1 research area: environmental stress and adaptation 2€¦ · 2015-04-13 · 40 pil joon seo 41...

1

Research area: Environmental Stress and Adaptation 1

2

Running head: Role of MYB96 in Seed Germination 3

4

5

6

Pil Joon Seo 7

8

Corresponding author; e-mail [email protected]; Tel 82-63-270-3423; fax 82-63-270-3408. 9

Department of Chemistry, Chonbuk National University, Jeonju 561-756, Republic of Korea 10

11

12

13

Plant Physiology Preview. Published on April 13, 2015, as DOI:10.1104/pp.15.00162

Copyright 2015 by the American Society of Plant Biologists

https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

https://plantphysiol.org

2

The Arabidopsis MYB96 Transcription Factor Is a Positive Regulator of 14

ABI4 in the Control of Seed Germination 15

16

Kyounghee Lee1, Hong Gil Lee1, Seongmun Yoon, Hyun Uk Kim, and Pil Joon Seo* 17

18

Department of Bioactive Material Sciences and Research Center of Bioactive Materials, 19

Chonbuk National University, Jeonju 561-756, Republic of Korea (K.L., H.G.L., P.J.S.); 20

Department of Agricultural Biotechnology, National Academy of Agricultural Science, Rural 21

Development Administration, Jeonju 560-500, Republic of Korea (S.Y., H.U.K.); Department 22

of Chemistry and Research Institute of Physics and Chemistry, Chonbuk National University, 23

Jeonju 561-756, Republic of Korea (P.J.S.) 24

25

26



3

1These authors contributed equally to this work. 27

28

2This work was supported by the Basic Science Research (NRF-2013R1A1A1004831) and 29

Global Research Network (NRF-2014S1A2A2028392) programs provided by the National 30

Research Foundation of Korea and by the Next-Generation BioGreen 21 Program (SSAC, 31

Project No. PJ009484012014) provided by the Rural Development Administration (H.-U.K). 32

K.L. and H.G.L. were supported by the BK21 PLUS program in the Department of Bioactive 33

Material Sciences. 34

35

36

37

Corresponding author 38

39

Pil Joon Seo 40

The author responsible for distribution of materials integral to the findings presented in this 41

article in accordance with the policy described in the Instructions for Authors 42

(www.plantphysiol.org) is: Pil Joon Seo ([email protected]). 43

44

45



4

ABSTRACT 46

47

Seed germination is a key developmental transition that initiates the plant life cycle. The 48

timing of germination is determined by coordinated action of two phytohormones, gibberellin 49

(GA) and abscisic acid (ABA). In particular, ABA plays a key role in integrating 50

environmental information and inhibiting the germination process. Utilization of embryonic 51

lipid reserves contributes to seed germination by acting as an energy source, and ABA 52

suppresses lipid degradation to modulate the germination process. Here, we report that the 53

ABA-responsive R2R3-type MYB transcription factor MYB96, which is highly expressed in 54

embryo, regulates seed germination by controlling the expression of ABA-INSENSITIVE 4 55

(ABI4). In the presence of ABA, germination was accelerated in MYB96-deficient myb96-1 56

seeds, whereas the process was significantly delayed in MYB96-overexpressing activation-57

tagging myb96-ox seeds. Consistently, myb96-1 seeds degraded a larger extent of lipid 58

reserves even in the presence of ABA, while reduced lipid mobilization was observed in 59

myb96-ox seeds. MYB96 directly regulates ABI4, which acts as a repressor of lipid 60

breakdown, to define its spatial and temporal expression. Genetic analysis further 61

demonstrated that ABI4 is epistatic to MYB96 in the control of seed germination. Taken 62

together, the MYB96-ABI4 module regulates lipid mobilization specifically in the embryo to 63

ensure proper seed germination under suboptimal conditions. 64

65

66



5

INTRODUCTION 67

68

Seeds are products of plant sexual reproduction and facilitate the spread of offspring. Since 69

plants are sessile organisms with a limited ability to seek favorable growth conditions, seed 70

dispersal is an evolutionary adaptive trait to disseminate their offspring to optimal locations 71

(Bewley, 1997; Nonogaki, 2014). Thus, seeds enable plants to endure environmental 72

disadvantages and confine growth until they encounter favorable environmental conditions 73

(Bewley, 1997). 74

Seed embryogenesis is initiated by double fertilization (Gehring et al., 2004; Berger 75

et al., 2008). While the zygote divides asymmetrically to form the diploid embryo, the triploid 76

endosperm constantly proliferates inside the maternal ovule (Natesh and Rau, 1984; West and 77

Harada, 1993). At the end of embryonic growth phase, cell cycle activities in the embryo are 78

arrested (Raz et al., 2001), and storage molecules, such as proteins, carbohydrates, and lipids, 79

accumulate particularly in the cotyledons (Goldberg et al., 1989; Huang et al., 1992; Raz et al., 80

2001). This phase is referred to as seed maturation. Mature seeds become dehydrated and 81

enter a quiescent state that is tolerant to desiccation (Crouch, 1987; Harada et al., 1988; 82

Kermode, 1990; McCarty and Carson, 1991), establishing primary dormancy. 83

Seed dormancy can be broken, when seeds experience stratification and/or after-84

ripening (Vleeshouwers et al., 1995; Bewley, 1997; Nonogaki, 2014). Germination is a key 85

developmental transition to determine when to initiate the plant life cycle. Since it is an 86

irreversible transition, seeds have to precisely monitor external environmental factors, such as 87

light, temperature, water and nutrient availability, and high salinity (Huang et al., 2003; Qu et 88

al., 2008; Joosen et al., 2013; Lim et al., 2013). These environmental signals are integrated 89

into internal developmental programs in seeds, which are operated primarily by antagonistic 90

actions of two phytohormones: ABA and GA (Holdsworth et al., 1999; Finch-Savage and 91

Leubner-Metzger, 2006; Seo et al., 2006). GA promotes germination, whereas ABA 92

suppresses completion of the developmental transition (Garciarrubio et al., 1997; Debeaujon 93

and Koornneef, 2000; Finkelstein et al., 2002; Peng and Harberd, 2002; Ogawa et al., 2003; 94

Lau and Deng, 2010). 95

Transcriptional regulation is a fundamental regulation scheme for the seed 96

germination process (Thomas, 1993; Nakabayashi et al., 2005). The GA function in 97

promoting seed germination is accomplished partly through the action of central GA signaling 98



6

repressors, DELLA-domain proteins, including GA INSENSITIVE (GAI), REPRESSOR OF 99

GA1-3 (RGA), RGA-LIKE 1 (RGL1), RGL2, and RGL3, all of which act as transcriptional 100

regulators (Hussain and Peng, 2003; Tyler et al., 2004; Cao et al., 2006; Park et al., 2013). 101

They interact with transcription factors to allow DELLAs to regulate gene expression by 102

targeting specific gene promoters (de Lucas et al., 2008; Feng et al., 2008; Arnaud et al., 2010; 103

Gallego-Bartolomé et al., 2010; Hong et al., 2012). Indeed, DELLAs bind to promoters of GA 104

INSENSITIVE DWARF1 (GID1), WRKY27, and SCARECROW-LIKE 3 (SCL3) to control seed 105

germination (Zentella et al., 2007; Gallego-Bartolomé et al., 2011; Zhang et al., 2011; Stamm 106

et al., 2012). The DELLA proteins are rapidly degraded in response to GA and are thus 107

considered as repressors of seed germination in the absence of GA (Dill et al., 2001; Tyler et 108

al., 2004). 109

ABA regulation of seed germination also requires ABA-responsive transcription 110

factors. ABA INSENSITIVE 3 (ABI3), ABI4, and ABI5, which encode transcription factors 111

with the B3 domain, APETALA2 (AP2) domain, and basic leucine zipper (bZIP) domain, 112

respectively, are expressed highly in seeds and are involved in regulating sensitivity to ABA 113

(Giraudat et al., 1992; Finkelstein et al., 1998; Finkelstein and Lynch, 2000). Indeed, genetic 114

mutants at these loci exhibit reduced ABA sensitivity as well as accelerated seed germination 115

in the presence of exogenous ABA (Finkelstein and Somerville, 1990). They act in concert 116

with each other and form combinatorial networks to determine proper time to germinate 117

(Söderman et al., 2000; Nakamura et al., 2001). 118

In addition to their overlapping roles in ABA-dependent seed germination, ABI3, 119

ABI4, and ABI5 have their own unique functions. ABI4 is particularly interesting in that it 120

plays a unique role in embryonic lipid catabolism during the germination process (Penfield et 121

al., 2006). Seeds utilize lipid reserves to fuel postgerminative seedling growth (Penfield et al., 122

2005; Quettier and Eastmond, 2009), but the lipid catabolic process is inhibited in the 123

presence of ABA in order to delay seed germination, thereby minimizing environmental 124

damage of early seedlings. Notably, ABA specifically represses embryonic lipid breakdown 125

(Penfield et al., 2006). The differential responses of embryo and endosperm to ABA are 126

accomplished by confined expression of ABI4 in the embryo (Penfield et al., 2006). However, 127

the mechanism by which ABI4 is expressed specifically in the embryo and which specific 128

regulator(s) participate in defining its spatial and temporal expression remain unknown. 129

We previously showed that the MYB96 transcription factor mediates a variety of 130



7

plant responses to ABA, including drought resistance, stomatal conductance, lateral root 131

development, anthocyanin accumulation, and cuticular wax biosynthesis (Seo et al., 2009, 132

2011; Seo and Park, 2010, 2011). Expression of MYB96 is considerably induced by drought 133

stress and ABA (Seo et al., 2009), and it activates expression of many ABA-responsive genes 134

through direct binding to gene promoters to optimize plant growth and fitness under 135

environmentally unfavorable conditions (Seo et al., 2009, 2011; Seo and Park, 2010). 136

Here, we report that MYB96 also plays a key role in ABA control of seed 137

germination. The MYB96 gene was significantly expressed in the embryo and conferred 138

embryonic ABA sensitivity in seed germination as well as triacylglycerol (TAG) breakdown. 139

In the presence of ABA, myb96-ox seeds exhibited delayed germination with reduced lipid 140

breakdown, whereas myb96-1 seeds showed accelerated seed germination and lipid 141

breakdown. The MYB96 regulation of seed germination was largely dependent on ABI4, a 142

key repressor of embryonic lipid mobilization during the germination process. Together, our 143

findings provide evidence that MYB96 is an unequivocal transcriptional regulator of ABI4 144

and defines spatial and temporal specificity of its expression to fine-tune seed germination 145

under unfavorable environmental conditions. 146

147

148



8

RESULTS 149

150

MYB96 Is Expressed in Embryos 151

MYB96 mediates ABA signal transduction in a variety of physiological processes, such as 152

drought response, lateral root development, and cuticular wax accumulation (Seo et al., 2009, 153

2011). Since seed germination is also a key developmental transition governed by ABA 154

(Bewleyl, 1997; Nakashima and Yamaguchi-Shinozaki, 2013), it was highly plausible that 155

MYB96 may also regulate seed germination in an ABA-dependent manner. 156

To explore the role of MYB96 in seed germination, we first determined its expression 157

patterns in seeds. Quantitative RT-PCR (qRT-PCR) analysis revealed that MYB96 transcripts 158

accumulated at high levels in dry seeds (Fig. 1A), and its transcript accumulation was 159

drastically reduced after cold stratification and imbibition. The transcript levels of MYB96 160

were reduced by 98% after stratification compared to those in dry seeds (Fig. 1A) and 161

recovered at seedling stages (Supplemental Fig. S1), implying an inhibitory role of MYB96 in 162

seed germination. 163

Spatial expression patterns of MYB96 were further examined using pMYB96:GUS 164

transgenic seeds, in which a promoter sequence covering an approximately 2-kb region 165

upstream of the MYB96 transcription start site was transcriptionally fused to a β-166

glucuronidase (GUS)-coding sequence. In agreement with the qRT-PCR results, GUS 167

activities were strongly detected in dry seeds (Fig. 1B) and reduced after stratification and 168

imbibition (Supplemental Fig. S2). Moreover, dissection of seeds showed that high levels of 169

GUS expression were observed only in the embryo (Fig. 1B). GUS activity was undetectable 170

in the endosperm and seed coat (Fig. 1B). 171

172

MYB96 Is Induced by ABA in Seeds but not by GA 173

MYB96 is transcriptionally induced by ABA in seedlings (Seo et al., 2009). Considering that 174

ABA content decreases in seeds following stratification and imbibition (Grappin et al., 2000; 175

Shu et al., 2013), decreased expression of MYB96 during seed germination seemed likely to 176

correlate with endogenous ABA levels in seeds. We therefore asked whether ABA induction 177

of MYB96 is also relevant in seeds. 178

To examine the effect of ABA on MYB96 expression in germinating seeds, stratified 179

wild-type seeds were plated on Murashige and Skoog (MS)-medium supplemented with or 180



9

without ABA. qRT-PCR analysis showed that transcript levels of MYB96 were significantly 181

increased 3.5-fold by exogenous ABA treatment in wild-type seeds (Fig. 1C) (Seo et al., 182

2009). Histochemical analysis also revealed that the ABA induction of MYB96 was mainly 183

observed in the embryo (Supplemental Fig. S3). 184

Seed germination is tightly regulated by antagonistic interactions between ABA and 185

GA (Yano et al., 2009; Yaish et al., 2010). Thus, we next asked whether the promotive action 186

of GA in seed germination is also associated with MYB96 expression. Contrary to ABA, 187

MYB96 was unaffected by exogenous GA treatment (Fig. 1C). Furthermore, MYB96 188

expression was also unchanged in quadruple-DELLA (gai-t6 rga-t2 rgl1-1 rgl2-1) and GA-189

deficient ga1-3 mutants (Supplemental Fig. S4). These observations suggest that MYB96 190

plays a primary role in ABA signal transduction in seeds. 191

192

MYB96 Regulates ABA-Dependent Seed Germination 193

Our observation that seed-expressed MYB96 was regulated by ABA suggested that it might 194

have a physiological role in ABA-dependent seed germination. We therefore measured the 195

germination rate of seeds of wild-type, the MYB96-overexpressing activation-tagging line 196

(myb96-ox; Seo et al., 2009), and the T-DNA insertional MYB96-deficient mutant (myb96-1; 197

Seo et al., 2009) at various concentrations of ABA. 198

Germination rate of myb96-ox and myb96-1 seeds was similar to that of wild-type 199

seeds in the absence of ABA (Fig. 2A). However, in the presence of ABA, the germination 200

rate was substantially reduced in myb96-ox seeds but elevated in myb96-1 seeds compared 201

with wild-type seeds (Fig. 2A). The differential ABA responses of myb96-ox and myb96-1 202

seeds were more evident at higher concentrations of ABA (Fig. 2A). 203

For ABA dose-response assays, seeds were germinated on MS-medium plates 204

supplemented with different concentrations of ABA, and germination percentages were scored 205

2 days after cold stratification. These assays clearly revealed that the myb96-ox seeds 206

exhibited increased sensitivity to exogenous ABA, and the myb96-1 seeds were hyposensitive 207

to ABA relative to wild-type seeds (Fig. 2B). 208

Cotyledon opening is also sensitive to exogenous ABA treatment in the association 209

with seed germination. Cotyledon opening of myb96-ox and myb96-1 seeds was 210

indistinguishable from that of wild-type seeds in the absence of ABA (Supplemental Fig. S5). 211

However, in agreement with seed germination rates, cotyledon opening of myb96-ox was 212



10

hypersensitive to ABA, whereas the myb96-1 mutants were hyposensitive (Supplemental Fig. 213

S5 and S6). These observations indicate that MYB96 determines ABA sensitivity and 214

regulates ABA-dependent seed germination. 215

216

ABI4 Is Up-Regulated in myb96-ox 217

To establish the molecular networks underlying the MYB96 regulation of seed germination, 218

we monitored expression patterns of genes associated with ABA-dependent seed germination, 219

such as ABA INSENSITIVE 1 (ABI1), ABI2, ABI3, ABI4, ABI5, ACYL-COA BINDING 220

PROTEIN 1 (ACBP1), ARABIDOPSIS HISTIDINE KINASE1 (AHK1), BEL1-LIKE 221

HOMEODOMAIN 1 (BLH1), FY, RING-H2 FINGER A2A (RHA2a), SNF1-RELATED 222

PROTEIN KINASE 2.2 (SnRK2.2), and SnRK2.3 (Finkelstein and Somerville, 1990; 223

Söderman et al., 2000; Carles et al., 2002; Fujii et al., 2007; Tran et al., 2007; Moes et al., 224

2008; Li et al., 2011; Jiang et al., 2012; Du et al., 2013; Kim et al., 2013), in wild-type, 225

myb96-ox, and myb96-1, in the absence of ABA. In seeds, many genes were differentially 226

expressed in myb96-ox and myb96-1, but MYB96 regulation of ABI4 was most likely relevant 227

(Fig. 3A). Expression of ABI4 was reduced in myb96-1 seeds, whereas myb96-ox increased 228

ABI4 expression. To further support the observation, we also analyzed expression of these 229

genes in wild-type, myb96-ox, and myb96-1 seedlings. Most of the genes examined were 230

transcriptionally unchanged in the mutants, but expression of ABI4 was elevated 231

approximately 12-fold in the myb96-ox mutant (Fig. 3B). The ABI3 and ABI5 genes were also 232

slightly up-regulated in myb96-ox (Fig. 3B). However, their expression was not down-233

regulated in myb96-1, possibly due to extremely low expression levels of the genes in wild-234

type seedlings under normal growth condition. 235

Transcript levels of the same set of genes were analyzed in myb96-1 seeds in the 236

presence of ABA. Most of the genes, except for AHK1, FY, and RHA2a, were induced by 237

ABA. Notably, the ABA induction of ABI4 and BLH1 genes was significantly reduced in the 238

myb96-1 seeds compared with wild-type seeds (Fig. 4), while the ABA induction of the others 239

were not influenced. Expression of two genes was also analyzed in germinating myb96-ox 240

seeds in the presence of ABA. Accordingly, their ABA induction was slightly hypersensitive 241

in myb96-ox (Supplemental Fig. S7). While expression of BLH1 seems to be dependent upon 242

MYB96, based on the close correlation between ABI4 expression and MYB96 activity (Fig. 3 243

and 4), we hypothesized that MYB96 is intimately required for proper expression of ABI4 in 244



11

the control of ABA-mediated seed germination. Consistent with this, expression patterns of 245

ABI4 in seeds were similar to those of MYB96. The ABI4 gene was highly expressed in dry 246

seeds, particularly embryo (Söderman et al., 2000; Penfield et al., 2006; Bossi et al., 2009), 247

and its expression was reduced after stratification and imbibition as the transcript 248

accumulation patterns of MYB96 (Supplemental Fig. S8). Their spatial expression patterns 249

were also similar (Supplemental Fig. S9), further supporting the positive regulation of ABI4 250

by MYB96. 251

252

MYB96 Binds Directly to the ABI4 Promoter 253

MYB96 is an R2R3-type MYB transcription factor (Seo et al., 2009). Plant R2R3 MYB-DNA 254

binding domain-containing proteins are known to bind directly to consensus DNA elements 255

that are enriched in adenosine and cytosine residues (Seo et al., 2011; Prouse and Campbell, 256

2013). We therefore asked whether MYB96 binds directly to the consensus motifs on the 257

ABI4 promoter. Sequence analysis revealed that the ABI4 promoter contains five conserved 258

sequence motifs that are analogous to the R2R3-type MYB-binding consensus sequences (Fig. 259

5A). The presence of MYB-binding cis-elements led us to examine whether MYB96 is 260

targeted to the ABI4 promoter. 261

To perform chromatin immunoprecipitation (ChIP) assays, we generated 262

pMYB96:MYB96-MYC transgenic plants. Total protein extracts from control pBA002 and 263

pMYB96:MYB96-MYC transgenic seeds were immunoprecipitated with anti-MYC-antibody. 264

DNA bound to epitope-tagged MYB96 proteins was analyzed by quantitative real-time PCR 265

(qPCR) assays. The ChIP analysis showed that the A region of the ABI4 promoter was 266

enriched by MYB96 (Fig. 5B). In contrast, two other genomic fragments containing MYB-267

binding cis-elements, B and C, were not enriched (Fig. 5B), supporting the specific 268

interaction of MYB96 with the A region of the ABI4 promoter. In addition, control ChIP with 269

resin alone did not enrich the A fragment (Fig. 5B). To convince the direct binding of MYB96 270

to the ABI4 promoter, we also generated the transgenic plants expressing the R2R3-MYB 271

DNA binding domain (BD) of MYB96 fused with the MYC-coding sequences (35S:96BD-272

MYC). ChIP analysis revealed that the MYB-DNA binding domain was sufficient to bind to 273

the ABI4 promoter (Supplemental Fig. S10). 274

To confirm the MYB96 binding to core sequences of ABI4 promoter, we performed 275

transient expression analysis using Arabidopsis protoplasts. Two core elements on the ABI4 276



12

promoter, A-1 (-264, CAAGTAACTTATGA) and A-2 (-335, GCTATAGTTACCCA), were 277

fused to the 35S minimal promoter. A recombinant reporter plasmid and an effector plasmid 278

p35S:MYB96 were cotransformed into Arabidopsis protoplasts. Cotransformation with the 279

reporter A-1 increased the GUS activity by two- to three-fold, but cotransformation with A-2 280

did not affect reporter gene expression (Fig. 5C). These results indicate that MYB96 281

specifically targets proximal sequences upstream of the ABI4 gene to activate its expression. 282

283

MYB96 Contributes to Inhibiting TAG Degradation during Germination 284

Seed germination is elaborately regulated by discrete actions of the embryo and endosperm 285

(Lafon-Placette and Köhler, 2014). An intriguing example is ABA-controlled lipid breakdown 286

and mobilization in the embryo under suboptimal growth conditions (Penfield et al., 2006). 287

Seed TAG degradation is triggered to fuel embryonic growth during germination but is 288

antagonized by ABA specifically in the embryo (Penfield et al., 2006). It is noteworthy that 289

the ABI4 transcription factor is a well-known regulator of this process, which confers 290

differential sensitivity of lipid catabolism to ABA in the embryo and endosperm (Penfield et 291

al., 2006). 292

Since ABI4 is a major regulatory target of the MYB96 transcription factor, we 293

hypothesized that MYB96 may also be responsible for ABA regulation of lipid breakdown 294

during seed germination, similar to the action of ABI4 (Penfield et al., 2006; Wind et al., 295

2013). To falsify the hypothesis, we measured levels of total fatty acid and eicosenoic acid 296

(20:1) in wild-type, myb96-ox, and myb96-1 seeds for 3 days after cold imbibition in the 297

absence or presence of exogenous ABA. In the absence of ABA, the levels of total fatty acid 298

and eicosenoic acid (20:1) were largely indistinguishable in myb96-ox and myb96-1 compared 299

with wild-type seeds (Supplemental Fig. S11). However, in the presence of ABA, the levels of 300

total fatty acid and eicosenoic acid were noticeably altered in myb96-ox and myb96-1. Total 301

fatty acid levels were reduced by approximately 30-35% 3 days after cold imbibition in wild-302

type seeds. However, TAG breakdown was largely repressed in the myb96-ox seeds, whereas 303

43% of total TAG was catabolized in the myb96-1 seeds (Fig. 6A). The levels of eicosenoic 304

acid displayed similar degradation kinetics to total fatty acid (Fig. 6B). These observations 305

demonstrate that MYB96 plays a role in regulating lipid breakdown during seed germination. 306

307

ABI4 Is Epistatic to MYB96 308



13

Our results indicated that the MYB96-ABI4 transcriptional cascade is crucial for ABA 309

regulation of seed germination, probably through lipid mobilization. To confirm the genetic 310

relationship between MYB96 and ABI4, we genetically crossed myb96-ox to the abi4-1 mutant. 311

We investigated the ABA sensitivity of myb96-ox/abi4-1 seeds during germination. 312

Delayed germination was observed in myb96-ox seeds, whereas the abi4-1 mutation led to 313

accelerated seed germination, in the presence of ABA (Fig. 7A). The germination rate of 314

myb96-ox/abi4-1 seeds was comparable to that of abi4-1 (Fig. 7A), indicating that MYB96 is 315

an upstream regulator of ABI4 and that both genes act in the same pathway. 316

In agreement with seed germination rate, eicosenoic acid catabolism of myb96-317

ox/abi4-1 was also indistinguishable from that of abi4-1 (Fig. 7B). A significant amount of the 318

stored TAG was degraded in both genotypes, even in the presence of ABA. Therefore, we 319

conclude that ABI4 is genetically epistatic to MYB96 with respect to the control of ABA-320

dependent seed germination as well as TAG catabolism. 321

Taken together, our observations demonstrate that the MYB96 transcription factor 322

serves as an ABA signaling mediator in modulating seed germination through ABI4-323

dependent embryonic lipid breakdown (Fig. 7C). MYB96 directly regulates ABI4, a key 324

regulator of embryonic lipid mobilization during seed germination, by binding to its gene 325

promoter. Genetic analyses further bolster this genetic hierarchy in the control of seed 326

germination. 327

328

329



14

DISCUSSION 330

331

MYB96 Regulation of ABI4 332

ABA is perceived by receptor protein complexes that are composed of PYRABACTIN 333

RESISTANCE (PYR)/PYR1-LIKE (PYL)/REGULATORY COMPONENT OF ABA 334

RECEPTOR (RCAR), type 2C protein phosphatases (PP2Cs), and SNF1-related protein 335

kinase 2 proteins (SnRK2s) (Raghavendra et al., 2010; Weiner et al., 2010). In the presence of 336

ABA, PYR/PYL/RCAR proteins lead to suppression of PP2C activities, derepressing SnRK2 337

protein kinases to activate ABA-responsive binding factors/ABA-responsive element-binding 338

proteins (ABFs/AREBs) (Fujii et al., 2009; Nishimura et al., 2010; Gonzalez-Guzman et al., 339

2012). Subsequent ABA responses are mediated by a large number of transcription factors, 340

indicating that transcriptional cascades are a fundamental framework in ABA signal 341

transduction (Giraudat et al., 1992; Busk and Pagès, 1998; Finkelstein et al., 1998; Finkelstein 342

and Lynch, 2000; Abe et al., 2003; Pandey et al., 2005; Seo et al., 2009). 343

In particular, the ABI3, ABI4, and ABI5 transcription factors all play a common role 344

in ABA regulation of seed germination by constituting combinatorial networks (Söderman et 345

al., 2000; Nakamura et al., 2001). However, despite their functional similarities, the 346

regulatory mechanisms of ABI3, ABI4, and ABI5 differ markedly. The ABI3 protein is 347

proteolytically degraded by a RING E3 ligase ABI3-INTERACTING PROTEIN 2 (AIP2), a 348

negative regulator of ABA signaling (Zhang et al., 2005). Controlled protein degradation also 349

underlies ABI5 activity regulation. The KEEP ON GOING (KEG) E3 ligase executes ABI5 350

degradation under normal growth conditions (Stone et al., 2006; Liu et al., 2010). In the 351

presence of ABA, KEG is rapidly degraded, promoting accumulation of high levels of ABI5. 352

Additional E3 ligases, such as DWD HYPERSENSITIVE TO ABA1 (DWA1), DWA2, and 353

SIZ1, further fine-tune protein accumulation of ABI5 (Miura et al., 2009; Lee et al., 2010). 354

Compared with ABI3 and ABI5, relatively less is known regarding how ABI4 activity 355

is regulated at the molecular level. This study demonstrates that the MYB96 transcription 356

factor regulates ABI4 expression by binding directly to the gene promoter and defines its 357

spatial and temporal expression. Both MYB96 and ABI4 genes are strongly expressed in the 358

embryo and are responsive to exogenous ABA (Penfield et al., 2006). Furthermore, the 359

promotive effect of ABA on ABI4 expression is largely impaired in the myb96-1 mutant, 360

indicating that MYB96 is an unequivocal transcriptional regulator required for proper 361



15

expression of ABI4 in an ABA signaling pathway. 362

The raising question is how MYB96 activity is regulated by ABA. Given the myriad 363

targets of MYB96, it is likely that MYB96 acts on upstream of ABA signaling pathways. It is 364

probable that controlled protein turnover and/or posttranslational modifications mediated by 365

ABA receptor-like complex might underlie ABA regulation of MYB96 activity, and the ABA 366

induction of MYB96 transcription may be a result of feedback regulation. Further works are 367

required to get the comprehensive view of the signaling network built up from MYB96. 368

369

TAG Degradation during Seed Germination 370

Utilization of seed storage reserves, such as carbohydrates, proteins, and lipids, is crucial for 371

driving germination and postgerminative seedling growth (Penfield et al., 2004, 2006; 372

Quettier and Eastmond, 2009), albeit controversial (Pritchard et al., 2002; Kelly et al., 2011). 373

Arabidopsis seeds mainly store TAG as the major carbon reserves, which accumulate at the 374

later stages of seed maturation (Lu and Hills, 2002; Maeo et al., 2009). Following seed 375

imbibition, fatty acids are degraded through β-oxidation (Footitt et al., 2002) and primarily 376

consumed as a form of soluble carbohydrates that are converted by the glyoxylate cycle and 377

gluconeogenesis (Penfield et al., 2005; Pracharoenwattana et al., 2010). In agreement with 378

this, mutants with defective TAG hydrolysis exhibit delayed germination and perturbed 379

postgerminative seedling growth (Penfield et al., 2005, 2006; Quettier and Eastmond, 2009; 380

Kelly et al., 2011). 381

Exogenous ABA provokes delayed germination in part by reducing lipid breakdown 382

(Penfield et al., 2006). Genes involved in conversion of TAG into soluble sugars are down-383

regulated in response to ABA (Pritchard et al., 2002), and thus the levels of fatty acid-derived 384

sugars in ABA-treated seeds are markedly decreased (Pritchard et al., 2002). Notably, the 385

ABA regulation of lipid breakdown is relevant particularly in embryos (Penfield et al., 2006), 386

indicating the differential sensitivity of embryo and endosperm to ABA. The ABI4 387

transcription factor is a major regulator in this process. Embryo-expressed ABI4 negatively 388

regulates lipid mobilization and thus seed germination in the presence of ABA (Penfield et al., 389

2006). 390

In this study, we discover the MYB96-ABI4 signaling module that regulates ABA-391

dependent seed germination process possibly through the control of lipid mobilization. 392

MYB96 not only confers ABA sensitivity to embryos, but also participates in embryonic lipid 393



16

mobilization to properly regulate seed germination, similar to the role of ABI4 in seed 394

germination (Penfield et al., 2006). The myb96-1 seeds degrade a significant content of TAG 395

even in the presence of ABA, whereas TAG breakdown is largely impaired in myb96-ox seeds. 396

Given that the MYB96-mediated physiological responses in seeds largely depend on ABI4, 397

MYB96 appears to be an explicit transcriptional regulator of ABI4 to define its expression 398

pattern in seeds and to ensure proper seed germination. 399

400

Importance of MYB96-ABI4 Transcriptional Cascades in Seed Germination 401

The MYB96 transcription factor modulates a variety of plant developmental processes in 402

response to ABA, including shoot development, root architecture remodeling, stomatal 403

closure, cuticular wax accumulation, and hormone biosynthesis (Seo et al., 2009, 2011; Seo 404

and Park, 2010). Based on this study, MYB96 also appears to play a role in ABA-dependent 405

seed germination. 406

Multiple functions of MYB96 are achieved by regulating a myriad of transcriptional 407

target genes that underlie a variety of signaling pathways. For example, ABA-induced 408

cuticular wax biosynthesis is mediated by MYB96 regulation of 3-KETOACYL-COENZYME 409

A SYNTHASE (KCS) genes encoding rate-limiting enzymes of the very long chain fatty acid 410

(VLCFA) elongation process (Seo et al., 2011). MYB96-GRETCHEN HAGEN3s (GH3s) 411

transcriptional cascades regulate lateral root development under water-deficient conditions by 412

reestablishing auxin homeostasis (Seo et al., 2009). The RESPONSIVE TO DESSICATION 22 413

(RD22) gene is probably one of regulatory targets of MYB96 that functions in the control of 414

drought tolerance (Seo et al., 2009). LIPID TRANSFER PROTEIN 3 (LTP3) is responsible in 415

part for MYB96 regulation of freezing and drought tolerance (Guo et al., 2013). In addition, 416

the MYB96-ABI4 transcriptional module is crucial for ABA-dependent seed germination. 417

Genetic analysis reveals that delayed germination of myb96-ox is fully suppressed by the abi4 418

mutation, indicating that ABI4 is the principle target of MYB96 in the control of seed 419

germination. Collectively, MYB96 is an important ABA signaling mediator that globally links 420

multiple signaling pathways and thus facilitates plants to trigger efficient physiological and 421

cellular reprogramming for environmental adaptation. 422

Meanwhile, ABI4 integrates a variety of external and internal signals, such as light, 423

ABA, reactive oxygen species (ROS), and soluble sugars (Pesaresi et al., 2007; Shkolnik-424

Inbar and Bar-Zvi, 2010; Kerchev et al., 2011; Yang et al., 2011; Foyer et al., 2012), and 425



17

regulates hormone biosynthesis and sugar and lipid metabolism (Kerchev et al., 2011; Shu et 426

al., 2013; Wind et al., 2013). Thus, ABI4 coordinates developmental programs with 427

environmental signals to optimize plant growth and development processes. MYB96 is 428

particularly relevant in ABA signal transduction to ABI4, and other signaling regulators are 429

likely responsible for transcriptional regulation of ABI4 with respect to other input signals. 430

Taken together, the MYB96-ABI4 signaling module is important for the control of 431

ABA-dependent seed germination. MYB96 precisely conveys ABA signaling to ABI4 in 432

embryos during seed germination, and ABI4 in turn integrates multitude environmental and 433

developmental information to determine proper timing for germination. Multiple 434

transcriptional cascades allow not only for signal amplification, but also enable plants to make 435

integrative decisions. 436

437

438

MATERIALS AND METHODS 439

440

Plant Materials and Growth Conditions 441

Arabidopsis thaliana (Columbia-0 ecotype) was used for all experiments described, unless 442

specified otherwise. Plants were grown under long day conditions (16-h light/8-h dark cycles) 443

with cool white fluorescent light (100 μmol photons m-2 s-1) at 23 °C. The myb96-ox and 444

myb96-1 mutants (GABI_120B05) were previously reported (Seo et al., 2009). The abi4-1 445

mutant (CS8104) was obtained from the Arabidopsis Biological Resource Center 446

(http://abrc.osu.edu/). The myb96-ox/abi4-1 double mutant was generated by genetic cross of 447

myb96-ox and abi4-1 mutants. Identification of abi4-1 was performed as previously described 448

(Finkelstein et al., 1998). 449

450

Quantitative Real-Time RT-PCR Analysis 451

Total RNA was extracted using TRI agent (TAKARA Bio, Singa, Japan) according to the 452

manufacturer’s recommendations. Reverse transcription (RT) was performed using Moloney 453

Murine Leukemia Virus (M-MLV) reverse transcriptase (Dr. Protein, Seoul, South Korea) 454

with oligo(dT18) to synthesize first-strand cDNA from 2 μg of total RNA. Total RNA samples 455

were pretreated with an RNAse-free DNAse. cDNAs were diluted to 100 μL with TE buffer, 456



18

and 1 μL of diluted cDNA was used for PCR amplification. 457

Quantitative RT-PCR reactions were performed in 96-well blocks using the Step-One 458

Plus Real-Time PCR System (Applied Biosystems). The PCR primers used are listed in 459

Supplemental Table S1. The values for each set of primers were normalized relative to 460

EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1 (eIF4A) (At3g13920). All qRT-461

PCR reactions were performed in triplicate using total RNA samples extracted from three 462

independent biological replicates. The comparative ΔΔCT method was employed to evaluate 463

relative quantities of each amplified product in the samples. The threshold cycle (CT) was 464

automatically determined for each reaction by the instrument software using default 465

parameters. The specificity of the qRT-PCR reactions was determined by melt curve analysis 466

of the amplified products using the standard method installed in the system. 467

468

Measurement of GUS Activity 469

Seeds were dissected into embryo and endosperm surrounded with seed coat. For 470

histochemical staining of GUS activity, plant materials were fixed by immersing in 90% 471

acetone for 20 min on ice, washed twice with rinsing solution [50 mM sodium phosphate, pH 472

7.0, 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6], and subsequently incubated in staining solution 473

containing 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc) (Duchefa, Harlem, 474

The Netherlands) at 37oC for 18-24 h, depending on staining intensity (Padmanaban et al., 475

2007). 476

477

Seed Germination Assays 478

All genotypes were grown at 23°C under long-day conditions, and seeds were collected at the 479

same time. Harvested seeds were dried at room temperature at least 1 month before 480

germination assays. For seed germination assays, 40-50 seeds for each line were sterilized and 481

plated on Murashige and Skoog medium (half-strength MS salts, 0.05% MES, pH 5.7, and 0.7% 482

agar) supplemented with various concentrations of ABA (0, 0.5, 1, 3 μM). Plates were 483

stratified in darkness for 3 days at 4oC and transferred to a culture room set at 23oC with a 16-484

h light/8-h dark cycle. Germination was scored at the indicated time points by counting the 485

frequency of radicle emergence from the seed coat and endosperm. For each germination 486

assay, biological triplicates were performed. 487



19

For investigating the effects of ABA on cotyledon greening, the percentage of 488

cotyledon greening was scored after the end of stratification. Cotyledon greening was defined 489

as complete expansion of cotyledon and greening. 490

491

Chromatin Immunoprecipitation (ChIP) Assays 492

ChIP assays were performed as previously described (Yang et al., 2011). pMYB96:MYC-493

MYB96 transgenic plants, anti-MYC antibodies (Millipore, Billerica, USA) and salmon sperm 494

DNA/protein A agarose beads (Millipore, Billerica, USA) were used for ChIP. DNA was 495

purified using phenol/chloroform/isoamyl alcohol and sodium acetate (pH 5.2). The level of 496

precipitated DNA fragments was quantified by quantitative real-time PCR using specific 497

primer sets (Supplemental Table S2). Values were normalized with the level of input DNA. 498

The values in pBA002 control plants were set to 1 after normalization against eIF4a for 499

quantitative PCR analysis. 500

501

Transient Gene Expression Assays 502

For transient expression assays using Arabidopsis protoplasts, reporter and effector plasmids 503

were constructed. The reporter plasmid contains a minimal 35S promoter sequence and the 504

GUS gene. The core elements on ABI4 promoter were inserted into the reporter plasmid. To 505

construct the p35S:MYB96 effector plasmid, the MYB96 cDNA was inserted into the effector 506

vector containing the CaMV 35S promoter. Recombinant reporter and effector plasmids were 507

cotransformed into Arabidopsis protoplasts by polyethylene glycol–mediated transformation 508

(Yoo et al., 2007). The GUS activities were measured by a fluorometric method. A CaMV 35S 509

promoter-luciferase construct was also cotransformed as an internal control. The luciferase 510

assay was performed using the Luciferase Assay System kit (Promega, Madison, WI). 511

512

Fatty Acid Determinations 513

The total fatty acid content and amount of eicosenoic acid (20:1 n-9) in seeds were measured 514

by gas chromatographic analysis with a known amount of 15:0 fatty acid as an internal 515

standard. Samples were transmethylated at 90°C for 90 min in 0.3 mL of toluene and 1 mL of 516

5% H2SO4 (v/v methanol). After transmethylation, 1.5 mL of 0.9% NaCl solution was added, 517

and the fatty acid methyl esters (FAMEs) were transferred to a new tube for three sequential 518

extractions with 1.5 mL of n-hexane. FAMEs were analyzed by gas chromatography using a 519



20

GC-2010 plus instrument (Shimadzu, Japan) with a 30 m x 0.25 mm (inner diameter) HP-520

FFAP column (Agilent, USA), during which the oven temperature was increased from 170°C 521

to 180 °C at 1°C/min. 522

523

Accession Numbers 524

Sequence data from this article can be found in the Arabidopsis Genome Initiative or 525

GenBank/EMBL databases under the following accession numbers: ABI1 (At4g26080), ABI2 526

(At5g57050), ABI3 (At3g24650), ABI4 (At2g40220), ABI5 (At2g36270), MYB96 527

(At5g62470), ACBP1 (At5g53470), AHK1 (At2g17820), BLH1 (At2g35940), FY 528

(At5g13480), RHA2a (At1g15100), SnRK2.2 (At3g50500), SnRK2.3 (At5g66880), and eIF4a 529

(At3g13920). 530

531

532

Supplemental Data 533

The following materials are available in the online version of this article. 534

535

Supplemental Figure S1. Temporal expression of MYB96. 536

Supplemental Figure S2. Expression of MYB96 in embryo after cold imbibition. 537

Supplemental Figure S3. ABA induction of MYB96 in embryo. 538

Supplemental Figure S4. Expression of MYB96 in quadruple-DELLA and GA-deficient 539

mutants. 540

Supplemental Figure S5. Cotyledon opening of myb96-ox and myb96-1 in the presence of 541

ABA. 542

Supplemental Figure S6. ABA dose-response assays. 543

Supplemental Figure S7. Expression of ABI4 and BLH1 in myb96-ox mutant in the presence 544

of ABA. 545

Supplemental Figure S8. ABI4 expression in dry seeds and during seed germination. 546

Supplemental Figure S9. Spatial expression of MYB96 and ABI4. 547

Supplemental Figure S10. Chromatin immunoprecipitation using 35S:96BD-MYC transgenic 548

plants. 549

Supplemental Figure S11. Lipid breakdown in wild-type, myb96-ox, and myb96-1 seeds 550

during seed germination in the absence of ABA. 551



21

Supplemental Table S1. Primers used in qRT-PCR. 552

Supplemental Table S2. Primers used in ChIP assays. 553

554

555

FIGURE LEGENDS 556

557

Figure 1. Expression of MYB96 in Seeds. 558

A, MYB96 expression in dry seeds and during seed germination. Wild-type seeds were kept in 559

darkness at 4oC for 72 h (stratification) and transferred to long day (LD) conditions at 22

oC 560

for germination. Transcript accumulation was analyzed by quantitative RT-PCR (qRT-PCR). 561

The eIF4a gene (At3g13920) was used as an internal control. Biological triplicates were 562

averaged. Bars indicate the standard error of the mean. DAC, days after cold stratification. 563

B, Histochemical staining analysis. The pMYB96:GUS transgenic seeds, in which a promoter 564

sequence covering an approximately 2-kb region upstream of the MYB96 transcription start 565

site was transcriptionally fused to a β-glucuronidase (GUS)-coding sequence, were subject to 566

GUS staining. Scale bars = 0.7 μm. 567

C, Induction of MYB96 by ABA in seeds. Stratified wild-type seeds were transferred to MS-568

medium supplemented with 5 μM ABA or GA and incubated for 1 day under LD conditions. 569

Transcript accumulation was analyzed by qRT-PCR. Biological triplicates were averaged. 570

Bars indicate the standard error of the mean. 571

572

Figure 2. ABA Sensitivity of myb96-ox and myb96-1 in Seed Germination. 573

A, Germination rate of myb96-ox and myb96-1. Seed germination percentage of the indicated 574

genotypes grown on different concentrations of ABA was quantified after the end of 575

stratification. Radicle emergence was used as a morphological marker for germination. At 576

least 40 seeds per genotype were measured in each replicate. Biological triplicates were 577

averaged. Bars indicate the standard error of the mean. Statistically significant differences 578

between the wild-type and mutants are indicated by asterisks (Student’s t-test, *P<0.05). 579

B, ABA dose-response assay. Wild-type, myb96-ox, and myb96-1 seeds were germinated on 580

an increasing concentration of ABA. Germination percentages were scored 2 days after cold 581

stratification. Biological triplicates were averaged. Bars indicate the standard error of the 582



22

mean. Statistically significant differences between the wild-type and mutants are indicated by 583

asterisks (Student’s t-test, *P<0.05). 584

585

Figure 3. Expression of Genes Involved in ABA-Dependent Seed Germination in myb96-ox 586

and myb96-1 mutants. 587

Germinating seeds (A) and 10-day-old seedlings (B) grown under LD conditions were 588

harvested for total RNA isolation. Transcript accumulation was analyzed by qRT-PCR. The 589

eIF4a gene was used as an internal control. Biological triplicates were averaged. Bars indicate 590

the standard error of the mean. Statistically significant differences between the wild-type and 591

mutants are indicated by asterisks (Student’s t-test, *P<0.05). 592

593

Figure 4. Compromised Expression of ABI4 in myb96-1 upon Exogenous ABA Treatment. 594

Germinating seeds were plated on MS-medium supplemented with or without 5 μM ABA and 595

incubated for 1 day. Transcript accumulation was analyzed by qRT-PCR. Biological triplicates 596

were averaged. Bars indicate the standard error of the mean. 597

598

Figure 5. Binding of MYB96 to Consensus Sequences in the ABI4 Promoter. 599

A, R2R3-MYB binding consensus sequences on the ABI4 promoter. Core binding sequences 600

are marked with arrowheads. Underbars represent amplified genomic regions. The numbers 601

below the underbars indicate amplification product size (bp). 602

B, ChIP assays. Total protein extracts from pMYB96:MYB96-MYC transgenic seeds were 603

immunoprecipitated with an anti-MYC antibody. Fragmented genomic DNA was eluted from 604

the protein-DNA complexes and subjected to quantitative PCR (qPCR) analysis. Biological 605

triplicates were averaged and statistical significance of the measurements was determined 606

using a Student’s t-test (*P <0.05). Bars indicate the standard error of the mean. In each 607

experiment, the measurement values in pBA002 were set to 1 after normalization against 608

eIF4a for quantitative PCR analysis. 609

C, Transient expression analysis using Arabidopsis protoplasts. The core promoter sequence 610

elements of ABI4, A-1 (CAAGTAACTTATGA) and A-2 (GCTATAGTTACCCA), were 611

constructed into the reporter plasmid. The recombinant reporter and effector constructs were 612

coexpressed transiently in Arabidopsis protoplasts, and GUS activities were determined 613

fluorimetrically. Luciferase gene expression was used to normalize the GUS activities. The 614



23

normalized values in control protoplasts were set to 1 and represented as relative activation. 615

Three independent measurements were averaged. Statistical significance was determined by a 616

Student’s t-test (*P<0.05). Bars indicate the standard error of the mean. 617

618

Figure 6. Lipid Breakdown in Wild-type, myb96-ox, and myb96-1 Seeds during Seed 619

Germination in the Presence of ABA. 620

Seeds were germinated on MS-plates supplemented with 1 μM ABA and incubated at 23oC 621

under LD conditions for 3 days. Lipid breakdown was determined by measuring the 622

abundance of total fatty acid (A) and eicosenoic acid (20:1) (B). Fatty acid content was 623

expressed as the percentage of the amount present in dry seeds of the indicated genotypes. At 624


averaged. Bars indicate the standard error of the mean. 626

627

Figure 7. Genetic Hierarchy of ABI4 and MYB96. 628

A, Germination rate of myb96-ox/abi4-1. Seed germination percentage of each genotype on 1 629

μM ABA was scored at indicated time points after cold stratification. At least 50 seeds per 630

genotype were measured in each replicate. Biological triplicates were averaged. Bars indicate 631

standard error of the mean. 632

B, Lipid breakdown of myb96-ox/abi4-1. Seeds were germinated on MS-plates supplemented 633

with 1 μM ABA and incubated at 23oC under LD conditions for 3 days. Eicosenoic acid (20:1) 634

content was expressed as a percentage of the amount in dry seeds of indicated genotypes. At 635


averaged. Bars indicate the standard error of the mean. 637

C, Proposed role of MYB96 during seed germination. The ABA-inducible R2R3-type 638

MYB96 transcription factor regulates ABI4 expression by binding directly to its gene 639

promoter. The MYB96-ABI4 module inhibits lipid mobilization specifically in the embryo, 640

thereby contributing to delaying seed germination under suboptimal conditions. 641



Figure 1

Figure 1. Expression ofMYB96 in Seeds.

A, MYB96 expression in dry seeds and during seed germination. Wild-type seeds were kept in darkness at 4oC for 72 h

(stratification) and transferred to long day (LD) conditions at 22oC for germination. Transcript accumulation was analyzed

by quantitative RT-PCR (RT-qPCR). The eIF4a gene (At3g13920) was used as an internal control. Biological triplicates

were averaged. Bars indicate the standard error of the mean. DAC, days after cold stratification.

B, Histochemical staining analysis. The pMYB96:GUS transgenic seeds, in which a promoter sequence covering an

approximately 2-kb region upstream of the MYB96 transcription start site was transcriptionally fused to a -glucuronidase

(GUS)-coding sequence, were subject to GUS staining. Scale bars = 0.7 m.

C, Induction of MYB96 by ABA in seeds. Stratified wild-type seeds were transferred to MS-medium supplemented with 5

M ABA or GA and incubated for 1 day under LD conditions. Transcript accumulation was analyzed by RT-qPCR.

Biological triplicates were averaged. Bars indicate the standard error of the mean.

B -GUS +GUS +GUS

A

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

Dry seed DAC0 DAC1

MYB96R

elat

ive

expr

essi

on

0

1

2

3

4

5

6

Mock ABA GA

MYB96

C

Embryo Embryo Endosperm/seed coat



Figure 2

0

20

40

60

80

100

0 0.5 1.0 3.0 (M)

0 12 24 36 48 60 72 84 96 108 120 132(h)

0

20

40

60

80

100

Ger

min

atio

n(%

)

0M ABA

0

20

40

60

80

1000.5M ABA

0

20

40

60

80

1001.0M ABA

0

20

40

60

80

1003.0M ABA

Ger

min

atio

n(%

)G

erm

inat

ion(

%)

Ger

min

atio

n(%

)

Col-0

myb96-ox

myb96-1

A

B

Ger

min

atio

n(%

)

*

*

*

*

*

*

*

*

*

*

**

* *

*

* *

*

*

*

*

*

*

*



Figure 2. ABA Sensitivity of myb96-ox and myb96-1 in Seed Germination.A, Germination rate of myb96-ox and myb96-1. Seed germination percentage of the indicatedgenotypes grown on different concentrations of ABA was quantified after the end of stratification.Radicle emergence was used as a morphological marker for germination. At least 40 seeds pergenotype were measured in each replicate. Biological triplicates were averaged. Bars indicate thestandard error of the mean. Statistically significant differences between the wild-type and mutants areindicated by asterisks (Student’s t-test, *P<0.05).B, ABA dose-response assay. Wild-type, myb96-ox, and myb96-1 seeds were germinated on anincreasing concentration of ABA. Germination percentages were scored 2 days after cold stratification.Biological triplicates were averaged. Bars indicate the standard error of the mean. Statisticallysignificant differences between the wild-type and mutants are indicated by asterisks (Student’s t-test,*P<0.05).



Figure 3

Col-0

myb96-ox

myb96-1

0

2

4

6

8

10

12

14

Rel

ativ

e ex

pres

sion

ABI1 ABI2 ABI3 ABI4 ABI5 ACBP1 BLH1 FY RHA2a SnRK2.2 SnRK2.3AHK1

*

*

*

0

0.5

1

1.5

2

2.5

Rel

ativ

e ex

pres

sion

B

A

ABI1 ABI2 ABI3 ABI4 ABI5 ACBP1 BLH1 FY RHA2a SnRK2.2 SnRK2.3AHK1

**

*

** *

*

*

*

*

Figure 3. Expression of Genes Involved in ABA-Dependent Seed Germination in myb96-ox and myb96-1 mutants.

Germinating seeds (A) and 10-day-old seedlings (B) grown under LD conditions were harvested for total RNA isolation.

Transcript accumulation was analyzed by RT-qPCR. The eIF4a gene was used as an internal control. Biological triplicates

were averaged. Bars indicate the standard error of the mean. Statistically significant differences between the wild-type and

mutants are indicated by asterisks (Student’s t-test, *P<0.05).



Figure 4

0

5

10

15

20

25

30

35ABI1

0

1

2

3

4ABI3

0

10

20

30

40

50

60ABI5

0

20

40

60

80ABI2

0

1

2

3

4BLH1

0

0.5

1

1.5

2

2.5ACBP1

0

0.5

1

1.5

2

2.5SnRK2.2

0

0.5

1

1.5

2

2.5

3

3.5SnRK2.3

Mock ABA Mock ABA

Col-0 myb96-1

Mock ABA Mock ABA

Col-0 myb96-1

0

1

2

3ABI4

0

0.5

1

1.5AHK1

0

1

2FY

0

0.5

1

1.5

2

2.5RHA2a

Mock ABA Mock ABA

Col-0 myb96-1

Mock ABA Mock ABA

Col-0 myb96-1

Rel

ativ

e ex

pres

sion

Rel

ativ

e ex

pres

sion

Rel

ativ

e ex

pres

sion

Figure 4. Compromised Expression of ABI4 in myb96-1 upon Exogenous ABA Treatment.

Germinating seeds were plated on MS-medium supplemented with or without 5 M ABA and incubated for 1 day.

Transcript accumulation was analyzed by RT-qPCR. Biological triplicates were averaged. Bars indicate the standard error

of the mean.



Figure 5

Figure 5. Binding of MYB96 to Consensus Sequences in the ABI4 Promoter.

A, R2R3-MYB binding consensus sequences on the ABI4 promoter. Core binding sequences are marked with arrowheads.

Underbars represent amplified genomic regions. The numbers below the underbars indicate amplification product size (bp).

B, ChIP assays. Total protein extracts from pMYB96:MYB96-MYC transgenic seeds were immunoprecipitated with an anti-

MYC antibody. Fragmented genomic DNA was eluted from the protein-DNA complexes and subjected to quantitative PCR

(qPCR) analysis. Biological triplicates were averaged and statistical significance of the measurements was determined using

a Student’s t-test (*P <0.05). Bars indicate the standard error of the mean. In each experiment, the measurement values in

pBA002 were set to 1 after normalization against eIF4a for quantitative PCR analysis.

C, Transient expression analysis using Arabidopsis protoplasts. The core promoter sequence elements of ABI4, A-1

(CAAGTAACTTATGA) and A-2 (GCTATAGTTACCCA), were constructed into the reporter plasmid. The recombinant

reporter and effector constructs were coexpressed transiently in Arabidopsis protoplasts, and GUS activities were

determined fluorimetrically. Luciferase gene expression was used to normalize the GUS activities. The normalized values in

control protoplasts were set to 1 and represented as relative activation. Three independent measurements were averaged.

Statistical significance was determined by a Student’s t-test (*P<0.05). Bars indicate the standard error of the mean.

A

eIF4a

B

0

1

2

3

- +

Rel

ativ

e en

richm

ent

- + -(anti-MYC) + +

A B C

ABC

ABI4-264

360358300

-335-1321-1887-1980

*

pBA002

pMYB96:MYB96-MYC

C

Min 35S GUS Nos-T

Min 35S GUS Nos-T

Min 35S GUS Nos-T

CaMV 35S MYB96 Nos-T

A-1

A-2

pMin35S

p35S:MYB96

A-1

A-2

Reporter

Effector

0

1

2

3

pMin35S A-1 A-2R

elat

ive

expr

essi

on

*



Figure 6

0

20

40

60

80

100

120

24h 48h 72h

0

20

40

60

80

100

120

24h 48h 72h

Tot

al F

A c

onte

nt (

% o

f se

ed)

20:1

con

tent

(%

of

seed

)

Col-0

myb96-ox

myb96-1

Col-0

myb96-ox

myb96-1

A

B

*

*

*

*

Figure 6. Lipid Breakdown in Wild-type, myb96-ox, and myb96-1 Seeds during Seed Germination in the Presence of ABA.

Seeds were germinated on MS-plates supplemented with 1 M ABA and incubated at 23oC under LD conditions for 3 days.

Lipid breakdown was determined by measuring the abundance of total fatty acid (A) and eicosenoic acid (20:1) (B). Fatty

acid content was expressed as the percentage of the amount present in dry seeds of the indicated genotypes. At least 30

seeds per genotype were measured in each replicate. Biological triplicates were averaged. Bars indicate the standard error

of the mean.



Figure 7

Figure 7. Genetic Hierarchy of ABI4 andMYB96.

A, Germination rate of myb96-ox/abi4-1. Seed germination percentage of each genotype on 1 M ABA was scored at

indicated time points after cold stratification. At least 50 seeds per genotype were measured in each replicate. Biological

triplicates were averaged. Bars indicate standard error of the mean.

B, Lipid breakdown of myb96-ox/abi4-1. Seeds were germinated on MS-plates supplemented with 1 M ABA and incubated

at 23oC under LD conditions for 3 days. Eicosenoic acid (20:1) content was expressed as a percentage of the amount in dry

seeds of indicated genotypes. At least 30 seeds per genotype were measured in each replicate. Biological triplicates were

averaged. Bars indicate the standard error of the mean.

C, Proposed role of MYB96 during seed germination. The ABA-inducible R2R3-type MYB96 transcription factor regulates

ABI4 expression by binding directly to its gene promoter. The MYB96-ABI4 module inhibits lipid mobilization specifically in

the embryo, thereby contributing to delaying seed germination under suboptimal conditions.

A

ABA

MYB96

ABI4

TAG degradation

Seed germination0

10

20

30

40

50

60

Col-0 myb96-ox abi4-1 myb96-ox/abi4-1

20:1

con

tent

(%

of

seed

)

a

b

c

c

B C

0

20

40

60

80

100

Ger

min

atio

n(%

)

0 12 24 36 48 60 72 84 96 108 120 132 (h)

0

20

40

60

80

100

Ger

min

atio

n(%

)

0M ABA

Col-0

myb96-ox

abi4-1

myb96-ox/abi4-1

1.0M ABA



Supplemental Figures

Supplemental Data. Lee et al. (2015)

Supplemental Figure S1. Temporal expression of MYB96Wild-type seeds were germinated and grown at 23oC under long day conditions (LDs). Whole plant materials were harvested at indicated time points. Transcript accumulation was analyzed by quantitative real-time RT-PCR (qRT-PCR). The EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1 (eIF4a) gene (At3g13920) was used as an internal control. Biological triplicates were averaged. Bars indicate standard error of the mean. DAC, days after cold imbibition.

0

0.2

0.4

0.6

0.8

1

1.2

1.4

Dry seed 0 2 4 7 14

MYB96

Rel

ativ

e ex

pres

sion

(DAC)



Supplemental Figure S2. Expression of MYB96 in embryo after cold imbibition The pMYB96:GUS transgenic seeds, in which a promoter sequence covering an approximately 2-kb region upstream of the MYB96 transcription start site was transcriptionally fused to a -glucuronidase(GUS)-coding sequence, were subject to GUS staining after cold imbibition. Scale bars = 1 m.

+GUS +GUS

Cold ImbibitionDry seed

Embryo Embryo



Supplemental Figure S3. ABA induction of MYB96 in embryo Stratified pMYB96:GUS transgenic seeds were plated on Murashige and Skoog (MS)-medium supplemented with or without 1 M abscisic acid (ABA) and incubated for 2 days. The seeds were subject to GUS staining. Scale bars = 1 m.

+GUS+GUS

+ABA-ABA



0

1

2

Ler ga1-30

1

2

Ler QD della

Rel

ativ

e ex

pres

sion

MYB96 MYB96

Supplemental Figure S4. Expression of MYB96 in quadruple-DELLA and GA-deficient mutantsTen-day-old quadruple-DELLA (QD della; gai-t6 rga-t2 rgl1-1 rgl2-1) and gibberellin (GA)-deficient ga1-3 mutant seedlings grown at 23oC under LD conditions were used to determine transcript levels of MYB96. Transcript accumulation was analyzed by qRT-PCR. The eIF4a gene (At3g13920) was used as an internal control. Biological triplicates were averaged. Bars indicate standard error of the mean.



Supplemental Figure S5. Cotyledon opening of myb96-ox and myb96-1 in the presence of ABACotyledon opening of the indicated genotypes grown on different concentrations of ABA was quantified after the end of stratification. Fully opened cotyledon was used as a morphological marker. At least 50 seeds per genotype were measured in each replicate. Biological triplicates were averaged. Bars indicate standard error of the mean. Statistically significant differences between the wild-type and mutants are indicated by asterisks (Student’s t-test, *P<0.05).

0

20

40

60

80

100

Cot

yled

on o

peni

ng (

%)

0

20

40

60

80

100

0

20

40

60

80

100

0

20

40

60

80

100

Cot

yled

on o

peni

ng (

%)

Cot

yled

on o

peni

ng (

%)

Cot

yled

on o

peni

ng (

%)

0 12 24 36 48 60 72 84 96 108 120132(h)

Col-0

myb96-ox

myb96-1

0M ABA

0.5M ABA

1.0M ABA

3.0M ABA

*

*

*

*

*

**

*

*

*

*

* * *

* *



Supplemental Figure S6. ABA dose-response assaysWild-type, myb96-ox, and myb96-1 seeds were germinated on different concentrations of ABA. Fully opened cotyledons were counted 84 h after cold stratification. Biological triplicates were averaged. Bars indicate standard error of the mean. Statistically significant differences between the wild-type and mutants are indicated by asterisks (Student’s t-test, *P<0.05).

0

20

40

60

80

100

Cot

yled

on o

peni

ng (

%)

0 0.5 1.0 3.0 (M)

Col-0

myb96-ox

myb96-1

*

*

*

*



Supplemental Figure S7. Expression of ABI4 and BLH1 in myb96-ox mutant in the presence of ABAGerminating seeds were plated on MS-medium supplemented with or without 5 M ABA and incubated for 24 h. Transcript accumulation was analyzed by qRT-PCR. Biological triplicates were averaged. Bars indicate standard error of the mean.

Rel

ativ

e ex

pres

sion

0

4

8

12

16BLH1

Mock ABA Mock ABA

Col-0 myb96-ox

0

5

10

15

20ABI4

Mock ABA Mock ABA

Col-0 myb96-ox



Supplemental Figure S8. ABI4 expression in dry seeds and during seed germination Wild-type dry seeds were stratified and transferred to LD conditions at 22oC for germination. Transcript accumulation was analyzed by qRT-PCR. The eIF4a gene was used as an internal control. Biological triplicates were averaged. Bars indicate the standard error of the mean. DAC, days after cold stratification.

0

0.2

0.4

0.6

0.8

1

1.2

Dry seed DAC0 DAC1

ABI4

Rel

ativ

e ex

pres

sion



Supplemental Figure S9. Spatial expression of MYB96 and ABI4Eight-week-old plants were used to analyze tissue-specific expression of MYB96 and ABI4. Transcript accumulation was analyzed by qRT-PCR. The eIF4a gene (At3g13920) was used as an internal control. Biological triplicates were averaged. Bars indicate the standard error of the mean. The y-axis is presented on a logarithmic scale for better comparison of fold changes. St, stems; Fl, flowers; Si,siliques; CL, cauline leaves; RL, rosette leaves; Ro, roots.

1

10

100

1000

10000

St Fl Si CL RL Ro

MYB96

1

10

100

1000

ABI4

Rel

ativ

e ex

pres

sion

St Fl Si CL RL Ro



Supplemental Figure S10. Chromatin immunoprecipitation using 35S:96BD-MYC transgenic plants Total protein extracts from 35S:96BD-MYC transgenic plants grown for 2 weeks under LD were immunoprecipitated with an anti-MYC antibody. Fragmented genomic DNA was eluted from the protein-DNA complexes and subjected to quantitative PCR analysis. Biological triplicates were averaged and statistical significance of the measurements was determined using a Student’s t-test (*P <0.05). Bars indicate the standard error of the mean. The measurement values in pBA002 were set to 1 after normalization against eIF4a for quantitative PCR analysis.

0

1

2

3

4

eIF4a

- +

Rel

ativ

e en

richm

ent

(anti-MYC) +

A

pBA00235S:96BD-MYC

*



Supplemental Figure S11. Lipid breakdown in wild-type, myb96-ox, and myb96-1 seeds during seed germination in the absence of ABASeeds were germinated and incubated at 23oC under LD conditions for 3 days. Lipid breakdown was determined by measuring the abundance of total fatty acid (A) and eicosenoic acid (20:1) (B). Fatty acid content was expressed as the percentage of the amount present in dry seeds of the indicated genotypes. At least 30 seeds per genotype were measured in each replicate. Biological triplicates were averaged. Bars indicate the standard error of the mean.

0

20

40

60

80

100

120

24h 48h 72h

0

20

40

60

80

100

24h 48h 72h

Tot

al F

A c

onte

nt (

% o

f se

ed)

20:1

con

tent

(%

of

seed

)Col-0

myb96-ox

myb96-1

Col-0

myb96-ox

myb96-1

A

B



SequencePrimer Usage

F R

eIF4a qRT-PCR TGACCACACAGTCTCTGCAA ACCAGGGAGACTTGTTGGACMYB96 qRT-PCR TGCAGTCTCGGAAGAAGGTG CATCTCGTGGCTTTGCTCATABI1 qRT-PCR CGTCTCACATCTTCGTCGCT TCAATCCTCGCAGCTTCATCABI2 qRT-PCR GGCTCGGAAACGGATTTTAC GCAAAGCCATCTTCGACAAAABI3 qRT-PCR GATTGAATCAGCGGCAAGAA GTTGTTGTGGTGGTGGAGGAABI4 qRT-PCR ATCCTCAATCCGATTCCACC ATTTGCCCCAGCTTCTTTGTABI5 qRT-PCR GGCGCAAGCGAGACATAAT CCCTCGCCTCCATTGTTATTACBP1 qRT-PCR AACCACACGACTCAATCGGA TTTCGACACCTTCCCAATCAAHK1 qRT-PCR TTCAGCGTCCAGTCTTACGG GCAAACAGAGCCCATGTCACBLH1 qRT-PCR AGACCTCAACGTGGTCTCCC GGATCCCATGTTCTTTGCCTFY qRT-PCR TGACGGCTCCATTTGTCATT CCATGCAAGATCCCAAACACRHA2a qRT-PCR CTCTCTCTCCTCGCCGTCTT CTGATCGGCGAGAACGATTASnRK2.2 qRT-PCR TAATGCCGGACGGTTTAGTG TATTTTCAAACGAGGTGCCGSnRK2.3 qRT-PCR CATTTTGACGCCGACTCATC TTCAGGTCACGATGGCAAAT

Supplemental Table S1. Primers used in qRT-PCR

qRT-PCR primers were designed using the Primer Express Software installed into the Applied Biosystems 7500 Real-Time PCR System. The sizes of PCR products ranged from 80 to 300 nucleotides in length. F, forward primer; R, reverse primer.



Supplemental Table S2. Primers used in ChIP assays

F, forward primer; R, reverse primer.

SequencePrimer Usage

F R

eIF4a ChIP TGACCACACAGTCTCTGCAA ACCAGGGAGACTTGTTGGACABI4(A) ChIP CAACATGCGAGTATTTCTCAC GAGAAAAATAGTGGAGAGGACGABI4(B) ChIP CCAGAAATATGATTCTAGTTTTTACTTATGTC CTCTATTTTAGAGGTGACCATTGGABI4(C) ChIP TTTCAAAATTCCTTTTCTTATAAAAAATG TTAGTCCACTTAACACCATTCTTGG



Parsed CitationsAbe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) functionas transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78

PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12509522?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Arnaud N, Girin T, Sorefan K, Fuentes S, Wood TA, Lawrenson T, Sablowski R, Østergaard L (2010) Gibberellins control fruitpatterning in Arabidopsis thaliana. Genes Dev 24: 2127-2132


Berger F, Hamamura Y, Ingouff M, Higashiyama T (2008) Double fertilization - caught in the act. Trends Plant Sci 13: 437-443PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18650119?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bewley JD (1997) Seed germination and dormancy. Plant Cell 9: 1055-1066PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12237375?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bossi F, Cordoba E, Dupré P, Mendoza MS, Román CS, León P (2009) The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as acentral transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2.2 genes during sugarsignaling. Plant J 59: 359-374


Busk PK, Pagès M (1998) Regulation of abscisic acid-induced transcription. Plant Mol Biol 37: 425-435PubMed: http://www.ncbi.nlm.nih.gov/pubmed/9617810?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cao D, Cheng H, Wu W, Soo HM, Peng J (2006) Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seedgermination and floral development in Arabidopsis. Plant Physiol 142: 509-525


Carles C, Bies-Etheve N, Aspart L, Léon-Kloosterziel KM, Koornneef M, Echeverria M, Delseny M (2002) Regulation ofArabidopsis thaliana Em genes: role of ABI5. Plant J 30: 373-383


Crouch ML (1987) Regulation of gene expression during seed development in flowering plants, In Developmental Biology: AComprehensive Synthesis (ed. L. W. Browder), pp 367-404. New York:Plenum Press

CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Debeaujon I, Koornneef M (2000) Gibberellin requirement for Arabidopsis seed germination is determined both by testacharacteristics and embryonic abscisic acid. Plant Physiol 122: 415-424


De Lucas M, Davière JM, Rodríguez-Falcón M, Pontin M, Iglesias-Pedraz JM, Lorrain S, Fankhauser C, Blázquez MA, Titarenko E,Prat S (2008) A molecular framework for light and gibberellin control of cell elongation. Nature 451: 480-484


Dill A, Jung HS, Sun TP (2001) The DELLA motif is essential for gibberellin-induced degradation of RGA. Proc Natl Acad Sci USA98: 14162-14167


Du ZY, Chen MX, Chen QF, Xiao S, Chye ML (2013) Arabidopsis acyl-CoA-binding protein ACBP1 participates in the regulation ofseed germination and seedling development. Plant J 74: 294-309


Feng S, Martinez C, Gusmaroli G, Wang Y, Zhou J, Wang F, Chen L, Yu L, Iglesias-Pedraz JM, Kircher S, Schäfer E, Fu X, Fan LM,Deng XW (2008) Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature 451: 475-479

PubMed: http://www.ncbi.nlm.nih.gov/pubmed/18216856?dopt=abstractCrossRef: Author and Title https://plantphysiol.orgDownloaded on April 16, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed/12509522?dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Abe&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Abe&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Arnaud N, Girin T, Sorefan K, Fuentes S, Wood TA, Lawrenson T, Sablowski R, �stergaard L (2010) Gibberellins control fruit patterning in Arabidopsis thaliana. Genes Dev 24: 2127-2132

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Arnaud&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gibberellins control fruit patterning in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gibberellins control fruit patterning in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Arnaud&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Berger F, Hamamura Y, Ingouff M, Higashiyama T (2008) Double fertilization - caught in the act. Trends Plant Sci 13: 437-443

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Berger&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Double fertilization - caught in the act&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Double fertilization - caught in the act&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Berger&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Bewley JD (1997) Seed germination and dormancy. Plant Cell 9: 1055-1066

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bewley&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Seed germination and dormancy&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Seed germination and dormancy&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bewley&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Bossi F, Cordoba E, Dupr� P, Mendoza MS, Rom�n CS, Le�n P (2009) The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2.2 genes during sugar signaling. Plant J 59: 359-374

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bossi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bossi&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Busk PK, Pag�s M (1998) Regulation of abscisic acid-induced transcription. Plant Mol Biol 37: 425-435

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Busk&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of abscisic acid-induced transcription&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of abscisic acid-induced transcription&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Busk&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Cao D, Cheng H, Wu W, Soo HM, Peng J (2006) Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis. Plant Physiol 142: 509-525

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cao&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Carles C, Bies-Etheve N, Aspart L, L�on-Kloosterziel KM, Koornneef M, Echeverria M, Delseny M (2002) Regulation of Arabidopsis thaliana Em genes: role of ABI5. Plant J 30: 373-383

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Carles&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of Arabidopsis thaliana Em genes: role of ABI5&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of Arabidopsis thaliana Em genes: role of ABI5&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Carles&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Crouch ML (1987) Regulation of gene expression during seed development in flowering plants, In Developmental Biology: A Comprehensive Synthesis (ed. L. W. Browder), pp 367-404. New York:Plenum Press

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Crouch&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of gene expression during seed development in flowering plants, In Developmental Biology: A Comprehensive Synthesis (ed.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of gene expression during seed development in flowering plants, In Developmental Biology: A Comprehensive Synthesis (ed.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Crouch&as_ylo=1987&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Debeaujon I, Koornneef M (2000) Gibberellin requirement for Arabidopsis seed germination is determined both by testa characteristics and embryonic abscisic acid. Plant Physiol 122: 415-424

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Debeaujon&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gibberellin requirement for Arabidopsis seed germination is determined both by testa characteristics and embryonic abscisic acid&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gibberellin requirement for Arabidopsis seed germination is determined both by testa characteristics and embryonic abscisic acid&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Debeaujon&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=De Lucas M, Davi�re JM, Rodr�guez-Falc�n M, Pontin M, Iglesias-Pedraz JM, Lorrain S, Fankhauser C, Bl�zquez MA, Titarenko E, Prat S (2008) A molecular framework for light and gibberellin control of cell elongation. Nature 451: 480-484

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=De&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A molecular framework for light and gibberellin control of cell elongation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A molecular framework for light and gibberellin control of cell elongation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=De&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Dill A, Jung HS, Sun TP (2001) The DELLA motif is essential for gibberellin-induced degradation of RGA. Proc Natl Acad Sci USA 98: 14162-14167

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Dill&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The DELLA motif is essential for gibberellin-induced degradation of RGA&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The DELLA motif is essential for gibberellin-induced degradation of RGA&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Dill&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Du ZY, Chen MX, Chen QF, Xiao S, Chye ML (2013) Arabidopsis acyl-CoA-binding protein ACBP1 participates in the regulation of seed germination and seedling development. Plant J 74: 294-309

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Du&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis acyl-CoA-binding protein ACBP1 participates in the regulation of seed germination and seedling development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis acyl-CoA-binding protein ACBP1 participates in the regulation of seed germination and seedling development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Du&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Feng S, Martinez C, Gusmaroli G, Wang Y, Zhou J, Wang F, Chen L, Yu L, Iglesias-Pedraz JM, Kircher S, Sch�fer E, Fu X, Fan LM, Deng XW (2008) Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature 451: 475-479



Finch-Savage WE, Leubner-Metzger G (2006) Seed dormancy and the control of germination. New Phytol 171: 501-523PubMed: http://www.ncbi.nlm.nih.gov/pubmed/16866955?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Finkelstein RR, Lynch TJ (2000) The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcriptionfactor. Plant Cell 12: 599-609


Finkelstein RR, Somerville C (1990) Three classes of abscisic acid (ABA)-insensitive mutations of Arabidopsis define genes thatcontrol overlapping subsets of ABA responses. Plant Physiol 94: 1172-1179


Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell Suppl: S15-S45CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Finkelstein RR, Wang ML, Lynch TJ, Rao S, Goodman HM (1998) The Arabidopsis abscisic acid response locus ABI4 encodes anAPETALA 2 domain protein. Plant Cell 10: 1043-1054


Footitt S, Slocombe SP, Larner V, Kurup S, Wu Y, Larson T, Graham I, Baker A, Holdsworth M (2002) Control of germination andlipid mobilization by COMATOSE, the Arabidopsis homologue of human ALDP. EMBO J 21: 2912-2922


Foyer CH, Kerchev PI, Hancock RD (2012) The ABA-INSENSITIVE-4 (ABI4) transcription factor links redox, hormone and sugarsignaling pathways. Plant Signal Behav 7: 276-281


Fujii H, Chinnusamy V, Rodrigues A, Rubio S, Antoni R, Park SY, Cutler SR, Sheen J, Rodriguez PL, Zhu JK (2009) In vitroreconstitution of an abscisic acid signalling pathway. Nature 462: 660-664


Fujii H, Verslues PE, Zhu JK (2007) Identification of two protein kinases required for abscisic acid regulation of seed germination,root growth, and gene expression in Arabidopsis. Plant Cell 19: 485-494


Gallego-Bartolomé J, Alabadí D, Blázquez MA (2011) DELLA-induced early transcriptional changes during etiolated development inArabidopsis thaliana. PLoS One 6: e23918


Gallego-Bartolomé J, Minguet EG, Marín JA, Prat S, Blázquez MA, Alabadí D (2010) Transcriptional diversification and functionalconservation between DELLA proteins in Arabidopsis. Mol Biol Evol 27: 1247-1256


Garciarrubio A, Legaria JP, Covarrubias AA (1997) Abscisic acid inhibits germination of mature Arabidopsis seeds by limiting theavailability of energy and nutrients. Planta 203: 182-187


Gehring M, Choi Y, Fischer RL (2004) Imprinting and seed development. Plant Cell Suppl: S203-S213CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM (1992) lsolation of the Arabidopsis AB13 gene by positionalcloning. Plant Cell 4: 1251-1261


Goldberg RB, Barker SJ, Perez-Grau L (1989) Regulation of gene expression during plant embryogenesis. Cell 5: 149-160https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Feng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Coordinated regulation of Arabidopsis thaliana development by light and gibberellins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Coordinated regulation of Arabidopsis thaliana development by light and gibberellins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Feng&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Finch-Savage WE, Leubner-Metzger G (2006) Seed dormancy and the control of germination. New Phytol 171: 501-523

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Finch-Savage&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Seed dormancy and the control of germination&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Seed dormancy and the control of germination&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Finch-Savage&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Finkelstein RR, Lynch TJ (2000) The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 12: 599-609

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Finkelstein&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Finkelstein&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Finkelstein RR, Somerville C (1990) Three classes of abscisic acid (ABA)-insensitive mutations of Arabidopsis define genes that control overlapping subsets of ABA responses. Plant Physiol 94: 1172-1179


http://scholar.google.com/scholar?as_q=Three classes of abscisic acid (ABA)-insensitive mutations of Arabidopsis define genes that control overlapping subsets of ABA responses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Three classes of abscisic acid (ABA)-insensitive mutations of Arabidopsis define genes that control overlapping subsets of ABA responses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Finkelstein&as_ylo=1990&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell Suppl: S15-S45


http://scholar.google.com/scholar?as_q=Abscisic acid signaling in seeds and seedlings.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Abscisic acid signaling in seeds and seedlings.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Finkelstein&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Finkelstein RR, Wang ML, Lynch TJ, Rao S, Goodman HM (1998) The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell 10: 1043-1054


http://scholar.google.com/scholar?as_q=The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Finkelstein&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Footitt S, Slocombe SP, Larner V, Kurup S, Wu Y, Larson T, Graham I, Baker A, Holdsworth M (2002) Control of germination and lipid mobilization by COMATOSE, the Arabidopsis homologue of human ALDP. EMBO J 21: 2912-2922

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Footitt&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Control of germination and lipid mobilization by COMATOSE, the Arabidopsis homologue of human ALDP&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Control of germination and lipid mobilization by COMATOSE, the Arabidopsis homologue of human ALDP&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Footitt&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Foyer CH, Kerchev PI, Hancock RD (2012) The ABA-INSENSITIVE-4 (ABI4) transcription factor links redox, hormone and sugar signaling pathways. Plant Signal Behav 7: 276-281

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Foyer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The ABA-INSENSITIVE-4 (ABI4) transcription factor links redox, hormone and sugar signaling pathways&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The ABA-INSENSITIVE-4 (ABI4) transcription factor links redox, hormone and sugar signaling pathways&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Foyer&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Fujii H, Chinnusamy V, Rodrigues A, Rubio S, Antoni R, Park SY, Cutler SR, Sheen J, Rodriguez PL, Zhu JK (2009) In vitro reconstitution of an abscisic acid signalling pathway. Nature 462: 660-664

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fujii&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=In vitro reconstitution of an abscisic acid signalling pathway&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=In vitro reconstitution of an abscisic acid signalling pathway&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fujii&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Fujii H, Verslues PE, Zhu JK (2007) Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis. Plant Cell 19: 485-494

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fujii&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fujii&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Gallego-Bartolom� J, Alabad� D, Bl�zquez MA (2011) DELLA-induced early transcriptional changes during etiolated development in Arabidopsis thaliana. PLoS One 6: e23918

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gallego-Bartolom�&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=DELLA-induced early transcriptional changes during etiolated development in Arabidopsis thaliana.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=DELLA-induced early transcriptional changes during etiolated development in Arabidopsis thaliana.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gallego-Bartolom�&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Gallego-Bartolom� J, Minguet EG, Mar�n JA, Prat S, Bl�zquez MA, Alabad� D (2010) Transcriptional diversification and functional conservation between DELLA proteins in Arabidopsis. Mol Biol Evol 27: 1247-1256

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gallego-Bartolom�&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional diversification and functional conservation between DELLA proteins in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional diversification and functional conservation between DELLA proteins in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gallego-Bartolom�&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Garciarrubio A, Legaria JP, Covarrubias AA (1997) Abscisic acid inhibits germination of mature Arabidopsis seeds by limiting the availability of energy and nutrients. Planta 203: 182-187

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Garciarrubio&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Abscisic acid inhibits germination of mature Arabidopsis seeds by limiting the availability of energy and nutrients&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Abscisic acid inhibits germination of mature Arabidopsis seeds by limiting the availability of energy and nutrients&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Garciarrubio&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Gehring M, Choi Y, Fischer RL (2004) Imprinting and seed development. Plant Cell Suppl: S203-S213

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gehring&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Imprinting and seed development.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Imprinting and seed development.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gehring&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM (1992) lsolation of the Arabidopsis AB13 gene by positional cloning. Plant Cell 4: 1251-1261

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Giraudat&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=lsolation of the Arabidopsis AB13 gene by positional cloning&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=lsolation of the Arabidopsis AB13 gene by positional cloning&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Giraudat&as_ylo=1992&as_allsubj=all&hl=en&c2coff=1



Gonzalez-Guzman M, Pizzio GA, Antoni R, Vera-Sirera F, Merilo E, Bassel GW, Fernández MA, Holdsworth MJ, Perez-Amador MA,Kollist H, Rodriguez PL (2012) Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatalaperture and transcriptional response to abscisic acid. Plant Cell 24: 2483-2496


Grappin P, Bouinot D, Sotta B, Miginiac E, Jullien M (2000) Control of seed dormancy in Nicotiana plumbaginifolia: post-imbibitionabscisic acid synthesis imposes dormancy maintenance. Planta 210: 279-285


Guo L, Yang H, Zhang X, Yang S (2013) Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress inArabidopsis. J Exp Bot 64: 1755-1767


Harada JJ, Baden CS, Comai L (1988) Spatially regulated genes expressed during seed germination and postgerminativedevelopment are activated during embryogeny. Mol Gen Genet 212: 466-473


Holdsworth M, Kurup S, McKibbin R (1999) Molecular and genetic mechanisms regulating the transition from embryo developmentto germination. Trends Plant Sci 4: 275-280


Hong GJ, Xue XY, Mao YB, Wang LJ, Chen XY (2012) Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpenesynthase gene expression. Plant Cell 24: 2635-2648


Huang AH (1992) Oleosins and oil bodies in seeds and other organs. Plant Physiol 110: 1055-1061PubMed: http://www.ncbi.nlm.nih.gov/pubmed/8934621?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Huang ZY, Zhang XS, Zheng GH, Gutterman Y (2003) Influence of light, temperature, salinity and storage on seed germination ofHaloxylon ammodendron. J Arid Environ 55: 453-464


Hussain A, Peng J (2003) DELLA proteins and GA signalling in Arabidopsis. J Plant Growth Regul 22: 134-140CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jiang S, Kumar S, Eu YJ, Jami SK, Stasolla C, Hill RD (2012) The Arabidopsis mutant, fy-1, has an ABA-insensitive germinationphenotype. Exp Bot 63: 2693-2703


Joosen RV, Arends D, Li Y, Willems LA, Keurentjes JJ, Ligterink W, Jansen RC, Hilhorst HW (2013) Identifying genotype-by-environment interactions in the metabolism of germinating Arabidopsis seeds using generalized genetical genomics. Plant Physiol162: 553-566


Kelly AA, Quettier AL, Shaw E, Eastmond PJ (2011) Seed storage oil mobilization is important but not essential for germination orseedling establishment in Arabidopsis. Plant Physiol 157: 866-875


Kerchev PI, Pellny TK, Vivancos PD, Kiddle G, Hedden P, Driscoll S, Vanacker H, Verrier P, Hancock RD, Foyer CH (2011) Thetranscription factor ABI4 is required for the ascorbic acid-dependent regulation of growth and regulation of jasmonate-dependentdefense signaling pathways in Arabidopsis. Plant Cell 23: 3319-3334


Kermode AR (1990) Regulatory mechanisms involved in the transition from seed development to germination. Crit Rev Plant Sci 2:155-195

CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title https://plantphysiol.orgDownloaded on April 16, 2021. - Published by



http://search.crossref.org/?page=1&rows=2&q=Goldberg RB, Barker SJ, Perez-Grau L (1989) Regulation of gene expression during plant embryogenesis. Cell 5: 149-160

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Goldberg&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of gene expression during plant embryogenesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of gene expression during plant embryogenesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Goldberg&as_ylo=1989&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Gonzalez-Guzman M, Pizzio GA, Antoni R, Vera-Sirera F, Merilo E, Bassel GW, Fern�ndez MA, Holdsworth MJ, Perez-Amador MA, Kollist H, Rodriguez PL (2012) Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid. Plant Cell 24: 2483-2496

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gonzalez-Guzman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gonzalez-Guzman&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Grappin P, Bouinot D, Sotta B, Miginiac E, Jullien M (2000) Control of seed dormancy in Nicotiana plumbaginifolia: post-imbibition abscisic acid synthesis imposes dormancy maintenance. Planta 210: 279-285

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Grappin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Control of seed dormancy in Nicotiana plumbaginifolia: post-imbibition abscisic acid synthesis imposes dormancy maintenance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Control of seed dormancy in Nicotiana plumbaginifolia: post-imbibition abscisic acid synthesis imposes dormancy maintenance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Grappin&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Guo L, Yang H, Zhang X, Yang S (2013) Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress in Arabidopsis. J Exp Bot 64: 1755-1767

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Guo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Guo&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Harada JJ, Baden CS, Comai L (1988) Spatially regulated genes expressed during seed germination and postgerminative development are activated during embryogeny. Mol Gen Genet 212: 466-473

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Harada&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Spatially regulated genes expressed during seed germination and postgerminative development are activated during embryogeny&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Spatially regulated genes expressed during seed germination and postgerminative development are activated during embryogeny&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Harada&as_ylo=1988&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Holdsworth M, Kurup S, McKibbin R (1999) Molecular and genetic mechanisms regulating the transition from embryo development to germination. Trends Plant Sci 4: 275-280

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Holdsworth&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular and genetic mechanisms regulating the transition from embryo development to germination&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular and genetic mechanisms regulating the transition from embryo development to germination&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Holdsworth&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Hong GJ, Xue XY, Mao YB, Wang LJ, Chen XY (2012) Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression. Plant Cell 24: 2635-2648

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hong&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hong&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Huang AH (1992) Oleosins and oil bodies in seeds and other organs. Plant Physiol 110: 1055-1061

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Huang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Oleosins and oil bodies in seeds and other organs&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Oleosins and oil bodies in seeds and other organs&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Huang&as_ylo=1992&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Huang ZY, Zhang XS, Zheng GH, Gutterman Y (2003) Influence of light, temperature, salinity and storage on seed germination of Haloxylon ammodendron. J Arid Environ 55: 453-464

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Huang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Influence of light, temperature, salinity and storage on seed germination of Haloxylon ammodendron&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Influence of light, temperature, salinity and storage on seed germination of Haloxylon ammodendron&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Huang&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Hussain A, Peng J (2003) DELLA proteins and GA signalling in Arabidopsis. J Plant Growth Regul 22: 134-140

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hussain&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=DELLA proteins and GA signalling in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=DELLA proteins and GA signalling in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hussain&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Jiang S, Kumar S, Eu YJ, Jami SK, Stasolla C, Hill RD (2012) The Arabidopsis mutant, fy-1, has an ABA-insensitive germination phenotype. Exp Bot 63: 2693-2703

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jiang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jiang&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Joosen RV, Arends D, Li Y, Willems LA, Keurentjes JJ, Ligterink W, Jansen RC, Hilhorst HW (2013) Identifying genotype-by-environment interactions in the metabolism of germinating Arabidopsis seeds using generalized genetical genomics. Plant Physiol 162: 553-566

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Joosen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identifying genotype-by-environment interactions in the metabolism of germinating Arabidopsis seeds using generalized genetical genomics&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identifying genotype-by-environment interactions in the metabolism of germinating Arabidopsis seeds using generalized genetical genomics&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Joosen&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Kelly AA, Quettier AL, Shaw E, Eastmond PJ (2011) Seed storage oil mobilization is important but not essential for germination or seedling establishment in Arabidopsis. Plant Physiol 157: 866-875

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kelly&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Seed storage oil mobilization is important but not essential for germination or seedling establishment in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Seed storage oil mobilization is important but not essential for germination or seedling establishment in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kelly&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Kerchev PI, Pellny TK, Vivancos PD, Kiddle G, Hedden P, Driscoll S, Vanacker H, Verrier P, Hancock RD, Foyer CH (2011) The transcription factor ABI4 is required for the ascorbic acid-dependent regulation of growth and regulation of jasmonate-dependent defense signaling pathways in Arabidopsis. Plant Cell 23: 3319-3334

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kerchev&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The transcription factor ABI4 is required for the ascorbic acid-dependent regulation of growth and regulation of jasmonate-dependent defense signaling pathways in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The transcription factor ABI4 is required for the ascorbic acid-dependent regulation of growth and regulation of jasmonate-dependent defense signaling pathways in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kerchev&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Kermode AR (1990) Regulatory mechanisms involved in the transition from seed development to germination. Crit Rev Plant Sci 2: 155-195

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kermode&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulatory mechanisms involved in the transition from seed development to germination&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulatory mechanisms involved in the transition from seed development to germination&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kermode&as_ylo=1990&as_allsubj=all&hl=en&c2coff=1


Kim D, Cho YH, Ryu H, Kim Y, Kim TH, Hwang I (2013) BLH1 and KNAT3 modulate ABA responses during germination and earlyseedling development in Arabidopsis. Plant J 75: 755-766


Lafon-Placette C, Köhler C (2014) Embryo and endosperm, partners in seed development. Curr Opin Plant Biol 17C: 64-69PubMed: http://www.ncbi.nlm.nih.gov/pubmed/24507496?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lau OS, Deng XW (2010) Plant hormone signaling lightens up: integrators of light and hormones. Curr Opin Plant Biol 13: 571-577PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20739215?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee JH, Yoon HJ, Terzaghi W, Martinez C, Dai M, Li J, Byun MO, Deng XW (2010) DWA1 and DWA2, two Arabidopsis DWD proteincomponents of CUL4-based E3 ligases, act together as negative regulators in ABA signal transduction. Plant Cell 22: 1716-1732


Li H, Jiang H, Bu Q, Zhao Q, Sun J, Xie Q, Li C (2011) The Arabidopsis RING finger E3 ligase RHA2b acts additively with RHA2a inregulating abscisic acid signaling and drought response. Plant Physiol 156: 550-563


Lim S, Park J, Lee N, Jeong J, Toh S, Watanabe A, Kim J, Kang H, Kim DH, Kawakami N, Choi G (2013) ABA-INSENSITIVE3, ABA-INSENSITIVE5, and DELLAs interact to activate the expression of SOMNUS and other high-temperature-inducible genes inimbibed seeds in Arabidopsis. Plant Cell 25: 4863-4878


Liu H, Stone SL (2010) Abscisic acid increases Arabidopsis ABI5 transcription factor levels by promoting KEG E3 ligase self-ubiquitination and proteasomal degradation. Plant Cell 22: 2630-2641


Lu C, Hills MJ (2002) Arabidopsis mutants deficient in diacylglycerol acyltransferase display increased sensitivity to abscisic acid,sugars, and osmotic stress during germination and seedling development. Plant Physiol 129: 1352-1358


Maeo K, Tokuda T, Ayame A, Mitsui N, Kawai T, Tsukagoshi H, Ishiguro S, Nakamura K (2009) An AP2-type transcription factor,WRINKLED1, of Arabidopsis thaliana binds to the AW-box sequence conserved among proximal upstream regions of genesinvolved in fatty acid synthesis. Plant J 60: 476-487


McCarty DR, Carson CB (1991) The molecular genetics of seed maturation in maize. Physiol Plant 81: 267-272CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Miura K, Lee J, Jin JB, Yoo CY, Miura T, Hasegawa PM (2009) Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1negatively regulates abscisic acid signaling. Proc Natl Acad Sci USA 106: 5418-5423


Moes D, Himmelbach A, Korte A, Haberer G, Grill E (2008) Nuclear localization of the mutant protein phosphatase abi1 is requiredfor insensitivity towards ABA responses in Arabidopsis. Plant J 54: 806-819


Nakabayashi K, Okamoto M, Koshiba T, Kamiya Y, Nambara E (2005) Genome-wide profiling of stored mRNA in Arabidopsis thalianaseed germination: epigenetic and genetic regulation of transcription in seed. Plant J 41: 697-709


Nakamura S, Lynch T, Finkelstein R (2001) Physical interactions between ABA response loci of Arabidopsis. Plant J 26: 627-635PubMed: http://www.ncbi.nlm.nih.gov/pubmed/11489176?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nakashima K, Yamaguchi-Shinozaki K (2013) ABA signaling in stress-response and seed development. Plant Cell Rep 32: 959-970https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.


http://search.crossref.org/?page=1&rows=2&q=Kim D, Cho YH, Ryu H, Kim Y, Kim TH, Hwang I (2013) BLH1 and KNAT3 modulate ABA responses during germination and early seedling development in Arabidopsis. Plant J 75: 755-766

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=BLH1 and KNAT3 modulate ABA responses during germination and early seedling development in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=BLH1 and KNAT3 modulate ABA responses during germination and early seedling development in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Lafon-Placette C, K�hler C (2014) Embryo and endosperm, partners in seed development. Curr Opin Plant Biol 17C: 64-69

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lafon-Placette&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lafon-Placette&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Lau OS, Deng XW (2010) Plant hormone signaling lightens up: integrators of light and hormones. Curr Opin Plant Biol 13: 571-577

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lau&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant hormone signaling lightens up: integrators of light and hormones&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant hormone signaling lightens up: integrators of light and hormones&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lau&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Lee JH, Yoon HJ, Terzaghi W, Martinez C, Dai M, Li J, Byun MO, Deng XW (2010) DWA1 and DWA2, two Arabidopsis DWD protein components of CUL4-based E3 ligases, act together as negative regulators in ABA signal transduction. Plant Cell 22: 1716-1732

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Li H, Jiang H, Bu Q, Zhao Q, Sun J, Xie Q, Li C (2011) The Arabidopsis RING finger E3 ligase RHA2b acts additively with RHA2a in regulating abscisic acid signaling and drought response. Plant Physiol 156: 550-563

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis RING finger E3 ligase RHA2b acts additively with RHA2a in regulating abscisic acid signaling and drought response&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis RING finger E3 ligase RHA2b acts additively with RHA2a in regulating abscisic acid signaling and drought response&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Lim S, Park J, Lee N, Jeong J, Toh S, Watanabe A, Kim J, Kang H, Kim DH, Kawakami N, Choi G (2013) ABA-INSENSITIVE3, ABA-INSENSITIVE5, and DELLAs interact to activate the expression of SOMNUS and other high-temperature-inducible genes in imbibed seeds in Arabidopsis. Plant Cell 25: 4863-4878

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lim&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lim&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Liu H, Stone SL (2010) Abscisic acid increases Arabidopsis ABI5 transcription factor levels by promoting KEG E3 ligase self-ubiquitination and proteasomal degradation. Plant Cell 22: 2630-2641

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Abscisic acid increases Arabidopsis ABI5 transcription factor levels by promoting KEG E3 ligase self-ubiquitination and proteasomal degradation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Abscisic acid increases Arabidopsis ABI5 transcription factor levels by promoting KEG E3 ligase self-ubiquitination and proteasomal degradation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Lu C, Hills MJ (2002) Arabidopsis mutants deficient in diacylglycerol acyltransferase display increased sensitivity to abscisic acid, sugars, and osmotic stress during germination and seedling development. Plant Physiol 129: 1352-1358

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mutants deficient in diacylglycerol acyltransferase display increased sensitivity to abscisic acid, sugars, and osmotic stress during germination and seedling development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mutants deficient in diacylglycerol acyltransferase display increased sensitivity to abscisic acid, sugars, and osmotic stress during germination and seedling development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lu&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Maeo K, Tokuda T, Ayame A, Mitsui N, Kawai T, Tsukagoshi H, Ishiguro S, Nakamura K (2009) An AP2-type transcription factor, WRINKLED1, of Arabidopsis thaliana binds to the AW-box sequence conserved among proximal upstream regions of genes involved in fatty acid synthesis. Plant J 60: 476-487

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Maeo&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Maeo&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=McCarty DR, Carson CB (1991) The molecular genetics of seed maturation in maize. Physiol Plant 81: 267-272

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=McCarty&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The molecular genetics of seed maturation in maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The molecular genetics of seed maturation in maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=McCarty&as_ylo=1991&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Miura K, Lee J, Jin JB, Yoo CY, Miura T, Hasegawa PM (2009) Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1 negatively regulates abscisic acid signaling. Proc Natl Acad Sci USA 106: 5418-5423

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Miura&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1 negatively regulates abscisic acid signaling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1 negatively regulates abscisic acid signaling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Miura&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Moes D, Himmelbach A, Korte A, Haberer G, Grill E (2008) Nuclear localization of the mutant protein phosphatase abi1 is required for insensitivity towards ABA responses in Arabidopsis. Plant J 54: 806-819

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Moes&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear localization of the mutant protein phosphatase abi1 is required for insensitivity towards ABA responses in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear localization of the mutant protein phosphatase abi1 is required for insensitivity towards ABA responses in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Moes&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Nakabayashi K, Okamoto M, Koshiba T, Kamiya Y, Nambara E (2005) Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed. Plant J 41: 697-709

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nakabayashi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nakabayashi&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Nakamura S, Lynch T, Finkelstein R (2001) Physical interactions between ABA response loci of Arabidopsis. Plant J 26: 627-635

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nakamura&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Physical interactions between ABA response loci of Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Physical interactions between ABA response loci of Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nakamura&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1



Natesh S, Rau MA (1984) The embryo. In Embryology of Angiosperms, B.M. Johri, ed (Berlin: Springer-Verlag), pp. 377-444CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nishimura N, Sarkeshik A, Nito K, Park SY, Wang A, Carvalho PC, Lee S, Caddell DF, Cutler SR, Chory J, Yates JR, Schroeder JI(2010) PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. Plant J61: 290-299


Nonogaki H (2014) Seed dormancy and germination-emerging mechanisms and new hypotheses. Front Plant Sci 5: 233PubMed: http://www.ncbi.nlm.nih.gov/pubmed/24904627?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ogawa M, Hanada A, Yamauchi Y, Kuwahara A, Kamiya Y, Yamaguchi S (2003) Gibberellin biosynthesis and response duringArabidopsis seed germination. Plant Cell 15: 1591-1604


Padmanaban S, Chanroj S, Kwak JM, Li X, Ward JM, Sze H (2007) Participation of endomembrane cation/H+ exchanger AtCHX20 inosmoregulation of guard cells. Plant Physiol 144: 82-93


Pandey GK, Grant JJ, Cheong YH, Kim BG, Li L, Luan S (2005) ABR1, an APETALA2-domain transcription factor that functions as arepressor of ABA response in Arabidopsis. Plant Physiol 139: 1185-1193


Park J, Nguyen KT, Park E, Jeon JS, Choi G (2013) DELLA proteins and their interacting RING Finger proteins repress gibberellinresponses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis. Plant Cell 25: 927-943


Penfield S, Graham S, Graham IA (2005) Storage reserve mobilization in germinating oilseeds: Arabidopsis as a model system.Biochem Soc Trans 33: 380-383


Penfield S, Li Y, Gilday AD, Graham S, Graham IA (2006) Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryoand reveals repression of seed germination by the endosperm. Plant Cell 18: 1887-1899


Penfield S, Rylott EL, Gilday AD, Graham S, Larson TR, Graham IA (2004) Reserve mobilization in the Arabidopsis endosperm fuelshypocotyl elongation in the dark, is independent of abscisic acid, and requires PHOSPHOENOLPYRUVATE CARBOXYKINASE1.Plant Cell 16: 2705-2718


Peng J, Harberd NP (2002) The role of GA-mediated signalling in the control of seed germination. Curr Opin Plant Biol 5: 376-381PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12183174?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Pesaresi P, Schneider A, Kleine T, Leister D (2007) Interorganellar communication. Curr Opin Plant Biol 10: 600-606PubMed: http://www.ncbi.nlm.nih.gov/pubmed/17719262?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Pracharoenwattana I, Zhou W, Smith SM (2010) Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported byperoxisomal hydroxypyruvate reductase when malate dehydrogenase is absent. Plant Mol Biol 72: 101-109


Pritchard SL, Charlton WL, Baker A, Graham IA (2002) Germination and storage reserve mobilization are regulated independentlyin Arabidopsis. Plant J 31: 639-647

PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12207653?dopt=abstractCrossRef: Author and Title https://plantphysiol.orgDownloaded on April 16, 2021. - Published by



http://search.crossref.org/?page=1&rows=2&q=Nakashima K, Yamaguchi-Shinozaki K (2013) ABA signaling in stress-response and seed development. Plant Cell Rep 32: 959-970

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nakashima&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABA signaling in stress-response and seed development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABA signaling in stress-response and seed development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nakashima&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Natesh S, Rau MA (1984) The embryo. In Embryology of Angiosperms, B.M. Johri, ed (Berlin: Springer-Verlag), pp. 377-444

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Natesh&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The embryo.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The embryo.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Natesh&as_ylo=1984&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Nishimura N, Sarkeshik A, Nito K, Park SY, Wang A, Carvalho PC, Lee S, Caddell DF, Cutler SR, Chory J, Yates JR, Schroeder JI (2010) PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. Plant J 61: 290-299

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nishimura&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nishimura&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Nonogaki H (2014) Seed dormancy and germination-emerging mechanisms and new hypotheses. Front Plant Sci 5: 233

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nonogaki&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Seed dormancy and germination-emerging mechanisms and new hypotheses.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Seed dormancy and germination-emerging mechanisms and new hypotheses.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nonogaki&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Ogawa M, Hanada A, Yamauchi Y, Kuwahara A, Kamiya Y, Yamaguchi S (2003) ��Gibberellin biosynthesis and response during Arabidopsis seed germination. Plant Cell 15: 1591-1604

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ogawa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=��Gibberellin biosynthesis and response during Arabidopsis seed germination&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=��Gibberellin biosynthesis and response during Arabidopsis seed germination&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ogawa&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Padmanaban S, Chanroj S, Kwak JM, Li X, Ward JM, Sze H (2007) Participation of endomembrane cation/H+ exchanger AtCHX20 in osmoregulation of guard cells. Plant Physiol 144: 82-93

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Padmanaban&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Participation of endomembrane cation/H+ exchanger AtCHX20 in osmoregulation of guard cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Participation of endomembrane cation/H+ exchanger AtCHX20 in osmoregulation of guard cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Padmanaban&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Pandey GK, Grant JJ, Cheong YH, Kim BG, Li L, Luan S (2005) ABR1, an APETALA2-domain transcription factor that functions as a repressor of ABA response in Arabidopsis. Plant Physiol 139: 1185-1193

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pandey&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pandey&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Park J, Nguyen KT, Park E, Jeon JS, Choi G (2013) DELLA proteins and their interacting RING Finger proteins repress gibberellin responses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis. Plant Cell 25: 927-943

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=DELLA proteins and their interacting RING Finger proteins repress gibberellin responses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=DELLA proteins and their interacting RING Finger proteins repress gibberellin responses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Penfield S, Graham S, Graham IA (2005) Storage reserve mobilization in germinating oilseeds: Arabidopsis as a model system. Biochem Soc Trans 33: 380-383

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Penfield&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Storage reserve mobilization in germinating oilseeds: Arabidopsis as a model system&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Storage reserve mobilization in germinating oilseeds: Arabidopsis as a model system&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Penfield&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Penfield S, Li Y, Gilday AD, Graham S, Graham IA (2006) Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryo and reveals repression of seed germination by the endosperm. Plant Cell 18: 1887-1899


http://scholar.google.com/scholar?as_q=Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryo and reveals repression of seed germination by the endosperm&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryo and reveals repression of seed germination by the endosperm&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Penfield&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Penfield S, Rylott EL, Gilday AD, Graham S, Larson TR, Graham IA (2004) Reserve mobilization in the Arabidopsis endosperm fuels hypocotyl elongation in the dark, is independent of abscisic acid, and requires PHOSPHOENOLPYRUVATE CARBOXYKINASE1. Plant Cell 16: 2705-2718


http://scholar.google.com/scholar?as_q=Reserve mobilization in the Arabidopsis endosperm fuels hypocotyl elongation in the dark, is independent of abscisic acid, and requires PHOSPHOENOLPYRUVATE CARBOXYKINASE1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Reserve mobilization in the Arabidopsis endosperm fuels hypocotyl elongation in the dark, is independent of abscisic acid, and requires PHOSPHOENOLPYRUVATE CARBOXYKINASE1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Penfield&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Peng J, Harberd NP (2002) The role of GA-mediated signalling in the control of seed germination. Curr Opin Plant Biol 5: 376-381

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Peng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The role of GA-mediated signalling in the control of seed germination&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The role of GA-mediated signalling in the control of seed germination&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Peng&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Pesaresi P, Schneider A, Kleine T, Leister D (2007) Interorganellar communication. Curr Opin Plant Biol 10: 600-606

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pesaresi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Interorganellar communication&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Interorganellar communication&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pesaresi&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Pracharoenwattana I, Zhou W, Smith SM (2010) Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent. Plant Mol Biol 72: 101-109

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pracharoenwattana&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pracharoenwattana&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Pritchard SL, Charlton WL, Baker A, Graham IA (2002) ��Germination and storage reserve mobilization are regulated independently in Arabidopsis. Plant J 31: 639-647


Google Scholar: Author Only Title Only Author and Title

Prouse MB, Campbell MM (2013) Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites.PLoS One 8: e65132


Qu XX, Huang ZY, Baskin JM, Baskin CC (2008) Effect of temperature, light and salinity on seed germination and radicle growth ofthe geographically widespread halophyte shrub Halocnemum strobilaceum. Ann Bot 101: 293-299


Quettier AL, Eastmond PJ (2009) Storage oil hydrolysis during early seedling growth. Plant Physiol Biochem 47: 485-490PubMed: http://www.ncbi.nlm.nih.gov/pubmed/19136267?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Raghavendra AS, Gonugunta VK, Christmann A, Grill E (2010) ABA perception and signalling. Trends Plant Sci 15: 395-401PubMed: http://www.ncbi.nlm.nih.gov/pubmed/20493758?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Raz V, Bergervoet J, Koornneef M (2001) Sequential steps for developmental arrest in Arabidopsis seeds. Development 128: 243-252


Seo M, Hanada A, Kuwahara A, Endo A, Okamoto M, Yamauchi Y, North H, Marion-Poll A, Sun TP, Koshiba T, Kamiya Y, YamaguchiS, Nambara E (2006) Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolismand abscisic acid regulation of gibberellin metabolism. Plant J 48: 354-366


Seo PJ, Park CM (2010) MYB96-mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acidbiosynthesis in Arabidopsis. New Phytol 186: 471-483


Seo PJ, Park CM (2011) Cuticular wax biosynthesis as a way of inducing drought resistance. Plant Signal Behav 6: 1043-1045PubMed: http://www.ncbi.nlm.nih.gov/pubmed/21617381?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Seo PJ, Lee SB, Suh MC, Park MJ, Go YS, Park CM (2011) The MYB96 transcription factor regulates cuticular wax biosynthesisunder drought conditions in Arabidopsis. Plant Cell 23: 1138-1152


Seo PJ, Xiang F, Qiao M, Park JY, Lee YN, Kim SG, Lee YH, Park WJ, Park CM (2009) The MYB96 transcription factor mediatesabscisic acid signaling during drought stress response in Arabidopsis. Plant Physiol 151: 275-289


Shkolnik-Inbar D, Bar-Zvi D (2010) ABI4 mediates abscisic acid and cytokinin inhibition of lateral root formation by reducing polarauxin transport in Arabidopsis. Plant Cell 22: 3560-3573


Shu K, Zhang H, Wang S, Chen M, Wu Y, Tang S, Liu C, Feng Y, Cao X, Xie Q (2013) ABI4 regulates primary seed dormancy byregulating the biogenesis of abscisic acid and gibberellins in Arabidopsis. PLoS Genet 9: e1003577


Söderman E, Brocard I, Lynch T, Finkelstein R (2000) Regulation and function of the Arabidopsis ABA-insensitive 4 (ABI4) gene inseed and ABA response signaling networks. Plant Physiol 124: 1752-1765


Stamm P, Ravindran P, Mohanty B, Tan EL, Yu H, Kumar PP (2012) Insights into the molecular mechanism of RGL2-mediatedinhibition of seed germination in Arabidopsis thaliana. BMC Plant Biol 12: 179

PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23035751?dopt=abstract https://plantphysiol.orgDownloaded on April 16, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pritchard&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=��Germination and storage reserve mobilization are regulated independently in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=��Germination and storage reserve mobilization are regulated independently in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pritchard&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Prouse MB, Campbell MM (2013) Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites. PLoS One 8: e65132

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Prouse&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Prouse&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Qu XX, Huang ZY, Baskin JM, Baskin CC (2008) Effect of temperature, light and salinity on seed germination and radicle growth of the geographically widespread halophyte shrub Halocnemum strobilaceum. Ann Bot 101: 293-299

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Qu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Effect of temperature, light and salinity on seed germination and radicle growth of the geographically widespread halophyte shrub Halocnemum strobilaceum&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Effect of temperature, light and salinity on seed germination and radicle growth of the geographically widespread halophyte shrub Halocnemum strobilaceum&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Qu&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Quettier AL, Eastmond PJ (2009) Storage oil hydrolysis during early seedling growth. Plant Physiol Biochem 47: 485-490

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Quettier&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Storage oil hydrolysis during early seedling growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Storage oil hydrolysis during early seedling growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Quettier&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Raghavendra AS, Gonugunta VK, Christmann A, Grill E (2010) ABA perception and signalling. Trends Plant Sci 15: 395-401

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Raghavendra&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABA perception and signalling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABA perception and signalling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Raghavendra&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Raz V, Bergervoet J, Koornneef M (2001) Sequential steps for developmental arrest in Arabidopsis seeds. Development 128: 243-252

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Raz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Sequential steps for developmental arrest in Arabidopsis seeds&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Sequential steps for developmental arrest in Arabidopsis seeds&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Raz&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Seo M, Hanada A, Kuwahara A, Endo A, Okamoto M, Yamauchi Y, North H, Marion-Poll A, Sun TP, Koshiba T, Kamiya Y, Yamaguchi S, Nambara E (2006) Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolism and abscisic acid regulation of gibberellin metabolism. Plant J 48: 354-366

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Seo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolism and abscisic acid regulation of gibberellin metabolism&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolism and abscisic acid regulation of gibberellin metabolism&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seo&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Seo PJ, Park CM (2010) MYB96-mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acid biosynthesis in Arabidopsis. New Phytol 186: 471-483


http://scholar.google.com/scholar?as_q=MYB96-mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acid biosynthesis in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=MYB96-mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acid biosynthesis in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seo&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Seo PJ, Park CM (2011) Cuticular wax biosynthesis as a way of inducing drought resistance. Plant Signal Behav 6: 1043-1045


http://scholar.google.com/scholar?as_q=Cuticular wax biosynthesis as a way of inducing drought resistance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cuticular wax biosynthesis as a way of inducing drought resistance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seo&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Seo PJ, Lee SB, Suh MC, Park MJ, Go YS, Park CM (2011) The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis. Plant Cell 23: 1138-1152


http://scholar.google.com/scholar?as_q=The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seo&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Seo PJ, Xiang F, Qiao M, Park JY, Lee YN, Kim SG, Lee YH, Park WJ, Park CM (2009) The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in Arabidopsis. Plant Physiol 151: 275-289


http://scholar.google.com/scholar?as_q=The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seo&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Shkolnik-Inbar D, Bar-Zvi D (2010) ABI4 mediates abscisic acid and cytokinin inhibition of lateral root formation by reducing polar auxin transport in Arabidopsis. Plant Cell 22: 3560-3573

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shkolnik-Inbar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABI4 mediates abscisic acid and cytokinin inhibition of lateral root formation by reducing polar auxin transport in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABI4 mediates abscisic acid and cytokinin inhibition of lateral root formation by reducing polar auxin transport in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shkolnik-Inbar&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Shu K, Zhang H, Wang S, Chen M, Wu Y, Tang S, Liu C, Feng Y, Cao X, Xie Q (2013) ABI4 regulates primary seed dormancy by regulating the biogenesis of abscisic acid and gibberellins in Arabidopsis. PLoS Genet 9: e1003577

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABI4 regulates primary seed dormancy by regulating the biogenesis of abscisic acid and gibberellins in Arabidopsis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABI4 regulates primary seed dormancy by regulating the biogenesis of abscisic acid and gibberellins in Arabidopsis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shu&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=S�derman E, Brocard I, Lynch T, Finkelstein R (2000) Regulation and function of the Arabidopsis ABA-insensitive 4 (ABI4) gene in seed and ABA response signaling networks. Plant Physiol 124: 1752-1765

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=S�derman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation and function of the Arabidopsis ABA-insensitive 4 (ABI4) gene in seed and ABA response signaling networks&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation and function of the Arabidopsis ABA-insensitive 4 (ABI4) gene in seed and ABA response signaling networks&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=S�derman&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1




Stone SL, Williams LA, Farmer LM, Vierstra RD, Callis J (2006) KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growthand development, is involved in abscisic acid signaling. Plant Cell 18: 3415-3428


Thomas TL (1993). Gene expression during plant embryogenesis and germination: an overview. Plant Cell 5:1401-1410PubMed: http://www.ncbi.nlm.nih.gov/pubmed/8281041?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Tran LS, Urao T, Qin F, Maruyama K, Kakimoto T, Shinozaki K, Yamaguchi-Shinozaki K (2007) Functional analysis of AHK1/ATHK1and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. Proc Natl Acad SciUSA 104: 20623-20628


Tyler L, Thomas SG, Hu J, Dill A, Alonso JM, Ecker JR, Sun TP (2004) Della proteins and gibberellin-regulated seed germinationand floral development in Arabidopsis. Plant Physiol 135: 1008-1019


Vleeshouwers LM, Bouwmeester HJ, Karssen CM (1995) Redefining seed dormancy: an attempt to integrate physiology andecology. J Ecol 83: 1031-1037


Weiner JJ, Peterson FC, Volkman BF, Cutler SR (2010) Structural and functional insights into core ABA signaling. Curr Opin PlantBiol 13: 495-502


West M, Harada JJ (1993) Embryogenesis in higher plants: An overview. Plant Cell 5: 1361-1369PubMed: http://www.ncbi.nlm.nih.gov/pubmed/12271035?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wind JJ, Peviani A, Snel B, Hanson J, Smeekens SC (2013) ABI4: versatile activator and repressor. Trends Plant Sci 18: 125-132PubMed: http://www.ncbi.nlm.nih.gov/pubmed/23182343?dopt=abstractCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yaish MW, El-Kereamy A, Zhu T, Beatty PH, Good AG, Bi YM, Rothstein SJ (2010) The APETALA-2-like transcription factor OsAP2-39 controls key interactions between abscisic acid and gibberellin in rice. PLoS Genet 6: e1001098


Yang SD, Seo PJ, Yoon HK, Park CM (2011) The Arabidopsis NAC transcription factor VNI2 integrates abscisic acid signals into leafsenescence via the COR/RD genes. Plant Cell 23: 2155-2168


Yang Y, Yu X, Song L, An C (2011) ABI4 activates DGAT1 expression in Arabidopsis seedlings during nitrogen deficiency. PlantPhysiol 156: 873-883


Yano R, Kanno Y, Jikumaru Y, Nakabayashi K, Kamiya Y, Nambara E (2009) CHOTTO1, a putative double APETALA2 repeattranscription factor, is involved in abscisic acid-mediated repression of gibberellin biosynthesis during seed germination inArabidopsis. Plant Physiol 151: 641-654


Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis.Nat Protoc 2: 1565-1572


Zentella R, Zhang ZL, Park M, Thomas SG, Endo A, Murase K, Fleet CM, Jikumaru Y, Nambara E, Kamiya Y, Sun TP (2007) Globalanalysis of della direct targets in early gibberellin signaling in Arabidopsis. Plant Cell 19: 3037-3057https://plantphysiol.orgDownloaded on April 16, 2021. - Published by


http://search.crossref.org/?page=1&rows=2&q=Stamm P, Ravindran P, Mohanty B, Tan EL, Yu H, Kumar PP (2012) ��Insights into the molecular mechanism of RGL2-mediated inhibition of seed germination in Arabidopsis thaliana. BMC Plant Biol 12: 179

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Stamm&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=��Insights into the molecular mechanism of RGL2-mediated inhibition of seed germination in Arabidopsis thaliana.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=��Insights into the molecular mechanism of RGL2-mediated inhibition of seed germination in Arabidopsis thaliana.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Stamm&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Stone SL, Williams LA, Farmer LM, Vierstra RD, Callis J (2006) KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growth and development, is involved in abscisic acid signaling. Plant Cell 18: 3415-3428

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Stone&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growth and development, is involved in abscisic acid signaling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growth and development, is involved in abscisic acid signaling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Stone&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Thomas TL (1993). Gene expression during plant embryogenesis and germination: an overview. Plant Cell 5:1401-1410

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Thomas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gene expression during plant embryogenesis and germination: an overview&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gene expression during plant embryogenesis and germination: an overview&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Thomas&as_ylo=1993&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Tran LS, Urao T, Qin F, Maruyama K, Kakimoto T, Shinozaki K, Yamaguchi-Shinozaki K (2007) Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. Proc Natl Acad Sci USA 104: 20623-20628

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tran&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tran&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Tyler L, Thomas SG, Hu J, Dill A, Alonso JM, Ecker JR, Sun TP (2004) Della proteins and gibberellin-regulated seed germination and floral development in Arabidopsis. Plant Physiol 135: 1008-1019

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tyler&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Della proteins and gibberellin-regulated seed germination and floral development in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Della proteins and gibberellin-regulated seed germination and floral development in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tyler&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://search.crossref.org/?page=1&rows=2&q=Vleeshouwers LM, Bouwmeester HJ, Karssen CM (1995) Redefining seed dormancy: an attempt to integrate physiology and ecology. J Ecol 83: 1031-1037

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Vleeshouwers&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Redefining seed dormancy: an attempt to integrate physiology and ecology&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Redefining seed dormancy: an attempt to integrate physiology and ecology&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Vleeshouwers&as_ylo=1995&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Weiner JJ, Peterson FC, Volkman BF, Cutler SR (2010) Structural and functional insights into core ABA signaling. Curr Opin Plant Biol 13: 495-502

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Weiner&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Structural and functional insights into core ABA signaling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Structural and functional insights into core ABA signaling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Weiner&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=West M, Harada JJ (1993) Embryogenesis in higher plants: An overview. Plant Cell 5: 1361-1369

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=West&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Embryogenesis in higher plants: An overview&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Embryogenesis in higher plants: An overview&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=West&as_ylo=1993&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Wind JJ, Peviani A, Snel B, Hanson J, Smeekens SC (2013) ABI4: versatile activator and repressor. Trends Plant Sci 18: 125-132

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wind&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wind&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Yaish MW, El-Kereamy A, Zhu T, Beatty PH, Good AG, Bi YM, Rothstein SJ (2010) The APETALA-2-like transcription factor OsAP2-39 controls key interactions between abscisic acid and gibberellin in rice. PLoS Genet 6: e1001098

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yaish&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yaish&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Yang SD, Seo PJ, Yoon HK, Park CM (2011) The Arabidopsis NAC transcription factor VNI2 integrates abscisic acid signals into leaf senescence via the COR/RD genes. Plant Cell 23: 2155-2168

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis NAC transcription factor VNI2 integrates abscisic acid signals into leaf senescence via the COR/RD genes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis NAC transcription factor VNI2 integrates abscisic acid signals into leaf senescence via the COR/RD genes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Yang Y, Yu X, Song L, An C (2011) ABI4 activates DGAT1 expression in Arabidopsis seedlings during nitrogen deficiency. Plant Physiol 156: 873-883

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABI4 activates DGAT1 expression in Arabidopsis seedlings during nitrogen deficiency&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABI4 activates DGAT1 expression in Arabidopsis seedlings during nitrogen deficiency&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Yano R, Kanno Y, Jikumaru Y, Nakabayashi K, Kamiya Y, Nambara E (2009) CHOTTO1, a putative double APETALA2 repeat transcription factor, is involved in abscisic acid-mediated repression of gibberellin biosynthesis during seed germination in Arabidopsis. Plant Physiol 151: 641-654

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yano&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yano&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat Protoc 2: 1565-1572

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yoo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yoo&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1



Zhang X, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3degradation. Genes Dev 19: 1532-1543


Zhang ZL, Ogawa M, Fleet CM, Zentella R, Hu J, Heo JO, Lim J, Kamiya Y, Yamaguchi S, Sun TP (2011) Scarecrow-like 3 promotesgibberellin signaling by antagonizing master growth repressor DELLA in Arabidopsis. Proc Natl Acad Sci USA 108: 2160-2165




http://search.crossref.org/?page=1&rows=2&q=Zentella R, Zhang ZL, Park M, Thomas SG, Endo A, Murase K, Fleet CM, Jikumaru Y, Nambara E, Kamiya Y, Sun TP (2007) Global analysis of della direct targets in early gibberellin signaling in Arabidopsis. Plant Cell 19: 3037-3057

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zentella&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Global analysis of della direct targets in early gibberellin signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Global analysis of della direct targets in early gibberellin signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zentella&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Zhang X, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes Dev 19: 1532-1543

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1


http://search.crossref.org/?page=1&rows=2&q=Zhang ZL, Ogawa M, Fleet CM, Zentella R, Hu J, Heo JO, Lim J, Kamiya Y, Yamaguchi S, Sun TP (2011) Scarecrow-like 3 promotes gibberellin signaling by antagonizing master growth repressor DELLA in Arabidopsis. Proc Natl Acad Sci USA 108: 2160-2165

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Scarecrow-like 3 promotes gibberellin signaling by antagonizing master growth repressor DELLA in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Scarecrow-like 3 promotes gibberellin signaling by antagonizing master growth repressor DELLA in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


1 research area: environmental stress and adaptation 2€¦ · 2015-04-13 · 40 pil joon seo 41...

Documents