1

Title: A novel variation in the FRIZZLE PANICLE (FZP) gene promoter improves 1

grain number and yield in rice. 2

3

Authors: Sheng-Shan Wang , Chia-Lin Chung ,, Kai-Yi Chen and Rong-Kuen Chen

4

5

Author affiliation: 6

Crop Improvement Division, Tainan District Agricultural Research and Extension 7

Station, Tainan 71246, Taiwan 8

†Department of Plant Pathology and Microbiology, National Taiwan University, 9

Taipei 10617, Taiwan 10

‡Department of Agronomy, National Taiwan University, Taipei 10617, Taiwan 11

§Chiayi Branch, Tainan District Agricultural Research and Extension Station, Tainan 12

71246, Taiwan 13

14

15

16

17

18

Running title: qSBN7 improves grain number in rice 19

Genetics: Early Online, published on March 9, 2020 as 10.1534/genetics.119.302862

Copyright 2020.

2

20

Keywords: secondary branch number per panicle, sink capacity, trade-offs among 21

yield components, CACTA transposon, rice, Oryza sativa 22

23

1Corresponding author: 24

Name: Rong-Kuen Chen, 25

Affiliation: Chiayi Branch, Tainan District Agricultural Research and Extension 26

Station 27

Address: No. 70, Muchang, Xinhua, Tainan 71246, Taiwan 28

Tel: +8865-3751574 29

E-mail: rkchen@mail.tndais.gov.tw 30

31

32

33

34

35

36

A novel variation in the FRIZZLE PANICLE (FZP) gene promoter improves 37

3

grain number and yield in rice 38

ABSTRACT 39

Secondary branch number per panicle plays a crucial role in regulating grain number 40

and yield in rice. Here we report the positional cloning and functional 41

characterization for SECONDARY BRANCH NUMBER7 (qSBN7), a quantitative 42

trait locus affecting secondary branch per panicle and grain number. Our research 43

revealed that the causative variants of qSBN7 are located in the distal promoter 44

region of FRIZZLE PANICLE (FZP), a gene previously associated with repression of 45

axillary meristem development in rice spikelets. qSBN7 is a novel allele of FZP 46

which causes an approximately 56% decrease in its transcriptional level, leading to 47

increased secondary branch and grain number, and reduced grain length. Field 48

evaluations showed that qSBN7 increased grain yield by 10.9% in a temperate 49

japonica variety, TN13, likely due to its positive effect on sink capacity. Our 50

findings suggest that incorporation of qSBN7 can increase yield potential and improve 51

the breeding of elite rice varieties. 52

53

54

Introduction 55

4

Grain number, one of the predominant components of rice yield, can be 56

efficiently increased by nitrogen fertilizer (Doberman and Fairhurst 2001). To achieve 57

high grain productivity, farmers usually apply excessive fertilizers, which lead to soil 58

acidification, groundwater contamination, and increased costs. Pyramiding 59

quantitative trait loci (QTLs) for grain number and other yield-related traits is an 60

alternative means of improving productivity without causing adverse environmental 61

effects. To date, several QTLs for grain number, such as Gn1a, DEP1, WFP/IPA1, 62

SCM2, SPIKE (qTSN4), GNP1, qNPT1, and SGDP7/COS1, have been identified from 63

natural variations and applied in rice breeding (Ashikari et al. 2005; Huang et al. 2009; 64

Jiao et al. 2010; Miura et al. 2010; Ookawa et al. 2010; Fujita et al. 2013; Wu et al. 65

2016; Bai et al. 2017; Wang et al. 2017a; Huang et al. 2018). 66

Grain number is associated with several morphological components of panicle 67

architecture, among which secondary branch number per panicle is one of the most 68

crucial (Mei et al. 2006; Luo et al. 2009). To identify new genes for grain number, a 69

backcross population with segregating secondary branch number per panicle and grain 70

number phenotypes was developed by using the donor parent IR65598-112-2 and 71

recurrent parent TN13 (Wang et al. 2017b). Genetic analysis and rough genetic 72

mapping suggested that qSBN7, a single locus located on the long arm of chromosome 73

5

7, underlay the secondary branch and grain number variant and that the allele of 74

IR65598-112-2 was recessive (Wang et al. 2017b). 75

IR65598-112-2 is a new plant type cultivar, one of several released in the 1990s 76

by the International Rice Research Institute with a higher grain number per panicle, 77

larger leaves, strong culms, and few unproductive tillers. The high yield potentials of 78

these cultivars render them suitable for rice breeding and genetic analysis of rice yield. 79

However, so far only a few QTLs for yield potentials have been identified from new 80

plant type cultivars (Fujita et al. 2013; Wang et al. 2017a). 81

To reveal the genetic determinant underlying secondary branch number per 82

panicle and grain yield in rice, we undertook map-based cloning and a functional 83

characterization of qSBN7. Natural variations in the promoter region of FRIZZLE 84

PANICLE (FZP), a gene encoding an APETALA2/ETHYLENE response factor (ERF), 85

was identified as the genetic basis of qSBN7. This finding provided insight into the 86

molecular mechanisms of the complex rice yield trait. Phenotypic evaluations also 87

showed that qSBN7 had pleiotropic effects on secondary branch number per panicle, 88

grain number, grain length, 1,000-grain weight, and percentage of filled grains. Our 89

results suggest that qSBN7 increases reproductive sink capacity in rice and can be 90

applied in breeding new elite cultivars. 91

6

92

Materials and Methods 93

Primers 94

Primers used for high-resolution mapping, DNA sequencing, genotyping of four grain 95

number genes, vector construction, expression analysis, NIL development, and 96

transgenic plant identification are listed in Table S1. 97

98

Development of NILs 99

Two BC3F2 populations with the genetic backgrounds of TN13 and TCS10 were 100

generated by recurrent backcross breeding using IR65598-112-2 as the donor parent. 101

Two backcross inbred lines (BILs) carrying homozygous qSBN7 allele of 102

IR65598-112-2, BIL_TN13sbn

and BIL_TCS10sbn

, were selected from respective 103

BC3F2 population based on the genotypes of the SNP2830.5 marker. A whole-genome 104

survey of the two BILs was conducted using restriction-site associated DNA 105

sequencing (RAD-seq). Seven and three introgression segments of IR65598-112-2 106

were detected in BIL_TN13sbn

and BIL_TCS10sbn

, respectively (Figure S1, A and B). 107

To develop NIL_TN13sbn

and NIL_TCS10sbn

, BIL_TN13sbn

and BIL_TCS10sbn

were 108

backcrossed to their recurrent parents two times. One BC5F1 plant was selected and 109

7

self-pollinated to develop NIL_TN13sbn

, using 8 Kompetitive Allele Specific PCR 110

(KASP) markers (TN13_C2_8, TN13_C3_6, TN13_C6_5, TN13_C7_22, 111

TN13_C8_20, TN13_C9_16, TN13_C11_21, SNP2831) located at the introgression 112

segments of IR65598-112-2 in BIL_TN13sbn

(Figure S1A). Similarly, One BC5F1 113

plant was selected and self-pollinated to develop NIL_CS10sbn

, using 5 KASP 114

markers (TCS10_C2_15, TCS10_C2_25, TCS10_C4_14, TCS10_C7_20, SNP2831) 115

located at the introgression segments of IR65598-112-2 in BIL_TCS10sbn

(Figure 116

S1B). Custom KASP SNP assays and KASP Genotyping Master Mix were supplied 117

by LGC Genomics (Middlesex, UK). KASP analysis was carried out according to the 118

manufacture’s protocol, with a 5 µL total reaction volume, on a CFX96 ConnectTM

119

Real-Time PCR Detection System (Bio-Rad). 120

121

Plant materials and growing conditions 122

For qRT-PCR analysis and transgenic analysis, BIL-sbn with the homozygous qSBN7 123

allele of IR65598-112-2 was developed as previously described12

(previously named 124

BIL-sbn/sbn). The 66 accessions used in sequence analysis of FZP are listed in Table 125

S2. All transgenic plants and the 66 accessions used for DNA sequencing were grown 126

in a closed greenhouse at Biotechnology Center in Southern Taiwan of Agricultural 127

8

Biotechnology Research Center, Academia Sinica, Tainan, Taiwan (23°10’N, 120°128

29’E). The others were grown in paddy fields at Chia-Yi, Taiwan (23°42’N, 120°129

28’E). The rice plants were cultivated according to conventional management 130

practices in a well-irrigated paddy field. The amount of nitrogen fertilizer used was 131

160 kg ha-1

in each field. 132

133

Fine mapping of qSBN7 134

Through backcross breeding, we generated a BC2F5 mapping population with 135

segregating panicle phenotypes using the donor parent IR65598-112-2 and recurrent 136

parent TN13. A total of 1,652 BC2F5 individuals were genotyped using the SNP2788 137

and SNP2855 markers. Twenty-four recombinants each with a single crossover event 138

in the interval between SNP2788 and SNP2855 were obtained and self-pollinated to 139

produce BC2F5:6 to BC2F5:9 lines for a progeny test. All recombinants were further 140

genotyped using additional five markers: Indel2823, Indel2829, SNP2830.7, 141

SNP2830.9 and SNP2835. For the progeny test, 52 individuals per BC2F5:6 line were 142

visually rated as low secondary branch number (SBN) type , segregating , or 143

high-SBN types. Furthermore, nine homozygous recombinants were selected based on 144

the location of their crossover sites and evaluated for secondary branch number per 145

9

main panicle in the BC2F5:9 generation. 146

147

Sequence polymorphisms of FZP in rice germplasms 148

Genomic DNA extracted from the 66 accessions were used as DNA templates for 149

PCR. Primers used in DNA sequencing of the 9.3-kb candidate region and genotyping 150

of four grain number genes (GN1A, IPA1, DEP1 and SPIKE) are listed in Table S1. To 151

avoid false nucleotide polymorphisms caused by PCR amplification, three 152

independent PCR amplicons resulting from each combination of primer pairs and 153

DNA templates were mixed and then submitted to Sanger sequencing. The DNA 154

sequences were analyzed using Chromas software version 2.23 155

(http://www.technelysium.com.au). 156

157

Vector construction and plant transformation 158

To generate the p66 plasmid, a DNA fragment spanning from 2466 bp upstream of the 159

FZP transcription start site to 1307 bp downstream of its stop codon was amplified 160

from TN13 plants using the Vector_p40F and Vector_p40R primers, then cloned into 161

the binary pCAMBIA1300 vector (Cambia) treated with BamHI. This mediated 162

vector was designated as p40. Then, a DNA fragment between 1375 bp and 7583 bp 163

10

upstream of the FZP transcription start site was amplified from TN13 plants using the 164

Vector_p66F and Vector_p66R primers, then cloned into the binary p40 vector treated 165

with EcoRI. To generate the pRNA1 plasmid, a 21-bp amiRNA sequence 166

(TAATGATATATGCATGATCGC for 3’-UTR of FZP) was designed using Web 167

MicroRNA Designer 3 software (http://wmd3.weigelworld.org/cgi-bin/webapp.cgi). 168

The amiRNA precursor was generated by gene synthesis. The sequence of the 169

amiRNA precursor is shown in Figure S2. The precursor was amplified using the 170

Vector_RNAi F and Vector_RNAi R primers and then cloned into the binary vector 171

pCAMBIA1301 (Cambia), which was digested using BglII and PmlI. All vectors were 172

constructed using the In-Fusion HD Cloning Kit (Clontech Takara Bio). Vector p66 173

was introduced into BIL-sbn and vector pRNA1 into TN13 by 174

Agrobacterium-mediated transformation (Toki et al. 2006) at the Transgenic Plant 175

Laboratory, Institute of Plant and Microbial Biology, Academia Sinica (Taiwan). The 176

copy number of each independent T0 plant was evaluated using TaqMan® Copy 177

Number Assays (Applied Biosystems). We chose the rice tubulin alpha-1 chain as an 178

endogenous control gene (Kim et al. 2015) and hptII in the p66 and pRNA1 plasmids 179

as the target gene. Real-time PCR data were analyzed using CopyCaller software 180

version 2.0 (Applied Biosystems) according to the manufacturer’s instructions. To 181

11

generate p66 and pRNA1 transgenic lines, hptII specific marker (Table S1) was used 182

to exclude the wild type plants at T1 and T2 generations. For p66, 4 out of 10 T1 lines 183

were selected then self-pollinated to generate T2; 10 out of 32-36 plants from each T2 184

line (total four independent T2 lines) were selected by hptII marker then used for 185

phenotyping. For pRNA1, 6 out of 12 T1 lines were selected then self-pollinated to 186

generate T2; 10 out of 32-36 plants from each T2 line (total six independent T2 lines) 187

were selected by hptII marker then used for phenotyping. 188

189

RNA isolation and qRT-PCR analysis 190

We extracted total RNA using the RNeasy Plant Mini Kit (Qiagen). One µg of total 191

RNA was treated with RNase-free DNase I (Ambion) and then submitted to cDNA 192

synthesis using a SuperScriptTM III First-Strand Synthesis System Kit (Invitrogen). 193

Transcriptional levels of LOC_Os07g47330 (FZP) and LOC_Os07g47340 were 194

detected in a real-time PCR analysis. All assays were conducted with three biological 195

and three technical replicates. Real-time PCR was performed on a CFX96 ConnectTM

196

Real-Time PCR Detection System (Bio-Rad). Each real-time PCR reaction was 197

performed with a final volume of 10 µL, consisting of 5 µL of 2× SsoAdvanced 198

Universal Probes Supermix (Bio-Rad), 0.25 µL of each primer (50 µmol/L), 0.25 µL 199

12

of probe (10 µmol/L), 1 µL cDNA of template, and 3.5 µL of ddH2O. The rice 200

ubiquitin gene UBQ5 (LOC_Os01g22490) was used as the internal control. 201

202

Next-generation sequencing and sequence analysis 203

To obtain the full length of the insertion located 6102 bp upstream of FZP, the 204

genomic DNA of BIL-sbn was extracted using the protocol described by CTAB 205

method (Murray and Thompson 1980). A HiSeq4000 platform (Illumina) was used for 206

next-generation sequencing. DNA libraries were sequenced as 150-bp pair-end reads 207

at Tri-I Biotech Inc. (Taipei, Taiwan). A total of 75.3 Gb of raw reads were obtained 208

and de novo assembled at Genomics company (Taipei, Taiwan). To investigate the 209

whole-genome background of BIL_TN13sbn

and BIL_TCS10sbn

, the RAD libraries of 210

TN13, TCS10, IR65598-112-2, BIL_TN13sbn

and BIL_TCS10sbn

were constructed as 211

previously described (Etter et al. 2011). A total of 7.6 Gb raw reads were obtained on 212

an Illumina HiSeq4000 at Tri-I Biotech Inc. (Taipei, Taiwan), and then analyze as 213

previously described (Wang et al. 2017b). 214

215

Analysis of grain quality 216

To evaluate eating quality traits, 150-200 g grains from each replication were milled 217

13

to yield brown rice grains. Chalky grain ratio was evaluated using 1,000 brown rice 218

grains and a rice quality selector (Satake Co.) following the operations manual. The 219

amylose content and protein content were measured using grain composition analyzer 220

(Kett Co.) in accordance with the operations manual. 221

222

Data availability Statement 223

Materials and plasmids are available upon request. FZP sequences of 66 rice 224

accessions (File S1), and the data in Supplemental Figures and Supplemental Tables 225

are available at FigShare 226

(https://figshare.com/articles/Supplemental_Material_for_Wang_et_al_2020/1191930227

3). Whole genome sequences of BIL_sbn are deposited in Sequence Read Archive 228

(SRA) database (SRA accession: PRJNA607167; 229

https://www.ncbi.nlm.nih.gov/sra/PRJNA607167). RAD sequencing data are 230

deposited in SRA database (SRA accession: PRJNA607003; 231

https://www.ncbi.nlm.nih.gov/sra/PRJNA607003). All other relevant data are within 232

the article and its Tables and Figures. 233

234

Results 235

14

High-resolution mapping and identification of qSBN7 236

TN13 is a temperate japonica cultivar with approximately 19.5 secondary branches 237

and 111.2 grains per panicle; IR65598-112-2 is a tropical japonica (javanica) cultivar 238

with approximately 82.1 secondary branches and 371.3 grains per panicle (Figure 1, 239

A-E). To identify the causal gene of qSBN7, we conducted high-resolution linkage 240

analysis on a segregating population consisting of 1,652 BC2F5 individuals derived 241

from IR65598-112-2 and TN13. The qSBN7 locus was narrowed to an approximately 242

9.3-kb segment between the Indel2829 and SNP2830.9 markers (Figure 1F and Figure 243

S3). According to Michigan State University Rice Genome Annotation Project release 244

7 (http://rice.plantbiology.msu.edu/), this region covers the full length of 245

LOC_Os07g47330 and the last two exons of LOC_Os07g47340 (Figure 1G). We 246

compared the sequences of TN13 and IR65598-112-2 across the 9.3-kb candidate 247

region and found no difference in the coding regions of the two candidate genes, 248

except for two SNPs (c.-4066C>T and c.-6383A>G) and an 8461-bp indel 249

(c.-6101>-6102insCACTACCA…) in the upstream of LOC_Os07g47330 (Figure 1G). 250

The 8461-bp insertion encodes a putative CACTA transposon (Figure S4) and thus 251

may affect the expression of LOC_Os07g47330 and LOC_Os07g47340, but the 252

transposon itself is unlikely to be the causative gene. 253

15

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis 254

was conducted to reveal the transcript levels of the two candidate genes at seedling 255

and three panicle development stages in TN13 and BIL-sbn (a BC2F4-derived line 256

carrying the homozygous qSBN7 locus of IR65598-112-2 in the TN13 genetic 257

background). No significant differences were detected between expressions of 258

LOC_Os07g47340 in TN13 and BIL-sbn at all stages (Figure 2A). However, 259

significantly higher expression of LOC_Os07g47330 was observed at the 1-mm 260

panicle stage in TN13 than in BIL-sbn (Figure 2B). At this stage the primary rachis 261

branch meristem produces lateral branches (Ikeda et al. 2004), suggesting that 262

differential expression of LOC_Os07g47330 may cause variations in secondary 263

branch number. LOC_Os07g47330 is the previously identified FRIZZLE PANICLE 264

(FZP) gene in rice. FZP encodes an ERF transcription factor (Komatsu et al. 2003) 265

and is the ortholog of the maize BRANCHED SILKLESS 1 gene (Chuck et al. 2002). 266

267

FZP was the gene responsible for qSBN7 268

To examine whether FZP underlay the secondary branch and grain number variant, a 269

9.8-kb genomic DNA fragment containing the FZP locus of TN13 (designated as p66) 270

(Figure S5) was introduced into BIL-sbn. The transgenic plants carrying a single copy 271

16

of p66 showed significantly lower secondary branch number per panicle, lower grain 272

number, and increased grain length (Figure 2 and Figure S6). Comparison of FZP 273

transcript levels in BIL-sbn and the four independent T2 lines showed that three lines 274

with rescued phenotypes (p66-01, p66-20, and p66-27) exhibited a significantly 275

higher FZP expression than BIL-sbn (Figure 2C). These results indicated that FZP 276

was the gene responsible for the observed qSBN7 effects. 277

278

Negative correlation between the level of FZP expression and qSBN7 phenotypes. 279

Next, we investigated whether the differential expression of FZP correlated with the 280

levels of secondary branch number per panicle, grain number, and grain length. We 281

generated a silencing transgenic line by introducing pRNA1, which contains a 21-bp 282

artificial microRNA sequence of FZP (amiRNA1), into TN13. Compared with TN13, 283

most of the independent T1 lines with single-copy amiRNA1 showed increased 284

secondary branch per panicle and grain number and reduced grain length, with some 285

variations (Figure 3 shows comparisons between TN13 and a representative silencing 286

line, pRNAi-19. Data from all 12 T1 lines are given in Figure S7, A-C). However, we 287

observed no significant difference in primary branch number per panicle among the 288

transgenic plants and TN13. (Figure 3B and Figure S7D) 289

17

We then performed qRT-PCR to clarify the transcript levels of FZP in TN13 and six 290

randomly chosen independent T2 lines. FZP was expressed in the six T2 lines at 291

lower levels than in TN13 (Figure 3F), and its expression was negatively correlated 292

with secondary branch number per panicle (r = −0.883) (Figure S8). We noted that 293

pRNAi-19, pRNAi-03, and BIL-sbn, which exhibited similar FZP expression levels 294

(approximately 36%–44% of FZP expression in TN13), all showed increased 295

secondary branch per panicle and grain number and similar panicle type (Figure 3 and 296

Figure S7). In pRNAi-01, the line exhibiting a stronger silencing effect (FZP 297

expression decreased to 24.6%), we found an increased secondary branch number per 298

panicle, almost no grains, and a frizzy panicle (floret formation replaced by 299

continuous branching), which was similar to previously reported fzp mutants14

(Figure 300

3A). Our findings confirmed that differential expression of FZP affected secondary 301

branch number per panicle, grain number, and grain length, but not primary branch 302

number per panicle. They also suggested that qSBN7 was a hypomorphic allele for 303

lower expression of FZP. 304

305

Sequence polymorphisms of FZP in rice germplasms 306

To investigate functional allelic variations in FZP, 66 accessions consisting of 22 307

18

temperate japonica, 15 tropical japonica, and 29 indica cultivars were selected for 308

sequencing analysis of a 1.8-kb genomic DNA region spanning a 402-bp promoter, 309

5’-UTR, the coding region, and 3’-UTR (Figure S9, A and B). Since IR65598-112-2 310

and TN13 have two single-nucleotide polymorphisms (SNPs) and one insertion 311

difference in the distal promoter region of FZP, the genotypes near these three 312

polymorphic sites in the 66 accessions were also examined. According to the panicle 313

structure of p66 and pRNA1 transgenic lines, FZP affected secondary branch number 314

per panicle by regulating secondary branch number per primary branch (Figure S6E 315

and Figure S7E). Therefore, secondary branch numbers per primary branch of the 66 316

accessions were evaluated. Eleven haplotypes were identified, with only four 317

synonymous polymorphisms and one missense polymorphism found in the coding 318

region (Figure S9C). Two indica cultivars carrying the same missense polymorphism, 319

IR61608-3B-20-2-2-1-2 (haplotype 10) and Mudgo (haplotype 11), showed different 320

levels of secondary branch numbers per primary branch, indicating that this was a 321

neutral mutation (Figure S9C and Table S2). Additionally, no amino acid changes in 322

ERF elements were detected (Figure S9C), indicating that the FZP protein was highly 323

conserved in rice. 324

Nucleotide variants found in the promoter and UTR regions may regulate the 325

19

transcriptional level of FZP, resulting in differential numbers of secondary branches 326

and grains. A comparison between the genotypes and phenotypes of the 66 accessions 327

(Figure S9C and Table S2) suggested that the polymorphisms at sites −6383, −220, 328

−136, 1211, and 1276 were unlikely to be the key regulatory elements for the trait. On 329

the other hand, haplotypes 6 (IR65598-112-2 and IR76904-7-19) and 7 (BSI325) 330

shared the same variants at sites −6102, −4066, and 1103 and exhibited relatively high 331

numbers of secondary branches per primary branch. Site 1103 (= Indel2829 marker) 332

at 3’-UTR was excluded based on the result from high-resolution mapping of qSBN7 333

(Figure S9A). 334

Among individual accessions in different rice populations (Table S2), 335

IR76904-7-19 (haplotypes 6) and IR65598-112-2 (haplotypes 6) showed higher 336

numbers of secondary branches per primary branch than other tropical japonica 337

cultivars investigated in this study. Similarly, BSI325 (haplotypes 7) showed higher 338

numbers of secondary branches per primary branch than other temperate japonica 339

cultivars tested. However, among the tested indica cultivars, Kasalath and Zhuan 340

(which shared the same variants at sites −6102, and −4066) did not show significantly 341

higher numbers of secondary branches per primary branch than the rest of the indica 342

cultivars (Table S2). To understand whether other trait-related polymorphisms 343

20

occurred in the distal promoter region, we sequenced an 8331-bp region in the 344

upstream of FZP for IR76904-7-19, BSI325, Kasalath, and Zhuan. Our results 345

revealed that whereas IR76904-7-19 and BSI325 were monomorphic to 346

IR65598-112-2, Kasalath and Zhuan9 differed from IR65598-112-2 by an 18-bp 347

duplication (GCACGCACGCACGGACGC) located 5308 bp upstream of FZP (Table 348

S2). This indicated that natural variants located in the distal promoter region of FZP 349

played a regulatory role in the production of secondary branches per panicle and 350

grains in rice, and qSBN7 was a rare allele in the collected accessions. 351

352

qSBN7 enhanced sink capacity and yield in a favorable genetic background 353

To evaluate the potential of qSBN7 for high-yield breeding, we generated two near 354

isogenic lines (NILs) NIL_TN13sbn

and NIL_TCS10sbn

, which carried the 355

homozygous qSBN7 allele of IR65598-112-2 in the TN13 (temperate japonica) and 356

TCS10 (indica) genetic background, respectively (Figure S1, C and D). Phenotypic 357

characterization of TN13 and NIL_TN13sbn

in rice paddies showed no significant 358

morphological differences at vegetative stages (Figure 4A). For panicle traits, 359

NIL_TN13sbn

showed higher numbers of secondary branches per panicle, grains per 360

panicle and grains per secondary branch than TN13, but also shorter grain length 361

21

(Figure 4). Similarly, there were no significant phenotypic differences among TCS10 362

and NIL_TCS10sbn

before flowering. However, NIL_TCS10sbn

showed severely 363

degenerated panicle and abortive grains (Figure S10), which were similar to the 364

phenotypes of the mutant lines (pRNAi-21) exhibiting stronger silencing effect of 365

FZP (Figure 3A). 366

Additional field experiments were conducted to determine whether qSBN7 affects 367

important agronomic traits, grain quality and yield components in the TN13 genetic 368

background. No significant difference in days to heading, plant height, amylose 369

content, protein content, chalky grain ratio and panicle number per plant were 370

observed between TN13 and NIL_TN13 sbn

(Table 1 and Table S3). However, 371

NIL_TN13sbn

showed significantly increased grain number, sink capacity, and grain 372

yield, and decreased 1,000-grain weight and filled-grain percentage than in TN13 373

(Table 1). NIL_TN13sbn

exhibited 10.9% higher grain yield than in TN13 (Table 1). 374

Taken altogether, our findings indicated that qSBN7 is a pleiotropic QTL for panicle 375

traits, and it could increase rice production without affecting grain quality in a 376

favorable genetic background TN13. 377

378

Discussion 379

22

Grain number is an essential agronomic trait for rice production, because it 380

determines reproductive sink capacity and thus affects grain yield. Several genes for 381

grain number have been identified from natural variations (Ashikari et al. 2005; 382

Huang et al. 2009; Jiao et al. 2010; Miura et al. 2010; Ookawa et al. 2010; Fujita et al. 383

2013; Wu et al. 2016; Wang et al. 2017a; Huang et al. 2018), each with distinct 384

pleiotropic effects on other agronomic traits. For example, the dep1 allele (DEP1 385

allele of Shennong 265) enhanced grain and secondary branch number per panicle but 386

reduced 1,000-grain weight, panicle length, and plant height (Huang et al. 2009). The 387

ipa1 allele (IPA1 allele of Shaoniejing) increased grain number, 1,000-grain weight, 388

and plant height, but reduced tiller number (Jiao et al. 2010). These genes with 389

differential effects are perhaps suitable for different ecological conditions and genetic 390

backgrounds, and can be applied to achieve different breeding goals. Further 391

identification of yield-related genes will allow greater flexibility in rice-breeding 392

programs. 393

Identifying advantageous alleles from natural variants can facilitate the breeding of 394

high-yield rice. We performed high-resolution mapping for a secondary branch per 395

panicle and grain number locus, qSBN7. Fine genetic mapping and a complementation 396

test for qSBN7 revealed that the causal gene was FZP, which encodes an ERF 397

23

transcription factor gene (Komatsu et al. 2003). Grass inflorescence development 398

involves meristem determinacy/indeterminacy decisions (Bommerta and Whippleb 399

2018). FZP appears to be a key regulator of the competitive balance between the 400

formation of axillary and floral meristems. Komatsu et al. (2003) showed that FZP 401

functions to repress axillary meristem formation in rice spikelets. Mutation of FZP 402

resulted in exceptionally high numbers of secondary and higher-order branches 403

without normal spikelets (Komatsu et al. 2003; Yi et al. 2005; Kato and Horibata 404

2012; Bai et al. 2016). FZP was recently identified as the causal gene of two grain 405

number loci in rice, Small Grain and Dense Panicle 7 (SGDP7) and CONTROL OF 406

SECONDARY BRANCH 1 (COS1) (Bai et al. 2017; Huang et al. 2018). An 18-bp 407

duplication ~5.3 kb upstream of FZP (SGDP7) caused reduced expression of FZP 408

and increased grain number and grain yield (Bai et al. 2017). A 4-bp deletion ~2.7 409

kb upstream of FZP (COS1) caused reduced expression of FZP and increased 410

secondary branches and grain yield (Huang et al. 2018). In this study, we found a 411

novel and advantageous allele of FZP. Compare to cultivated rice (TN13), qSBN7 of 412

IR65598-112-2 is also a hypomorphic allele of FZP which causes an approximately 413

56% decrease in its transcriptional level. Similar to SGDP7, qSBN7 probably 414

increased the transition from spikelet meristem to secondary branch meristem on 415

24

primary branches while sufficiently preventing the formation of tertiary branches on 416

secondary ones. Thus, qSBN7 can simultaneously increase secondary branch and 417

grain number, making it suitable for breeding elite rice varieties. 418

Sequence polymorphisms of FZP in 66 accessions showed that the FZP protein 419

was highly conserved in rice, and that variants located in the distal promoter region 420

were responsible for modulating production of secondary branches per panicle and 421

grains. It is notable that among the 66 accessions, only IR65598-112-2, IR76904-7-19, 422

and BSI325 carried the qSBN7 allele, suggesting that qSBN7 has not been widely used 423

in modern rice-breeding programs. In addition to the two polymorphic sites (−6102 424

and −4066) identified in the qSBN7 allele, the 18-bp duplication previously identified 425

in the SGDP7 allele (Bai et al. 2017) were found at site −5308 (in Kasalath and 426

Zhuan 9) (Table S2). This duplication contained two BES1 transcription factor 427

binding sites (CGTGCG), which were reported to be regulated by a brassinosteroid 428

signal transduction gene, OsBZR1(He et al. 2005; Bai et al. 2007). Curiously, 429

although both the variants of qSBN7 (−6102 and −4066) and the 18-bp duplication 430

(Bai et al. 2017) could repress the FZP expression and increase secondary branch 431

number in rice, two indica cultivars Kasalath and Zhuan (which contained both the 432

variants of qSBN7 and the 18-bp duplication) did not show significantly higher 433

25

numbers of secondary branches per primary branch than the rest of the indica 434

cultivars. How different variations in the promoter region of FZP affect its expression 435

and the regulation of secondary branch number per primary branch remain to be 436

resolved. 437

Transgenic analysis and allelic evaluation of qSBN7 revealed its pleiotropic effects 438

of increasing secondary branch per panicle and grain number, and reducing grain 439

length, 1,000-grain weight, and percentage of filled grains (Figure 2, Figure 4 and 440

Table 1). Other studies have noted trade-offs among yield components. It has been 441

reported that improving grain number per panicle could increase competition for 442

assimilate supply, resulting in a reduced filled grain percentage and 1,000-grain 443

weight. Thus, introgression lines carrying QTLs for grain number usually showed 444

increased panicle size but not enhanced grain yield (Ohsumi et al. 2011; Takai et al. 445

2014; Fukushima et al. 2017). In this study, qSBN7 could improve grain number and 446

grain yield in TN13 by approximately 71.4% and 10.9%, respectively (Table 1). TN13 447

is a variety exhibiting high lodging-resistance, long and erect flag leaf, and low 448

number of grains. The architectures imply that TN13 may have relatively higher 449

photosynthesis efficiencies but poor sink capacity (Li et al. 1998; Horton 2000). 450

When qSBN7 was introgressed into TN13, the improved sink capacity together with 451

26

the inherently high source capacity in TN13 successfully improved the grain yield. In 452

contrast, TCS10 is a high grain number variety which carries a grain number QTL, 453

Gn1a (Table S2). Although pyramiding qSBN7 with Gn1a may further promote the 454

development of spikelet meristems, most of the spikelets in NIL_TCS10sbn

were 455

aborted (Figure S10), perhaps due to a shortage of carbohydrates. Source, sink, and 456

translocation capacities all play important roles in grain yield (Ohsumi et al. 2011; 457

Adriani et al. 2016). qSBN7 allele of IR65598-112-2 had no effect on source size, but 458

the efficiencies of photosynthesis and translocation of carbohydrates appeared to be 459

critical during grain filling stage. In recent years, some QTLs for source-related traits 460

have been identified and used for rice breeding (Sun et al. 2014; Hu et al. 2015). 461

Pyramiding the beneficial qSBN7 allele and source-related QTLs may be the key to 462

successful development of high yield rice. 463

464

Acknowledgments 465

The work was supported by the Ministry of Science and Technology of Taiwan 466

(106-2313-B-002-021-MY3), Bureau of Animal and Plant Inspection and Quarantine 467

(BAPHIQ), Council of Agriculture, Taiwan (108AS-8.4.4-BQ-B1(1)), and Tainan District 468

Agricultural Research and Extension Station, Council of Agriculture, Taiwan 469

27

(108AS-7.6.3-NS-N2). 470

471

Literature Cited 472

Adriani, D. E., M. Dingkuhn, A. Dardou, H. Adam, D. Luquet et al., 2016 Rice 473

panicle plasticity in near isogenic lines carrying a QTL for larger panicle is 474

genotype and environment dependent. Rice 9: 28. 475

Ashikari, M., H. Sakakibara, S. Lin, T. Yamamoto, T. Takashi et al., 2005 Cytokinin 476

oxidase regulates rice grain production. Science 309: 741–745. 477

Bai, M. Y., L. Y. Zhang, S. S. Gampala, S. W. Zhu, W. Y. Song et al., 2007 Functions 478

of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice. Proc. Natl. 479

Acad. Sci. USA 104: 13839–13844. 480

Bai, X., Y. Huang, D. Mao, M. Wen, L. Zhang et al., 2016 Regulatory role of FZP in 481

the determination of panicle branching and spikelet formation in rice. Sci. Rep. 6: 482

19022. 483

Bai, X., Y. Huang, Y. Hu, H. Liu, B. Zhang et al., 2017 Duplication of an upstream 484

silencer of FZP increases grain yield in rice. Nat. Plants 3: 885–893. 485

Bommerta, P., and C. Whippleb, 2018 Grass inflorescence architecture and meristem 486

determinacy. Semin. Cell Dev. Biol. 79: 37–47. 487

28

Chuck, G., M. Muszynski, E. Kellogg, S. Hake, and R. J. Schmidt, 2002 The control 488

of spikelet meristem identity by the branched silkless1 gene in maize. Science 298: 489

1238–1241. 490

Doberman, A., and T. Fairhurst, 2001 Rice: Nutrient disorders and nutrient 491

management. PPI/PPIC, Singapore and IRRI, Philippines. 492

Etter, P. D., S. Bassham, P. A. Hohenlohe, E. A. Johnson, and W. A. Cresko, 2011 493

SNP discovery and genotyping for evolutionary genetics using RAD sequencing. 494

Methods Mol. Biol. 772: 157–178. 495

Fujita, D., K. R. Trijatmiko, A. G. Tagle, M. V. Sapasap, Y. Koide et al., 2013 NAL1 496

allele from a rice landrace greatly increases yield in modern indica cultivars. Proc. 497

Natl. Acad. Sci. USA 110: 20431–20436. 498

Fukushima, A., H. Ohta, N. Yokogami, N. Tsuda, A. Yoshida et al., 2017 Effects of 499

genes increasing the number of spikelets per panicle, TAW1 and APO1, on yield 500

and yield-related traits in rice. Plant Prod. Sci. 20: 485–489. 501

He, J. X., J. M. Gendron, Y. Sun, S. S. L. Gampala, N. Gendron et al., 2005 BZR1 is a 502

transcriptional repressor with dual roles in brassinosteroid homeostasis and 503

growth responses. Science 307: 1634–1638. 504

Horton, P., 2000 Prospects for crop improvement through the genetic manipulation of 505

29

photosynthesis: morphological and biochemical aspects of light capture. J. Exp. 506

Bot. 51: 475–485. 507

Hu, B., W. Wang, S. Ou, J. Tang, H. Li et al., 2015 Variation in NRT1.1B contributes 508

to nitrate-use divergence between rice subspecies. Nat. Genet. 47: 834–838. 509

Huang, X., Q. Qian, Z. Liu, H. Sun, S. He et al., 2009 Natural variation at the DEP1 510

locus enhances grain yield in rice. Nat. Genet. 41: 494–497. 511

Huang, Y., S. Zhao, Y. Fu, H. Sun, X. Ma et al., 2018 Variation in the regulatory 512

region of FZP causes increases in secondary inflorescence branching and grain 513

yield in rice domestication. Plant J. 96: 716–733. 514

Ikeda, K., H. Sunohara, and Y. Nagato, 2004 Developmental course of inflorescence 515

and spikelet in rice. Breed. Sci. 54: 147–156. 516

Jiao, Y., Y. Wang, D. Xue, J. Wang, M. Yan et al., 2010 Regulation of OsSPL14 by 517

OsmiR156 defines ideal plant architecture in rice. Nat. Genet. 42: 541–544. 518

Kato, T., and A. Horibata, 2012 A novel frameshift mutant allele, fzp-10, affecting the 519

panicle architecture of rice. Euphytica 184: 65–72. 520

Kim, A. R., H. Lim, J. I. Cho, C. K. Kim, S. U. Ji et al., 2015 Over- expression of 521

BrTSR53 gene improves tolerance of rice plant to salt stress. Plant Breed. Biotech. 522

3: 376–383. 523

30

Komatsu, M., A. Chujo, Y. Nagato, K. Shimamoto, and J. Kyozuka, 2003 FRIZZY 524

PANICLE is required to prevent the formation of axillary meristems and to 525

establish floral meristem identity in rice spikelets. Development 130: 3841–3850. 526

Li, Z., S. R. M. Pinson, J. W. Stansel, and A. H. Paterson, 1998 Genetic dissection of 527

the source-sink relationship affecting fecundity and yield in rice (Oryza sativa L.). 528

Mol. Breed. 4: 419–426. 529

Luo, X., F. Tian, Y. Fu, J. Yang, and C. Sun, 2009 Mapping quantitative trait loci 530

influencing panicle-related traits from Chinese common wild rice (Oryza 531

rufipogon) using introgression lines. Plant Breed. 128: 559–567. 532

Mei, H. W., J. L. Xu, Z. K. Li, X. Q. Yu, L. B. Guo et al., 2006 QTLs influencing 533

panicle size detected in two reciprocal introgressive line (IL) populations in rice 534

(Oryza sativa L.). Theor. Appl. Genet. 112: 648–656. 535

Miura, K., M. Ikeda, A. Matsubara, X. J. Song, M. Ito et al., 2010 OsSPL14 promotes 536

panicle branching and higher grain productivity in rice. Nat. Genet. 42: 545–549. 537

Murray, M. G., and W. F. Thompson, 1980 Rapid isolation of high molecular weight 538

plant DNA. Nucleic Acids Res. 8: 4321–4325. 539

Ohsumi, A., T. Takai, M. Ida, T. Yamamoto, Y. Arai-Sanoh et al., 2011 Evaluation of 540

yield performance in rice near-isogenic lines with increased spikelet number. 541

31

Field Crops Res. 120: 68–75. 542

Ookawa, T., T. Hobo, M. Yano, K. Murata, T. Ando et al., 2010 New approach for 543

rice improvement using a pleiotropic QTL gene for lodging resistance and yield. 544

Nat. Commun. 1: 132. 545

Sun, H., Q. Qian, K. Wu, J. Luo, S. Wang et al., 2014 Heterotrimeric G proteins 546

regulate nitrogen-use efficiency in rice. Nat. Genet. 46: 652–656. 547

Takai, T., T. Ikka, K. Kondo, Y. Nonoue, N. Ono et al., 2014 Genetic mechanisms 548

underlying yield potential in the rice high-yielding cultivar Takanari, based on 549

reciprocal chromosome segment substitution lines. BMC Plant Biol. 14: 295. 550

Toki, S., N. Hara, K. Ono, H. Onodera, A. Tagiri et al., 2006 Early infection of 551

scutellum tissue with Agrobacterium allows high-speed transformation of rice. 552

Plant J. 47: 969–976. 553

Wang, S., K. Wu, Q. Qian, Q. Liu, Q. Li et al., 2017a Non-canonical regulation of 554

SPL transcription factors by a human OTUB1-like deubiquitinase defines a new 555

plant type rice associated with higher grain yield.Cell Res. 27: 1142–1156. 556

Wang, S. S., R. K. Chen, K. Y. Chen, C. Y. Liu, S. M. Kao et al., 2017b Genetic 557

mapping of the qSBN7 locus, a QTL controlling secondary branch number per 558

panicle in rice. Breed. Sci. 67: 340–347. 559

32

Wu, Y., Y. Wang, X. F. Mi, J. X. Shan, X. M. Li et al., 2016 The QTL GNP1 encodes 560

GA20ox1, which increases grain number and yield by increasing cytokinin 561

activity in rice panicle meristems. PLOS Genet. 12: e1006386. 562

Yi, G., J. H. Choi, E. G. Jeong, N. S. Chon, K. K. Jena et al., 2005 Morphological and 563

molecular characterization of a new frizzy panicle mutant, “fzp-9(t)”, in rice 564

(Oryza sativa L.). Hereditas 142: 92–97. 565

566

567

568

569

570

571

572

573

574

575

576

577

578

579

580

581

582

583

584

585

586

587

588

Table 1. Comparison of agronomic traits between TN13 and NIL_TN13sbn 589

Traits1 TN13 NIL_TN13

sbn P-value

3

33

Days to heading 76.7 ± 1.5 76.0 ± 1.7 0.643

Plant height (cm) 93.2 ± 1.2 95.3 ± 3.2 0.338

Panicles per plant 15.6 ± 1.2 16.3 ± 1.2 0.493

Grains per panicle 99.2 ± 4.8 170.0 ± 16.1 0.002

Percentage of filled grains 85.6 ± 1.1 65.8 ± 9.2 0.025

1000-grain weight (g) 26.1 ± 0.8 21.1 ± 0.8 0.002

Sink capacity per plant2 (g) 39.9 ± 1.4 58.1 ± 7.3 0.013

Grain yield per plant (g) 34.2 ± 1.5 37.9 ± 1.3 0.045

1The experiments were carried out in paddy fields at Chia-Yi, Taiwan, in the first crop season of 2019. 590

A completely randomized design with three replications was used in all trials. Plant spacing was 15 cm 591

between plants and 30 cm between rows, with a single plant per hill. Data are shown as mean ± SD. (n 592

= 6 plants). 593

2 Sink capacity per plant (maximum grain weight per plant) = (number of grains per plant) ⅹ 594

(1000-grain weight)/1000. 595

3 The P-value indicates the significance of the difference between TN13 and NIL_TN13sbn based on 596

Student’s t-test. 597

598

599

600

601

602

603

604

605

606

607

608

Figure Legends 609

34

610

Figure 1 Map-based cloning of qSBN7. (A) Plant architecture of IR65598-112-2. 611

Scale bar, 20 cm. (B) Plant architecture of TN13. Scale bar, 20 cm. (C) Panicle 612

structure of IR65598-112-2 and TN13. Scale bar, 4 cm. (D) Number of secondary 613

branches per panicle. (E) Number of grains per panicle. (F) A high-resolution map 614

delimiting the qSBN7 locus to a 9.3-kb region between the Indel2829 and SNP2830.9 615

markers. (G) The structure of two putative genes predicted in Rice Genome 616

Annotation Project release 7. A C/T SNP, 8461-bp insertion, and A/G SNP were 617

located 4066, 6102 and 6383 bp upstream of LOC_Os07g47330, respectively. Values 618

in D and E are means ± SD (n = 10 plants). 619

620

621

Figure 2 Expression analysis of two candidate genes and complementation test of 622

qSBN7. (A) Transcript levels of LOC_Os07g47340 at seedling and three panicle 623

development stages. (B) Transcript levels of LOC_Os07g47330 at seedling and three 624

panicle development stages. (C) Transcript levels of FZP in BIL-sbn and four 625

independent transgenic lines at the 1-mm panicle stage. (D) Panicle structure of 626

BIL-sbn. Scale bar, 4 cm. (E) Panicle structure of p66-01. Scale bar, 4 cm. (F) Panicle 627

35

structure of TN13. Scale bar, 4 cm. (G) Grains of BIL-sbn, p66-01, and TN13. Scale 628

bar, 5 mm. (H) Number of secondary branches per main panicle. (I) Number of grains 629

per main panicle. (J) Grain length. Values in A–C and H–J are means ± SD (n = 3 630

independent trials and 3 plants per trial in A–C; n = 10 plants in H–J). Data in D–J 631

were collected from plants grown in paddies under greenhouse conditions in the 2016 632

second crop season. The plant spacing was 15 cm between plants and 20 cm between 633

rows. Student’s t-test was used to examine P values. ** Significant at 1% level; * 634

Significant at 5% level; n.s., not significant. 635

636

637

Figure 3 Transgenic analysis for FZP through gene silencing. (A) Panicle structures 638

of TN13, BIL-sbn, and four transgenic T1 lines. Scale bar, 4 cm. (B) Comparison of 639

primary branch number per main panicle between TN13 and pRNAi-19. (C) 640

Comparison of secondary branch number per main panicle between TN13 and 641

pRNAi-19. (D) Comparison of grain number per main panicle between TN13 and 642

pRNAi-19. (E) Comparison of grain length between TN13 and pRNAi-19. (F) FZP 643

transcript levels in TN13, BIL-sbn, and six independent T2 transgenic lines. Values in 644

B–F are means ± SD (n = 10 plants in B–E; n = 3 independent trials and 3 plants per 645

36

trial in F). Data in A–E were collected from plants grown in paddies under greenhouse 646

conditions in the 2016 second crop season. The plant spacing was 15 cm between 647

plants and 20 cm between rows. Data in F were collected from plants grown in 648

paddies under greenhouse conditions in the 2017 first crop season. The plant spacing 649

was 23 cm between plants and 23 cm between rows. Student’s t-test was used to 650

examine P values. ** Significant at 1% level; * Significant at 5% level; n.s., not 651

significant. 652

653

654

Figure 4 Phenotypic characterization of TN13 and NIL_TN13sbn

. (A) Plant structure 655

of TN13 and NIL_TN13sbn

. Scale bar, 20 cm. (B) Panicle structure of TN13 and 656

NIL_TN13sbn

. Scale bar, 4 cm. (C) Grain size of TN13 and NIL_TN13sbn

. Scale bar, 5 657

mm. (D) Number of primary branches per main panicle. (E) Number of secondary 658

branches per main panicle. (F) Number of grains per main panicle. (G) Grain length. 659

(H) Number of grains per secondary branch. A completely randomized design with 660

three replications was used in all trials. Data in D–H were collected from plants 661

grown in paddies under natural conditions. The plant spacing was 15 cm between 662

plants and 30 cm between rows. Values in D–H are means ± SD (n = 10 plants). 663

37

Student’s t-test was used to examine P values. ** Significant at 1% level; n.s., not 664

significant. 665

666