aem accepts, published online ahead of print on 10...
TRANSCRIPT
1
Characterization of Biphenyl Dioxygenase Sequences and Activities Encoded by the 1
Metagenomes of Highly Polychlorobiphenyl-Contaminated Soils 2
3
4
RUNNING TITLE: Dioxygenase activities in PCB-contaminated soil 5
6
7
Christine Standfuß-Gabisch,1†, Djamila Al-Halbouni,1‡, and Bernd Hofer1,2§* 8
9
10
1 Division of Microbiology, Helmholtz-Zentrum für Infektionsforschung, Braunschweig, 11
Germany. 12
2 Department of Chemical Biology, Helmholtz-Zentrum für Infektionsforschung, 13
Braunschweig, Germany. 14
† Present address: Research Group Viral Immune Modulation, Helmholtz-Zentrum für 15
Infektionsforschung, Braunschweig, Germany. 16
‡ Present address: Institute of Biology I, RWTH Aachen University, Aachen, Germany. 17
§ Present address: Department of Chemical Biology, Helmholtz-Zentrum für 18
Infektionsforschung, Braunschweig, Germany. 19
* Corresponding author. Mailing address: Helmholtz-Zentrum für Infektionsforschung, 20
Abteilung Chemische Biologie, Inhoffenstraße 7, D-38124 Braunschweig, Germany. 21
Phone: (49-531) 61814200. Fax: (49-531) 61813499. E-mail: bernd.hofer@helmholtz-22
hzi.de. 23
24
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.07381-11 AEM Accepts, published online ahead of print on 10 February 2012
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
2
SUMMARY 25
26
Total extracted DNA of two heavily polychlorobiphenyl-contaminated soils has been 27
analysed with respect to biphenyl dioxygenase sequences and activities. This was done by 28
PCR amplification and cloning of a DNA segment encoding the active site of the enzyme. 29
The obtained translated sequences fell into three similarity clusters (I - III). Sequence 30
identities were high within, but moderate or low between clusters. Members of clusters I and 31
II showed high sequence similarities with well-known biphenyl dioxygenases. Cluster III 32
showed low (43 %) sequence identity with a biphenyl dioxygenase from Rhodococcus jostii 33
RHA1. Amplicons from the three clusters were used to reconstitute and express complete 34
biphenyl dioxygenase operons. In most cases, the resulting hybrid dioxygenases were 35
detected in cell extracts of the recombinant hosts. At least 83 % of these enzymes were 36
catalytically active. Several amino acid exchanges were identified that critically affected 37
activity. Chlorobiphenyl turnover by the enzymes containing the prototype sequences of 38
clusters I and II was characterized with 10 congeners that were major, minor or no 39
constituents of the contaminated soils. No direct correlations were observed between on-site 40
concentrations and rates of productive dioxygenations of these chlorobiphenyls. The 41
prototype enzymes displayed markedly different substrate and product ranges. The cluster II 42
dioxygenase possessed a broader substrate spectrum towards the assayed congeners, whereas 43
the cluster I enzyme was superior in the attack of ortho-chlorinated aromatic rings. These 44
results demonstrate the feasibility of the applied approach to functionally characterize 45
dioxygenase activities of soil metagenomes via amplification of incomplete genes. 46
47
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
3
INTRODUCTION 48
49
Environmental pollutions by polychlorobiphenyls (PCBs) pose a specific problem to 50
bioremediation, as they typically consist of industrial mixtures of dozens of different 51
congeners. Even if broad in substrate range, no single pathway is able to metabolize all PCBs 52
in such mixtures. Thus, the recruitment of novel biocatalysts that may support their removal 53
is of considerable interest. A key enzyme in the aerobic catabolism of PCBs is biphenyl 54
dioxygenase (BphA), which carries out the initial attack of the inert aromatic nucleus. It 55
belongs to class II of aryl-hydroxylating dioxygenases (ARHDOs) that typically hydroxylate 56
substituted benzenes like toluenes and biphenyls (7). This enzyme represents a catabolic 57
bottleneck, as its substrate range is typically narrower than that of subsequent pathway 58
enzymes (9, 13, 43). Moreover, its regiospecificity is a crucial parameter, as it co-determines 59
whether the initial dioxygenation products become dead-end metabolites or can be further 60
transformed. 61
A number of enzyme engineering projects have been carried out to obtain BphAs with 62
altered or broadened substrate ranges (6, 14, 19, 43). Another approach is the detection and 63
isolation of naturally occurring, but so far inaccessible enzymatic activities by metagenomic 64
methods (24, 31). Such techniques seem promising to discover novel biocatalysts, as only a 65
tiny fraction of existing microorganisms is apparently culturable under laboratory conditions 66
(3). Metagenomic approaches have been applied to characterize the diversity of dioxygenase 67
sequences at a number of PCB-polluted sites (1, 10, 17). Sequences with high as well as with 68
low similarities to those known from culturable organisms have been detected, depending on 69
the examined site and probably also on the PCR primers used. So far, however, these 70
investigations were limited to the determination of (incomplete) gene sequences. Therefore, it 71
remained unclear in how far detected sequences belonged to active enzymes. Moreover, it 72
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
4
was impossible to deduce detailed substrate and product specificities from the translated 73
DNA sequences. 74
Previously we developed a sequence-based strategy that permits the characterization of 75
enzymatic properties of BphA and other class II ARHDO activities, whose genes are only 76
fragmentarily amplified (9, 18). It should be applicable to DNA from any source, including 77
metagenomes. In this approach, a "donor" segment is amplified which encodes the catalytic 78
center. This is fused with sequences of a "recipient" bphA gene cluster that is efficiently 79
expressed in an appropriate host. It was confirmed that the substrate ranges of the resulting 80
hybrid dioxygenases are dependent on the nature of the donor segment (9, 18). 81
Here we report the use of this system for a first characterization of dioxygenase activities 82
encoded by the metagenomes of two soil samples from a heavily contaminated site near the 83
city of Wittenberg, Germany. This site has previously been characterized with respect to PCB 84
profile and bacterial community structure (25, 26). 85
86
87
MATERIALS AND METHODS 88
89
Chemicals. Chlorobiphenyl (CB) congeners (99% purity) were obtained from Lancaster 90
Synthesis (White Lund, Morecombe, England), Promochem (Wesel, Germany), or Restek 91
(Sulzbach, Germany). 92
Isolation of DNA from soil samples. Soil sampling and storage have previously been 93
described (25, 26). DNA was isolated using the "FastDNA SPIN Kit for Soil" from Qbiogene 94
BIO 101 (MP Biomedicals, Heidelberg, Germany) according to the protocol of the supplier. 95
Briefly, up to 500 mg of soil were mixed with 978 µl of sodium phosphate buffer and 122 µl 96
of MT buffer, and cells were disrupted for 30 s in a Qbiogene "FastPrep" Instrument (MP 97
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
5
Biomedicals, Heidelberg, Germany) at a rate of 5.5 m/s. After centrifugation (12000 g, 30 s), 98
the supernatant was mixed with 250µl of PPS (Protein Precipitation Solution). Precipitated 99
proteins were removed by centrifugation (12000 g, 5 min). The supernatant was mixed with 1 100
ml of Binding Matrix Suspension. After settling of the matrix, 500 µl of the supernatant were 101
discarded, and the re-suspended matrix was placed in two subsequent batches onto a 102
"SpinFilter" and centrifuged (12000 g, 1 min). After addition of 500 µl of SEWS-M 103
(salt/ethanol wash solution) to the filter and centrifugation (12000 g, 1 min), it was air-dried, 104
and the DNA was eluted with 50 µl of DES (ultra-pure water). After another centrifugation 105
(12000 g, 1 min) of the filter, the eluate was collected and supplemented with 0.1 vol. of 10 106
mM Tris-HCl, pH 8, and stored at -20°C. 107
PCR with DNA from soil samples. Reactions were carried out in PCR buffer containing 108
1.5 mM MgCl2, (QIAGEN, Hilden, Germany) with about 50 ng of template DNA, 0.5 µM 109
primers HDO2AF and HDO2AR (18), 0.25 mM dNTPs, 0.2 mg/ml BSA, 1.6 µl of DMSO 110
and 1 unit of recombinant Taq DNA polymerase (Fermentas, St. Leon-Rot, Germany) in a 111
total volume of 20 µl. The thermocycler program was as follows: 1 cycle of 30 s at 94 °C; 30 112
cycles of 30 s at 60 °C, followed by 90 s at 72 °C with an increment of 3 s per cycle; 1 cycle 113
of 600 s at 72 °C. 114
Molecular cloning techniques. Restriction, ligation, dephosphorylation, agarose gel 115
electrophoresis and bacterial transformations were caried out following standard protocols 116
(30). 117
Plasmid constructions. pAIA6099 is a derivative of pAIA6100 (18) that harbors a 118
deletion of 12 codons within the MluI/AflII fragment of bphA1, which inactivates the gene. It 119
was constructed as follows: Two segments of bphA1-LB400 were PCR-amplified, using 120
pAIA111 (18) as template and BPH1917 (CGCTCCAGGCACGCGTGGC, MluI+ 121
(underlined)) and BPH-2420MUT 122
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
6
(GGGTGCCAGATCCGGAAGATCGTCATATGCTGGCCGACC, NdeI+ (underlined)) or 123
BPH2454MUT (ATGACGATCTTCCGGATCTGGCACCCTCGAGGTCCCAATG, XhoI+ 124
(underlined)) and BPH-2711 (AATCAGGGTGACCGGTCTGC, AgeI+ (underlined)), 125
respectively, as primers. Both products were fused in an overlap-extension PCR with 126
BPH1917 and BPH-2711 as primers. The amplicon was cleaved with MluI and AgeI and was 127
used to replace the corresponding fragment in pAIA50 (43). This introduced the deletion as 128
well as NdeI and XhoI sites and yielded pAIA500. A part of its inactivated bphA1 gene was 129
PCR-amplified with primers HDO2AF and HDO2AR (18). The latter introduced an AflII site. 130
The product was cleaved with MluI and AflII and used to replace the MluI/AflII fragment of 131
pAIA6100. 132
Cloning of PCR products in TOPO vectors. Taq-DNA-polymerase-generated PCR 133
products were inserted into the T-overhang topoisomerase vector pCR-XL-TOPO 134
(Invitrogen, Karlsruhe, Germany) according to the protocol of the supplier. E. coli strain 135
Top10 (Invitrogen, Karlsruhe, Germany) was transformed with the ligation reactions. 136
Plasmid preparations from transformants were analysed by restriction and agarose gel 137
electrophoresis. 138
Subcloning of PCR products in pAIA6099. The MluI/AflII fragments of the inserts of 139
the TOPO clones were excised with these enzymes and were ligated into MluI/AflII-cleaved 140
and dephosphorylated pAIA6099. E. coli strains Top10 or XL10-Gold (Stratagene, 141
Amsterdam, The Netherlands) were transformed with the ligation reactions. Plasmid 142
preparations from transformants were analysed by restriction and agarose gel electrophoresis. 143
Correct plasmids were used to transform E. coli BL21[DE3](pLysS). The resulting clones 144
were analysed for correct plasmid size. 145
Preparation of resting cells. Preparation of resting cells was carried out as previously 146
described (33) with some modifications. Cells of E. coli BL21(DE3)[pLysS], harboring the 147
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
7
respective plasmid, were grown in LB medium at 30 °C. At an optical density at 600 nm 148
(OD600) of about 1.0, IPTG was added to 0.4 mM, and the incubation was continued for 149
another 60 min. Cells were harvested, washed with 1 vol. of 50 mM sodium phosphate buffer 150
(pH 7.5) and resuspended in the same buffer to give the concentrations specified below. 151
Determination of specific ARHDO activity with biphenyl. Biphenyl was placed into an 152
Erlenmeyer flask at a final nominal concentration of 125 µM, and the solvent was 153
evaporated. Five ml of resting cells (see above) were added to a final OD600 of 1, and the 154
flask was shaken at room temp with 120 RPM. At appropriate times, samples of 640 µl were 155
withdrawn, mixed with 160 µl of 5 N NaOH, and centrifuged for 3 min at 12000 g. UV/Vis 156
sprectra of the supernatants were recorded, using the resting cell medium as baseline. The 157
absorption at 600 nm was set to zero. Formation rates of extradiol- or meta-cleavage products 158
(MCPs), expressed in mAbs/min, were determined from the linear parts of the resulting plots. 159
Concentrations of wild-type (WT) and variant BphA1 subunits were determined by 160
evaluation of digitalized images of SDS gels of cell extracts stained with Sypro-Ruby (5), 161
using the AIDA 4.15 software (raytest, Straubenhardt, Germany) and bovine serum albumin 162
as standard. The extracts were prepared with the Relay 96 Protein Screen (Invitrogen) 163
according to the manufacturer’s instructions. 164
Determination of CB catabolism by prototype hybrid dioxygenases. Resting cell 165
suspensions containing 0.5 % (w/v) of glucose and 2 OD600 of E. coli BL21[DE3](pLysS) 166
harbouring pAIA6B15 or pAIA6C18 were shaken in Erlenmeyer flasks at 30 °C with 167
nominal concentrations of single CBs of 125 µM. At various times, aliquots were withdrawn 168
and centrifuged for 5 min at 12000 g. UV/Vis sprectra of the supernatants were recorded, and 169
rates of MCP formation were determined as described above. 170
Sequence determination and analysis. DNA sequencing was carried out as previously 171
described (4). DNA and protein sequence alignments and calculations of dendrograms were 172
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
8
performed with Clustal W2 (15, 21) at the EBI website 173
(http://www.ebi.ac.uk/Tools/msa/clustalw2/). Dendrograms were displayed with the iTOL 174
tool (22, 23) at the same website (http://itol.embl.de/). Sequence database searches were done 175
with the blastn and blastp programs (2) at the NCBI website 176
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). 177
Database accession numbers. Newly determined sequences have been deposited in the 178
GenBank/EMBL/DDBJ database under accession numbers FR877587 - FR877632 and 179
HE577113 - HE577117. 180
181
182
RESULTS AND DISCUSSION 183
184
Amplification of ARHDO gene segments from metagenomic DNA. DNA was isolated 185
from an uncontaminated and from two increasingly PCB-contaminated soil samples (A, B, C) 186
from a moorland in the vicinity of the city of Wittenberg, Germany (25). The polluted 187
samples contained average PCB concentrations of approximately 1 g/kg or 10 g/kg, 188
respectively. Using this DNA as potential template, PCR amplifications targeting segments 189
which encode the substrate-range-determining cores of the alpha subunits of class II 190
ARHDOs, here collectively termed BphAs, were attempted, using the previously established 191
consensus primers HDO2AF and HDO2AR (18), which amplify fragments of about 720 bp. 192
It is clear that such an approach will probably not detect PCB-attacking dioxygenase 193
sequences not belonging to class II and that it can only be estimated which fraction of all 194
available class II sequences will be amplified. It has been pointed out that theoretical 195
considerations as well as experimental results suggest that the used oligonucleotides are able 196
to amplify more than 80 % of the cores of known sequences encoding alpha subunits of class 197
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
9
II ARHDOs (18). 198
For high efficiency and restriction-independent cloning, the amplicons were inserted into 199
a T-overhang TOPO cloning vector. With soil A only trace amounts of PCR products were 200
observed, which were not further processed. The heavily contaminated soils B and C, 201
however, yielded significant amounts of amplicons of the expected length, suggesting that 202
bphA sequences are enriched and thus are likely to be functionally relevant in these soils. 203
Sequences of the alpha subunit core gene segments. A total of 51 TOPO clones, 26 204
from soil B and 25 from soil C, were sequenced. Translation of the sequences showed that 205
one contained a frameshift and four contained nonsense mutations. DNA and protein 206
sequence alignments revealed that the sequences formed three similarity clusters, named I to 207
III (Fig. 1A). They comprised 37, 12 or 2 sequences, respectively. Nucleotide (NT) and 208
amino acid (AA) sequence identities between these clusters were 85 - 88 %, 38 - 42 % or 37 - 209
38 %, respectively (Table 1). Within a given cluster, NT and AA sequences were 97 - 100 % 210
identical (Table 1). It can, of course, not be ruled out that minor sequence differences were 211
due to PCR errors. However, the detection of similar micro-heterogeneities and of 212
comparable frequencies of nonsense and frameshift mutations in metagenomic studies not 213
involving PCR, but direct cloning of environmental DNA (36, 38), suggests that all or a 214
major fraction of the apparent sequence diversity was of natural origin. Unequivocal 215
consensus sequences could be determined for clusters I and II, as the bias towards one 216
specific NT or AA, respectively, was always very strong. For cluster I, the consensus 217
sequence itself was found in 7 of 37 clones at the NT level and in 10 of 37 clones at the AA 218
level. For cluster II, the respective values were 1 and 3 for a total of 12 clones. Clones WB15 219
of cluster I and WC18 of cluster II, which contained the consensus sequences, are in the 220
following referred to as prototypes. Cluster I sequences were predominant in both soils, even 221
more so in soil C (Table 2). In contrast, the percentage of cluster II sequences was higher in 222
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
10
soil B. Cluster III sequences were only found in soil C. This might indicate that enzymes or 223
organisms, respectively (see below), belonging to clusters I and III can more readily cope 224
with the more heavily contaminated site. 225
A database search revealed that the sequence most closely related to the translated 226
sequences of cluster I was that of the BphA alpha subunit (BphA1) of strain LB400, showing 227
96 % AA sequence identity with the WB15 prototype (Table 1). Of dioxygenases 228
experimentally shown to possess catalytic activity, BphA1 of Pseudomonas 229
pseudoalcaligenes KF707, showed the highest degree of AA sequence identity (93 %) with 230
the sequences of cluster II (Table 1). Interestingly, the NT sequence of the WC18 prototype 231
was 100 % identical with the sequences of putative bphA1 gene fragments from two strains 232
isolated from the Wittenberg site, Burkholderia sp. WBF3 and WBF4 (Table 1). The two 233
sequences of cluster III were most similar (56 %) to a putative ring-hydroxylating 234
dioxygenase alpha subunit from Burkholderia ambifaria IOP40-10 (Table 1). Of 235
dioxygenases experimentally shown to be catalytically active, BphA1 of Rhodococcus jostii 236
RHA1 possessed the highest (43 %) AA sequence identity (Table 1). Thus, the enzymes of 237
clusters I and II belong to known ARHDO subfamilies, whereas the dioxygenases of cluster 238
III appear to be part of a novel subfamily. 239
A number of previous studies also characterized PCB-polluted soils by using PCRs that 240
target parts of the ARHDO class II alpha subunit gene. Capodicasa et al. (10) investigated 241
bioreactors containing soils contaminated with 0.89 g PCB/kg. They found highly similar 242
sequences that, in translated form, showed 92 - 99 % AA identity to known sequences, 243
mostly from cultivated organisms like strains LB400, KF707 or Pseudomonas sp. Cam-1. 244
Aguirrre de Cárcer et al. (1) examined soil with a PCB contamination of 0.18 g per kg of dry 245
material. They discovered large sequence diversities before as well as after introduction of 246
willow trees for rhizomediation. Sequencing of 28 clones revealed that the translated 247
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
11
sequences all showed similarities to characterized ARHDO sequences. However, they 248
showed great heterogeneity among each other, displaying between 10 % and 100 % AA 249
sequence identity. Iwai et al. (17) investigated PCB-contaminated soil with the comparatively 250
low concentration of 0.015 g/kg. They directly subjected PCR products to pyro-sequencing, 251
obtaining about 2600 sequences of 175 or 200 NT, depending on the primer used. In their 252
analysis, the authors obtained 40 sequence clusters that contained newly determined as well 253
as database sequences, and 25 clusters that contained only novel sequences, indicating a wide 254
variety of primary structures. In summary, these studies, including the present one, identified 255
abundances of either highly similar or of fairly diverse alpha subunit segment sequences. 256
Diversity appears to decrease with increasing PCB contaminations of the soil samples. 257
Witzig et al. (40) investigated the sequence diversity of alpha subunit segments of 258
diterpenoid dioxygenase (DitA), which also belongs to the ARHDO family. This work is of 259
interest here, because it also examined PCB-contaminated soil from the Wittenberg site. The 260
authors determined 77 sequences of PCR products encoding the very same region of the 261
alpha subunit as our amplicons. Their template DNAs originated from bacterial isolates as 262
well as from the metagenome. The latter sequences were obtained either after cloning or after 263
electrophoretic separation of the amplicons. Their results resemble ours in several respects. 264
For DitA1 as well as for BphA1, the large majority of sequences fall into two similarity 265
clusters, I and II in Fig. 1. The relative sizes of the clusters are comparable. While inter-266
cluster distances differ, intra-cluster sequence identities are similarly high at 96 % or above. 267
The assumption that both minor clusters represent the same group of organisms is 268
corroborated by the finding that the bphA1 sequences of the Wittenberg isolates WBF3 and 269
WBF4 are completely identical with those of clones WB25, WB62 and WC18, belonging to 270
BphA1 cluster II, and that the ditA1 sequences of the latter strains (100 % identity; accession 271
nos. DQ789336 and DQ789337) belong to DitA1 cluster II. As mentioned above, our PCR 272
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
12
amplifications suggest an enrichment of bphA1 genes in the polluted soils. Thus it appears 273
likely that the ability to utilize certain CBs selected for certain bph operons, and, as long as 274
horizontal gene transfer plays no major role, thereby for certain taxa, and that this selection is 275
also reflected by the ditA1 genes. This interpretation agrees with results of Witzig et al. (40) 276
for isolates from the Wittenberg site, which suggest that the observed clustering of ditA1 277
sequences is paralleled by taxonomic clustering, as determined by gyrB sequencing. The 278
widespread occurrence of dit genes in CB and aromatic hydrocarbon degraders in general 279
may originate from the utilization of ubiquitous resin acids prior to introduction of the 280
pollutants (40). 281
Reconstitution of complete BphA gene clusters and determination of gene 282
expression. In order to assess whether or not the environmental DNA fragments harbor the 283
potential to encode parts of active dioxygenases and to establish sequence-function and 284
sequence-specificity correlations, 21 of the different alpha subunit core sequences were used 285
to reconstitute complete bphA gene clusters. This was done by supplementing them with the 286
missing flanking sequences of the alpha subunit gene as well as with the other three genes 287
required for BphA systems. These encode the beta subunit, a ferredoxin, and a ferredoxin 288
reductase. In principle, this was done as previously described, by exchanging the respective 289
core segment of the cloned bphA-LB400 gene cluster against an amplified core fragment 290
(18). The procedure was modified in that a newly constructed plasmid, pAIA6099, harboring 291
an inactive bphA1 core segment that lacks 36 bp (for details see MATERIALS AND 292
METHODS) was used for the replacement. This recipient plasmid also harbored genes 293
bphBC from strain LB400, encoding the two subsequent catabolic pathway enzymes. Their 294
presence enables verification if the products of the initial dioxygenation are further 295
metabolized. Many of the resulting MCPs possess characteristic electronic spectra which not 296
only facilitate assessment of dioxygenase activity, but also permit to some extent assignments 297
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
13
of the regiospecificity of the initial dioxygenation (see below). 298
The primary transformants of this reconstitutive subcloning were checked for genetic 299
correctness, and the expression strain E. coli BL21[DE3](pLysS) was transformed by the 300
respective plasmids. The resulting clones, 14 of them belonging to cluster I, six to cluster II 301
and one to cluster III, were used for further analysis. 302
Cellular concentrations of dissolved alpha and beta subunits were determined by 303
quantitation of SDS-PAGE band intensities. In most, but not all cases, the concentrations of 304
hybrid alpha subunits were similar to that of the parental BphA1-LB400 (data not shown). 305
The WT beta subunits were generally found in some excess, compared to the concentrations 306
of the alpha subunits. Three hybrid subunits were not detected. In accordance with this 307
observation, no catalytic activity was observed (below). 308
Catalytic activity of the hybrid enzymes and its correlation with AA substitutions. 309
Catalytic activity of the hybrid enzymes was quantitated with resting cells and biphenyl as 310
substrate (Table 3). It has been shown with this and a wide range of other substrates that the 311
activities of BphB and BphC in these strains are not rate-limiting (41, 43; C. S.-G. and B. H., 312
unpublished results). Of 14 hybrid BphAs belonging to cluster I, 10 were active, 3 were 313
inactive, and in one case no alpha subunit was found. Of 6 BphAs of cluster II, 5 were active; 314
again in one case a large subunit was not detected. Also the alpha subunit of cluster III hybrid 315
WC27 was not observed. In accordance with this, no activity was detected, neither with 316
biphenyl, nor with a range of other aromatic compounds, such as toluene, isopentylbenzene, 317
diphenylmethane and dibenzofuran. A possible reason for the absence of some hybrid 318
subunits among the dissolved proteins is an incompatibility between recipient and donor 319
protein segments with respect to proper folding, leading to rapid proteolysis and/or 320
precipitation of the hybrid. Of all 18 detected hybrids, 83 % were definitely active, whereas 7 321
% showed no activity under assay conditions. As hybrid formation, even with core segments 322
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
14
from active ARHDOs, will not in all cases yield active enzymes, the percentage of "active" 323
donor segments may actually be higher. 324
When AA deviations relative to the prototypes resulted in significant changes of catalytic 325
activity, decreases rather than increases were observed, a behaviour expected for the 326
introduction of random AA substitutions into the prototype sequence. In the following, AA 327
deviations that strongly affected activity (Table 3) are discussed with respect to structure-328
function relationships. In cluster I, this was the case for the apparently inactive hybrids 329
WB70, WC10 and WC65 as well as for hybrid WC23, which displayed a 40-fold decreased 330
activity. 331
BphA-WB70h (h denotes hybrid) harbors only a single substitution relative to its WB15 332
prototype, Ser274Pro (AA numbering from BphA1-LB400). In order to examine which other 333
residues are tolerated at this position in related ARHDOs, we neglected sequence data 334
without a positive correlation to enzymatic activity and restricted our sequence alignment to 335
23 alpha subunit sequences of active class II ARHDOs. This showed that also Thr and Ala 336
occur at this position. In the crystal structure of the closely related LB400 enzyme (20; PDB 337
ID 2XRX), Ser274 has no direct contact to the biphenyl substrate. Its replacements by Ala or 338
Thr do not appear to lead to steric clashes. A Pro residue, however, would shift Gly273. This 339
displacement could, via Met324, well be transmitted to His323, resulting in steric 340
interference with the substrate. 341
Similarly, the two replacements in hybrid WC10, Gln322Arg, and Ala354Thr should not 342
directly affect interactions with the substrate. Ser354 as well as Pro354, but not Thr354 are 343
found in our compilation of active enzymes. In the LB400 structure, neither of these 3 344
changes appears to cause steric interference. The only other residue found in position 322 is 345
Glu, which is sterically similar to Gln. Although BphA-LB400 seems to be able to 346
accomodate Glu as well as Arg at this position, it seems likely that the Gln322Arg exchange 347
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
15
is mainly responsible for the inactivity of WC10, as it probably affects the positions of its 348
direct main chain neighbors, Gly321 and His323, which, according to the LB400 structure, 349
make van der Waals contacts with the substrate. 350
BphA-WB65h also harbors two changes, Gly271Arg, and Tyr370His. In active enzymes 351
Phe, but no His occurs at position 370. Gly 271, however, is invariant. The crystal structure 352
of the LB400 dioxygenase clearly shows that both residues are remote from the substrate-353
binding site and that His370, but not the large Arg271 side chain can be accomodated without 354
major rearrangements of the protein structure. This suggests that probably the latter exchange 355
triggers structural changes that result in inactivity. 356
Hybrid WC23 contains two replacements in close proximity, Ile375Leu and Asn377Ser. 357
Leu375 and Thr377, but no Ser377, are found in active enzymes. The smaller Ser would 358
generate a cavity within the fold, unless this is prevented by shifts of Ser itself and of 359
adjacent residues. This may well affect the active site, for example the substrate-lining 360
Phe378, which has been shown to be critical for dioxygenation (42). 361
Only one of the six cluster II hybrids, WB14, showed a remarkable (about 35-fold) 362
reduction in activity. It contains only a single change, Val352Met. The LB400 structure 363
indicates that this Val is well remote from the active site and that a Met residue could be 364
accomodated at position 352. Thus a mechanism that triggers the observed drastic decrease in 365
activity is not obvious. A crucial role of this Val residue is in agreement with its invariance in 366
the compilation of active enzymes. We note, however, that changes of other invariant 367
residues such as Lys291, His343, Val358 and Asp361 did not lead to drastic losses of 368
activity. 369
Assay of BphA prototypes for productive dioxygenation of selected CBs. The strains 370
producing the prototype enzymes BphA-WB15h and -WC18h were assayed for 371
dioxygenation of 10 CBs that were major, minor or no constituents of the PCB mixture found 372
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
16
at the Wittenberg site. It had previously been shown that the BphB and BphC enzymes, 373
which were also synthesized by the recombinant strains, were able to convert ortho,meta-374
dioxygenated products of all of these CBs into MCPs (33, 34, 43). Initial dioxygenations that 375
formed this type of further degradable catabolites, were termed “productive”. The finding 376
that BphC of strain LB400 is unable to convert meta,para-dihydroxylated biphenyl (11a) 377
indicates that productive dioxygenations in the pathway examined here are directed to ortho 378
and meta carbons. The 10 congeners used were di- or trisubstituted and possessed no 379
unchlorinated ring. They contained all three types of monochlorinated rings. Six of them 380
(2,2'-, 2,4’-, 4,4’, 3,4,2’-, 2,4,3’- and 3,4,4’-CB) were present at the contaminated site in 381
different amounts (Table 4), while the other four (3,3’-, 3,5,2’-, 2,3,3’- and 3,5,4’-CB) were 382
not detected (25). 383
An overview on the results is shown in Table 4, where congeners are listed according to 384
the type of their monochlorinated ring. With a single exception (below), productive 385
dioxygenation was always directed towards the monochlorinated ring. The position of the 386
chlorine at this ring largely determined the rate of dioxygenation. There was no obvious 387
correlation with the aqueous solubilities of the congeners (Table 4). 388
Some simple rules can be deduced from experimental data for correlations between 389
absorption maxima and substituent patterns of chlorinated MCPs (Table 5), which allow 390
some assignments of the sites of the initial dioxygenations. (A) Substitutions at carbons 5, 4 391
or ortho (for numbering see footnote of Table 5) shift absorption maxima from values above 392
430 nm to increasingly lower values. (B) In cases of multiple substitutions, these effects 393
dominate in the order ortho > 4 > 5. Values based on these rules are given for the different 394
MCPs in the "Expected" column of Table 5. In the subsequent two columns, they are 395
compared with other experimental data. As can be seen, the observed values agree in many, 396
but not all cases. 397
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
17
CBs with an ortho-monochlorinated ring were most readily turned over by both enzymes 398
(Table 4). There was a fundamental difference, however, regarding the site of attack, as 399
reflected (with the exception of 2,2'-CB) by the different absorption maxima of the resulting 400
MCPs (Table 5). These indicate, as shown in Fig. 2, that BphA-WC18h dioxygenated 2,4'-, 401
3,4,2'- and 3,5,2'-CB at unchlorinated carbons (positions 5,6 or 5',6', respectively), whereas 402
BphA-WB15h attacked them at the semichlorinated side of the ring (positions 2,3 or 2',3', 403
respectively). It appears very likely that the same scheme also applies to 2,2'-CB, where the 404
resulting MCPs are neither expected nor found to possess a significant difference in their 405
absorption maxima. Generally, the rates of attack of the ortho-monochlorinated ring were 406
higher with BphA-WB15h than with BphA-WC18h. The two of these four CBs that were 407
found in higher concentrations at the Wittenberg site (2,4'- and 3,4,2'-CB) were the best 408
substrates for the latter enzyme. Such a correlation was less clear for BphA-WB15h, as also 409
2,2'-CB was an excellent substrate for this dioxygenase. 410
CBs with a meta-monochlorinated ring were much "slower" substrates with both enzymes 411
(Table 4). Independent of the substitution pattern of the non-oxidized ring, BphA-WC18h 412
turned all three congeners over at similar rates. 3,3'-CB was dioxygenated at the 413
unchlorinated side (Table 5). In analogy with this, we assigned the same regiospecificity to 414
the dioxygenations of 2,3,3'- and 2,4,3'-CB (Fig. 2), which also agrees with the finding that 415
an attack involving meta-dechlorination has very rarely been observed (37). In contrast to 416
BphA-WC18h, the WB15 enzyme attacked the meta-monochlorinated ring only in 2,3,3'-CB. 417
It also slowly dioxygenated 2,4,3'-CB; here, however, as deduced from Table 5, the attack 418
was not directed against the monochlorinated ring, but against carbons 2 and 3 (Fig. 2), in 419
agreement with the described preference of this enzyme for chlorinated ortho carbons. Only 420
BphA-WB15h showed a somewhat faster productive dioxygenation of 2,4,3'-CB, which is 421
the only of these three congeners that was found at the contaminated site. 422
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
18
For CBs possessing a para-chlorinated ring, almost no turnover was observed with both 423
enzymes (Table 4). Only BphA-WC18h slowly dioxygenated of 4,4'-CB, which, like 3,4,4'-424
CB, belongs to the CBs that are predominant at the Wittenberg site. 425
In our assays, BphA-WC18h showed a broader CB range than BphA-WB15h. On the 426
other hand, the latter enzyme clearly was a better catalyst for the dioxygenation of CBs with 427
ortho-chlorinated rings. A correlation between the concentrations of the selected CBs at the 428
polluted site and their rates of productive dioxygenation by the two prototype enzymes was 429
not generally apparent. The expectation of such a correlation may well be based on an 430
oversimplified view. Rapid dioxygenation of a given CB must not necessarily result in an 431
evolutionary advantage. It may indeed result in a disadvantage, if accumulating catabolites 432
exert toxic effects (8, 11, 12, 16, 27, 29). Moreover, the evolution of catalytic activity in the 433
presence of substrate mixtures will necessarily lead to compromises, so that any given 434
enzyme will only be able to efficiently transform a fraction of substrates. Thus evolution 435
towards the efficient utilization of a substrate other than applied in our assays may obscure 436
correlations with the congeners used here. 437
Concluding remarks. The present work demonstrated the feasibility of the applied 438
approach in not only retrieving ARHDO sequence information from metagenomic DNA, but 439
also experimental data on enzymatic properties such as activity, substrate and product ranges. 440
In this context, it will be of interest to investigate in detail in how far the sequence diversity 441
within a given sequence cluster affects the substrate spectrum. Moreover, it appears 442
intriguing to obtain active enzymes from the donor segments of similarity cluster III and, 443
generally speaking, of other classes of ARHDOs by constructing alternative recipient gene 444
clusters, based on genes from strains such as RHA1, PAH degraders and others. 445
446
447
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
REFERENCES 448
449
1. Aguirre de Cárcer, D., M. Martín, U. Karlson, and R. Rivilla. 2007. Changes in 450
bacterial populations and in biphenyl dioxygenase gene diversity in a polychlorinated 451
biphenyl-polluted soil after introduction of willow trees for rhizoremediation. Appl. 452
Environ. Microbiol. 73:6224-6232. 453
2. Altschul, S.F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic 454
local alignment search tool. J. Mol. Biol. 215:403-410. 455
3. Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identification and 456
in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 457
59:143-169. 458
4. Bartels, F., S. Backhaus, E. R. B. Moore, K. N. Timmis, and B. Hofer. 1999. 459
Occurrence and expression of glutathione S-transferase-encoding bphK genes in 460
Burkholderia sp. strain LB400 and other biphenyl-utilizing bacteria. Microbiology 461
145:2821-2834. 462
5. Berggren, K., T. H. Steinberg, W. M. Lauber, J. A. Carroll, M. F. Lopez, E. 463
Chernokalskaya, L. Zieske, Z. Diwu, R. P. Haugland, and W. F. Patton. 1999. A 464
luminescent ruthenium complex for ultrasensitive detection of proteins immobilized on 465
membrane supports. Anal. Biochem. 276:129-143. 466
6. Brühlmann, F., and W. Chen. 1999. Tuning biphenyl dioxygenase for extended 467
substrate specificity. Biotechnol. Bioeng. 63:544-551. 468
7. Butler, C. S., and J. R. Mason. 1997. Structure-function analysis of the bacterial 469
aromatic ring-hydroxylating dioxygenases. Adv. Microb. Physiol. 38:47-84. 470
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
20
8. Cámara, B., C. Herrera, M. González, E. Couve, B. Hofer, and M. Seeger. 2004. 471
From PCBs to highly toxic metabolites by the biphenyl pathway. Environ. Microbiol. 472
6:842-850. 473
9. Cámara, B., M. Seeger, M. González, C. Standfuß-Gabisch, S. Kahl, and B. Hofer. 474
2007. Generation by a widely applicable approach of a hybrid dioxygenase showing 475
improved oxidation of polychlorobiphenyls. Appl. Environ. Microbiol. 73:2682-2689. 476
10. Capodicasa, S., S. Fedi, M. Carnevali, L. Caporali, C. Viti, F. Fava, and D. 477
Zannoni. 2009. Terminal-restriction fragment length polymorphism analysis of 478
biphenyl dioxygenase genes from a polychlorinated biphenyl-polluted soil. Res. 479
Microbiol. 160:742-750. 480
11. Dai, S., F. H. Vaillancourt, H. Maaroufi, N. M. Drouin, D. B. Neau, V. Snieckus, J. 481
T. Bolin, and L. D. Eltis. 2002. Identification and analysis of a bottleneck in PCB 482
biodegradation. Nature Struct. Biol. 9:934-939. 483
11a. Eltis, L. D., B. Hofmann, H.-J. Hecht, H. Lünsdorf, and K. N. Timmis. 1993. 484
Purification and crystallization of 2,3-dihydroxybiphenyl 1,2-dioxygenase. J. Biol. 485
Chem. 268:2727–2732. 486
12. Fava, F. 1996. Aroclor 1221 aerobic dechlorination by a bacterial co-culture: Role of 487
chlorobenzoic acid degrading bacteria in the process. Chemosphere 32:1477-1483. 488
13. Furukawa, K., J. Hirose, A. Suyama, T. Zaiki, and S. J. Hayashida. 1993. Gene 489
components responsible for discrete substrate specificity in the metabolism of biphenyl 490
(bph operon) and toluene (tod operon). J. Bacteriol. 175:5224-5232. 491
14. Furukawa, K., H. Suenaga, and M. Goto. 2004. Biphenyl dioxygenases: functional 492
versatilities and directed evolution. J. Bacteriol. 186:5189-5196. 493
15. Goujon, M., H. McWilliam, W. Li, F. Valentin, S. Squizzato, J. Paern, and R. 494
Lopez. 2010. A new bioinformatics analysis tools framework at EMBL-EBI. Nucleic 495
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
21
Acids Res. 38(Suppl. 2):W695-W699. 496
16. Havel, J., and W. Reineke. 1992. Degradation of Aroclor 1221 and survival of strains 497
in soil microcosms. Appl. Microbiol. Biotechnol. 38:129-134. 498
17. Iwai, S., B. Chai, W. J. Sul, J. R. Cole, S. A. Hashsham, and J. M. Tiedje. 2010. 499
Gene-targeted-metagenomics reveals extensive diversity of aromatic dioxygenase 500
genes in the environment. ISME J. 4:279-285. 501
18. Kahl, S., and B. Hofer. 2003. A genetic system for the rapid isolation of aromatic-502
ring-hydroxylating dioxygenase activities. Microbiology 149:1475-1481. 503
19. Kumamaru, T., H. Suenaga, M. Mitsuoka, T. Watanabe, and K. Furukawa. 1998. 504
Enhanced degradation of polychlorinated biphenyls by directed evolution of biphenyl 505
dioxygenase. Nat. Biotechnol. 16:663-666. 506
20. Kumar, P., M. Mohammadi, J.-F. Viger, D. Barriault, L. Gomez-Gil, L. D. Eltis, J. 507
T. Bolin, and M. Sylvestre. 2011. Structural insight into the expanded PCB-degrading 508
abilities of a biphenyl dioxygenase obtained by directed evolution. J. Mol. Biol. 509
405:531-547. 510
21. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. 511
McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. 512
Gibson and D. G. Higgins. 2007. ClustalW and ClustalX version 2. Bioinformatics 513
2007 23:2947-2948. 514
22. Letunic, I., and P. Bork. 2006. Interactive Tree Of Life (iTOL): An online tool for 515
phylogenetic tree display and annotation. Bioinformatics 23:127-128. 516
23. Letunic, I., and P. Bork. 2011. Interactive Tree Of Life v2: Online annotation and 517
display of phylogenetic trees made easy. Nucleic Acids Res. 39(Suppl. 2):W475-518
W478. 519
24. Lorenz, P., K. Liebeton, F. Niehaus, and J. Eck. 2002. Screening for novel enzymes 520
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
22
for biocatalytic processes: accessing the metagenome as a resource of novel functional 521
sequence space. Curr. Opin. Biotechnol. 13:572-577. 522
25. Nogales, B., E. R. B. Moore, W.-R. Abraham, and K. N. Timmis. 1999. 523
Identification of the metabolically active members of a bacterial community in a 524
polychlorinated biphenyl-polluted moorland soil. Environ. Microbiol. 1:199-212. 525
26. Nogales, B., E. R. B. Moore, E. Llobet-Brossa, R. Rossello-Mora, R. Amann, and 526
K. N. Timmis. 2001. Combined Use of 16S Ribosomal DNA and 16S rRNA to Study 527
the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil. Appl. Environ. 528
Microbiol. 67:1874-1884. 529
27. Parnell, J. J., J. Park, V. Denef, T. Tsoi, S. Hashsham, J. Quensen III, and J. M. 530
Tiedje. 2006. Coping with polychlorinated biphenyl (PCB) toxicity: Physiological and 531
genome-wide responses of Burkholderia xenovorans LB400 to PCB-mediated stress. 532
Appl. Environ. Microbiol. 72:6607-6614. 533
28. Patil, G. S. 1991. Correlation of aqueous solubility and octanol-water partition 534
coefficient based on molecular structure. Chemosphere 22:723-738. 535
29. Sakai, M., K. Miyauchi, N. Kato, E. Masai, and M. Fukuda. 2003. 2-Hydroxypenta-536
2,4-dienoate metabolic pathway genes in a strong polychlorinated biphenyl degrader, 537
Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 69:427-433. 538
30. Sambrook, J., and D. W. Russel. 2001. Molecular cloning. A Laboratory Manual, 539
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 540
31. Schloss, P. D., and J. Handelsman. 2003. Biotechnological prospects from 541
metagenomics. Curr. Opin. Biotechnol. 14:303-310. 542
32. Seah, S. Y., G. Labbé, S. Nerdinger, M. R. Johnson, V. Snieckus, and L. D. Eltis. 543
2000. Identification of a serine hydrolase as a key determinant in the microbial 544
degradation of polychlorinated biphenyls. J. Biol. Chem. 275:15701-15708. 545
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
23
33. Seeger, M., K. N. Timmis, and B. Hofer. 1995. Conversion of chlorobiphenyls into 546
phenylhexadienoates and benzoates by the enzymes of the upper pathway for 547
polychlorobiphenyl degradation encoded by the bph locus of Pseudomonas sp. strain 548
LB400. Appl. Environ. Microbiol. 61:761-768. 549
34. Seeger, M., M. Zielinski, K. N. Timmis, and B. Hofer. 1999. Regiospecificity of 550
dioxygenation of di- to pentachlorobiphenyls and their degradation to chlorobenzoates 551
by the bph-encoded catabolic pathway of Burkholderia sp. Strain LB400. Appl. 552
Environ. Microbiol. 65:3614-3621. 553
35. Suenaga, H., M. Goto, and K. Furukawa. 2001. Emergence of multifunctional 554
oxygenase activities by random priming recombination. J. Biol. Chem. 276:22500-555
22506. 556
36. Suenaga, H., T. Ohnuki, and K. Miyazaki. 2007. Functional screening of a 557
metagenomic library for genes involved in microbial degradation of aromatic 558
compounds. Environ. Microbiol. 9:2289-2297. 559
37. Suenaga, H., T. Watanabe, M. Sato, Ngadiman, and K. Furukawa. 2002. Alteration 560
of regiospecificity in biphenyl dioxygenase by active-site engineering. J. Bacteriol. 561
184:3682-3688. 562
38. Suenaga, H., Y. Koyama, M. Miyakoshi, R. Miyazaki, H. Yano2, M. Sota, Y. 563
Ohtsubo, M. Tsuda, and K. Miyazaki. 2009. Novel organization of aromatic 564
degradation pathway genes in a microbial community as revealed by metagenomic 565
analysis. ISME J. 3:1335–1348. 566
39. Wei, X.-Y., Z.-G. Ge, Z.-Y. Wang, and J. Xu. 2007. Estimation of aqueous solubility 567
(-lgSw) of all polychlorinated biphenyl (PCB) congeners by density functional theory 568
and position of Cl substitution (NPCS) method. Chinese J. Struct. Chem. 26:519-528. 569
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
24
40. Witzig, R., H.A.H. Aly, C. Strömpl, V. Wray, H. Junca, and D. H. Pieper. 2007. 570
Molecular detection and diversity of novel diterpenoid dioxygenase DitA1 genes from 571
proteobacterial strains and soil samples. Environ. Microbiol. 9:1202-1218. 572
41. Zielinski, M., S. Backhaus, and B. Hofer. 2002. The principal determinants for the 573
structure of the substrate-binding pocket are located within a central core of a biphenyl 574
dioxygenase alpha subunit. Microbiology 148:2439-2448. 575
42. Zielinski, M., S. Kahl, H.-J. Hecht, and B. Hofer. 2003. Pinpointing biphenyl 576
dioxygenase residues that are crucial for substrate interaction. J. Bacteriol. 185:6976-577
6980. 578
43. Zielinski, M., S. Kahl, C. Standfuß-Gabisch, B. Cámara, M. Seeger, and B. Hofer. 579
2006. Generation of novel-substrate-accepting biphenyl dioxygenases through 580
segmental random mutagenesis and identification of residues involved in enzyme 581
specificity. Appl. Environ. Microbiol. 72:2191–2199. 582
583 on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
25
FIGURE LEGENDS 584
585
FIG. 1. Dendrograms of metagenomic BphA1 (A) and DitA1 (B) sequences from the 586
Wittenberg site. Dendrograms were derived from sequence alignments. Similarity clusters are 587
indicated by brackets and are designated by roman numerals. Scale bars give distances in 588
amino acid substitutions per site. DitA1 sequences (40) are identified by database accession 589
numbers. 590
591
FIG. 2. Regiospecificity of CB dioxygenation by cluster I and cluster II prototype hybrid 592
enzymes. Sites of productive attack were deduced as given in Table 5 and in the text. 593
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 1. Similarities of amino acid sequences encoded by the Wittenberg clones. Sequence cluster Amino acid sequence identity (%)
Name No. of clones
sequenced Within the cluster With cluster II With cluster III
With the most similar sequence in the data base a
I 37 97-100 85-88 38-42 96 b II 12 97-100 - 37-38 100/93 c III 2 99 - - 56/43 d
a If the most similar sequence belongs to a putative enzyme, a second value is given, which
refers to the most similar sequence of a non-putative enzyme. b Biphenyl dioxygenase alpha subunit from Burkholderia xenovorans LB400 (NCBI Protein
Database accession no. ABE37059). c Putative ring-hydroxylating dioxygenase alpha subunit from Burkholderia sp. WBF3
(accession no. ABG75584) and WBF4 (accession no. ABG75585). Biphenyl dioxygenase alpha subunit from Pseudomonas pseudoalcaligenes KF707 (accession no. Q52028).
d Putative ring-hydroxylating dioxygenase alpha subunit from Burkholderia ambifaria IOP40-10 (accession no. EDT02834). Biphenyl dioxygenase alpha subunit from Rhodococcus jostii RHA1 (accession no. BAA06868).
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 2. Distribution of DNA sequences of soils B and C between sequence clusters.
Sequence Cluster
Sequences obtained from soil B C
Number % Number % I 17 65 20 80II 9 35 3 12III 0 0 2 8
Sum 26 100 25 100
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 3. Activity of hybrid dioxygenases with biphenyl as substrate, and correlation with AA substitutions in BphA1 a.
Clone name
Sequence cluster
Specific activity
[(pmol/min)/ mg BphA1] b,c
AA substitution relative to
cluster prototype d
Comparison e of and comments on AA substitutions
WB6 I 21.6 D279G G, N also found at this position. WB11 I 30.0 K291E K invariant. WB15 I 41.9 na h WB40 I 49.1 L309P V also found at this position. WB41 I 59.9 S283P
H343R
SBSR i. I, T, M, L also found at this position. H invariant.
WB70 I nad f S274P T, A also found at this position. Probable steric clash between P274 and G273.
WB72 I 25.9 T356A V, W, I also found at this position.
WB74 I nad, npd g I247V I341T I375V
L, M also found at this position. T, S, A also found at this position.L, V also found at this position.
WC5 I 75.9 L304H K, R also found at this position. WC10 I nad Q322R
A354T
SBSR. E also found at this position. S, P also found at this position.
WC15 I 80.7 F265L Y also found at this position WC23 I 0.904 I375L
N377S L, V also found at this position. T also found at this position. Neighbor of SBSR F378.
WC42 I 94.9 I339V V also found at this position. WC65 I nad G271R
Y370H G invariant. F also found at this position.
WB14 II 14.2 V352M V invariant. WB42 II 654 E250G
V358A D361N
G, D, N also found at this position. V invariant. D invariant.
WB47 II nad, npd Y232C T329P A360T
Y invariant. Neighbor of SBSR M231 and of Fe ligand H233. T invariant. A invariant.
WB68 II 639 M247V I, L also found at this position. WB69 II 744 T260A K, S also found at this position. WC18 II 500 na WC27 III nad, npd na a Prototype lines are in bold. b SDs were ± 30 %. c Specific activity was calculated using a molar extinction coefficient of 33200 for the MCP
(35).
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
d AA numbering from BphA1-LB400. e With 23 alpha subunit sequences of active benzene-type (class II) ARHDOs. Their NCBI
protein database accession nos. are: CAA56346, AAB07750, BAA06868, AAP74038, AAA26005, ADI95397, CAA06970, Q07944, AAC43632, AAC46390, ABE37059, AAB88813, Q52028, AAK14781, 1WQL_A, AAD12763, AAB36666, AAC03436, CAB99196, AAC44526, CAA08985, BAJ72245, BAC01052. We changed the BAC01052 sequence in positions 351-359 to VWAFVVVDA, because in this segment the database sequence obviously switched to a wrong reading frame.
f nad, no activity detected. g npd, no protein (BphA1) detected. h na, not applicable i SBSR, substrate binding site residue, i. e., AA is located within a distance of 6 Å from the
biphenyl molecule in the BphA-LB400 structure 2XRX (20).
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 4. Productive dioxygenation of various CBs by prototype hybrid BphAs.
CB Rate of product formation
[mAbsmax/h] Chlori- nated
carbons
Conta- mination of site a
Aqueous solubility
[µM]
BphA-WB15h BphA-WC18h
mean SD mean SD 2,2’ + 1.91 b 1370 320 87 512,4’ ++ 3.47 b 1170 270 626 2233,4,2’ +++ 0.616 b 507 11 121 163,5,2’ - 0.501 b 133 41 46 103,3’ - 0.354 b npo d npo 37 132,3,3’ - 0.426 c 31 5 54 72,4,3’ + 0.776 b 59 9 46 114,4’ +++ 0.426 b npo npo 7 13,4,4' +++ 0.301 c npo npo npo npo3,5,4' - 0.194 c npo npo npo npo
a Gross classification of CB contaminations, based on gas chromatography data (25). -, no; +, minor; ++, medium; +++, major constituent of the Wittenberg site.
b Experimental (28). c Calculated (40). d npo, no product observed.
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 5. Absorption maxima a of MCPs formed via dioxygenation of CBs by prototype hybrid BphAs, and tentative assignments of initially oxidized carbons.
CB Resulting MCP
Chlori- nated
carbons
Potentially oxidized carbons
Chlori- nated
carbonsb
Expectedc,d Previous experimental data
BphA-WB15h
BphA-WC18h
λmax [nm] λmax [nm] Oxidized carbons λmax [nm] λmax [nm]
2,2’ 2,3 8 ≈ 393 392 c 2,3 h 393 393
5,6 5,8 ≈ 393 395 e 5,6 e 2,4’ 2,3 10 > 430 438 c 2,3 h 433 (399) 5,6 5,10 ≈ 402 400 2’,3’ 3,8 ≈ 393 3,4,2’ 2,3 3,8 ≈ 393 5,6 3,4,8 ≈ 393 2’,3’ 9,10 > 430 440 (401) f 2',3' h 435 (401) 5’,6’ 5,9,10 ≈ 402 401 3,5,2’ 2,3 4,8 ≈ 393 2’,3’ 9,11 > 430 435 (402) f 2',3' h 435 (400) 5’,6’ 5,9,11 ≈ 402 400 3,3’ 2,3 9 > 430 npo i
5,6 4,9 ≈ 410 430 (410)c
425 (395) e5,6 e,h 395
2,3,3’ 5,6 4,5,9 ≈ 402 2’,3’ 8,9 ≈ 393
385 ± 3 388 j 5’,6’ 4,8,9 ≈ 393 400 (370) c 5’,6’ h 2,4,3’ 2,3 3,9 > 430 433 f 2,3 f 420 (438) 5,6 3,5,9 ≈ 402 437 f 5,6 h 2’,3’ 8,10 ≈ 393
388 j 5’,6’ 4,8,10 ≈ 393 4,4’ 2,3 3,10 > 430 432 e,g 2,3 e,h npo 433
a All values ± 2 nm, unless otherwise indicated. Numbers in parentheses indicate final values in case of a shift of the absorption maximum during incubations.
b Carbon numbering in MCP is as shown here: 9
10
11 12
7
8
6O
3
45
2
1
OH
OH
O
c Data from ref. 33. d Data from ref. 32. e Data from ref. 9. f C. S.-G. and B. H., unpublished results. g Data from ref. 43. h Data from ref. 34. i npo, no product observed. j Absorption unstable.
on Septem
ber 8, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from