2 days. The seeds were subject to GUS staining. Scale bars = 1 m.
+GUS+GUS
+ABA-ABA
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
0
1
2
Ler ga1-30
1
2
Ler QD della
Rel
ativ
e ex
pres
sion
MYB96 MYB96
Supplemental Figure S4. Expression of MYB96 in quadruple-DELLA and GA-deficient mutantsTen-day-old quadruple-DELLA (QD della; gai-t6 rga-t2 rgl1-1 rgl2-1) and gibberellin (GA)-deficient ga1-3 mutant seedlings grown at 23oC under LD conditions were used to determine transcript levels of MYB96. Transcript accumulation was analyzed by qRT-PCR. The eIF4a gene (At3g13920) was used as an internal control. Biological triplicates were averaged. Bars indicate standard error of the mean.
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S5. Cotyledon opening of myb96-ox and myb96-1 in the presence of ABACotyledon opening of the indicated genotypes grown on different concentrations of ABA was quantified after the end of stratification. Fully opened cotyledon was used as a morphological marker. At least 50 seeds per genotype were measured in each replicate. Biological triplicates were averaged. Bars indicate standard error of the mean. Statistically significant differences between the wild-type and mutants are indicated by asterisks (Student’s t-test, *P<0.05).
0
20
40
60
80
100
Cot
yled
on o
peni
ng (
%)
0
20
40
60
80
100
0
20
40
60
80
100
0
20
40
60
80
100
Cot
yled
on o
peni
ng (
%)
Cot
yled
on o
peni
ng (
%)
Cot
yled
on o
peni
ng (
%)
0 12 24 36 48 60 72 84 96 108 120132(h)
Col-0
myb96-ox
myb96-1
0M ABA
0.5M ABA
1.0M ABA
3.0M ABA
*
*
*
*
*
**
*
*
*
*
* * *
* *
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S6. ABA dose-response assaysWild-type, myb96-ox, and myb96-1 seeds were germinated on different concentrations of ABA. Fully opened cotyledons were counted 84 h after cold stratification. Biological triplicates were averaged. Bars indicate standard error of the mean. Statistically significant differences between the wild-type and mutants are indicated by asterisks (Student’s t-test, *P<0.05).
0
20
40
60
80
100
Cot
yled
on o
peni
ng (
%)
0 0.5 1.0 3.0 (M)
Col-0
myb96-ox
myb96-1
*
*
*
*
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S7. Expression of ABI4 and BLH1 in myb96-ox mutant in the presence of ABAGerminating seeds were plated on MS-medium supplemented with or without 5 M ABA and incubated for 24 h. Transcript accumulation was analyzed by qRT-PCR. Biological triplicates were averaged. Bars indicate standard error of the mean.
Rel
ativ
e ex
pres
sion
0
4
8
12
16BLH1
Mock ABA Mock ABA
Col-0 myb96-ox
0
5
10
15
20ABI4
Mock ABA Mock ABA
Col-0 myb96-ox
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S8. ABI4 expression in dry seeds and during seed germination Wild-type dry seeds were stratified and transferred to LD conditions at 22oC for germination. Transcript accumulation was analyzed by qRT-PCR. The eIF4a gene was used as an internal control. Biological triplicates were averaged. Bars indicate the standard error of the mean. DAC, days after cold stratification.
0
0.2
0.4
0.6
0.8
1
1.2
Dry seed DAC0 DAC1
ABI4
Rel
ativ
e ex
pres
sion
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S9. Spatial expression of MYB96 and ABI4Eight-week-old plants were used to analyze tissue-specific expression of MYB96 and ABI4. Transcript accumulation was analyzed by qRT-PCR. The eIF4a gene (At3g13920) was used as an internal control. Biological triplicates were averaged. Bars indicate the standard error of the mean. The y-axis is presented on a logarithmic scale for better comparison of fold changes. St, stems; Fl, flowers; Si,siliques; CL, cauline leaves; RL, rosette leaves; Ro, roots.
1
10
100
1000
10000
St Fl Si CL RL Ro
MYB96
1
10
100
1000
ABI4
Rel
ativ
e ex
pres
sion
St Fl Si CL RL Ro
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S10. Chromatin immunoprecipitation using 35S:96BD-MYC transgenic plants Total protein extracts from 35S:96BD-MYC transgenic plants grown for 2 weeks under LD were immunoprecipitated with an anti-MYC antibody. Fragmented genomic DNA was eluted from the protein-DNA complexes and subjected to quantitative PCR analysis. Biological triplicates were averaged and statistical significance of the measurements was determined using a Student’s t-test (*P <0.05). Bars indicate the standard error of the mean. The measurement values in pBA002 were set to 1 after normalization against eIF4a for quantitative PCR analysis.
0
1
2
3
4
eIF4a
- +
Rel
ativ
e en
richm
ent
(anti-MYC) +
A
pBA00235S:96BD-MYC
*
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Figure S11. Lipid breakdown in wild-type, myb96-ox, and myb96-1 seeds during seed germination in the absence of ABASeeds were germinated and incubated at 23oC under LD conditions for 3 days. Lipid breakdown was determined by measuring the abundance of total fatty acid (A) and eicosenoic acid (20:1) (B). Fatty acid content was expressed as the percentage of the amount present in dry seeds of the indicated genotypes. At least 30 seeds per genotype were measured in each replicate. Biological triplicates were averaged. Bars indicate the standard error of the mean.
0
20
40
60
80
100
120
24h 48h 72h
0
20
40
60
80
100
24h 48h 72h
Tot
al F
A c
onte
nt (
% o
f se
ed)
20:1
con
tent
(%
of
seed
)Col-0
myb96-ox
myb96-1
Col-0
myb96-ox
myb96-1
A
B
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
SequencePrimer Usage
F R
eIF4a qRT-PCR TGACCACACAGTCTCTGCAA ACCAGGGAGACTTGTTGGACMYB96 qRT-PCR TGCAGTCTCGGAAGAAGGTG CATCTCGTGGCTTTGCTCATABI1 qRT-PCR CGTCTCACATCTTCGTCGCT TCAATCCTCGCAGCTTCATCABI2 qRT-PCR GGCTCGGAAACGGATTTTAC GCAAAGCCATCTTCGACAAAABI3 qRT-PCR GATTGAATCAGCGGCAAGAA GTTGTTGTGGTGGTGGAGGAABI4 qRT-PCR ATCCTCAATCCGATTCCACC ATTTGCCCCAGCTTCTTTGTABI5 qRT-PCR GGCGCAAGCGAGACATAAT CCCTCGCCTCCATTGTTATTACBP1 qRT-PCR AACCACACGACTCAATCGGA TTTCGACACCTTCCCAATCAAHK1 qRT-PCR TTCAGCGTCCAGTCTTACGG GCAAACAGAGCCCATGTCACBLH1 qRT-PCR AGACCTCAACGTGGTCTCCC GGATCCCATGTTCTTTGCCTFY qRT-PCR TGACGGCTCCATTTGTCATT CCATGCAAGATCCCAAACACRHA2a qRT-PCR CTCTCTCTCCTCGCCGTCTT CTGATCGGCGAGAACGATTASnRK2.2 qRT-PCR TAATGCCGGACGGTTTAGTG TATTTTCAAACGAGGTGCCGSnRK2.3 qRT-PCR CATTTTGACGCCGACTCATC TTCAGGTCACGATGGCAAAT
Supplemental Table S1. Primers used in qRT-PCR
qRT-PCR primers were designed using the Primer Express Software installed into the Applied Biosystems 7500 Real-Time PCR System. The sizes of PCR products ranged from 80 to 300 nucleotides in length. F, forward primer; R, reverse primer.
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Supplemental Table S2. Primers used in ChIP assays
F, forward primer; R, reverse primer.
SequencePrimer Usage
F R
eIF4a ChIP TGACCACACAGTCTCTGCAA ACCAGGGAGACTTGTTGGACABI4(A) ChIP CAACATGCGAGTATTTCTCAC GAGAAAAATAGTGGAGAGGACGABI4(B) ChIP CCAGAAATATGATTCTAGTTTTTACTTATGTC CTCTATTTTAGAGGTGACCATTGGABI4(C) ChIP TTTCAAAATTCCTTTTCTTATAAAAAATG TTAGTCCACTTAACACCATTCTTGG
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Parsed CitationsAbe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) functionas transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12509522?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Arnaud N, Girin T, Sorefan K, Fuentes S, Wood TA, Lawrenson T, Sablowski R, Østergaard L (2010) Gibberellins control fruitpatterning in Arabidopsis thaliana. Genes Dev 24: 2127-2132
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20889713?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Berger F, Hamamura Y, Ingouff M, Higashiyama T (2008) Double fertilization - caught in the act. Trends Plant Sci 13: 437-443PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18650119?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bewley JD (1997) Seed germination and dormancy. Plant Cell 9: 1055-1066PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12237375?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bossi F, Cordoba E, Dupré P, Mendoza MS, Román CS, León P (2009) The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as acentral transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2.2 genes during sugarsignaling. Plant J 59: 359-374
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19392689?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Busk PK, Pagès M (1998) Regulation of abscisic acid-induced transcription. Plant Mol Biol 37: 425-435PubMed: http://www.ncbi.nlm.nih.gov/pubmed/9617810?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cao D, Cheng H, Wu W, Soo HM, Peng J (2006) Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seedgermination and floral development in Arabidopsis. Plant Physiol 142: 509-525
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16920880?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Carles C, Bies-Etheve N, Aspart L, Léon-Kloosterziel KM, Koornneef M, Echeverria M, Delseny M (2002) Regulation ofArabidopsis thaliana Em genes: role of ABI5. Plant J 30: 373-383
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12000684?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Crouch ML (1987) Regulation of gene expression during seed development in flowering plants, In Developmental Biology: AComprehensive Synthesis (ed. L. W. Browder), pp 367-404. New York:Plenum Press
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Debeaujon I, Koornneef M (2000) Gibberellin requirement for Arabidopsis seed germination is determined both by testacharacteristics and embryonic abscisic acid. Plant Physiol 122: 415-424
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/10677434?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
De Lucas M, Davière JM, Rodríguez-Falcón M, Pontin M, Iglesias-Pedraz JM, Lorrain S, Fankhauser C, Blázquez MA, Titarenko E,Prat S (2008) A molecular framework for light and gibberellin control of cell elongation. Nature 451: 480-484
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18216857?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Dill A, Jung HS, Sun TP (2001) The DELLA motif is essential for gibberellin-induced degradation of RGA. Proc Natl Acad Sci USA98: 14162-14167
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11717468?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Du ZY, Chen MX, Chen QF, Xiao S, Chye ML (2013) Arabidopsis acyl-CoA-binding protein ACBP1 participates in the regulation ofseed germination and seedling development. Plant J 74: 294-309
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Feng S, Martinez C, Gusmaroli G, Wang Y, Zhou J, Wang F, Chen L, Yu L, Iglesias-Pedraz JM, Kircher S, Schäfer E, Fu X, Fan LM,Deng XW (2008) Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature 451: 475-479
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18216856?dopt=abstractCrossRef: Author and Title https://plantphysiol.orgDownloaded on April 16, 2021. - Published by
Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Finch-Savage WE, Leubner-Metzger G (2006) Seed dormancy and the control of germination. New Phytol 171: 501-523PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16866955?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Finkelstein RR, Lynch TJ (2000) The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcriptionfactor. Plant Cell 12: 599-609
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/10760247?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Finkelstein RR, Somerville C (1990) Three classes of abscisic acid (ABA)-insensitive mutations of Arabidopsis define genes thatcontrol overlapping subsets of ABA responses. Plant Physiol 94: 1172-1179
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16667813?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell Suppl: S15-S45CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Finkelstein RR, Wang ML, Lynch TJ, Rao S, Goodman HM (1998) The Arabidopsis abscisic acid response locus ABI4 encodes anAPETALA 2 domain protein. Plant Cell 10: 1043-1054
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/9634591?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Footitt S, Slocombe SP, Larner V, Kurup S, Wu Y, Larson T, Graham I, Baker A, Holdsworth M (2002) Control of germination andlipid mobilization by COMATOSE, the Arabidopsis homologue of human ALDP. EMBO J 21: 2912-2922
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12065405?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Foyer CH, Kerchev PI, Hancock RD (2012) The ABA-INSENSITIVE-4 (ABI4) transcription factor links redox, hormone and sugarsignaling pathways. Plant Signal Behav 7: 276-281
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22415048?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fujii H, Chinnusamy V, Rodrigues A, Rubio S, Antoni R, Park SY, Cutler SR, Sheen J, Rodriguez PL, Zhu JK (2009) In vitroreconstitution of an abscisic acid signalling pathway. Nature 462: 660-664
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19924127?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fujii H, Verslues PE, Zhu JK (2007) Identification of two protein kinases required for abscisic acid regulation of seed germination,root growth, and gene expression in Arabidopsis. Plant Cell 19: 485-494
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17307925?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gallego-Bartolomé J, Alabadí D, Blázquez MA (2011) DELLA-induced early transcriptional changes during etiolated development inArabidopsis thaliana. PLoS One 6: e23918
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gallego-Bartolomé J, Minguet EG, Marín JA, Prat S, Blázquez MA, Alabadí D (2010) Transcriptional diversification and functionalconservation between DELLA proteins in Arabidopsis. Mol Biol Evol 27: 1247-1256
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20093430?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Garciarrubio A, Legaria JP, Covarrubias AA (1997) Abscisic acid inhibits germination of mature Arabidopsis seeds by limiting theavailability of energy and nutrients. Planta 203: 182-187
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/9362564?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gehring M, Choi Y, Fischer RL (2004) Imprinting and seed development. Plant Cell Suppl: S203-S213CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM (1992) lsolation of the Arabidopsis AB13 gene by positionalcloning. Plant Cell 4: 1251-1261
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/1359917?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Goldberg RB, Barker SJ, Perez-Grau L (1989) Regulation of gene expression during plant embryogenesis. Cell 5: 149-160https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/2643470?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gonzalez-Guzman M, Pizzio GA, Antoni R, Vera-Sirera F, Merilo E, Bassel GW, Fernández MA, Holdsworth MJ, Perez-Amador MA,Kollist H, Rodriguez PL (2012) Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatalaperture and transcriptional response to abscisic acid. Plant Cell 24: 2483-2496
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22739828?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Grappin P, Bouinot D, Sotta B, Miginiac E, Jullien M (2000) Control of seed dormancy in Nicotiana plumbaginifolia: post-imbibitionabscisic acid synthesis imposes dormancy maintenance. Planta 210: 279-285
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/10664134?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Guo L, Yang H, Zhang X, Yang S (2013) Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress inArabidopsis. J Exp Bot 64: 1755-1767
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23404903?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Harada JJ, Baden CS, Comai L (1988) Spatially regulated genes expressed during seed germination and postgerminativedevelopment are activated during embryogeny. Mol Gen Genet 212: 466-473
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Holdsworth M, Kurup S, McKibbin R (1999) Molecular and genetic mechanisms regulating the transition from embryo developmentto germination. Trends Plant Sci 4: 275-280
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hong GJ, Xue XY, Mao YB, Wang LJ, Chen XY (2012) Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpenesynthase gene expression. Plant Cell 24: 2635-2648
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/22669881?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Huang AH (1992) Oleosins and oil bodies in seeds and other organs. Plant Physiol 110: 1055-1061PubMed: http://www.ncbi.nlm.nih.gov/pubmed/8934621?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Huang ZY, Zhang XS, Zheng GH, Gutterman Y (2003) Influence of light, temperature, salinity and storage on seed germination ofHaloxylon ammodendron. J Arid Environ 55: 453-464
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hussain A, Peng J (2003) DELLA proteins and GA signalling in Arabidopsis. J Plant Growth Regul 22: 134-140CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jiang S, Kumar S, Eu YJ, Jami SK, Stasolla C, Hill RD (2012) The Arabidopsis mutant, fy-1, has an ABA-insensitive germinationphenotype. Exp Bot 63: 2693-2703
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Joosen RV, Arends D, Li Y, Willems LA, Keurentjes JJ, Ligterink W, Jansen RC, Hilhorst HW (2013) Identifying genotype-by-environment interactions in the metabolism of germinating Arabidopsis seeds using generalized genetical genomics. Plant Physiol162: 553-566
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kelly AA, Quettier AL, Shaw E, Eastmond PJ (2011) Seed storage oil mobilization is important but not essential for germination orseedling establishment in Arabidopsis. Plant Physiol 157: 866-875
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kerchev PI, Pellny TK, Vivancos PD, Kiddle G, Hedden P, Driscoll S, Vanacker H, Verrier P, Hancock RD, Foyer CH (2011) Thetranscription factor ABI4 is required for the ascorbic acid-dependent regulation of growth and regulation of jasmonate-dependentdefense signaling pathways in Arabidopsis. Plant Cell 23: 3319-3334
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/21926335?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kermode AR (1990) Regulatory mechanisms involved in the transition from seed development to germination. Crit Rev Plant Sci 2:155-195
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title https://plantphysiol.orgDownloaded on April 16, 2021. - Published by
Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Kim D, Cho YH, Ryu H, Kim Y, Kim TH, Hwang I (2013) BLH1 and KNAT3 modulate ABA responses during germination and earlyseedling development in Arabidopsis. Plant J 75: 755-766
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23663178?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lafon-Placette C, Köhler C (2014) Embryo and endosperm, partners in seed development. Curr Opin Plant Biol 17C: 64-69PubMed: http://www.ncbi.nlm.nih.gov/pubmed/24507496?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lau OS, Deng XW (2010) Plant hormone signaling lightens up: integrators of light and hormones. Curr Opin Plant Biol 13: 571-577PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20739215?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee JH, Yoon HJ, Terzaghi W, Martinez C, Dai M, Li J, Byun MO, Deng XW (2010) DWA1 and DWA2, two Arabidopsis DWD proteincomponents of CUL4-based E3 ligases, act together as negative regulators in ABA signal transduction. Plant Cell 22: 1716-1732
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20525848?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li H, Jiang H, Bu Q, Zhao Q, Sun J, Xie Q, Li C (2011) The Arabidopsis RING finger E3 ligase RHA2b acts additively with RHA2a inregulating abscisic acid signaling and drought response. Plant Physiol 156: 550-563
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lim S, Park J, Lee N, Jeong J, Toh S, Watanabe A, Kim J, Kang H, Kim DH, Kawakami N, Choi G (2013) ABA-INSENSITIVE3, ABA-INSENSITIVE5, and DELLAs interact to activate the expression of SOMNUS and other high-temperature-inducible genes inimbibed seeds in Arabidopsis. Plant Cell 25: 4863-4878
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liu H, Stone SL (2010) Abscisic acid increases Arabidopsis ABI5 transcription factor levels by promoting KEG E3 ligase self-ubiquitination and proteasomal degradation. Plant Cell 22: 2630-2641
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20682837?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lu C, Hills MJ (2002) Arabidopsis mutants deficient in diacylglycerol acyltransferase display increased sensitivity to abscisic acid,sugars, and osmotic stress during germination and seedling development. Plant Physiol 129: 1352-1358
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12114588?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Maeo K, Tokuda T, Ayame A, Mitsui N, Kawai T, Tsukagoshi H, Ishiguro S, Nakamura K (2009) An AP2-type transcription factor,WRINKLED1, of Arabidopsis thaliana binds to the AW-box sequence conserved among proximal upstream regions of genesinvolved in fatty acid synthesis. Plant J 60: 476-487
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19594710?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
McCarty DR, Carson CB (1991) The molecular genetics of seed maturation in maize. Physiol Plant 81: 267-272CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Miura K, Lee J, Jin JB, Yoo CY, Miura T, Hasegawa PM (2009) Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1negatively regulates abscisic acid signaling. Proc Natl Acad Sci USA 106: 5418-5423
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19276109?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Moes D, Himmelbach A, Korte A, Haberer G, Grill E (2008) Nuclear localization of the mutant protein phosphatase abi1 is requiredfor insensitivity towards ABA responses in Arabidopsis. Plant J 54: 806-819
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18298671?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nakabayashi K, Okamoto M, Koshiba T, Kamiya Y, Nambara E (2005) Genome-wide profiling of stored mRNA in Arabidopsis thalianaseed germination: epigenetic and genetic regulation of transcription in seed. Plant J 41: 697-709
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15703057?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nakamura S, Lynch T, Finkelstein R (2001) Physical interactions between ABA response loci of Arabidopsis. Plant J 26: 627-635PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11489176?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nakashima K, Yamaguchi-Shinozaki K (2013) ABA signaling in stress-response and seed development. Plant Cell Rep 32: 959-970https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23535869?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Natesh S, Rau MA (1984) The embryo. In Embryology of Angiosperms, B.M. Johri, ed (Berlin: Springer-Verlag), pp. 377-444CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nishimura N, Sarkeshik A, Nito K, Park SY, Wang A, Carvalho PC, Lee S, Caddell DF, Cutler SR, Chory J, Yates JR, Schroeder JI(2010) PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. Plant J61: 290-299
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19874541?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nonogaki H (2014) Seed dormancy and germination-emerging mechanisms and new hypotheses. Front Plant Sci 5: 233PubMed: http://www.ncbi.nlm.nih.gov/pubmed/24904627?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ogawa M, Hanada A, Yamauchi Y, Kuwahara A, Kamiya Y, Yamaguchi S (2003) Gibberellin biosynthesis and response duringArabidopsis seed germination. Plant Cell 15: 1591-1604
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Padmanaban S, Chanroj S, Kwak JM, Li X, Ward JM, Sze H (2007) Participation of endomembrane cation/H+ exchanger AtCHX20 inosmoregulation of guard cells. Plant Physiol 144: 82-93
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17337534?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pandey GK, Grant JJ, Cheong YH, Kim BG, Li L, Luan S (2005) ABR1, an APETALA2-domain transcription factor that functions as arepressor of ABA response in Arabidopsis. Plant Physiol 139: 1185-1193
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16227468?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Park J, Nguyen KT, Park E, Jeon JS, Choi G (2013) DELLA proteins and their interacting RING Finger proteins repress gibberellinresponses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis. Plant Cell 25: 927-943
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23482857?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Penfield S, Graham S, Graham IA (2005) Storage reserve mobilization in germinating oilseeds: Arabidopsis as a model system.Biochem Soc Trans 33: 380-383
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15787611?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Penfield S, Li Y, Gilday AD, Graham S, Graham IA (2006) Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryoand reveals repression of seed germination by the endosperm. Plant Cell 18: 1887-1899
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16844907?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Penfield S, Rylott EL, Gilday AD, Graham S, Larson TR, Graham IA (2004) Reserve mobilization in the Arabidopsis endosperm fuelshypocotyl elongation in the dark, is independent of abscisic acid, and requires PHOSPHOENOLPYRUVATE CARBOXYKINASE1.Plant Cell 16: 2705-2718
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Peng J, Harberd NP (2002) The role of GA-mediated signalling in the control of seed germination. Curr Opin Plant Biol 5: 376-381PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12183174?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pesaresi P, Schneider A, Kleine T, Leister D (2007) Interorganellar communication. Curr Opin Plant Biol 10: 600-606PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17719262?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pracharoenwattana I, Zhou W, Smith SM (2010) Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported byperoxisomal hydroxypyruvate reductase when malate dehydrogenase is absent. Plant Mol Biol 72: 101-109
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19812894?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pritchard SL, Charlton WL, Baker A, Graham IA (2002) Germination and storage reserve mobilization are regulated independentlyin Arabidopsis. Plant J 31: 639-647
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12207653?dopt=abstractCrossRef: Author and Title https://plantphysiol.orgDownloaded on April 16, 2021. - Published by
Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Prouse MB, Campbell MM (2013) Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites.PLoS One 8: e65132
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23741471?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Qu XX, Huang ZY, Baskin JM, Baskin CC (2008) Effect of temperature, light and salinity on seed germination and radicle growth ofthe geographically widespread halophyte shrub Halocnemum strobilaceum. Ann Bot 101: 293-299
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17428834?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Quettier AL, Eastmond PJ (2009) Storage oil hydrolysis during early seedling growth. Plant Physiol Biochem 47: 485-490PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19136267?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Raghavendra AS, Gonugunta VK, Christmann A, Grill E (2010) ABA perception and signalling. Trends Plant Sci 15: 395-401PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20493758?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Raz V, Bergervoet J, Koornneef M (2001) Sequential steps for developmental arrest in Arabidopsis seeds. Development 128: 243-252
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11124119?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Seo M, Hanada A, Kuwahara A, Endo A, Okamoto M, Yamauchi Y, North H, Marion-Poll A, Sun TP, Koshiba T, Kamiya Y, YamaguchiS, Nambara E (2006) Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolismand abscisic acid regulation of gibberellin metabolism. Plant J 48: 354-366
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17010113?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Seo PJ, Park CM (2010) MYB96-mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acidbiosynthesis in Arabidopsis. New Phytol 186: 471-483
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20149112?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Seo PJ, Park CM (2011) Cuticular wax biosynthesis as a way of inducing drought resistance. Plant Signal Behav 6: 1043-1045PubMed: http://www.ncbi.nlm.nih.gov/pubmed/21617381?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Seo PJ, Lee SB, Suh MC, Park MJ, Go YS, Park CM (2011) The MYB96 transcription factor regulates cuticular wax biosynthesisunder drought conditions in Arabidopsis. Plant Cell 23: 1138-1152
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/21398568?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Seo PJ, Xiang F, Qiao M, Park JY, Lee YN, Kim SG, Lee YH, Park WJ, Park CM (2009) The MYB96 transcription factor mediatesabscisic acid signaling during drought stress response in Arabidopsis. Plant Physiol 151: 275-289
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19625633?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shkolnik-Inbar D, Bar-Zvi D (2010) ABI4 mediates abscisic acid and cytokinin inhibition of lateral root formation by reducing polarauxin transport in Arabidopsis. Plant Cell 22: 3560-3573
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/21097710?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shu K, Zhang H, Wang S, Chen M, Wu Y, Tang S, Liu C, Feng Y, Cao X, Xie Q (2013) ABI4 regulates primary seed dormancy byregulating the biogenesis of abscisic acid and gibberellins in Arabidopsis. PLoS Genet 9: e1003577
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23818868?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Söderman E, Brocard I, Lynch T, Finkelstein R (2000) Regulation and function of the Arabidopsis ABA-insensitive 4 (ABI4) gene inseed and ABA response signaling networks. Plant Physiol 124: 1752-1765
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11115891?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Stamm P, Ravindran P, Mohanty B, Tan EL, Yu H, Kumar PP (2012) Insights into the molecular mechanism of RGL2-mediatedinhibition of seed germination in Arabidopsis thaliana. BMC Plant Biol 12: 179
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23035751?dopt=abstract https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Stone SL, Williams LA, Farmer LM, Vierstra RD, Callis J (2006) KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growthand development, is involved in abscisic acid signaling. Plant Cell 18: 3415-3428
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17194765?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Thomas TL (1993). Gene expression during plant embryogenesis and germination: an overview. Plant Cell 5:1401-1410PubMed: http://www.ncbi.nlm.nih.gov/pubmed/8281041?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tran LS, Urao T, Qin F, Maruyama K, Kakimoto T, Shinozaki K, Yamaguchi-Shinozaki K (2007) Functional analysis of AHK1/ATHK1and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. Proc Natl Acad SciUSA 104: 20623-20628
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18077346?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tyler L, Thomas SG, Hu J, Dill A, Alonso JM, Ecker JR, Sun TP (2004) Della proteins and gibberellin-regulated seed germinationand floral development in Arabidopsis. Plant Physiol 135: 1008-1019
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15173565?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Vleeshouwers LM, Bouwmeester HJ, Karssen CM (1995) Redefining seed dormancy: an attempt to integrate physiology andecology. J Ecol 83: 1031-1037
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Weiner JJ, Peterson FC, Volkman BF, Cutler SR (2010) Structural and functional insights into core ABA signaling. Curr Opin PlantBiol 13: 495-502
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20934900?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
West M, Harada JJ (1993) Embryogenesis in higher plants: An overview. Plant Cell 5: 1361-1369PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12271035?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wind JJ, Peviani A, Snel B, Hanson J, Smeekens SC (2013) ABI4: versatile activator and repressor. Trends Plant Sci 18: 125-132PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23182343?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yaish MW, El-Kereamy A, Zhu T, Beatty PH, Good AG, Bi YM, Rothstein SJ (2010) The APETALA-2-like transcription factor OsAP2-39 controls key interactions between abscisic acid and gibberellin in rice. PLoS Genet 6: e1001098
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20838584?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yang SD, Seo PJ, Yoon HK, Park CM (2011) The Arabidopsis NAC transcription factor VNI2 integrates abscisic acid signals into leafsenescence via the COR/RD genes. Plant Cell 23: 2155-2168
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/21673078?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yang Y, Yu X, Song L, An C (2011) ABI4 activates DGAT1 expression in Arabidopsis seedlings during nitrogen deficiency. PlantPhysiol 156: 873-883
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/21515696?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yano R, Kanno Y, Jikumaru Y, Nakabayashi K, Kamiya Y, Nambara E (2009) CHOTTO1, a putative double APETALA2 repeattranscription factor, is involved in abscisic acid-mediated repression of gibberellin biosynthesis during seed germination inArabidopsis. Plant Physiol 151: 641-654
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19648230?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis.Nat Protoc 2: 1565-1572
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17585298?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zentella R, Zhang ZL, Park M, Thomas SG, Endo A, Murase K, Fleet CM, Jikumaru Y, Nambara E, Kamiya Y, Sun TP (2007) Globalanalysis of della direct targets in early gibberellin signaling in Arabidopsis. Plant Cell 19: 3037-3057https://plantphysiol.orgDownloaded on April 16, 2021. - Published by
Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17933900?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang X, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3degradation. Genes Dev 19: 1532-1543
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/15998807?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang ZL, Ogawa M, Fleet CM, Zentella R, Hu J, Heo JO, Lim J, Kamiya Y, Yamaguchi S, Sun TP (2011) Scarecrow-like 3 promotesgibberellin signaling by antagonizing master growth repressor DELLA in Arabidopsis. Proc Natl Acad Sci USA 108: 2160-2165
PubMed: http://www.ncbi.nlm.nih.gov/pubmed/21245327?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.
top related