aeromonas veronii infection associated with high morbidity

European seabass Dicentrarchus labrax is an eco-nomically important species in Mediterranean aquacul-ture (Cardia and Lovatelli, 2007), with the top producers of this fish species located in Turkey and Greece fol-lowed by Egypt and Spain (FAO/GLOBEFISH, 2013). The production of European seabass increased to 128.105 tons in 2013 (FEAP, 2014), which does not account for the contribution from Egypt. Portion-sized fish are mainly produced in the Mediterranean Sea (Cardia and Lovatelli, 2007; Monfort, 2007), with a small fraction of the Turkish production originating from the Black Sea (FAO/GLOBEFISH, 2013).

Infectious diseases threaten aquaculture industries not only via direct financial costs related to biomass losses but also via indirect costs related to disease man-agement practices and depreciation of product value. Among the potential disease agents, bacterial patho-gens are the most frequently encountered (Lafferty et al., 2015; Meyer, 1991). In the Mediterranean Sea, the

dominant bacterial pathogens responsible for heavy losses in European seabass production are Vibrio anguillarum, Photobacterium damselae subsp. pisci-cida, and Tenacibaculum maritimum (Öztürk and Altınok, 2014; Toranzo et al., 2005). Other taxa impli-cated in infections include V. alginolyticus, V. ordalii, and V. harveyi (Abdel-Aziz et al., 2013; Korun and Timur, 2008; Pujalte et al., 2003). Disease outbreaks have also been caused by Streptococcus iniae (Zlotkin et al., 1998) and Mycobacterium marinum (Colorni, 1992; Ucko and Colorni, 2005; Ucko et al., 2002) in the Red Sea.

Here, we report on an infection caused by Aeromonas veronii bv. sobria in European seabass farmed in sea cages in the Aegean Sea. The aim of the present study was to examine the disease, and identify and character-ize the bacterial causative agent. To our knowledge, this is the first study of A. veronii bv. sobria in European seabass farmed in the Mediterranean Sea and the first study to examine the pathogenicity of this species.

© 2017 The Japanese Society of Fish Pathology魚病研究 Fish Pathology, 52 (2), 68–81, 2017. 6

* Corresponding authorE-mail: [email protected]

Research article

Aeromonas veronii Infection Associated with High Morbidity and Mortality in Farmed European Seabass Dicentrarchus labrax

in the Aegean Sea, Greece

Maria Smyrli1,2, Athanasios Prapas3, George Rigos1, Constantina Kokkari1,

Michail Pavlidis2 and Pantelis Katharios1*

1Institute of Marine Biology, Biotechnology and Aquaculture, Hellenic Centre for Marine Research, Heraklion 71003, Greece

2Department of Biology, University of Crete, Heraklion 70013, Greece3Department of Pathology of Aquatic Organisms, Veterinary Center of Athens,

Ag. Paraskevi 15310, Greece

(Received January 24, 2016)

ABSTRACT―In the present study, we examined a disease caused by Aeromonas veronii bv. sobria in sea cage-farmed European seabass Dicentrarchus labrax, in the Aegean Sea, Greece. Commercial sized fish were affected by A. veronii bv. sobria and exhibited high morbidity and mortality. Gross pathologic features and histology revealed a systemic infection characterized by the presence of abscesses and chronic granulomatous inflammation. Two clinical bacterial isolates (Aero NS and Aero PDB) were identified as A. veronii bv. sobria based on bacteriological characteristics and sequence anal-ysis for 16S rRNA and gyrB genes. Infectivity tests in the form of intraperitoneal injection administration (Aero NS) and immersion in a bacterial suspension (Aero NS and Aero PDB) revealed that both isolates could cause clinical signs similar to those observed in the field and high mortality rate. To our knowl-edge, this is the first report of A. veronii bv. sobria isolated from farmed European seabass in the Mediterranean Sea accompanied by supporting data of its pathogenicity.

Key words: Dicentrarchus labrax, European seabass, Aeromonas veronii bv. sobria, pathogenicity, Aegean Sea, Mediterranean Sea, Greece

Aeromonas veronii in European seabass 69

Materials and Methods

Description of the studyTwo neighboring fish farms in the Aegean Sea were

affected by A. veronii bv. sobria, which were located in Argolikos Bay, Eastern Peloponnese, Greece. The dis-ease appeared in the first fish farm in 2008 and in the second fish farm in 2009. The affected fish had approached commercial size (250–400 g), while smaller fish (<50 g) in adjacent cages did not show any signs of distress. Morbidity and mortality was observed in water temperature over 18°C, increased during the summer months and reached a peak in June and July (water temperature: 24–26°C). Although daily mortality was generally low (<0.5%), the accumulated mortality over 3–4 months could be as high as 17–20%. Fish exhib-ited anorexia, lethargic swimming mostly at the water surface, darkening of skin color, and exophthalmia. Anemia was evident from the pale color of the gills, while the majority of fish were icteric as manifested by a yel-lowish color of the skin, fins, and blood serum (Figs. 1A & B). Occasionally, there were superficial epidermal lesions, which progressively ulcerated and extended to the underlying musculature (Figs. 1C & D), and redden-ing of the fins and opercula. The disease is still present in the area, following a similar seasonal pattern but pre-senting a wider outbreak period (unpublished data).

Sampling procedureFish were monitored for bacterial pathogens at both

sites from 2008 to 2011. Moribund fish of several sizes underwent full necropsy. Tissue samples from the affected internal organs were preserved in 10% neutral buffered formalin for histological examination. The samples presented here were collected during the dis-ease outbreak.

Bacteria were isolated on-site from the kidney of moribund fish during the disease outbreak in 2009 on blood agar and Trypticase soy agar (TSA) supplemented with salt (2% NaCl). After the initial on-site identifica-tion of the isolated taxa, two predominant isolates were preserved for further analyses. Namely, Aero NS was isolated from the first farm and Aero PDB was isolated from the second farm. Both strains were preserved at –80°C in cryovials with ceramic beads, which are spe-cific for long-term cryogenic preservation of bacteria (MicrobankTM, ProLab).

Sampled fish had been vaccinated for V. anguilla-rum and Ph. damselae subsp. piscicida and were not medicated with antibiotics. In 2015 and 2016, further samplings were conducted at the same location. The preliminary results of the sampling conducted in Sep-tember and November 2015, corresponding to five iso-lates are reported here. Strains NS2, NS8, and NS10 were isolated in September, while strains NS6152 and NS6251 were isolated in November.

Phenotypic characterization of bacterial isolatesThe initial identification of bacteria isolated on-site

was conducted by fish veterinarians at the fish farms using the API20E system based on the manufacturer’s instructions (Biomérieux, Athens, Greece). The pre-served isolates were sent to the Hellenic Centre for Marine Research (HCMR) for further characterization and identification.

Colony morphology was observed on TSA supple-mented with 0.5–2% NaCl, after incubation for 24–48 h at 25°C. Microscopic observation and Gram staining were performed. Motility was tested on motility, indole, and ornithine (MIO) medium (Sigma-Aldrich). Growth was tested on selective media, Aeromonas isolation agar (AIA) plus ampicillin (Sigma-Aldrich) and thiosul-fate-citrate-bile salts-sucrose (TCBS) agar (Sigma-Aldrich). Growth in a salinity range from 0.5% to 4% NaCl was tested in Trypticase soy broth (TSB) at 25°C. Growth in the temperatures 4°C, 12°C, 22°C, 30°C, and 37°C was tested in TSB supplemented with 0.5% NaCl. Biochemical characterization was conducted with BIOLOG GEN III Microplate after incubation for 48 h at 25°C. The presence of a catalase enzyme was tested separately. The type strains LMG 3785 (A. veronii bv. sobria) and LMG 9075 (A. veronii bv. veronii) were included in all tests as reference strains. The commer-cial kits’ profile was used only for identification at the genus level. Key biochemical reactions were used for further identification.

Susceptibility to seven antibacterial agents, six of which are registered for application in aquaculture (FEAP, 2009), and to the O/129 vibriostatic agent (150 μg) was assessed by the disk diffusion method (Bauer et al., 1966) using 6 mm commercial disks (Oxoid). The two isolates were initially incubated on TSA supple-mented with 0.5% NaCl for 24 h at 25°C. Following the procedure proposed by Alderman and Smith (2001) for fish pathogens, colonies were suspended in sterile saline solution. The concentration of bacterial cells applied was approximately 3 × 108 cfu/mL. The sus-pension was subsequently inoculated onto Mueller-Hinton agar supplemented with 0.5% NaCl using a ster-ile cotton swab. The inhibition diameter was recorded after incubation for 48 h at 25°C. No recommended breakpoints were available in the literature for the patho-gens.

Hemolytic activity was assessed on 5% horse blood agar and 5% seabass blood agar at 25°C. Fish blood was taken aseptically from healthy European seabass broodfish maintained in the aquaculture facilities at HCMR. Results were recorded at 24 h and 48 h.

Molecular characterization of bacterial strainsTwo housekeeping genes, 16S rRNA (Martinez-

Murcia et al., 1992; Soler et al., 2004) and B-subunit of DNA gyrase (gyrB) (Soler et al., 2004; Yanez et al.,

M. Smyrli, A. Prapas, G. Rigos, C. Kokkari, M. Pavlidis and P. Katharios70

2003), were amplified and sequenced for Aero NS and Aero PDB. For the strains (NS2, NS8, NS10, NS6152 and NS6251) isolated in 2015, only the gyrB gene was amplified and sequenced. The sequences produced were compared with sequences in GenBank using BLAST algorithms. The gyrB gene was used for phylo-genetic analyses (Dauga, 2002; Roger et al., 2012; Silver et al., 2011).

Bacterial DNA was extracted from an overnight cul-ture obtained from a single colony. The culture was centrifuged and the boiling extraction method was applied to the obtained pellet. Polymerase chain reac-tion (PCR) amplification was performed in a final total volume of 25 μL, containing 1 μL DNA template, 0.2 pmol of each primer, and 12.5 μLTaq PCR Master Mix (Qiagen). PCR reactions were performed in a Bio-Rad MJ Mini Personal Thermal Cycler as follows: denatur-ation at 94°C for 3 min, 30 cycles at 94°C for 1 min, annealing for 1 min, extension at 72°C for 1.30 min, and final extension at 72°C for 10 min. Sequencing was conducted in a ABI3730xl sequencer based on the pro-tocol of BigDye Terminators 3.1 (Applied Biosystems). The characteristics of the primer pairs used are summa-rized in Table 1.

All sequences of Aeromonas spp. based on the sec-ond edit ion of Bergey’s Manual of Systematic Bacteriology (Martin-Carnahan and Joseph, 2005) in combination with the sequences produced herein were used for phylogenetic analyses. Alignment was per-formed in Clustal X2 (Larkin et al., 2007). Genetic dis-tances were estimated in MEGA 5 (Tamura et al., 2011) under the Tamura-Nei (Tamura and Nei, 1993) model of evolution. Phylogenetic relationships were examined with i) neighbor-joining analysis (Saitou and Nei, 1987) performed in MEGA under the Tamura-Nei model of evolut ion and i i ) maximum l ikel ihood analysis (Felsenstein, 1981) conducted using RAxML (Stamatakis et al., 2008) under the CAT model. The confidence of tree nodes was tested by the bootstrap analysis with 1,000 replicates.

Challenge testsChallenge tests were conducted using 35–70 g

European seabass. Fish were reared in borehole water (20°C) at facilities in the HCMR and fed commercial dry

pellets. For the challenge tests, fish were transported to a challenge facility at the University of Crete and placed in 250 L tanks with aerated artificial seawater at 20°C. Fish remained unfed during the infectivity trials.

Bacteria were grown in TSB supplemented with 0.5% NaCl for 18–20 h at 25°C. Before use, the bacte-ria were centrifuged and washed with sterile saline (0.9% NaCl). The bacterial concentration was deter-mined by optical density (600 nm) and verified by direct counting in a Neubauer chamber.

The infectivity of Aero NS was tested by intraperito-neal injection (IP) with 104 cfu/fish (0.1 mL) (herein after referred to as the IP-challenge) and by immersion in a bacterial suspension of 105 cfu/mL for 2.5 h in aerated borehole water (herein after referred to as the bath-chal-lenge). Subsequently, the infectivity of Aero PDB was tested only by the bath-challenge since the IP-challenge resulted in acute mortality in the first strain tested. Ten fish were included in each challenge. Control fish in the IP-challenge were injected with 0.1 mL sterile saline (0.9% NaCl). All fish were fully anaesthetized before injection. No bacteria were added to the control fish in the bath-challenge.

Mortality and clinical signs of the disease were recorded daily. Dead fish were subjected to macro-scopic examination, and samples from the spleen, liver, and kidney were preserved in 10% neutral buffered for-malin for histological examination. Bacteria were iso-lated aseptically from the kidney of dead fish on TSA supplemented with 2% NaCl and AIA medium. The plates were incubated for at least 48 h at 25°C before bacterial growth was examined.

All trials were performed in registered facilities according to the National Guidelines for Experimentation on Live Animals.

HistopathologyFormalin-fixed tissues of the spleen, liver, kidney,

and skin excised from fish exhibiting clinical signs of the disease were dehydrated in a 70–95% ethanol series and embedded in glycol methacrylate resin (Technovit 7100, Heraeus Kulzer, Germany). Serial sections (3–5 μm thick) were obtained using a microtome (Leica RM2245, Germany) with disposable blades. After dry-ing, the slides were stained with methylene blue/azure II/

Table 1. Characteristics of the primer pairs used for the PCR amplification of the studied genes

Gene Primer set Primer’s sequence (5′-3′) Product size (bp) ReferencegyrB gyrB3F TCCGGCGGTCTGCACGGCGT 1,100 (Yanez et al., 2003)

gyrB7F GGGGTCTACTGCTTCACCAAgyrB9R ACCTTGACGGAGATAACGGCgyrB14R TTGTCCGGGTTGTACTCGTC

16S Bac27F AGAGTTTGATCMTGGCTCAG 1,450 (Lane, 1991)518F CCAGCAGCCGCGGTAATACG800R TACCAGGGTATCTAATCC1492R TACGGYTACCTTGTTACGACTT


basic fuchsine (Bennett et al., 1976), hematoxylin and eosin, and Ziehl-Neelsen stains.

Results

PathologyThe main organs affected in naturally infected fish

were the kidney, spleen, and liver. The spleen was enlarged with numerous whitish nodules throughout the surface of the organ (Figs. 1E & F). In advanced cases, the kidney was also enlarged with the presence of extensive necrosis in the renal parenchyma, which was grossly visible (Fig. 1G). Necrotic foci and diffuse hemorrhages were observed in the liver (Fig. 1H).

Histology of the samples collected on-site revealed a systemic infection characterized by a chronic granulo-matous inflammation. Lesions were discovered in all tissues of the kidney, liver, spleen, and muscle exam-ined. Several lesions were necrotic and calcified, while granulomas often contained the foci of rod-shaped bac-teria. Caseous necrosis was evident in dermal lesions,

while well-demarcated necrotic lesions were often found in the liver. Bacteria could also be observed in non-granulomatous areas in the kidney (Figs. 2A–D). No acid-fast bacteria were observed in the Ziehl-Neelsen-stained sections.

Phenotypic characterization of bacterial strainsDuring disease outbreaks, the pathogens were iso-

lated in pure colonies on TSA supplemented with 2% NaCl. The isolates were classified into two groups: one consisted of non-pigment producing isolates and the other consisted of pigment-producing isolates. Biochemical profiles retrieved from API20E corre-sponded to A. sobria for all isolates. Aero NS and Aero PDB were preserved and analyzed as representatives of the two phenotypic groups.

Both strains formed smooth, circular, and opaque colonies, the color of which appeared from white to buff on TSA supplemented with 2% NaCl after incubation for 24 h at 25°C. Fully-grown colonies were observed after incubation for 48 h, and Aero PDB produced a brown

Fig. 1. A) Icteric appearance of affected fish. B) Yellow color of the blood serum indicating liver damage. C) European seabass with ulcerative lesions at the epidermis. D) Ulcerative epidermal lesion with visible granulomatous reaction. E) Splenomegaly in infected European seabass. F) Numerous whitish nodules are grossly visible in the spleen. G) Enlarged kidney with focal necrosis. H) Liver necrotic foci. All pictures were retrieved from naturally infected fish.


pigment diffused onto the medium (Figs. 3A & B). Both strains were Gram-negative, rod-shaped, and approxi-mately 1 μm in size. Motility was observed only for Aero PDB while Aero NS was non-motile. Both strains

grew well on AIA medium, where no acid production from xylose was observed. The growth of Aero PDB was limited and Aero NS did not grow on TCBS agar. Both strains grew better on lower salinity media (0.5–2%

Fig. 2. A) Well demarcated necrotic lesions in the liver (H&E). B) Epidermal lesion showing extensive necrosis (H&E). C) Granuloma in the kidney with bacterial foci in the center (polychrome stain). D) Higher magnification of the previous picture showing the foci of the bacteria within the granuloma. All pictures were retrieved from naturally infected fish.

Fig. 3. A) Strain Aero NS on TSA 0.5% NaCl after 48 h incubation at 25°C. B) Strain Aero PDB on TSA 0.5% NaCl after 48 h incu-bation at 25°C. C) Hemolysis on European seabass blood agar after 48 h incubation at 25°C with strain Aero NS. D) Hemolysis on European seabass blood agar after 24 h incubation at 25°C with strain Aero PDB.


NaCl). No growth was observed in salinity at or over 4% NaCl. The optimum temperature for growth in both strains was 30°C, while no growth was observed at or below 12°C. The growth properties of newly isolated strains NS2, NS8, NS10, NS6152, and NS6251 were similar to those of Aero NS and Aero PDB. All the newly isolated strains were Gram-negative and

rod-shaped bacteria, and their colony morphology was similar to that of Aero PDB. All the newly isolated strains were motile and produced pigment on TSA sup-plemented with 0.5% NaCl after incubation for 48 h.

Both Aero NS and Aero PDB were oxidase and cat-alase positive and were able to utilize glucose and treha-lose; however, they were unable to utilize D-arabitol and

Table 2. The metabolic fingerprint of the strains Aero NS (a), Aero PDB (b), NS 2 (c), NS 8 (d), NS 10 (e), NS 6.15.2 (f) and NS 6.25.1 (g) obtained using the BIOLOG GEN III MicroPlate system following 48 h incubation at 25°C. Differences in the reactions are highlighted with grey color without taking into account the intermediate and variable reactions. The type strains of A. veronii bv. sobria, LMG 3785 (h) and A. veronii bv. veronii, LMG 9075 (i) were used as reference strains.

# Substrate a b c d e f g h i # Substrate a b c d e f g h i

A1 Negative control – – – – – – – – – E1 Gelatin Ι – – – – – – + +A2 Dextrin + + + + + + + + + E2 Glycyl-L-Proline Ι + + + + + + + IA3 D-Maltose + + + + + + + + + E3 L-Alanine Ι + + + + Ι + + +A4 D-Trehalose + + + + + + + + + E4 L-Arginine Ι + + + + + + + –A5 D-Cellobiose – – – – – – – – + E5 L-Aspartic Acid Ι + + + + + + + +A6 Gentiobiose – – – – – – – – – E6 L-Glutamic Acid Ι + + + + + + + +A7 Sucrose + + + + + + + + + E7 L-Histidine Ι + + + + + + + +A8 D-Turanose – – – – – – – – + E8 L-Pyroglutamic Acid – – – – – – – –A9 Stachyose – – – – – – – – – E9 L-Serine + + + + + + + + +A10 Positive control + + + + + + + + + E10 Lincomycin Ι + + + + + + + +A11 pH 6 + + + + + + + + + E11 Guanidine HCl + + + + + + + + +A12 pH 5 + + – – – + Ι – – E12 Niaproof 4 + + + + + + + + +B1 D-Raffinose – – – – – – – – – F1 Pectin – Ι – – – + + + +B2 α-D-Lactose – – – – – – – – – F2 D-Galacturonic Acid – – Ι – Ι – – – –B3 D-Melibiose – – – – – – – – – F3 L-Galactonic Acid Lactone – – Ι – – – – – –B4 β-Methyl-D-Glucoside – – – – – – – – + F4 D-Gluconic Acid + + + + + + + + +B5 D-Salicin – – – – – Ι – – + F5 D-Glucuronic Acid – – – – – – – – –B6 N-Acetyl-D-Glucosamine + + + + + + + + + F6 Glucuronamide – – + – Ι – – – –B7 N-Acetyl-β-D-Mannosamine – – + – – – – – – F7 Mucic Acid – – – – – – – – –B8 N-Acetyl-D-Galactosamine Ι + + + + + + + + F8 Quinic Acid – – + – – – – – –B9 N-Acetyl Neuraminic Acid – – – – – – – – – F9 D-Saccharic Acid – – – – – – – – –B10 1% NaCl + + + + + + + + + F10 Vancomycin + + + + + + + + +B11 4% NaCl – – – – – – Ι – – F11 Tetrazolium Violet – – – – – – – – +B12 8% NaCl – – – – – – – – – F12 Tetrazolium Blue V + – + + + + + +C1 α-D-Glucose + + + + + + + + + G1 p-Hydroxy- Phenylacetic Acid – – – – – – – – –C2 D-Mannose + + + + + + + + + G2 Methyl Pyruvate + + + + + + + + +C3 D-Fructose + + + + + + + + + G3 D-Lactic Acid Methyl Ester – – – – – – – – –C4 D-Galactose + + Ι + + + + + + G4 L-Lactic Acid – – – – – – – – –C5 3-Methyl Glucose – – – – – Ι – – – G5 Citric Acid + – – + I I I – +C6 D-Fucose Ι – Ι – Ι + – – I G6 α-Keto-Glutaric Acid – – I – I – – – –C7 L-Fucose – – Ι – – Ι – – – G7 D-Malic Acid – – – – – – – – –C8 L-Rhamnose – – – – – – – – – G8 L-Malic Acid + + + + + + + + +C9 Inosine + + + + + + + + + G9 Bromo-Succinic Acid I – – – – I – + IC10 1% Sodium Lactate + + + + + + + + + G10 Nalidixic Acid – – – – – – – – –C11 Fusidic Acid – – – – – – – – – G11 Lithium Chloride – – – – – – – – +C12 D-Serine + + + + + + + + + G12 Potassium Tellurite – I – – – – – – –D1 D-Sorbitol – – – – – – – – H1 Tween 40 + + + + + I + + –D2 D-Mannitol + + + + + + + + + H2 γ-Amino-Butryric Acid – – – – – – – – –D3 D-Arabitol – – Ι – Ι – – – – H3 α-Hydroxy- Butyric Acid – – – – – – – – –D4 myo-Inositol – – – – Ι – – – – H4 β-Hydroxy-D,L-Butyric Acid Ι – – – – – – – –D5 Glycerol Ι + + + + + + + + H5 α-Keto-Butyric Acid Ι + – – – – + – –D6 D-Glucose- 6-PO4 + + + + + + + + + H6 Acetoacetic Acid – + Ι + + – Ι – –D7 D-Fructose- 6-PO4 + + + + + + + + + H7 Propionic Acid Ι Ι – – – – Ι – –D8 D-Aspartic Acid – – – – – Ι – – – H8 Acetic Acid + + + – + + + + –D9 D-Serine + + + + + + + + + H9 Formic Acid + – Ι – – – Ι + –D10 Troleandomycin + + + + + + + + + H10 Aztreonam V I + + + – Ι – +D11 Rifamycin SV + + + + + + + + + H11 Sodium Butyrate + + – – – + Ι + +D12 Minocycline – – – – – – – – – H12 Sodium Bromate Ι Ι – – – – + – –

Symbols: V, variable reaction; +, positive reaction; –, negative reaction; Ι, intermediate reaction.


xylose. Biochemical profiles retrieved from API20E corresponded to A. sobria for both strains. Biochemical profiles retrieved from BIOLOG GEN III Microplate cor-responded to A. veronii bv. veronii (p=56.2%) for Aero NS and to A. sobria (p=69%) for Aero PDB.

The biochemical profiles of strains NS2, NS8, NS10, NS6152, and NS6251 retrieved from BIOLOG GEN III Microplate corresponded to A. hydrophila-like (DNA group 2) (p=50–88%). The biochemical profiles of the type strains LMG 3785 (A. veronii bv. sobria) and LMG 9075 (A. veronii bv. veronii) retrieved from BIOLOG GEN III Microplate corresponded to A. sobria (p=70%) and A. veronii bv. veronii (p=57%), respectively. Thus, all the analyzed isolates were identified as Aeromonas spp. using commercial identification kits.

At the species level, Aero NS and Aero PDB were identified as A. veronii due to negative reactions to esculin and L-arabinose. At the biovariety level, Aero NS and Aero PDB were identified as A. veronii bv. sobria owing to the ability to ferment sucrose, positive reactions to arginine dihydrolase (ADH) and lysine decarboxylase (LDC), and negative reactions to ornithine decarboxyl-ase (ODC) and salicin. The results of the phenotypic

tests and growth properties are summarized in Tables 2 and 3.

On the seabass blood agar, beta-hemolysis was clearly observed after incubation for 24 h at 25°C (Figs. 3C & D), while only weak hemolysis was observed on the horse blood agar after incubation for 48 h at 25°C. Both strains were resistant to ampicillin. Susceptibility to all the other antibiotics tested as well as to the vibrio-static agent O/129 was observed (Table 4).

Table 3. Phenotypic and growth properties of strains Aero NS (a) and Aero PDB (b). The type strains of A. veronii bv. sobria, LMG 3785 (c) and A. veronii bv. veronii, LMG 9075 (d) were used as reference strains. The biochemical properties of the on-site identified isolates (e) are pre-sented as percentage of positive reactions.

Test a b c d e (%)

β-galactosidase (ONPG) (+) + + + 100

Arginine dihydrolase (ADH) (+) + + – 100Lysine decarboxylase (LDC) (+) + + + 100Ornithine decarboxylase (ODC) (–) – – + 0Citrate utilization (CIT) (–) + – + 80H2S production (H2S) (–) – – – 0Urease (URE) (–) – – – 0Tryptophan deaminase (TDA) (+) – + + 60Indole production (IND) (–) – + + 0Acetoin production (VP) (+) + + + 70Gelatinase (GEL) (+) (–) + + 50Oxidase (OX) (+) + + + 100Glucose (GLU) (+) + + + 100Mannitol (MAN) (+) + + + 80Inositol (INO) (–) – – – 0Sorbitol (SOR) (–) – – – 0Rhamnose (RHA) (–) – – – 0Sucrose (SAC) (+) + + + 90Melibiose (MEL) (–) – – – 0Amygdalin (AMY) (–) – – – 0Arabinose (ARA) (–) – – – 0Catalase + + + + ndΑΙΑ + + + + ndTCBS – + – + ndTSB 0,5–3% NaCl + + + + ndTSB ≥4% NaCl – – – – ndMotility – + + + ndPigment production – + – – V

Symbols: V, variable reaction; +, positive reaction; –, negative reaction, nd, not done.

Table 4. Antibiotic sensitivity test for strain Aero NS and Aero PDB. Except tetracycline, all antibiotics are regis-tered for use in aquaculture (FEAP, 2009). The diameter of inhibition zone is given in mm.

DiameterAntibiotic (μg) Aero NS PDB

Ampicillin (AMP) 10 0 0Tetracycline (TE) 30 31 33Oxytetracycline (OT) 30 37 35Sulphamethoxazole/Trimethoprim (SXT) 25 30 32Oxolinic acid (OA) 2 35 36Flumequine (UB) 30 41 39Florfenicol (FFC) 30 37 39O/129 150 12 14


Molecular characterization of bacterial strainsAero NS, Aero PDB and all the strains isolated in

2015 were correlated with A. veronii in BLAST (p=99%) after gyrB sequence analysis. The mean genetic dis-tance between Aero NS and Aero PDB for the 16S rRNA and gyrB gene was 0%. The mean genetic distance among all the analyzed isolates (n=7) for the gyrB gene were 0% too. The mean genetic distances in the A. veronii clade were 0.1% and 1.5% for 16S rRNA and gyrB, respectively. The mean distances in the genus Aeromonas were 1.2% and 8.2% for 16S rRNA and gyrB, respectively. Therefore, Aero NS and Aero PDB were classified into the same group and form a mono-phyletic clade with A. veronii based on the gyrB sequence (Fig. 4). The accession numbers in the NCBI GenBank are: KF636138 (Aero NS), KR049227 (Aero PDB), KY310612 (NS2), KY310611 (NS8), KY310610

(NS10), KY310608 (NS6152), and KY310609 (NS6251).

Challenge testsWithin 24 h, the IP-injected fish with Aero NS

appeared lethargic and exhibited light reddening on the skin and fins. The fish demonstrated distinct behavior; i.e., they were grouped and hovered calmly under the water surface with pectoral fins that were wide-open. Diffused hemorrhages were clearly observed in the peri-toneum cavity and internal organs accompanied by ascetic fluid (Fig. 5A). All the IP-injected fish died within four days of the challenge test beginning. No mortality was observed in the control fish (Fig. 6).

The external signs of the bath-challenged fish included lethargic swimming and reddening on the fins and skin (Fig. 5B). The color of a few fish became dark. Diffused hemorrhages and ascetic fluid were

Fig. 4. Phylogenetic relationships between strains Aero NS and Aero PDB and other Aeromonas spp. according to the topology of ML analysis for gyrB gene. Numbers on branches indicate the bootstrap values of NJ analysis followed by the bootstrap values of ML analysis. Only values >75% for NJ and >50% for ML are presented here. Accession numbers (GenBank, NCBI) of the used sequences are presented in parenthesis as well as the strain code when necessary. T: indicates the type strains.


observed in the peritoneum cavity, hemorrhages were observed on the surfaces of the internal organs, and lesions were mainly observed on the liver and spleen (Figs. 5C & D) and rarely observed on the kidney. Splenomegaly was observed after the sixth day post-challenge for Aero PDB and after the ninth day post-challenge for Aero NS. Mortality initiated on the fourth day post-challenge for Aero NS and on the fifth day post-challenge for Aero PDB post-challenge (Fig. 6). All the fish challenged with Aero NS died within 10 days after the bath-challenge began while all the fish challenged with Aero PDB died within 7 days after the bath-chal-lenge began. No mortality was observed in the control fish (Fig. 6). Bacteria were isolated from all dead fish.

Histological observation revealed that both strains caused similar lesions in the spleen and liver. Multifocal

Fig. 5. A) Hemorrhages in the peritoneum cavity and internal organs of IP-injected fish with strain Aero NS (1 day post-challenge). B) Reddening of the skin and fins of bath challenged fish with strain Aero NS (5 days post-challenge). C) Abscesses on the spleen and diffused hemorrhages on the liver and peritoneum cavity of bath challenged fish with strain Aero PDB (6 days post-challenge). D) Abscesses on the liver (big) and spleen (slightly visible) of bath challenged fish with strain Aero NS (8 days post-challenge).

Fig. 6. Daily survival (%) of challenged European seabass with strains Aero NS (injection and bath) and Aero PDB (bath).


liquefactive necrosis was prominent in the spleen and abscesses were prominent in the liver (Figs. 7A & B). Diffused bacteria were readily visible in both organs (Figs. 7C & D).

Discussion

To our knowledge, this is the first study of A. veronii bv. sobria infection in farmed European seabass in the Aegean Sea. Clinical signs of disease were investi-gated and two clinical strains of A. veronii bv. sobria were identified and characterized. The two strains exhibited the same molecular profile but their phenotypic properties differed from each other. Challenge tests revealed that the clinical signs related to both strains were similar to those observed in the field, and both strains could cause high mortality in European seabass.

In the present study, the main organs of European seabass affected by A. veronii bv. sobria were the kidney, spleen, and liver, where lesions, hemorrhages, granulo-mas, and necrotic foci were observed. Moreover, epider-mal lesions progressively became ulcerated extending to the underlying musculature, and the fins were reddened. Clinical signs, such as petechial hemorrhages and enlargement of the internal organs, have also been observed in European seabass infected with A. hydrophila in the Aegean Sea (Doukas et al., 1998). In the Black Sea, splenomegaly, anemic (pale) gills, and necrotic foci in the spleen, liver, and kidney have been observed in European seabass infected with A. salmonicida subsp. achromogenes (Karatas et al., 2005). Darkening of the

skin color, erratic swimming, ulcerative lesions and nod-ules in the spleen and kidney have been observed in European seabass in the Black Sea during a survey on pathogenic bacteria (Uzun and Ogut, 2015). This sur-vey indicated that the most prevalent pathogenic species was A. veronii bv. sobria followed by Ph. damselae subsp. damselae, and suggested that A. veronii bv. sobria might be implicated in disease development (Uzun and Ogut, 2015). Although daily mortality in the present study was generally low, cumulative losses were high and comparable to other aeromonad infections in European seabass. A low daily mortality rate (0.5%) has been previously associated with A. hydrophila in adult European seabass (150–330 g) in the Aegean Sea (Doukas et al., 1998). In the Black Sea, the mortality of European seabass (5–100 g) was associated with A. salmonicida subsp. achromogenes, and reached 20% between June and July (≥ 16°C) (Karatas et al., 2005).

The bacterial strains (Aero NS and Aero PDB) described in the present study as the etiological agents of the disease belonged to the mesophilic Aeromonas group (Janda and Abbott, 2010). Although both strains grew well on TSA supplemented with 2% NaCl, the opti-mum growth was observed on TSA supplemented with 0.5% NaCl in accordance with the freshwater “prefer-ence” of aeromonads (Martin-Carnahan and Joseph, 2005). Considering the constraints of the API 20E sys-tem with fish pathogens, in particular with bacteria of the genera Aeromonas and Vibrio (Austin, 2011; Santos et al., 1993), and the discrepancy between final identifica-tion and identification retrieved from BIOLOG GEN III

Fig. 7. A) Multifocal liquifactive necrosis in the spleen. B) Higher magnification of spleen showing bacterial foci. C) Abscesses in the liver. D) Higher magnification of the previous picture showing bacterial foci in the abscess. All pictures were retrieved from bath challenged fish 6 days post-challenge. Polychrome stain was applied to all sections.


Microplate (Ciapini et al., 2002), these commercial kits’ profiles were used only for identification to the genus level. The typical phenotypic properties of the genus Aeromonas, such as resistance to ampicillin, presence of oxidase and catalase, absence of urease, fermenta-tion of D-glucose and trehalose, and inability to produce acid from xylose (Abbott et al., 2003) were observed in both strains. At the species level, pigment production (Aero PDB), lack of motility (Aero NS), and inability to produce indole from tryptophan (Aero NS and Aero PDB) were considered typical properties of A. salmonicida. Conversely, negative reactions to esculin and L-arabinose were attributed to the A. sobria species complex, in which the ability to ferment sucrose was mainly attributed to A. veronii bv. sobria (Abbott et al., 2003). In agreement with this, both Aero NS and Aero PDB (and all strains isolated from 2015 in the present study) were identified as A. veronii at the species level when the housekeeping genes were used for identifica-tion. The phylogenetic analyses supported the above-mentioned identification as Aero NS and Aero PDB were classified into the A. veronii clade in both maximum like-lihood and neighbor-joining analyses for the gyrB gene. Finally, based on key biochemical properties, such as ADH (+), LDC (+), ODC (–), and salicin (–) reactions (Abbott et al., 2003), Aero NS and Aero PDB were iden-tified as A. veronii bv. sobria at the biovariety level. A recent genomic study reported that the negative reaction to ODC was correlated with A. veronii bv. sobria (Colston et al., 2014).

Aero NS, Aero PDB, and A. veronii bv. sobria iso-lated from European seabass in the Black Sea (Uzun and Ogut, 2015) were negative for indole, which is not a typical characteristic of A. veronii. However, no pigment-producing strains were isolated in the study performed by Uzun and Ogut (2015). Reactions to H2S, urea, L-arabinose, mannose, sucrose, maltose, inositol, xylose, sorbitol, rhamnose and lactose, exhibited the expected profiles of the species. Finally, Aero NS and Aero PDB were susceptible to all antibiotics (registered for application in aquaculture) tested in the present study except ampicillin, which possibly indicates a recent occurrence of the bacteria in the area.

The results of the challenge tests clearly indicated that A. veronii bv. sobria was a pathogen for European seabass. The infectivity tests, such as the bath-chal-lenge, successfully reproduced the clinical signs observed in the field. Although abscesses observed in the internal organs of the bath-challenged fish indicated the existence of the acute form of the disease, granulo-mas observed in the field indicated the existence of the chronic form of the disease, which probably developed during a longer period of infection. The results of the bath-challenge test revealed that the mortality rate caused by Aero NS advanced more rapidly than that caused by Aero PDB, which indicated that there were

different virulent properties and/or mechanisms between motile and non-motile strains. Further research is required to explain these differences.

The IP-challenge revealed that Aero NS caused high mortality up to 100% only a few days after the chal-lenge began. However, this test is not an effective pro-cedure and does not simulate field conditions, unlike the bath-challenge. The mortality caused by Aero NS occurred much earlier in the IP-challenge than in the bath-challenge, and clinical signs observed in the field were not reproduced. The majority of the IP-challenged fish succumbed to the infection within two days after the challenge began. In goldfish Carassius auratus, the mortality reached 100% after intramuscular injection with 106 cfu/fish of A. veronii. However, when the bacterial concentration was 104 cfu/fish, which was applied in the present study, the mortality was lower by approximately 40% (Sreedharan et al., 2013). Similarly, the mortality reached 100% in spotted sand bass Paralabrax maculatofasciatus, when over 107 cfu/fish of A. veronii was orally and intraperitoneally administered (Guzman-Murillo et al., 2000). Unfortunately, no data obtained in the above-mentioned studies, including experimental times and daily mortalities are available. Therefore, we cannot compare the results between the above-men-tioned studies and the present study.

It is worth comparing the relative “preference” between fish and mammalian erythrocytes, as the rela-tive preference for fish erythrocytes was observed in the hemolysis test on blood agar and this could indicate adaptation by the pathogen (both Aero NS and Aero PDB) to the fish. The icteric appearance of the fish could be related to hepatic jaundice in the chronic form of the disease observed in the field. The hemolytic nature of the bacterium could explain the high hemolysis observed mainly in the IP-challenged fish, which could be compared to the acute form of the disease that is not generally observed in the field.

Aeromonads are mainly known as fresh or brackish water inhabitants. Mesophilic species are also present in the marine environment, which generally prefer nutri-ent-rich and warm waters (Martin-Carnahan and Joseph, 2005). Although Aeromonas spp. have been frequently isolated from marine environmental samples, epizootic diseases caused by Aeromonas spp. are not common in fish species farmed in the Mediterranean Sea. In the Aegean Sea, aeromonads have been sporadically detected via microbial screenings or surveys on dis-eased fish including sharpsnout seabream Diplodus puntazzo (Athanassopoulou et al., 1999), gilthead seabream Sparus aurata (Avsever et al., 2012; Zorrilla et al., 2003), and European seabass (Avsever et al., 2012; Doukas et al., 1998; Yardımcı and Timur, 2015). However, the pathogenicity of aeromonads has not usu-ally been examined and in most cases species of marine bacteria belonging to the genera Vibrio, Photobacterium,


Pseudomonas, and Tenacibaculum, which are known pathogens, were also isolated (Athanassopoulou et al., 1999; Avsever et al., 2012; Yardımcı and Tibur, 2015). In the low salinity environment of the Black Sea, aero-monads have been detected in various fish species, inc lud ing sa lmon Salmo salar , ra inbow t rout Oncorhynchus mykiss, turbot Psetta maxima, and European seabass (Öztürk and Altınok, 2014). Recently, a study reported that A. veronii bv. sobria was the most prevalent species detected from dead farmed European seabass vaccinated against V. anguillarum and Ph. damselae subsp. damselae (Uzun and Ogut, 2015). Infectious diseases have spread in aquaculture by interactions with wild populations, evolution from non-pathogenic microorganisms, and transfer of anthropo-genic stocks and materials (Arechavala-Lopez et al., 2013; Murray and Peeler, 2005). Mortality of European seabass caused by A. veronii bv. sobria was observed in Argolikos Bay (Aegean Sea) and the Black Sea (Uzun and Ogut, 2015). However, these two incidents cannot be directly correlated with each other when the distance between these two locations is taken into consideration. Moreover, there are no freshwater flows into the area studied in Argolikos Bay, even though aeromonads pre-fer low salinity water. In addition, the disease is still present in the field following a similar seasonal pattern of occurrence. Thus, it can be assumed that the mortality of European seabass is caused by an establishing dis-ease rather than a stress-induced infection owing to an opportunistic pathogen under adverse environmental conditions.

The effect of climate change on the Mediterranean Sea has been identified in various studies. The increases in salinity and water temperature related to cli-mate change appear suitable for the invasion and estab-lishment of tropical species in the East Mediterranean Sea in particular (Lejeusne et al., 2016; Raitsos et al., 2010). Changes in water temperature might be advan-tageous to opportunistic pathogens (Vezzulli et al., 2010) and warm water pathogens (Danovaro et al., 2009), and could be implicated in emerging pathologies in marine ecosystems. Current fish farming systems are particularly vulnerable because high population den-sities and various stressors related to production proce-dures increase the risk of infection and allow diseases to become established (Murray and Peeler, 2005).

In conclusion, a disease caused by A. veronii bv. sobria resulted in high morbidity and mortality of com-mercial-sized European seabass. The clinical isolates caused high mortalities of IP- and bath-challenged fish. The clinical signs of the disease could be reproduced in the bath-challenge test. Epizootiology has not thor-oughly elucidated the disease caused by A. veronii bv. sobria, and the disease still occurs in the area where it was initially detected. Further research in the Aegean Sea, including monitoring during the summer months,

would reveal further information on the disease.

Acknowledgements

The work was supported by FISHPHAGE (131), Excellence Program co-funded by European Social Fund and Greek National Funds under the National Strategic Reference Framework 2007-2013.

References

Abbott, S. L., W. K. Cheung and J. M. Janda (2003): The genus Aeromonas: biochemical characteristics, atypical reac-tions, and phenotypic identification schemes. J. Clin. Microbiol., 41, 2348–2357.

Abdel-Aziz, M., A. E. Eissa, M. Hanna and M. A. Okada (2013): Identifying some pathogenic Vibrio/Photobacterium spe-cies during mass mortalities of cultured Gilthead seabream (Sparus aurata) and European seabass (Dicentrarchus labrax) from some Egyptian coastal provinces. Int. J. Vet. Sci. Med., 1, 87–95.

Alderman, D. J. and P. Smith (2001): Development of draft pro-tocols of standard reference methods for antimicrobial agent susceptibility testing of bacteria associated with fish diseases. Aquaculture, 196, 211–243.

Arechavala-Lopez, P., P. Sanchez-Jerez, J. T. Bayle-Sempere, I. Uglem and I. Mladineo (2013): Reared fish, farmed escapees and wild fish stocks - a triangle of pathogen transmission of concern to Mediterranean aquaculture management. Aquac. Environ. Interact., 3, 153–161.

Athanassopoulou, F., T. Prapas and H. Rodger (1999): Dis-eases of Puntazzo puntazzo Cuvier in marine aquaculture systems in Greece. J. Fish Dis., 22, 215–218.

Austin, B. (2011): Taxonomy of bacterial fish pathogens. Vet. Res., 42, 20.

Avsever, M. L., E. E. Onuk, N. Türk, S. Tunalıgil, S. Eskiizmirliler, S. İnçoglu and M. Yabanlı (2012): Pasteurel-losis cases in sea bass and sea bream cultured in the Aegean Region and other bacteria isolated from these cases. Bornova Veteriner Bilimleri Dergisi, 34, 9–16.

Bauer, A. W., W. M. M. Kirby, J. C. Sherris and M. Turck (1966): Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol., 45, 493–496.

Bennett, H. S., A. D. Wyrick, S. W. Lee and J. H. McNeil (1976): Science and art in preparing tissues embedded in plastic for light microscopy, with special reference to glycol meth-acrylate, glass knives and simple stains. Stain Technol., 51, 71–97.

Cardia, F. and A. Lovatelli (2007): A review of cage aquacul-ture: Mediterranean Sea. FAO Fisheries Technical Paper 498, 159 p.

Ciapini, A., R. Dei, C. Sacco, S. Ventura, C. Viti and L. Giovannetti (2002): Phenotypic and genotypic characteri-sation of Aeromonas isolates. Ann. Microbiol., 52, 339–352.

Colorni, A. (1992): A systemic mycobacteriosis in the European sea bass Dicentrarchus labrax cultured in Eilat (Red Sea). Isr. J. Aquac., 44, 75–81.

Colston, S., M. Fullmer, L. Beka, B. Lamy, J. Gogarten and J. Graf (2014): Bioinformatic genome comparisons for taxo-nomic and phylogenetic assignments using Aeromonas as a test case. MBio, 5(6), e02136–14.

Danovaro, R., S. Fonda Umani and A. Pusceddu (2009): Cli-mate change and the potential spreading of marine muci-lage and microbial pathogens in the Mediterranean Sea.


PLoS One, 4, e7006.Dauga, C. (2002): Evolution of the gyrB gene and the molecular

phylogeny of Enterobacteriaceae: a model molecule for molecular systematic studies. Int. J. Syst. Evol. Micro-biol., 52(2), 531–547.

Doukas, V., F. Athanassopoulou, E. Karagouni and E. Dotsika (1998): Short communication Aeromonas hydrophila infec-tion in cultured sea bass, Dicentrarchus labrax L., and Puntazzo puntazzo Cuvier from the Aegean Sea. J. Fish Dis., 21, 317–320.

FAO/GLOBEFISH (2013): A quarterly update on world seafood markets. FAO/GLOBEFISH Highlights, 56 p.

FEAP (2009): List of licensed veterinary medicines. Federa-tion of European Aquaculture Producers Fish Heatlh WG 20/11/2009, 6 p.

FEAP (2014): European Aquaculture Production Report 2004-2013. Federation of European Aquaculture Producers, 52 p.

Felsenstein, J. (1981): Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol., 17, 368–376.

Guzman-Murillo, M. A., M. L. Merino-Contreras and F. Ascencio (2000): Interaction between Aeromonas veronii and epi-thelial cells of spotted sand bass (Paralabrax maculatofas-ciatus) in culture. J. Appl. Microbiol., 88, 897–906.

Janda, J. M. and S. L. Abbott (2010): The Genus Aeromonas: Taxonomy, Pathogenicity and Infection. Clin. Microbiol. Rev., 23, 35–73.

Karatas, S., A. Candan and D. Demircan (2005): Atypical Aeromonas infection in cultured sea bass (Dicentrarchus labrax) in the Black Sea. Isr. J. Aquacult. Bamid., 57, 255–263.

Korun, J. and G. Timur (2008): Marine vibrios associated with diseased sea bass (Dicentrarchus labrax) in Turkey. J. Fisheries Sciences. com, 2, 66–76.

Lafferty, K. D., C. D. Harvell, J. M. Conrad, C. S. Friedman, M. L. Kent, A. M. Kuris, E. N. Powell, D. Rondeau and S. M. Saksida (2015): Infectious diseases affect marine fisheries and aquaculture economics. Ann. Rev. Mar. Sci., 7, 471–496.

Lane, D. J. (1991): 16S/23S rRNA sequencing, In “Nucleic Acids Techniques in Bacterial Systematics” (ed. by E. Stackebrandt and M. Goodfellow). John Wiley & Sons, Chichester, pp. 115–147.

Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson and D. G. Higgins (2007): Clustal W and Clustal X version 2.0. Bio-informatics, 23, 2947–2948.

Lejeusne, C., P. Chevaldonné, C. Pergent-Martini, C. F. Boudouresque and T. Pérez (2016): Climate change effects on a miniature ocean: the highly diverse, highly impacted Mediterranean Sea. Trends Ecol. Evol., 25, 250–260.

Martin-Carnahan, A. and S. W. Joseph (2005): Genus I. Aeromonas Stanier 1943, 213AL, In “Bergey’s manual of systematic bacteriology” (ed. by D. J. Brenner, N. R. Krieg and J. T. Staley) Springer, New York, pp. 557–578.

Martinez-Murcia, A. J., S. Benlloch and M. D. Collins (1992): Phylogenetic interrelationships of members of the genera Aeromonas and Plesiomonas as determined by 16S ribo-somal DNA sequencing: lack of congruence with results of DNA-DNA hybridizations. Int. J. Syst. Bacteriol., 42, 412–421.

Meyer, F. P. (1991): Aquaculture disease and health manage-ment. J. Anim. Sci., 69, 4201–4208.

Monfort, M. C. (2007): Marketing of aquacultured seabass and

seabream from the Mediterranean basin (No 82). FAO, Rome, 50 p.

Murray, A. G. and E. J. Peeler (2005): A framework for under-standing the potential for emerging diseases in aquacul-ture. Prev. Vet. Med., 67, 223–235.

Öztürk, R. Ç. and İ. Altınok (2014): Bacterial and viral fish dis-eases in Turkey. Turk. J. Fish Aquat. Sc., 14, 275–297.

Pujalte, M. J., A. Sitjà-Bobadilla, M. C. Macián, C. Belloch, P. Álvarez-Pellitero, J. Pérez-Sánchez, F. Uruburu and E. Garay (2003): Virulence and molecular typing of Vibrio harveyi strains isolated from cultured dentex, gilthead sea bream and European sea bass. Syst. Appl. Microbiol., 26, 284–292.

Raitsos, D. E., G. Beaugrand, D. Georgopoulos, A. Zenetos, A. M. Pancucci-Papadopoulou, A. Theocharis and E. Papathanassiou (2010): Global climate change amplifies the entry of tropical species into the eastern Mediterra-nean Sea. Limnol. Oceanogr., 55, 1478–1484.

Roger, F., H. Marchandin, E. Jumas-Bilak, A. Kodjo and B. Lamy (2012): Multilocus genetics to reconstruct aero-monad evolution. BMC Microbiol., 12(1), 1–23.

Saitou, N. and M. Nei (1987): The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4, 406–425.

Santos, Y., J. L. Romalde, I. Bandin, B. Magarinos, S. Nunez, J. L. Barja and A. E. Toranzo (1993): Usefulness of the API-20E system for the identification of bacterial fish patho-gens. Aquaculture, 116, 111–120.

Silver, A. C., D. Williams, J. Faucher, A. J. Horneman, J. P. Gogarten and J. Graf (2011): Complex evolutionary history of the Aeromonas veronii group revealed by host interac-tion and DNA sequence data. PloS one, 6, e16751.

Soler, L., M. A. Yáñez, M. R. Chacon, M. G. Aguilera-Arreola, V. Catalán, M. J. Figueras and A. J. Martínez-Murcia (2004): Phylogenetic analysis of the genus Aeromonas based on two housekeeping genes. Int. J. Syst. Evol. Microbiol., 54, 1511–1519.

Sreedharan, K., R. Philip and I. Singh (2013): Characterization and virulence potential of phenotypically diverse Aeromo-nas veronii isolates recovered from moribund freshwater ornamental fishes of Kerala, India. Antonie Van Leeu-wenhoek, 103, 53–67.

Stamatakis, A., P. Hoover and J. Rougemont (2008): A rapid bootstrap algorithm for the RAxML web-servers. Syst. Biol., 75, 758–771.

Tamura, K. and M. Nei (1993): Estimation of the number of nucleotide substitutions in the control region of mitochon-drial DNA in humans and chimpanzees. Mol. Biol. Evol., 10, 512–526.

Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei and S. Kumar (2011): MEGA5: Molecular evolutionary genetics analysis using Maximum Likelihood, Evolutionary Dis-tance, and Maximum Parsimony Methods. Mol. Biol. Evol., 28, 2731–2739.

Toranzo, A. E., B. Magariños and J. L. Romalde (2005): A review of the main bacterial fish diseases in mariculture systems. Aquaculture, 246, 37–61.

Ucko, M. and A. Colorni (2005): Mycobacterium marinum infec-tions in fish and humans in Israel. J. Clin. Microbiol., 43, 892–895.

Ucko, M., A. Colorni, H. Kvitt, A. Diamant, A. Zlotkin and W. R. Knibb (2002): Strain variation in Mycobacterium marinum fish isolates. Appl. Environ. Microbiol., 68, 5281–5287.

Uzun, E. and H. Ogut (2015): The isolation frequency of bacte-rial pathogens from sea bass (Dicentrarchus labrax) in the Southeastern Black Sea. Aquaculture, 437, 30–37.

Vezzulli, L., M. Previati, C. Pruzzo, A. Marchese, D. G. Bourne


and C. Cerrano (2010): Vibrio infections triggering mass mortality events in a warming Mediterranean Sea. Envi-ron. Microbiol., 12, 2007–2019.

Yanez, M. A., V. Catalán, D. Apráiz, M. J. Figueras and A. J. Martínez-Murcia (2003): Phylogenetic analysis of mem-bers of the genus Aeromonas based on gyrB gene sequences. Int. J. Syst. Evol. Microbiol., 53, 875–883.

Yardımcı, R. E. and G. Timur (2015): Isolation and identification of Tenacibaculum maritimum, the causative agent of Tenacibaculosis in farmed sea bass (Dicentrarchus

labrax) on the Aegean Sea coast of Turkey. Isr. J. Aqua-cult. Bamid., 67, 10.

Zlotkin, A., H. Hershko and A. Eldar (1998): Possible transmis-sion of Streptococcus iniae from wild fish to cultured marine fish. Appl. Environ. Microbiol., 64, 4065–4067.

Zorrilla, I., M. Chabrillón, S. Arijo, P. Díaz-Rosales, E. Martínez-Manzanares, M. C. Balebona and M. A. Moriñigo (2003): Bacteria recovered from diseased cultured gilthead sea bream (Sparus aurata L.) in southwestern Spain. Aqua-culture, 218, 11–20.

aeromonas veronii infection associated with high morbidity

Documents