DNA profiling Each of us has a unique DNA profile1 or fingerprint. A technique called electrophoresis2 is used to obtain DNA profiles, relying

on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein).

We have many sections of non-coding DNA in our genome. Within this non-coding

DNA are areas called short tandem repeats (STR3s). For example, you may have a stretch of DNA made up of the following base4 sequence:

ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

ATGTTCCATGATAGCACAT

This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.

For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome5 from your mother, and 3

repeats of this sequence within the STR on the matching chromosome from your father.

The different numbers of repeats within an STR results in DNA of different lengths.

Because of this, electrophoresis can be used to show how many repeats you have.

Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Polymerase chain reaction6 (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA

1 A genetic tool used to compare and contrast DNA sequences using electrophoresis. DNA profiling is

used in forensic science and to help in establishing parentage. 2 Using an electric charge to separate molecules in a solution or gel according to size. It is

routinely used to separate fragments of DNA. 3 (short tandem repeats) Short DNA sequences that are repeated in a head-to-tail manner. They

are useful in DNA profiling. 4 Part of four types of simple molecules or nucleotides (adenine, thymine, cytosine and guanine)

that are the sub-units (building blocks) of DNA and RNA. 5 A threadlike component in cells that consists of a single long molecule of DNA coated with

proteins. Genes are carried on the chromosomes. 6 (PCR) A laboratory process in which a segment of DNA is copied multiple times using DNA

polymerase.

will show up as bands at different spots on the electrophoresis gel (see picture

above). The banding pattern produced is called a DNA profile or fingerprint, and can be analysed.

Source: http://www.biotechnologyonline.gov.au/human/dnaprofile.html For more information please see: http://www.ipn.uni-kiel.de/eibe/UNIT02EN.PDF

Gene therapy

Genetic testing can reveal if a person has a genetic condition. Can we use biotechnology to cure

them?

Disease can occur when genes become defective through changes called mutations. These

changes result in a new form of the gene – a new allele1- which may cause it to function less

effectively, or not at all.

In time, it may be possible to use gene therapy to replace an abnormal or faulty gene with a normal copy of the same gene.

Currently, gene therapy is an experimental procedure that aims to correct only defective genes

that cause disease and not other characteristics. In the future, it may be used to treat ailments such as heart disease, inherited diseases or cancers.

None of us is perfect

Each human carries about half-a-dozen defective genes. Most of us do not suffer any harmful

effects from our defective genes, because we carry two copies of nearly all genes. Scientists are

looking at gene therapy as a treatment for genetic disorders. Absent or faulty genes can be

replaced by working genes, so that the body can make the correct enzyme or protein and consequently eliminate the root cause of the disease.

How to do gene therapy

Gene therapy requires some way of delivering a functioning gene into the cells of a patient. In

recent trials, several different ways of using carriers2 to deliver the gene have been researched.

Disabled viruses can transfer genes into a cell efficiently. However, it can be difficult to

make a virus totally harmless, so some disease symptoms associated with the virus may

also develop.

Non-viral carriers include fat globules (liposomes) and artificial chromosomes (a sequence

of DNA created in a laboratory). These can transport large amounts of DNA, but they are not as easily incorporated into the genetic material of the cell.

For background information on gene therapy, go to:

http://www.ornl.gov/hgmis/medicine/genetherapy.html

1 One of two or more alternative forms of a gene. A person may have two copies of the same

allele (homozygous) or two different forms (heterozygous). Different alleles arise from changes in the base sequence of that gene through mutations. For example, the gene for eye colour has

different alleles resulting in blue or brown eyes. 2 An individual who carries one copy of a recessive gene for a hereditary condition.

The uses

Gene therapy research and trials are being conducted to treat conditions such as:

inherited disorders

o severe combined immunodeficiency syndrome (SCID)

o diabetes

o thalassaemia

o haemophilia

o cystic fibrosis

cancers of different types

heart disease

age-related diseases

o arthritis

o dementia.

Mending a broken heart

Heart attacks cause damage to the muscle cells of the heart. Scar tissue forms, disrupting the heart's electrical system, and weakening the heart.

Recently, researchers have reprogrammed the scar tissue, making it behave like heart muscle cells.

The researchers, from the Children's Medical Research Institute (CMRI) in Sydney and the

Children's Hospital Westmead, added two extra genes to the scar tissue cells. One gene programs

the cell to be excitable, like a muscle cell, and the other allows the cells to communicate, passing on the electrical pulse of the heart.

Gene therapy trials

In 1990, four-year-old American Ashanthi DeSilva became the first person to be treated with

gene therapy for severe combined immunodeficiency (SCID) syndrome. Because this disease

affects the immune system, children born with it are very susceptible to any infectious diseases,

and must be kept in germ-free environments such as a plastic enclosure. SCID is therefore sometimes referred to as 'boy in the bubble' syndrome.

Ashanthi's cells were provided with genes encoding an infection-fighting enzyme that she lacked.

Doctors removed white blood cells from her body, grew the cells in the lab, and inserted the

missing gene into the cells using a viral vector. The genetically modified blood cells were then infused into her bloodstream.

This procedure is not a cure. The treated white blood cells only work for a few months, and the

process must be continually repeated. Since that trial, more than 3000 people have received this treatment in human clinical trials.

Gene therapy is still an experimental procedure, and has suffered a number of major setbacks since this first trial. Some trial patients developed a leukaemia-like illness caused by the vector

used to transfer the gene. Trials were temporarily halted to allow time for the development of

safer gene transfer vectors, and are now underway again in several countries. Future techniques

may be safer, and be able to deliver the correct gene, to the correct cells, in the correct tissues.

A 2007 gene therapy trial for inherited retinal disease had promising results. Patients had a modest increase in vision with no apparent side-effects.

The NHMRC is in the process of establishing an expert Cellular Therapies Advisory Committee to

provide medical and technical advice to Human Research Ethics Committees on the clinical application of gene therapy. http://nhmrc.gov.au/about/committees/expert/ctac/index.htm

The challenges

For gene therapy to be effective, a gene must reach the right place in the body and become part of the normal workings of the cells involved.

It is important:

to find the right gene

to target the right cells in the body

to deliver the DNA of the required gene into these cells

to make sure the DNA is used correctly by these cells

that the procedure is performed safely causing no injury or harmful side-effects.

To date, gene therapy has only been performed experimentally in human clinical trials, as there are several possible adverse consequences.

To see real benefit, future techniques will need to guarantee the safety of the technique and

deliver the correct gene to the correct cells in the correct tissues.

Just your genes...?

Gene therapy is only used on non-reproductive (somatic) cells - that is, any cells other than

sperm or egg cells.

The genetic change introduced by the therapy is not passed on to the patient's children. For the

‘new’ gene to be passed on to the patient's offspring, germline gene therapy has to occur - that

is, a permanent transfer of the gene into the patient’s egg or sperm cells. This is illegal in some

countries.

Currently, there is insufficient knowledge about the possible consequences for future generations

of the use of these therapeutic techniques. A number of ethical considerations need to be taken into account before the therapy can be used widely.

These include weighing up the potential benefits for the patient against the harm that might be

done to them or their children, and considering under what conditions it would be justifiable to make changes, so that they do not occur in future generations.

The genetics underlying most conditions is quite complex. Completely eradicating a particular

form of a gene we believe to cause disease may have far-reaching consequences for future generations. That particular gene change may actually be advantageous in some circumstances.

For example, people who carry a copy of the allele that causes sickle cell anaemia have an

increased resistance to the deadly infectious disease, malaria. If the sickle cell allele is removed from the population, many more people might die in areas affected by malaria.

Watch an animation from the Walter and Eliza Hall Institute of Medical Research that depicts

aspects of the haemoglobin molecules and the mutant form that causes the disease sickle cell

anaemia: http://www.wehi.edu.au/wehi-tv/dna/index.html and click on "Haemoglobin and

Sickle Cell Anaemia"

One possible future?

Although gene therapy is still an experimental technique, some futurists have speculated that

with expanded knowledge, scientists may potentially be able to 'improve' characteristics such as

intelligence, personality or physical features. However, this task would be difficult and complex, since:

hundreds of genes may be involved in any of these characteristics

these genes interact with the environment in which we develop.

An example of concerns associated with gene therapy is ‘gene doping’ - the possibility of athletes

abusing gene therapy to ‘genetically modify’ themselves to gain a competitive advantage.

Research is underway to use gene therapy to increase red blood cell production (and therefore

oxygen delivery to cells) in people with severe anemia – however, this therapy could potentially be used to boost the capacity of athletes.

Gene therapy which has so far been found to increase muscle size in animal models, and which is

intended for patients with muscle wasting diseases, could in theory be adapted to strengthen particular muscles in athletes.

Read more:

ABC Health Report: http://www.abc.net.au/rn/talks/8.30/helthrpt/stories/s1076995.htm

Controversy exists as to whether ‘designer babies’ and gene doping will actually happen. Some

people maintain that such genetic alterations are too complex and have too many serious ethical

implications, while others claim it is ‘only a matter of time’. A number of popular films have

attempted to visualise a ‘genetically modified’ future. For example, the 1997 science fiction film,

‘GATTACA’, is about a futuristic society in which embryos are selected and modified for

intelligence, physical perfection, resistance to disease and athletic ability. Children conceived in

the normal way are treated as second-class citizens and relegated to menial jobs. While the film

combines Hollywood action and adventure, it touches on a vision of a future that reflects many of

the topical ethical issues and public concerns surrounding biotechnology today.

Listen to Penny Biggins’s idea of what the future might hold-GM Man: (http://www.biotechnologyonline.gov.au/popups/audio_abc.html)

The human genome project

The Human Genome Project1 is an international collaboration which officially began in late 1980’s

and early 1990s. The expected project completion date was 2005, but rapid technological

advances saw the completion of this venture four years ahead of schedule in 2001.

The aims of the project were to:

determine the sequences that comprise human DNA

identify all of the genes in human DNA

store this information in databases and improve analytical tools

transfer technologies gained from the project to private industry (e.g. biotechnology

companies), to develop new medical applications

address the ethical, legal and social issues that may arise from the project.

The National Human Genome Research Institute is part of the US National Institutes of Health. They contributed to the International Human Genome Project: http://www.genome.gov/

Their Education Kit, called ‘Exploring our Molecular Selves’ can be downloaded here:

http://www.genome.gov/Pages/EducationKit/

Watch a movie to see shotgun sequencing of the private human genome project.

http://www.biotechnologyonline.gov.au/popups/vid_publicprojectsequencing.html

Watch a movie to see sequencing of the public human genome project.

http://www.biotechnologyonline.gov.au/popups/vid_privateprojectsequencing.html

For Further information please see:

http://www.ipn.uni-kiel.de/eibe/UNIT14EN.PDF

1 The project that has identified and located all of the genes in human DNA, and determined the

sequences of the chemical bases that make up human DNA. This information is stored in computer databases.

Transgenic Food & agriculture

Humans need food to live. Today, we spend much less time obtaining and preparing food than our

grandparents did, and we eat a much greater variety.

Over time, we have learned more about the human body and this has changed the kinds of foods

we eat. For example, in 1959, Australians consumed about 117 kg of vegetables per person. In 1989,

that figure had risen to 162 kg.

Worldwide, it has been estimated that the demand for cereals will increase to 2,466 million tons by

2020. Meat demand will increase to 313 million tons, and roots and tubers demand will increase to 864

million tons.

As well as changing the food we eat, more land and resources have been used to produce it.

Producers want food crops and animal varieties to work harder and more efficiently. Mostly, this is

achieved through new agricultural methods.

When growing crop plants or breeding animals for food, farmers select the best animals and crops

that suit their needs. This can be the best milking cow, highest-yielding crop or juiciest fruit. These

characteristics are largely controlled by the plant’s or animal’s genes.

Sometimes, when you cross two plants, you can end up with what you want and the 'bonus' of

something you don’t. For example, you may get a plant that has juicy fruit but is also susceptible to

disease. Sometimes these traits cannot be separated, and are said to be linked. Linked genes are

found very close together on the chromosome. Extra crossbreeding may be able to separate them,

but this is not always possible, and takes a long time.

Plants and animals with desirable traits can also be bred using modern biotechnology and gene

technology. The process can be more selective than conventional breeding, by both finding the

genes that control a particular characteristic, and changing one specific characteristic at a time.

Reproductive technologies such as cloning can be used to produce identical organisms, each with a

specific characteristic. This can produce herds of identical animals or fields of identical crop plants.

Although the selected traits may be useful, one drawback of cloning a whole crop or herd of

identical organisms is the risk of them succumbing to the same disease or a parasite.

Genetic diversity is nature’s way of ensuring that some members of a species will be immune to a

given threat, so that the species can survive.

In nature, different species cannot interbreed, so our ancestors selected and bred with characteristics

within the species. Today, gene technology can be used to transfer genes from one species to

another.

Genes can be transferred between species that have been separated for hundreds of millions of

years by evolution (e.g. transfer of a gene from a bacterium into a plant). Therefore, a much greater

range of traits can be bred into an agriculturally important species. This has led to a concern that

gene technology allows scientists to ‘play God’.

Gene technology can be used in agriculture and food production to:

increase crop or animal resistance to pests while reducing the use of chemicals

increase crop or animal tolerance to chemicals that are used to kill harmful pests

create disease resistance in crops and animals

improve the food yield per plant or animal

make plants and animals more suited to special environmental conditions such as drier

regions or saline water

improve the nutritional quality of the food produced by the plant or animal.

Gene technology is also being used to deliver benefits in the forestry and fishery industries.

Some people feel that the GM food labeling system is not good enough. Rather than label according

to whether any new genetic material is in the end product of the food, they want it labeled

according to origin.

For example, the refining process used to make canola oil removes all DNA and protein. The end result

does not contain any genetic material and does not require labelling. Labelling according to process

would state that canola oil came from a plant that had been genetically modified.

Read what the Australian Consumer’s Association (CHOICE magazine Online members) had to say

about labelling of genetically modified foods in 2003:

Read about GM foods and labeling in Canada:

http://www.hc-sc.gc.ca/fn-an/gmf-agm/index_e.html

Please revise: http://www.ipn.uni-kiel.de/eibe/UNIT09EN.PDF

Alternative fuel for cars and other powered engines

Fuel Cells & Alternative Fuel Vehicles: Advantages and Disadvantages

The history of the fuel cell can be traced back to the 19th century. Since then the development

and usage of fuel cells in a variety of applications have come a long way. Fuel cells hold great

promise for fueling alternative fuel vehicles. Here is some of the history of the development of

fuel cells:

William Grove invented the fuel cell in 1839. General Electric invented proton exchange membrane fuel cells in the 1950s Francis Bacon demonstrated a 5kW alkaline fuel cell in 1959. NASA's use of fuel cells during the Apollo space missions in the 1960s was the first

commercial use of fuel cells. Alkaline fuel cells have flown over 100 missions and operated for more than 80,000

hours in spacecrafts operated by NASA. The US Navy has been using fuel cells in submarines since the 1980s Fuel cell buses are running in several cities around the world, the largest being the

European Union backed CUTE project (Clean Urban Transport for Europe). All major automakers have prototypes of alternative fuel vehicles using fuel cells on

the road-some have already been leased to customers. Iceland has plans to convert its fishing fleet from diesel engines to hydrogen fuel cells

as part of a national project to create a fossil fuel free economy Several car manufacturers are hoping to produce their first semi-commercial models

of fuel cell cars by 2005, yet they will most probably not be mass produced until

2010. Numerous fuel cell products will be coming to market-portable direct methanol fuel

cells will power mobile phones, laptops and cameras in the near future

Fuel cells have several advantages over conventional power sources like internal combustion gas engines or batteries. Additionally, there are disadvantages facing manufacturers hoping to commercialize fuel cells. See how they stack up as the next best fuel for alternative fuel vehicles.

Advantages

Fuel cells reduce pollution that is caused by the burning of fossil fuels-their only by-

product is water If the hydrogen used in the fuel cell comes from the electrolysis of water, then using

fuel cells will eliminate greenhouse gases Because fuel cells don't need conventional fuels like oil or gas, they eliminate

economic dependence on politically unstable countries Since hydrogen can be manufactured anywhere there is water and electricity,

production of potential fuel can be allocated in various areas Fuel cells operate at a higher efficiency than diesel or gas engines which makes them

an ideal source of efficient power for alternative fuel vehicles Most fuel cells operate silently, while internal combustion engines do not Fuel cells can operate for longer times than batteries, therefore to double the

operating time, only the fuel needs to be doubled and not the capacity of the unit

itself

The maintenance of fuel cells is relatively straightforward since there are few moving parts

in the system

Disadvantages

Energizing fuel cells continues to be a major problem while production,

transportation, distribution and storage of hydrogen remains difficult Reforming hydrocarbons via a reformer to produce hydrogen is technically

challenging and not actually environmentally friendly The refuelling and the starting time of fuel cell vehicles are longer, while the driving

range is shorter than in a conventional vehicle Fuel cells are normally somewhat larger than comparable batteries or engines,

however, the size of the units continues to decrease with research and testing Fuel cells are currently expensive to produce, since most units are hand-made and

some use expensive materials The technology is not yet fully developed, therefore few products are readily available

Although hydrogen fuel cells appear to be the most promising source of alternative fuel, other sources are being researched and tested. Alternative transportation fuels provide economic advantages while also offering significant environmental benefits. They offer air quality advantages through reduced emissions and some fuels produce less greenhouse gas emissions than gasoline. There's significant research being conducted worldwide. Canada, for example, is recognized as a world leader in the development and use of alternative transportation fuels with more than 170,000 alternative fuel vehicles in use across Canada. Some of the most promising alternative fuel sources being suggested for future use in motor vehicles are:

Ethanol Propane

Natural gas Biodiesel Electricity Hydrogen

At this point, it's anyone's guess what the future holds for alternative fuel vehicles.

Source: allabouthybridcars.com