29 dna polymerase active site

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc Val. 268, No. 32, Issue of November 15, pp. 24106-24113, 1993

Printed in U.S.A.

$29 DNA Polymerase Active Site RESIDUE ASPz4’ OF CONSERVED AMINO ACID MOTIF “Dx2SLYP” IS CRITICAL FOR SYNTHETIC ACTIVITIES*

(Received for publication, April 9, 1993, and in revised form, June 30, 1993)

Maria A. BlascoS, Jose M. Lkzaro, Luis Blanco, and Margarita Salass From the Centro de Biologia Molecular “Seuero Ochoa” (Consejo Superior de Inuestigaciones Cientificas- Uniuersidad Autonoma de Madrid), Universidad Autonoma, Cantoblanco, 28049 Madrid, Spain

429 DNA polymerase shares with other a-like DNA polymerases several regions of amino acid sequence similarity and sensitivity to inhibitors of eukaryotic DNA polymerase a. In this paper, site-directed mutants in the 429 DNA polymerase residues SerZ6’, Leuzb3, and Prozss of the conserved amino acid motif “DxzSLYP” are described. Two mutants, D249E and S252R, were drastically affected in all the synthetic activities, whereas their 3’ to 5’ exonuclease activity and interaction with the TP primer was normal. Mu- tant D249E, slightly affected in template-primer binding, was completely inactive in all conditions tested, suggesting that Aspz4’ could be playing a direct role in catalysis. On the other hand, mutant S252R, strongly affected in template-primer binding, showed some DNA polymerization activity in the presence of Mn2+. Mutants S252G and P255S showed a reduced template-primer binding ability; these mutants, together with mutant L253V, showed metal ion-dependent phenotypes in their synthetic activities and altered sensitivities to the PPi analog phosphonoacetic acid. All these results support the hypothesis that the DxzSLYP motif forms part of the polymerization active site of the 429 DNA polymerase, being the Aspz4’ residue critical both for protein-primed initiation and DNA polymerization.

The linear double-stranded DNA of phage 429 replicates by a protein-priming mechanism (Salas, 1991) in which a virally encoded DNA polymerase catalyzes both the formation of the TP. dAMP covalent complex (initiation reaction) and its further processive elongation to produce unit-length 429 DNA (Blanco and Salas, 1985a). Intrinsic properties of 429 DNA polymerase are its ability to produce strand displace- ment coupled to the polymerization process and its high processivity (Blanco et al., 1989). In addition, 429 DNA polymerase has two degradative activities, a 3’ to 5’ exonuclease activity (Watabe et al., 1984; Blanco and Salas, 1985b), involved in proofreading (Garmendia et al., 1992), and a pyrophosphorolytic activity (Blasco et al., 1991). The fact that

*This investigation was supported by research Grant 5R01 GM27242-13 from the National Institutes of Health, by Grant PB90- 0091 from Direccion General de Investigacibn Cientifica y Tecnica, by Grant BIOT CT 91-0268 from European Economic Community, and by an Institutional grant from Fundacion Ram6n Areces. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertzsement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Predoctoral fellow from Ministerio de Educacibn y Ciencia. § To whom correspondence should be addressed.

429 DNA polymerase is a small (66 kDa) single-subunit enzyme containing well characterized enzymatic activities make this polymerase an appropriate system for structure- function studies.

429 DNA polymerase has been included in the group of a- like DNA polymerases because of its sensitivity to specific inhibitors of eukaryotic DNA polymerase a (Blanco and Salas, 1986; Bernad et al., 1987) and because it contains several regions of amino acid similarity conserved among these group of polymerases (Larder et al., 1987a; Bernad et al., 1987; Wong et al., 1988; Blanco et al., 1991; Ito and Braithwaite, 1991; Braithwaite and Ito, 1993) that have been proposed to form the polymerization active site (Larder et al., 1987a; Gibbs et al., 1988). This hypothesis is supported by the fact that several altered sensitivities to drugs supposed to bind at the dNTP binding site map in or near these conserved regions (Larder et al., 1987a; Gibbs et al., 1988; Hall et al., 1989; Marcy et al., 1990; Matsumoto et al., 1990; Hwang et al., 1992).

Using a site-directed mutagenesis approach, the functional significance of the conserved regions characterized by motifs “Kx3NSxYG,” “YGDTDS,” and “KxY” has been described previously for 429 DNA polymerase; all the mutant polymerases showed normal 3‘ to 5’ exonuclease activity but they were affected in synthetic activities (protein-primed initiation and/or DNA polymerization). Motif Kx3NSxYG has been proposed to be involved in template-primer binding and dNTP selection (Blasco et al., 1992b, 1993); 429 DNA polymerase residues Asp4s6 and Asp458 of conserved motif YGDTDS have been proposed to be involved in metal binding and catalysis (Bernad et al., 1990), and mutations in conserved motif KxY have been shown to affect primer recognition (Blasco et al., 1992a). In additiod, a mutant in residue TyrZs4 of 429 DNA polymerase conserved motif Dx,SLYP has been described to be affected in Me2+-dNTP binding (Blasco et al., 199213).

In this paper, we report a detailed characterization of purified 429 DNA polymerase mutants D249E, S252G, S252R, L253V, and P255S in the conserved motif DxzSLYP of 429 DNA polymerase. The results obtained indicate that Asp249 could be involved in catalysis. Other phenotypes associated to mutants in this motif are a decreased ability to bind template-primer structures, metal ion-dependent phenotypes in synthetic reactions, and altered sensitivity to the PPi analog PAA.’

The abbreviations used are: PAA, phosphonoacetic acid; BSA, bovine serum albumin; dNTP, deoxynucleoside triphosphate; PP,, inorganic pyrophosphate; TP, $29 terminal protein; TP’DNA, $29 terminal protein-DNA complex; pol/exo, polymerase/exonuclease- coupled assay. Mutations are indicated by original amino acid (in

D249E = Aspz4’ to Glu. single-letter notation), its position, and the replacing amino acid i.e.

24106

429 DNA Polymerase Active Site 24107

MATERIALS AND METHODS

Nucleotides-Unlabeled nucleotides were purchased from Phar- macia P-L Biochemicals. [LY-~’P]~NTPs (400 Ci/mmol), [cY-~‘S]~ATP (600 Ci/mmol), and [y3*P]ATP (5000 Ci/mmol) were obtained from Amersham International PIC. The PPi analog PAA was from ICN.

Proteins-Restriction endonucleases, T4 DNA ligase, and poly- nucleotide kinase were from New England Biolabs. The site-directed mutagenesis kit, “Oligonucleotide-directed in uitro mutagenesis system Version 2,” was from Amersham International PIC. Sequenase version 2.0, from United States Biochemical Corp., was used for DNA sequencing. Wild-type or mutant 629 DNA polymerases were purified essentially as described (Blanco and Salas, 1984) with the modifica- tions to be published elsewhere. TP was purified as described (Zabal- 10s et d., 1989).

DNA Templates and Substrates-TP’DNA was isolated as described (Pedalva and Salas, 1982). Oligonucleotides SP1 (5’GATC- ACAGTGAGTAC), SPlc (5’GTACTCACTGTGATC) and SPlc+6 (5’TCTATTGTACTCACTGTGATC) were prepared as described (Blasco et al., 1992b). SP1 oligonucleotide was labeled with polynu- cleotide kinase and [-p3’P]ATP. Hybrid molecules SPl/SPlc and SPl/SPlc+G were obtained as described (Garmendia et al., 1992). EcoRI-digested $29 DNA was prepared from proteinase K-treated 629 DNA (Inciarte et al., 1976). 32P-dA-tailed DNA, prepared as described (Bernad et al., 1989), was used as substrate for quantitative analysis of the 3’ to 5’ exonuclease activity.

Plasmids and Bacteria-Plasmid pMBw2, harboring the $129 DNA polymerase gene, was obtained as described (Blasco et al., 1990). The E. coli strain K514 was used as a host for transformation with pT7-4 (Tabor and Richardson, 1985) recombinants containing the 429 DNA polymerase gene. The E. coli X lysogen BL21(DE3) pLysS (Studier and Moffatt, 1986) was used for expression of the mutant proteins.

Site-directed Mutagenesis and Expression of 629 DNA Polymerase Mutants-The wild-type 629 DNA polymerase gene cloned into M13 mp8 (M13 mp8w2) was used for site-directed mutagenesis, carried out essentially as described (Nakamaye and Eckstein, 1986). For expression, fragments carrying the different mutations were cloned in plasmid pMBw2 (Fig. l ) , which expresses 629 DNA polymerase

FIG. 1. Construction of recombinant plasmids containing site-directed mutations at conserved motif DxsSLYP of 629 DNA polymerase. The recombinant plasmids were con- structed as described under “Materials and Methods.” AmpR, ampicillin resist- ance; 610, promoter of bacteriophage T7; 1,2a, 3, and 4, indicate homology regions according to Blanco et al. (1991); these regions are also named 11,111, I, and VII, respectively, according to the original nomenclature of Larder et al. (1987a). The mutated region 1 is represented by a black box; wild-type regions are repre-

E, EcoRI; H, HindIII. sented by open boxes. A, AccI; B, BstBI;

under the control of the T7 RNA polymerase-specific 610 promoter (Tabor and Richardson, 1985). The presence of the desired mutations and the absence of any other changes were confirmed by complete sequencing of each 429 DNA polymerase mutant gene. Expression of the mutant proteins was carried out in the Escherichia coli strain BL21(DE3) pLysS, which contains the T7 RNA polymerase gene under the control of the lacUV5 promoter and, thus, it is inducible by the lactose analog isopropyl-1-thio-8-D-galactopyranoside (Studier - . ”

and Moffatt, 1986). 3’ to 5‘ Exonuclease Assavs-For auantitative analysis, 32P-dA-

tailed DNA (3.3 X lo6 cpm/pmol of 3’ end) was used as substrate to assay the exonucleolytic activity of wild-type or mutant 629 DNA polymerases. The reaction mixture contained, in 25 pl, 50 mM Tris- HCI (pH 7.5), 10 mM MgC12, 0.1 mg/ml BSA, 1 mM dithiothreitol, 4% glycerol, 50 mM NaCl, 70 ng of 32P-tailed DNA, and either 10 or 20 ng of each polymerase. After incubation for 1 min at 25 “C, the reactions were stopped with 40 mM EDTA, and the ethanol-soluble material was counted (Cerenkov radiation). Samples withdrawn immediately after incubation were also analyzed by thin-layer chroma- togragphy as described above. Densitometry of the spot corresponding to 5’-dAMP also allowed to obtain relative values (referred to those of the wild-type polymerase) of the 3’ to 5’ exonuclease activity for different mutant 629 DNA polymerases.

The dAMP turnover coupled to the “filling-in” assay (see later) was determined by polyethyleneimine-cellulose thin-layer chromatog- raphy (polygram cel 300 PEI/UV264) and further autoradiography of samples withdrawn immediately after the DNA polymerization reaction. The chromatogram was developed with 0.15 M lithium formate (pH 3.0), conditions in which it is possible to separate 5’-dAMP from DNA and unincorporated dNTP that remain at the origin.

DNA Polymerase Assay (Filling-in Reaction)-The reaction mixtures contained, in 25 PI, 50 mM Tris-HC1 (pH 7.5), 10 mM MgCI2, 1 mM dithiothreitol, 4% glycerol, 50 mM NaCI, 0.1 mg/ml BSA, 10 ng of either wild-type or mutant 629 DNA polymerase, 0.2 pg of EcoRI- digested 629 DNA as template, 0.25 p M [cY-~’P]~ATP, and 200 p~ each dGTP and dTTP. After incubation for 2 min at 30 “C, the reactions were stopped by adding up to 10 mM EDTA, 0.1% SDS, and the samples were filtered through Sephadex (2-50 spin columns.

H B A A E

Site-directed M13mp8w2 mutagenesis 9.5 Kb Site-directed in “D--SLYP” mutagenesis

D249E

H H B A

Ml3mp8Mutl 9.5 Kb

M13mp8D249E 9.5 Kb

H B A A E

t pMBD249E 4.6 Kb

APR

24108 429 DNA Polymerase Active Site The excluded volume was counted (Cerenkov radiation) and analyzed by agarose gel electrophoresis and autoradiography. Densitometric scans of the exposed films were done for quantitation.

PolymeraselEronuclease-coupled Assay (Pol/Exo Assay)-Hybrid molecules of oligonucleotide SPlc+6 (21-mer) and 5’-32P-labeled oligonucleotide SP1 (15-mer) (described before) were obtained. This hybrid, containing 5’-protruding ends, can be used both as substrate for the 3’ to 5’ exonuclease activity and as template-primer for DNA polymerization. The reaction mixture contained, in 12.5 pl, 50 mM Tris-HC1 (pH 7.51, 10 mM MgC12, 1 mM dithiothreitol, 0.1 mg/ml BSA, 0.4 ng of the hybrid molecule, and 10 ng of either wild-type or mutant $29 DNA polymerase. After incubation for 5 min at 30 ”C, the reactions were stopped by addition of EDTA to 10 mM. Samples were analyzed by 8 M urea, 20% polyacrylamide gel electrophoresis and autoradiography. Polymerization or exonuclease activities are detected as an increase or decrease, respectively, in the size of the 5’- labeled primer strand (SP1).

Gel Retardation Assay of Template-Primer DNA Molecules-The method was essentially as described (Carthew et al., 1985). Reaction mixtures contained, in 10 pl, 12 mM Tris-HC1 (pH 7.5), 1 mM EDTA, 20 mM ammonium sulfate, 0.2 ng of hybrid molecules of oligonucleotide SPlc+6 (21-mer), and 5’-32P-labeled oligonucleotide SP1 (15- mer) and the indicated amount of either wild-type or mutant $29 DNA polymerase. Mixtures were incubated for 30 min at 4 “C. Elec- trophoresis was carried out in 4% polyacrylamide gels containing 12 mM Tris acetate (pH 7.5), 1 mM EDTA, and run at 200 V in the same buffer, during 1 h at 4 “C. After electrophoresis, gels were dried and autoradiographed. $29 DNA polymerase-DNA complexes were detected as a shift (retardation) in the position of the labeled DNA.

Initiation Assay (TP.dAMP Formation)-The reaction mixture contained, in 25 pl, 50 mM Tris-HC1 (pH 7.5), either 10 mM MgCl, or 1 mM MnC12, 20 mM ammonium sulfate, 0.1 mg/ml BSA, 1 mM dithiothreitol, 4% glycerol, 50 mM NaCl, 0.25 p M [cx-~’P]~ATP, the indicated amounts of purified TP, and either wild-type or mutant $29 DNA polymerase and, when indicated, TP.DNA (0.5 pg) as template. After incubation for the indicated time and temperature, the reaction was stopped by adding up to 10 mM EDTA, 0.1% SDS, the samples were filtered through Sephadex G-50 spin columns in the presence of 0.1% SDS, and the excluded volume was analyzed by SDS-polyacrylamide gel electrophoresis and autoradiography as described (Peiialva and Salas, 1982). Quantitation was done by densitometry of the radioactive bands corresponding to TP’dAMP.

To measure the apparent kinetic constants, the initiation reaction was carried out essentially as described above, with 20 ng of TP and 20 ng of either wild-type or mutant $29 DNA polymerase, T P ’DNA (0.5 pg) as template, 0.25 p~ [cx-~’P]~ATP, and variable amounts of unlabeled dATP. Incubation was for 8 min when M%+ was used, and for 80 s with Mn”, conditions shown to be linear with time and enzyme doses. The formation of the TP . dAMP complex was determined as described above. Apparent K, and Vmax values were determined for each DNA polymerase using Lineweaver-Burk plots of the experimental results.

Competition Assays for TP Binding between Wild-type and Mutant $29 DNA Polymerases-Reactions were carried out as described under “Initiation Assay,” in the absence of TP.DNA and using invariant amounts of TP (12.5 ng) and wild-type 429 DNA polymerase (25 ng). Increasing amounts of the indicated mutant $29 DNA polymerase were added to the assay. After incubation for 3 h at 30 “C, the reactions were stopped by adding up to 10 mM EDTA, 0.1% SDS, and filtered as above. Quantitation was done by densitometry of the radioactive bands corresponding to TP. dAMP.

Elongation of TP. dAMP Initiation Compler-The incubation mixtures contained, in 25 pl, 50 mM Tris-HC1 (pH 7.5), either 10 mM MgCl, or 1 mM MnCl’, 1 mM dithiothreitol, 4% glycerol, 0.1 mg/ml BSA, 20 mM ammonium sulfate, the indicated concentration of each dNTP and 0.25 p~ [cx-~’P]~ATP, 0.5 pg of TP.DNA, 20 ng of TP, and 20 ng of either wild-type or mutant $29 DNA polymerase. When indicated, PAA was added. After incubation for the indicated time at 30 ‘C, the reactions were stopped by adding up to 10 mM EDTA, 0.1% SDS, filtered as above, and the Cerenkov radiation counted. Samples were subjected to alkaline 0.7% agarose gel electrophoresis and autoradiography.

Replication of Primed M13 DNA-The incubation mixture contained, in 25 pl, 50 mM Tris-HC1 (pH 7.5), either 10 mM MgCL or 1 mM MnC12, 20 mM ammonium sulfate, 1 mM dithiothreitol, 4% glycerol, 0.1 mg/ml BSA, 20 p M of each dNTP and 0.25 p M [ L U - ~ ~ P ] dATP, 0.25 pg of primed M13 single-stranded DNA, and 20 ng of either wild-type or mutant $29 DNA polymerase. After incubation

for 30 min at 30 “C, the reactions were stopped by adding up to 10 mM EDTA-0.1% SDS, the samples were filtered through Sephadex G-50 spin columns in the presence of 0.1% SDS, and the excluded volume was analyzed by alkaline 0.7% agarose gel electrophoresis and autoradiography. Densitometric scans of the exposed films were done for quantitation.

RESULTS

Site-directed Mutants in 429 DNA Polymerase Conserved Motif DX2SLYP-Dx2SLYP is one of the most conserved amino acid motifs in the C-terminal part of a-like DNA polymerases. The Asp and Tyr residues are invariant in the 39 a-like DNA polymerases compared. The Ser and Pro residues are invariant in 38 and 37 sequences, respectively. The Leu residue, the most variable, is present in 34 a-like DNA polymerases. Residues Aspz4’, SerZ5’, Tyr254, and Pro255 form conserved motif Dx2SLYP in 429 DNA polymerase. Changes in these conserved amino acid residues were selected for site-directed mutagenesis, taking into account secondary structure predictions (Chou and Fasman, 1978; Garnier et al., 1978). Mutants D249E, S252G, S252R, L253V, and P255S were obtained. A mutant in Tyr254 residue (Y254F) of 429 DNA polymerase was already described in previous works (Blanco et al., 1991; Blasco et al., 1992b) to be affected in Me2+-dNTP binding. Mutant proteins were overexpressed and purified as described under “Materials and Methods.”

3’ to 5’ Exonuclease Activity of 429 DNA Polymerase Mu- tants in Conserved Motif Dx2SLYP-As expected from the N- terminal location proposed for the 3’ to 5‘ exonuclease domain (Bernad et al., 1989; Blanco et al., 1991; Soengas et al., 1992) of 429 DNA polymerase, single substitutions at conserved residues Aspz4’, SerZ5’, TyrZs4 (Blasco et al., 1992b), and did not diminish exonuclease activity, measured as degradation of “P-dA-tailed DNA (see Table I); in fact, this activity was even increased (2-3-fold) compared with that of the wild-type 429 DNA polymerase.

d N T P Incorporation on Ternplate-Primer DNA Molecules- Wild-type and mutant 429 DNA polymerases were assayed in filling-in of EcoRI ends as described under “Materials and Methods”; in this assay, the template-directed incorporation of [32P]dATP to a DNA primer is studied. In the presence of M$+ as metal activator, mutants D249E and S252R showed no detectable polymerization activity, whereas mutants S252G, L253V and P255S had 60-70% the wild-type activity (see Table I). Mutant Y254F was described previously to have normal polymerization activity (Blasco et al., 1992b; see also Table I). When the dAMP turnover coupled to the filling-in reaction carried out by mutants D249E and S252R was analyzed (see “Materials and Methods”; not shown), no detectable turnover was seen, indicating that no incorporation of labeled [32P]dAMP had occurred. Mutants S252G, L253V, and P255s had a similar turnover to that of the wild-type 429 DNA polymerase (not shown), ruling out a possible defect of these mutans in either translocation or stabilization of the incor- porated nucIeotide; this contrasts with the high turnover described for mutant Y254F (Blanco et al., 1991; Blasco et al., 1992b). Interestingly, when Mn2+ was used as metal activator (see Table I), some dNTP incorporation by mutant S252R was detected, showing 13% the wild-type activity. On the contrary, mutant P255S showed a reduced polymerization activity as compared with the one in the presence of M F ; mutants S252G and L253V showed similar activity to that of the wild-type enzyme, and no polymerization activity was detected for mutant D249E. Mutant Y254F was previously shown to have 250% the wild-type activity in the presence of Mn2+ (Blasco et al., 199213; see also Table I).

Using a pol/exo-coupled assay (see “Materials and Meth-

$29 DNA Polymerase Active Site 24109 TABLE I

Enzymatic activities of wild-type and mutant 429 DNA polymerases Single dNTP incorporation

Polymerization TP as primer DNA as

primer, 3 ' 4 '

DNA Replication Filling-in Primed M13 TP,DNA Exonuclease

activity Polymer= TP . DNA No t-=wlak template template of spl/

(TP . (TP . (SP1/ (EcoRI DNA dAMP) dAMP) SPlc+G)" SPlc+d ends) replication replication'

% " P M % Wild type 100/lOOd lOOd 0.005 1 100/100d 100/100d D249E < l / < l d <Id >500 >500 <l/<ld <0.5/<0.5d S252G 28/7od 2Od 0.01 1 60/7od 90/80d S252R < l / < l d <Id 10 >500 <1/13d <0.5/ad L253V 9/63d 50d 0.01 1 70/100d 120/74d Y254F 3/12d 1 4d 0.025 5 97/250d 13/107d P255S 240/100" 126d 0.001 0.3 70/16d 122/25d

dNTP concentration required to incorporate the first dNTP on SPl/SPlc+G molecules. dNTP concentration required to fully replicate SPl/SPlc+6 molecules. Activity values relative to wild-type enzyme using 20 mM dNTPs. Activitv values relative to wild-twe enzvme. using Mn2+ as metal activator.

% 100/100d 100

<0.5/<0.5d 177 8/70d 218

<0.5/<0.5d 254

3/179d 200 54/2d 125

1/80d 272

e ActiviG values extracted from B i k o etal. (1992b).

ods") the elongation of a 5"labeled primer (15-mer) hybrid- ized to a short template molecule (21-mer) was analyzed in the presence of Mg2+ as metal activator. As described previously for wild-type DNA polymerase (Garmendia et al., 1992; Blasco et al., 1992b), when increasing amounts of unlabeled dNTPs are provided, elongation competes exonucleolysis, and dNTP incorporation is observed as an increase in the size of the labeled primer. Using this experimental approach two kind of measurements were carried out: the dNTP concentration required to incorporate the first dNTP on 15/21-mer molecules and also the dNTP concentration required to fully replicate the molecule; this last value could be indicative of the translocation ability of mutant polymerases. Wild-type 429 DNA polymerase needs 0.005 p~ dNTPs to extend the 15-mer primer one nucleotide and 1 p~ dNTPs to fully replicate the molecule (see Table I). Mutant D249E was not able to extend the 15-mer primer, even at 500 p~ dNTPs (see Table I), and, consequently, no replication was observed. Mutant S252R needed 10 p~ dNTPs to obtain the 16-mer product, and no full replication was observed when dNTP concentrations up to 500 p~ were added (see Fig. 2B and Table I). Mutants S252G and L253V needed 0.01 p~ dNTPs to extend the 15-mer primer one nucleotide, and the same dNTPs concentration than the wild-type enzyme to fully replicate the molecule (see Table I and Fig. 2, A and C ) . Interestingly, with mutant P255S, the 16-mer product was obtained with only 0.001 p~ dNTPs, 5-fold less dNTP concentration than with the wild-type DNA polymerase (see Table I and Fig. 2D), suggesting a higher affinity of this mutant polymerase for dNTPs. In agreement with that, this mutant polymerase needed lower dNTP concentration (0.3 pM) than the wild-type enzyme to fully replicate 15/21-mer molecules (see Table I). Mutant Y254F was described previously to need 5-fold more dNTP concentration than the wild- type enzyme to incorporate the first nucleotide and for full replication (Blasco et al., 1992b; see Table I).

Primed M13 DNA replication assays were carried out to study processive polymerization by wild-type and mutant DNA polymerases. As shown in Table I, when M$+ was used as metal activator, mutants S252G, L253V, and P255S showed similar activity to that of the wild-type enzyme, mutant Y254F was 13% active (Blasco et al., 1992b), and mutants D249E and S252R showed no detectable polymerization activity, as expected from the previous data. As it was the case

in the filling-in reaction, in the presence of Mn2+ some dNTP incorporation by mutant S252R was detected, having 8% the wild-type activity, and mutant P255S showed a reduced polymerization activity compared with that of the wild-type polymerase; mutants S252G, L253V, and Y254F(Blasco et al., 1992b) showed similar activity to that of the wild-type enzyme, and no activity was detected for mutant D249E (see Table I).

All the above data indicate that mutants S252G, L253V, and P255S have a similar activity than wild-type 429 DNA polymerase both in processive (primed M13 DNA replication) and nonprocessive (filling-in) DNA polymerization when Mg2+ is used as metal activator; on the other hand, when Mn2+ is used, mutant P255S has a reduced polymerization activity, and mutants S252R and Y254F have increased polymerization activities as compared with the ones in the presence of M$+.

Gel Retardation Assays of Template-Primer DNA Molecules by Wild-type or Mutant 429 DNA Polymerases-To study the affinity of wild-type and mutant 429 DNA polymerases for template-primer DNA molecules, gel retardation assays were carried out. As shown in Fig. 3, wild-type 429 DNA polymerase was able to retard labeled hybrid 15/21-mer molecules, giving rise to a single retardation band (Blasco et al., 1993). Mutants Y254F (not shown) and L253V were able to retard this DNA to a similar extent than wild-type 429 DNA polymerase. Mutants D249E, P255S, and S252G were able to retard these molecules, but to a lower extent than wild-type 429 DNA polymerase (about 2-3-fold reduction), and mutant S252R was very unefficient.

Ability of $29 DNA Polymerase Mutants in Conserved Motif Dx2SLYP to Form TP' dAMP Complex (Initiation of 429 DNA Rep1icatwn)"The phenotype of the different mutant polymerases in initiation of 429 DNA replication was studied ana- lyzing the formation of TP .dAMP, the initiation product. Mutant proteins D249E and S252R showed no detectable dAMP incorporation in this reaction in the presence of either M$+ or Mn2+ as metal activator (see Table I and Fig. 4A). Mutants S252G, L253V, Y254F (Blasco et al., 1992b), and P255S showed 28,9,3, and 240%, respectively, the activity of the wild-type enzyme when M$+ was used as metal activator. Interestingly, when MnZ+ was used, the activity values of mutants S252G, L253V, Y254F (Blasco et al., 1992b), and P255S were 70, 63, 12, and loo%, respectively, suggesting a

24110 429 DNA Polymerase Active Site

A B

0 I 2 5 10 25 50 100 300 1x1d1x1~3x10J 0 1 2 5 IO 25 50 100 300 lxld1x1~3x104

dNTPs. nM dNTPs, nM

D

i . L

7-

0 I 2 5 IO 25 50 100 300 lxld1x1~3x10J 0 1 2 5 10 25 50 IO0 300 lxldlx1~3x10~

dNTPs, nM dNTPs. nM FIG. 2. DNA polymerase/exonuclease coupled away. The assay was carried out as described under "Materials and Methods," using

32P-labeled hybrid molecules SPl/SPlc+G as template-primer DNA, the indicated concentration of each dNTP, and the 429 DNA polymerase mutants S252G ( A ) , S252R ( B ) , L253V (C) and P255S (D). Arrows indicate the 15-mer position (nonelongated primer) and 21-mer position (completely elongated primer). In the case of mutant S252R only the 15-mer position is indicated by an arrow.

metal ion-dependent phenotype of these mutant DNA polymerases in the initiation reaction (see Table I). To study this metal ion effect, the K , for dATP and V,, for mutant polymerases were determined in the initiation reaction using either M e or Mn2+ as metal activator (see Table 11). When M e was used as metal activator, mutant S252G showed similar K , for dATP to that of the wild-type enzyme, but the V,,, was reduced 5-fold; when Mn2+ was used, K , and Vma,

values were more similar to those of the wild-type enzyme, resulting in an increase in the efficiency of the reaction as compared with M e . Mutant L253V showed a K , for dATP of 60 p~ and a %fold reduced Vma, compared with that of the wild-type enzyme in the presence of M e ; when Mn2+ was used, the K , and Vma, values were essentially normal, resulting in an increase in the efficiency of dNTP incorporation for this mutant polymerase as compared with the activity in the


wt

FIG. 3. Gel retardation assay of 15121-mer

template-primer DNA molecules by wild-type or mutant 429 DNA polymerases. The assay was carried out as described under “Materials and Meth- ods” using 32P-labeled hybrid molecules SPl/SPlc+6 as template-primer DNA. The different amounts of DNA polymerase used are indicated. Arrows indicate the retardation band of SPl/SPlc+G (15/21-mer) by DNA polymerase and the 15/21-mer+ ( nonretarded SPl/SPlc+6 (15/21-mer) and SP1 (15-mer) bands.

+ + Pol

lbmer +

~ ~ _ _ _ _ _ _ D249E P255S wt S252G S252R L253V

a-

029 DNA Pol, ng - 157.53.7

A

Wt D249E S252G S252R L253V P255S

0 - - - - - - .) C T P - d A M P

B

04 I 0 50 100 150 200

MUTANT POLYMERASE D249E. ng

FIG. 4. A, formation of TP.dAMP initiation complex catalyzed by wild-type and mutant 629 DNA polymerases. The reaction conditions were as described under “Materials and Methods” in the presence of 20 ng of TP, 20 ng of the indicated DNA polymerase, and Mg2‘ as metal activator. Incubation was for 10 min at 30 “C. After reaction, samples were analyzed in polyacrylamide gels and autoradiographed. Radioactive bands corresponding to TP dAMP initiation complex are shown. B, competition for T P primer between wild-type and mutant DNA polymerases. The reaction conditions were as described under “Materials and Methods.” The graphic represents both theoretical and experimental values of inhibition of template- independent TP-deoxynucleotidylation by wild-type DNA polymerase when increasing amounts of mutant polymerase D249E were added.

TABLE I1 Apparent kinetic constants of wild-type and mutant 429 DNA

Dolvmerases in the initiation reaction Me MnZ+ V-lKm

Polymerase Kma V,. K,” V,. M e Mn2+

P M f lM Wild type 16 1 1.4 1 100 100 S252G 15 0.2 1.5 0.7 22 70 L253V 60 0.3 2.3 1.1 7 70 P255S 7.5 0.8 0.7 0.5 176 100

K,,, value for dATP.

157.53.7 157.53.7 - 157.53.7 157.53.7 157.53.7 157.53.7

presence of Mg+. Mutant P255S showed a K, for dATP of 7.5 ~ L M and a similar V,, to that of the wild-type enzyme when M e was used as metal activator; when Mn2+ ions were used, the K,,, for dATP was 0.7 p ~ , but the Vmax was half the one for the wild-type enzyme, resulting in a reduction of the efficiency of the reaction with Mn2+ with respect to that obtained with M e . The fact that this mutant showed a higher affinity than the wild-type enzyme for dATP in the initiation reaction agrees with the finding that it needed lower dNTP concentration than wild-type DNA polymerase in pol/ exo assays (see before). Mutant Y254F was described to have a K,,, for dATP 15-fold higher than wild-type 429 DNA polymerase in the presence of M e and only 4-fold higher in the presence of Mn2+ (Blasco et al., 1992b).

Using Mn2+ as metal activator, TP-deoxynucleotidylation can be detected in the absence of any template (Blanco et dl., 1992). This template-independent deoxynucleotidylation of TP catalyzed by $29 DNA polymerase is a powerful tool to distinguish those mutations that are affecting template binding from those directly affecting dNTP binding and/or catalysis. As shown in Table I, the values for TP. dAMP formation observed for mutants in conserved motif Dx2SLYP were similar in the absence or in the presence of template, except in the case of mutant S252G that had a lower activity in the absence than in the presence of template. Mutants D249E and S352R were studied in competition assays with wild-type $29 DNA polymerase for the TP, to test if these mutant polymerases were affected in the interaction with the TP primer in the initiation reaction. As shown in Fig. 4B, mutant polymerase D249E was able to interact with TP, inhibiting TP. dAMP complex formation by wild-type 429 DNA polymerase. The pattern of inhibition was similar to the theoretical one (if interaction of mutant polymerase D249E with TP is the same than that of the wild-type enzyme). The same result was obtained with mutant polymerase S252R (not shown).

429 DNA Replication: Elongation of TP.dAMP Initiation Complex by 429 DNA Polymerase Mutants-429 DNA polymerase is able to elongate TP-dAMP initiation product up to full-length 429 DNA using TP .DNA as template and high concentration of dNTPs. This process requires strand dis- placement and a high processivity, two properties of wild-type 429 DNA polymerase (Blanco et al., 1989). Fig. 5 shows the ability to elongate TP.dAMP initiation product at different dNTPs concentration by wild-type or mutant DNA polymerases, using either Mg2+ or Mn2+ as metal activator. Table I shows the activity values relative to that of the wild-type polymerase for the mutant proteins when the dNTP concentration used was 20 p ~ , with M e or Mn2’ as metal activator. Mutants D249E and S252R were unable to replicate TP.

24112 429 DNA Polymerase Active Site

dNTPs, pM dNTPs, FM

FIG. 5. Effect of MgP* and MnP+ in TP.DNA replication at different dNTPs concentration using either wild-type or mutant 429 DNA polymerases. The reaction conditions were as described under “Materials and Methods.” Incubation was for 10 min at 30 ‘C.

rm I,

pzus 0 20

o l m m x a w s m 0.0 0 1 0.4 0.8 0.8 1.0

PAA, pM PAA, pM FIG. 6. Sensitivity to PAA by wild-type or mutant 429 DNA

polymerases in TP.DNA replication. The reaction conditions were as described under “Materials and Methods.” 20 PM dNTPs and 20 ng of the indicated DNA polymerase were used. Incubation was for 10 min at 30 “C.

DNA, as expected from the fact that these mutants were unable to carry out the initiation reaction. Mutant S252G was 8% active when MgZ+ was used as metal activator; when Mn2+ was used, the replication activity of mutant S252G increased to 70% that of the wild-type 429 DNA polymerase. Mutant L253V, that was only 1% active in TP DNA replication when Mg2+ was used, became 80% as active as the wild-type enzyme when Mn2+ ions were used. As described previously (Blasco et al., 1992b), mutant Y254F, that was only 3% active with M%+, became 179% active in the presence of Mn2+ (see Table I). On the contrary, mutant polymerase P255S had 54% the activity of the wild-type enzyme when M$+ was used as metal activator, but its activity decreased to 2% that of wild-type DNA polymerase when Mn2+ was used. Considering that mutants S252G and L253V showed similar activity to that of the wild-type enzyme in primed M13 DNA replication assays (see before), both in the presence of Mg2+ or Mn2+ as metal activators, the metal ion effect observed for these two mutant polymerases in TP.DNA replication is probably a conse- quence of the metal ion effect in the initiation step. On the contrary, mutant P255S also showed a reduced polymerization activity in filling-in and primed M13 DNA replication assays when Mn2+ was used as metal activator (see before), indicating that the metal ion effect for this mutant polymerase is general to all the polymerization reactions.

Mutants in Conserved Motif Dx2SLYP Show an Altered Sensitivity to PAA-429 DNA polymerase has a moderate sensitivity to PAA in TP DNA replication assays (Bernad et al., 1987) and in primed M13 DNA replication assays (not shown). As shown in Fig. 6, mutants S252G and P255S were hypersensitive to PAA in TP . DNA replication. In the pres-

ence of M e , IC, values (drug concentration at which enzyme activity is 50% that of the control) were 150, 70, and 20 p ~ , respectively, for wild-type DNA polymerase and mutants S252G and P255S. Interestingly, when Mn2+ was used as metal activator (Fig. 6), wild-type 429 DNA polymerase sensitivity to PAA increased up to 1000-fold, being the IC, value of 0.2 KM, indicating that the inhibitory effect of PAA strongly depends on the divalent cation used. Mutants S252G and P255S were also hypersensitive to PAA in the presence of Mn2+, their ICso values being 0.08 and 0.04 p ~ , respectively, whereas mutant L253V was resistant, its ICw value being 0.6 p ~ . Similar results were observed in primed M13 DNA replication assays (not shown).

DISCUSSION

429 DNA polymerase shares with other a-like DNA polymerases several regions of amino acid homology along the primary structure (for review see Blanco et al., 1991; Ito and Braithwaite, 1991; Braithwaite and Ito, 1993). In this paper, a functional analysis of site-directed mutants in residues Aspz4’, Se352, and of 429 DNA polymerase conserved motif Dx2SLYP is described. In agreement with the N-terminal location of the 3‘ to 5’ exonuclease activity (Bernad et al., 1989; Soengas et al., 1992), none of the mutations in this conserved motif reduced this activity, but altered phenotypes in synthetic activities were observed. The con- servative change to Glu drastically abolished synthetic activities, although this mutant enzyme was able to interact normally with TP, and it was only slightly affected in template-primer DNA binding. Our results suggest that the Asp residue, invariant in all a-like DNA polymerases described up to now, could have a direct role in catalysis. Moreover, site- directed mutation of 429 DNA polymerase residue Asp249 to Asn (D249N) has been also obtained; preliminary studies with crude fractions indicate that this mutant polymerase is not able to catalyze the formation of the TP . dAMP complex.2 On the other hand, a single mutation at residue Asp22o (D220V) of conserved motif Dx2SLYP of phage PRDl DNA polymerase reduced the activity to 0.7% in an “in vivo” complemen- tation assay (Jung et al., 1990). Two other Asp residues in 429 DNA polymerase, Asp4M and Asp468 (located in conserved motif YGDTDS), have been proposed to be involved in catalysis at the polymerization active site (Bernad et al., 1990). We propose that Aspz4’, together with Asp466 and Asp458, may be close in the three-dimensional structure of 429 DNA polymerase, contributing to the catalysis, perhaps acting as metal ligands. Similar groups of acidic residues have been described to be critical for the maintenance of the synthetic activities in E. coli DNA polymerase I Klenow fragment (Polesky et al., 1990, 1992), HIV-I reverse transcriptase (Lar- der et al., 1987b,1989), T7 RNA polymerase (Osumi-Davis et al., 1992; Bonner et al., 1992) and several RNA virus replicases (Inokuchi and Hirashima, 1987; Jablonsky et al., 1991; Sankar and Porter, 1992; Ribas and Wickner, 1992).

Two site-directed mutants have been obtained in 429 DNA polymerase residue Ser2s2, S252R and S252G. Mutant S252R was inactive in all the synthetic activities when M P was used as metal activator, but when Mn2+ was used, the polymerization activity on template-primer molecules was partially recovered; this mutant, although able to interact with the TP primer, was unable to bind to template-primer molecules in gel retardation assays. Furthermore, mutant S252G also showed a reduction in binding to template-primer DNA, indicating that residue S e P 2 could have a role in DNA binding.

M. A. Blasco, L. Blanco, and M. Salas, unpublished results.


On the other hand, 429 DNA polymerase mutant S252G was mainly affected in reactions involving the use of TP. DNA as template (see Table I), although in the presence of Mn2+ ions, these activities increased to the levels of wild-type 429 DNA polymerase.

Mutant L253V was not affected in template-primer DNA binding, but it was strongly affected in reactions involving the use of TP as primer; again, in the presence of Mn2+, this mutant polymerase recovered similar activity values to those of the wild-type enzyme. Interestingly, mutant P255S showed a reversal metal ion-dependent phenotype (Mn" being a poorer activator than Mg2+), but in this case, in synthetic reactions involving the use of either TP or DNA as primer. This mutant showed a 2-3-fold reduced template-primer DNA binding. The fact that mutants in residues SerZ5', Tyr254 (Blasco et al., 1992b), and Pro255 showed metal ion- dependent phenotypes could be explained by the proximity of these residues to critical Aspz4' that, as proposed before, could be acting as a metal ligand.

429 DNA polymerase has been described to be sensitive to the PPi analog PAA (Bernad et al., 1987). As shown in this paper, the PAA inhibitory effect is strongly dependent on the metal ion used; when Mn2+ was used as metal activator in 429 DNA replication assays, the IC6, value for PAA decreased from 140 FM (when Mg2' is used) to 0.2 PM, making PAA a powerful inhibitor of 429 DNA replication. Mutants S252G and P255S were shown to be more sensitive to PAA than wild-type 429 DNA polymerase, both in TP.DNA and in primed M13 DNA replication assays. Mutant L253V was shown to be less sensitive than the wild-type 429 DNA polymerase to PAA in both assays. Mutant Y254F had no altered sensitivity to this These results agree with the previous description of several altered sensitivities to PAA in/or near this conserved motif in other DNA polymerases (Larder et al., 1987a; Gibbs et al., 1988; Matsumoto et al., 1990). Recently, it has been reported that a single mutation at T4 DNA polymerase residue Leu412 (L412 M), located in the Dx,SLYP motif, conferred PAA sensitivity in vivo; furthermore, in vitro studies showed that this mutation made T4 DNA polymerase hypersensitive to PAA and increased its translocation ability (Reha-Krantz et al., 1993). In the case of the mutants described in this paper at the 429 DNA polymerase DxzSLYP conserved motif, there was not a direct relationship between alterations in translocation and PAA sensitivity.

The results presented in this paper and in previous ones (Blanco et al., 1991; Blasco et al., 1992b) strongly support the hypothesis that the Dx2SLYP conserved motif forms part of the polymerization active site of a-like DNA polymerases. The 429 DNA polymerase Ser residue of this motif is proposed to be involved in DNA binding and the Asp residue in catalysis of both TP-primed initiation and DNA polymerization.

Acknowledgments-We thank L. Villar for sequencing the 429

M. A. Blasco, J. M. Lazaro, L. Blanco, and M. Salas, unpublished data.

DNA polymerase mutant genes. We are grateful to Drs. S. Tabor and C. C. Richardson for plasmid pT7-4 and to Dr. Studier for E. coli strain BL21(DE3) pLysS.

REFERENCES Bernad, A., Zaballos, A., Salas, M., and Blanco, L. (1987) EMBO J. 6 , 4219-

Bernad, A,, Blanco, L., Lazaro, J. M., Martin, G., and Salas, M. (1989) Cell 6 9 ,

Bernad, A,, Lharo, J. M., Salas, M., and Blanco, L. (1990) Proc. Natl. Acad.

Blanco, L., and Salas, M. (1984) Proc. Natl. Acad. Sci. U. S. A . 8 1 , 5325-5329 Blanco, L., and Salas, M. (1985a) Proc. Natl. Acad. Sci. U. S. A. 82,6404-6408 Blanco, L., and Salas, M. (1985b) Nucleic Acids Res. 13 , 1239-1249

Blanco, L., Bernad, A., Lazaro, J. M., Martin, G., Garmendia, C., and Salas, Blanco, L., and Salas, M. (1986) Virology 163,179-187

Blanco, L., Bernad, A,, Blasco, M. A., and Salas, M. (1991) Gene (Amst . ) 100 ,

Blanco, L., Bernad, A,, Esteban, J. A., and Salas, M. (1992) J. Bid. Chem. 2 6 7 ,

4225

219-228

Sci. U. S. A . 87,4610-4614

M. (1989) J . Biol. Chern. 264,8935-8940

27-38

Blasco, M. A., Blanco, L., Pares, E., Salas, M., and Bernad, A. (1990) Nucleic

Blasco, M. A., Bernad, A., Blanco, L., and Salas, M. (1991) J . Biol. Chern. 2 6 6 ,

1225-1230

Acids Res. 18,4763-4470

Blasco, M. A,, Esteban, J. A,, MQndez, J., Blanco, L., and Salas, M. (1992a)

Blasco, M. A,, Lazaro, J. M., Bernad, A., Blanco, L., and Salas, M. (1992b) J.

Blasco, M. A,, Lkaro, J. M., Blanco, L., and Salas, M. (1993) J. Biol. Chern.

Braithwaite, D. K., and Ito, J. (1993) Nucleic Acids Res. 2 1 , 787-802 Bonner, G., Patra, D., Lafer, E. M., and Sousa, R. (1992) EMBO J. 11,3767-

Carthew, R. W., Chodosh, L. A., and Sharp, P. A. (1985) Cell 43,439-448 Chou, P. Y., and Fasman, G. D. (1978) Adu. Enzyrnol. 47,45-148 Garmendia, C., Bernad, A,, Esteban, J. A,, Blanco, L., and Salas, M. (1992) J.

Garnier, J., Osguthorpe, D. J., and Robson, B. (1978) J. Mol. Biol. 120,97-120 Gibbs, J., Chiou, H., Bastow, K., Cheng, Y., and Coen, D. M. (1988) Proc. Natl.

Hall, J. D., Wang, Y., Pierpont, J., Berlin, M. S., Rurdlett, S. E., and Woodward,

Hwang, C. B, Ruffner, K. L., and Coen, D. M. (1992) J. Virol. 6 6 , 1774-1776 Inclarte, M. R., Lazaro, J. M., Salas, M., and Viriuela, E. (1976) Virology 74 ,

Inokuchi, V., and Hirashima, A. (1987) J. Virol. 61,3946-3949 Ito, J., and Braithwaite, D. K. (1991) Nucleic Acids Res. 19,4045-4057 Jablonsky, S. A,, Luo, M., and Morrow, C. D. (1991) J. Virol. 6 6 , 4565-4572 Jung, G., Leavitt, M. C., Schultz, M., and Ito, J. (1990) Biochem. Biophys. Res.

Larder, B. A., Kemp, S. D., and Darby G. (1987a) EMBO J. 6,169-175 LaJd:rLBAA., Purifoy, D. J., Powell, KI L., and Darby, G. (1987b) Nature 3 2 7 ,

7904-7909

Chrornosom 102,32-38

Biol. Chem. 267,19427-19434

268,16763-16770

3775

Biol. Chern. 2 6 7 , 2594-2599

Acad. Sci. U. S. A . 85,6672-6676

S. (1989) Nucleic Acids Res. 17,9231-9231

314-323

Comnun. 170,1294-1300

Larder, B. A., Kemp, S. D., and Purifoy, D. J. M. (1989) Proc. Natl. Acad. Sci.

Marcy, A. I., Hwang, C. B., Ruffner, K. L., and Coen, D. M. (1990) J. Virol.

Matsumoto, K., Kim, Ch. I., Kobayashi, H., Kanehiro, H., and Hirokawa, H.

Nakamaye, K., and Eckstein, F. (1986) Nucleic Acids Res. 14,9679-9698 Osumi-Davis, P. A,, De Aguilera, M. C., Woody, R. W., and Woody, A.-Y. M.

Peiialva, M. A,, and Salas, M. (1982) Proc. Natl. Acad. Sci. U. S. A. 79 , 5522-

Polesky, A. H., Steitz, T. A,, Grindley, N. D. F., and Joyce, C. M. (1990) J.

Polesky, A. H., Dahlber , M. E., Benkovic, S. J. , Grindley, N. D. F., and Joyce,

Reba-Krantz, L. J., Nonay, R. L., and Stocki, S. (1993) J . Virol. 67,60-66 Ribas, J. C., and Wickner, R. B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,2185-

I l b - l l ' l

U. S. A . 86,4803-4807

64,5883-5890

(1990) Virology 178,337-339

(1992) J. Mol. Biol. 226,37-45

5526

Biol. Chern. 2 6 6 , 14579-14591

C. M. (1992) J. Biol. (!hem. 267,8417-8428

2189 Salas, M. (1991) Annu. Reu. Eiochern. 60,39-71 Sankar, S., and Porter, A. G. (1992) J. Bid. Chern. 2 6 7 , 10168-10176 Soengas, M. S., Esteban, J. A., Lazaro, J. M., Bernad, A., Blasco, M. A

Studier, F. W., and Moffatt, B. A. (1986) J. Mol. Biol. 189 , 113:130 Tabor, S., and Richardson, C. C. (1985) Proc. Natl. Acad. Scr. U. S.

M., and Blanco, L. (1992) EMBO J. 11,4227-4237

I n74-1 n7n

., Salas,

A. 8 2 ,

Watabe, K., Leusch, M., and Ito, J. (1984) Biochem. Biophys. Res. Comrnun.

Wong, S. W., Wahl, A. F., Yuan, P.-M, Arai, N., Pearson, B. E. Arai K. Korn,

Zaballos, A., Lazaro, J. M., Mendez, E., Mellado, R. P., and Salas, M. (1989)

^". 1 ","

123 , 1019-1026

D., Hunkapiller, M. W., and Wang, T. S.-F. (1988) EMBOk 7,3?-4?

Gene (Amst . ) 83,187-195

29 dna polymerase active site

Documents