zegeye thesis final (mechanism of action of doc from bacteriophage p1)

Vrije Universiteit Brussel Katholieke Universiteit Leuven

Universiteit Antwerpen

Interuniversity Program Molecular Biology (IPMB)

Mechanism of Action of Doc (Death on Curing) from Phage P1

Thesis submitted in partial fulfillment of the requirements for the Degree of Master of Molecular Biology

ZEGEYE HAILU JEBESSA

Promoter: Prof. Dr. Ir. Remy Loris Structural Biology Brussels Faculty of Science and Bioscience Engineering Vrije Universiteit Brussel

Supervisor: Drs Abel Garcia-Pino Structural Biology Brussels

Faculty of Science and Bioscience Engineering. Vrije Universiteit Brussel

Academic year 2008-2009

i

Acknowledgements

I realized finally “No pain No gain”

First and foremost, I thank God for the passion and courage he put inside me to confront all the difficult moments.

My two years study for Master of Molecular Biology is coming to an end. When I remembered the first year, with that much courses, number of professors and sinusitis/Asthma/PC screen reflection creating trouble to my eye, hard but memorable. The second year, it is similar feeling when I have been working in the lab of structural biology being with Medicine background and those bunch of courses but here gastritis was my new syndrome that joins the already exciting sinusitis/asthma.

It is with great feeling that I acknowledge the assistance I have received from many individuals. The length of the list of those who deserve credit makes it impractical to name individuals.

My sincere gratitude goes to my promoter Prof. Dr. Ir. Remy Loris for welcoming me to his lab, and for meticulous comment and correction of my thesis. Your comments are priceless and you made me to think carefully about biology before dealing it. I owe also a special recognition to Dr. Ir. Lieven Buts who were always there at times of my confusion at every corner of the lab. You deserve credit “Bayyee Galattoomii”. I extend my sincere acknowledgement to my supervisor Drs. Abel Garcia-Pino for the guidance and friendly approach. I would also like to thank Ir. Yann, Matia, Radu (Think positive and Possible), Dr. Ir. Natalie, Dr. Ir. Koen, other members of TA group and SBB for courage, support and friendship you gave me during my stay. I can’t forget to thank Ir. Adinda for her kindness and realization of difficulties for people when they are new “Kabaja Guddaan siif qaba”.

I am so grateful to all of you: Prof. Dr. Van Driessche Edilbert for all of your positive concern and answering my queries positively; Rudi Willems, you deserve the most for making life easier in IPMB “No One Died Ever Before” and Greta Verhasselt for updating us with every news of IPMB.

I would also like to thank VLIR for financial assistance during the study period.

Wada Z. you are always circulating in my blood though I weren’t there to take care of you. I owe a special recognition to my Mom without whose assistance my achievements would have been impossible and of course my Dad. I am also grateful to Mes “Me@Ze” Shania.

ii

Abstract

Toxin-antitoxin (TA) modules are diverse and present on plasmid and chromosome of almost all

prokaryotes. They are composed of closely linked genes encoding a stable toxin that can harm the cell

and relatively non-stable partner antitoxin, which protects the cell from the toxin life harming effect.

Toxins, described so far, are known to interfere with vital cellular processes such as replication and

translation targeting DNA gyrase and mRNA or ribosomes respectively. Antitoxin abrogates the

poisoning effect of the toxin through non-covalent protein-protein contact forming a complex.

Accidental release of the toxin from the complex lead to either cell death or growth arrest. Due to this

fact the toxin is considered as a molecular time bomb. Even though the biological function of these

modules is an ongoing debate, their molecular architect and properties are starting to get elucidated

and it seems that these characteristics are conserved across all described TA systems.

Phenomenons of medical significance such as biofilm formation, bacterial persistence during

antibiotic treatment, and bacterial pathogenesis have already been implicated to TA systems. TA

systems owned by pathogens also becoming an attractive antibiotic target.

One of the several TA systems described so far include the phd/doc locus of bacteriophage P1 that

represents the plasmidic form of addiction module. The phd/doc locus of bacteriophage P1 encodes

the toxin Doc (Death on curing) and antitoxin Phd (Prevent host death). Antitoxin Phd has two

distinct functions: it auto regulate transcription from its own operator and protect the cell from the

toxin Doc. Site directed mutagenesis was employed to generate several selected Doc mutants believed

to be associated with its functional activity, cloned into expression vector pET-21b, expressed and

purified, and used for in vitro toxicity assay.

Bacteriophage P1 encoded Doc has previously been described as a protein that mediate efficient cell

growth arrest and mimicked mechanism of action of the aminoglycoside antibiotic hygromycin B in

which both targets 30s ribosomal subunit to inhibit translation and induce growth arrest. Consistent

with this finding our in vitro Doc toxicity experiment demonstrated that Doc inhibit translation

efficiently. Immediate (together with Doc) or later addition of Phd correspondingly neutralized and

reversed Doc induced in vitro translation inhibition. Furthermore, 1:1 complex formation between the

partners was found to be enough for neutralization and reversal of Doc toxicity contrary to the already

described heterotrimeric complex formation (P2D) for Doc inactivation. Residue A61 and H66 on Doc

found to be associated with functional activity of Doc.

iii

List of Abbreviations

AEBSF 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride

BCIP 5-Bromo-4-chloro-3’-indolyphosphate P-toluidine

Bis-Tris Bis(2-hydroxyethyl)-imino-tris(hydroxymethyl)-methane

CaCl2 Calcium chloride

CAPS N-cyclohexyl-3-aminopropane sulphonic acid

CD Circular dichroism

Doc Death on curing

EDTA Ethylenediaminetetraacetic acid

GdHCl Guanidine hydrochloride

HCl Hydrochloric acid

His Histidine

IgG Immunoglobulin G

IMAC Immobilized metal affinity chromatography

IPTG Isopropyl β-D-1-thiogalactopyranoside

LB Luria-Bertani

MES 2-(N-morpholino)ethanesulfonic acid

MgCl2 Magnisim chloride

NaCl Sodium chloride

NaOH Sodium hydroxide

NBT Nitro-blue tetrazolium chloride

PBS Phosphate buffered saline

PCR Polymerase chain reaction

Phd Prevent host death

ppGpp Guanosine tetraphosphate

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis

TA Toxin-Antitoxin

TBE Tris/Borate/EDTA

Tris Tris(hydroxymethyl)aminomethane

iv

Table of contents

Acknowledgements .............................................................................................................. i

Abstract ............................................................................................................................... ii

List of Abbreviations ......................................................................................................... iii

1. Introduction ..................................................................................................................... 1

2. Toxin-Antitoxin (TA) Modules ...................................................................................... 3

2.1 Discovery of TA Loci ............................................................................................... 3

2.2 General Common Properties of Toxin-Antitoxin Modules ...................................... 3

2.2.1 Families of TA Modules .................................................................................... 3

2.2.2 Genetic Organization and Regulation of Transcription of TA module ............. 4

2.2.3 Structural and Functional Similarities of TA Module ....................................... 8

2.2.4 Features of Toxin and Antitoxin ........................................................................ 9

2.3 Phyletic and Phylogenetic Distribution of TA Modules......................................... 11

2.4 Biological Functions of TA Loci ............................................................................ 12

2.4.1 Programmed Cell Death ................................................................................... 13

2.4.2 Plasmid Stabilization. ...................................................................................... 15

2.4.3 Stabilization of Mobile Genetic Elements (Transposons) ............................... 17

2.4.4 Selfish Genes ................................................................................................... 18

2.4.5 Stress-Response ............................................................................................... 18

2.5 Phd/Doc Toxin-Antitoxin Module from Bacteriophage P1.................................... 20

2.5.1 Interaction between Phd and Doc .................................................................... 21

2.5.2 Cellular Targets of Doc Toxin ......................................................................... 25

3. Aim of the Work ........................................................................................................... 27

4. Materials and Methods .................................................................................................. 28

4.1 Materials ................................................................................................................. 28

4.1.1 Bacterial Growth Media ................................................................................... 28

4.1.2 Bacterial Strains ............................................................................................... 28

4.1.3 Cloning and Expression Vector ....................................................................... 28

4.1.4 Oligonucleotides .............................................................................................. 29

4.1.5 Used Kits .......................................................................................................... 31

4.1.6 Enzymes and Antibodies ................................................................................. 31

4.1.7 Molecular Weight Markers .............................................................................. 32

v

4.1.8 Stock Solutions ................................................................................................ 33

4.2 Methods .................................................................................................................. 34

4.2.1 Cloning and Mutagenesis. ................................................................................. 34

4.2.1.1 Purification of Plasmid DNA. ....................................................................... 34

4.2.1.2 Amplification and Cloning of phd/doc to PET-21b Vector. ......................... 34

4.2.1.3 Site Directed Mutagenesis ............................................................................ 35

4.2.2 Expression and Purification of Wild Type and Mutant Doc, and Phd .............. 38

4.2.2.1 Expression ................................................................................................... 38

4.2.2.2 Purification .................................................................................................... 39

4.2.2.3 SDS-PAGE Analysis .................................................................................... 40

4.2.3 Growth Assay .................................................................................................... 41

4.2.4 In Vitro Translation Assay/Cell Free Expression System ................................. 41

4.2.4.1 Western Blotting ........................................................................................... 42

4.2.5 Circular Dichroism ............................................................................................ 42

5. Results ........................................................................................................................... 43

5.1 Cloning of Phd/doc into pET-21b Vector and Mutagenesis .................................. 43

5.1.1 Construction of PAG2-2 Vector ...................................................................... 43

5.1.2 Isolation of Mutations in doc that are Used for In Vitro Toxicity Assay ........ 43

5.2 Expression and Purification of Phd, Doc, DocH66Y and DocA61R ..................... 45

5.3 DocH66Y Reduces Cell Growth In Vivo ................................................................ 47

5.4 Doc Inhibits Translation In Vitro ............................................................................ 48

5.5 Phd Neutralizes Doc In Vitro .................................................................................. 49

5.6 DocA61R and DocH66Y do not Inhibit Translation In Vitro ................................ 50

5.7 DocH66Y and DocA61R Possesses Definite Secondary Structure ........................ 51

6. Discussion ..................................................................................................................... 52

7. References ..................................................................................................................... 55


1. Introduction

Prokaryotic organisms can be referred as true champions for adaptation and survival

under an impressive variety of conditions and these capabilities never ceased to amaze

the scientific community. Bacteria and Archaea have developed multiple metabolic

strategies to inhabit several niches and utilize various organic and inorganic substrates as

sources of energy. The basis for this extreme rich metabolic diversity most probably lies

on the flexibility of their genomes (Salyers & Whitt, 2002a). Besides vertical gene

transfer, the genetic content of prokaryotes can also be altered through horizontal gene

transfer mechanisms such as conjugation, transduction and transformation (Perry et al.,

2002). These combined factors make it relatively easy for bacteria and archaea to adapt

themselves to several external stimuli and (extreme) selective pressure. One of the

arsenal of these organisms to cope with various environmental challenge involve toxin-

antitoxin module.

At the beginning of the 1980’s, an operon that couples plasmid proliferation with cell

division was identified on the F-plasmid of the bacterium Escherichia coli (Ogura &

Hiraga, 1983) and was subsequently named ccd. Soon thereafter, it was discovered that

Ccd acts by killing cells that become plasmid-free (Gerdes et al., 1986). Many operons

with a similar architecture and capable of stabilizing plasmids have since been identified

and have been named ‘toxin-antitoxin (TA) modules’. They are present on plasmids and

chromosomes of most if not all prokaryotes and research stretching over the past decades

indicates that they play a key role in prokaryotic stress physiology (Gerdes et al., 2005).

TA modules comprise a large group of toxin and antitoxin gene, where the toxin gene

codes the toxin and antitoxin gene codes antitoxin. On the basis of the antitoxin gene they

are distinguished in two types: type I and type II. In type I the antitoxin is antisense RNA

(Gerdes & Wagner, 2007) and in type II the antitoxin is protease sensitive protein (Butts

et al., 2005; Gerdes et al., 2005). Antitoxin protect the cell from toxin action either by

inhibiting the translation of toxin gene by antisense RNA of the antitoxin or sequestering

the toxin via complex formation between partner toxin-antitoxin protein (Gerdes et al.,

1997; Zielenkiewicz & Ceglowski, 2001; Hayes, 2003; Butts et al., 2005; Gerdes et al.,

Chapter 1: Introduction 2


2005; Gerdes & Wagner, 2007). The subject of this master thesis focuses on the second

type.

When bacterial cell acquire a plasmid with a functional TA locus basal level expression

of both the toxin and partner antitoxin is guaranteed and keeping the cell safe from toxin

action. As long as the cells retain at least single copy of plasmid, this situation remains as

it was. When the cell loses plasmid, either fresh toxin or fresh antitoxin will not be

produced and the balance between the toxin and its partner antitoxin get perturbed and

the fate of the cell is dictated by pre-existing toxin-antitoxin complex. The antitoxin has

short in vivo life span while the toxin relatively owns longer in vivo life span. This

situation leaves plasmid cured cell undefended from the toxin action. The stable toxin can

attack its target in cells thereby inhibiting cell growth and ultimately killing the cell.

These mechanisms ensure the retention of the plasmid in the population and thus confer

an advantage to plasmid-retaining cells by reducing the competitiveness of their plasmid-

free counterparts (Hayes, 2003).

The bacterial TA system has recently attracted the attention of many researchers because

of new insights that have been acquired into these events and wide spread distribution

both on plasmids of medical importance and on bacterial chromosomes (Engelberg-Kulka

& Glaser, 1999; Gerdes, 2000; Zielenkiewicz & Ceglowski, 2001; Hargreaves et al.,

2002; Grady & Hayes, 2003; Meinhart et al., 2003).

One of these TA modules includes the 1993 discovered prophage P1 owned phd/doc

locus and will be the subject of my master thesis. Although the regulation and

biophysical properties of this TA module have been studied very well, the killing

mechanism is remained to be elucidated. The theme of the work would be to investigate

in vitro toxicity of Doc and complement this result with existing in vivo studies in order

provide a clue on killing mechanism of the Doc toxin.


2. Toxin-Antitoxin (TA) Modules

2.1 Discovery of TA Loci

Intuitively, it seems likely that cells that rapidly adjust the rate of DNA and protein

synthesis in response to extreme amino-acid starvation would better adapt to stressful

condition. Prokaryotes own TA loci on their genomes that might fulfill this function.

These TA loci are widely distributed on plasmids and chromosomes of bacteria and

archaea. Although database mining has shown that TA loci are ubiquitous in free-living

prokaryotic cells (Pandey & Gerdes, 2005), they were first discovered on plasmid where

they referred as plasmid-borne ‘killer’ genes. These ‘killer’ genes are involved in plasmid

maintenance. Obviously, chromosomal TA loci do not function to stabilize plasmids.

Eventhogh they are still under study, for determination of exact biological function, the

loci are proposed to play a key role in a prokaryotic stress physiology (Gerdes et al.,

2005).

Like eukaryotic chromosome, bacterial plasmids have centromeres, which function to

segregate plasmid molecules prior to cell division (Gerdes et al., 2005). However,

plasmids also encode maintenance loci whose gene products are activated in plasmid-free

cells. These loci function to prevent the proliferation of plasmid-free progeny (Ogura &

Hiraga, 1983; Gerdes et al., 1986), which increases plasmid maintenance in growing

bacterial cultures.

2.2 General Common Properties of Toxin-Antitoxin Modules

2.2.1 Families of TA Modules

Historically, the different proteic TA modules were categorized in to the following eight

families (Table 2.1.): the two component ccdBA, relBE, parDE, higBA, mazEF,phd/doc,

vapBC and the three component ω-ε-ζ (Gerdes et al., 2005; Pandey & Gerdes,2005;

Melderen & Saavedra De Bast, 2009). More recently, additional families of TA modules

have been described such as the hipBA locus of E.coli K-12, which is involved in

persister cell formation (Schumacher et al., 2009). Other families are apparently hybrids

with the toxin gene being related to the toxins of one of the nine classic families

Chapter 2: Toxin-Antitoxin (TA) Modules 4


(including hipBA) but the antitoxin gene belonging to one of the other families. These

families are defined based on amino acid sequence homology (Pandey & Gerdes, 2005).

2.2.2 Genetic Organization and Regulation of Transcription of TA module

The genetic organizations of a few representative TA loci are shown in Fig 2.1. Table 2.1

gives an overview of the components of the nine classic TA modules. In general, the TA

loci are organized into operons in which the upstream gene encodes the antitoxin and the

downstream gene encodes the toxin (Gerdes et al., 1986; Gerdes, 2000; Zielenkiewicz &

Ceglowski, 2001; Butts et al., 2005; Gerdes et al., 2005). One exception to this rule is the

higBA family in which the upstream gene codes for the toxin (Tian et al., 1996; Budde et

al., 2007; Christensen-Dalsgaard & Gerdes, 2006). Both genes are translationally coupled

and transcription of both elements starts at a promoter sequence just upstream of the

antitoxin’s cistron (Gerdes et al., 2005). Transcription autoregulation occurs generally by

binding of the antitoxin or the toxin-antitoxin complexes within their own promoter

regions, which is responsible for regulating expression of both toxin and antitoxin. In

many cases, the toxins act as co repressors of transcription, indicating that a TA complex

binds to the operator sites. In general both toxin and antitoxin are essential for

transcription autoregulation since in most cases the antitoxin has no repressor activity by

itself (Fig 2.2) (Gotfredsen & Gerdes, 1998; Dao-Thi et al., 2000; Gerdes, 2000;

Marianovsky et al., 2001; Kamada et al., 2003; Mandl et al., 2006). An exception to

these general rules is ω-ε-ζ system where the ω dimer (ω2) regulates the transcription of

the toxin (Ζ) and the antitoxin (Ε) (de la Hoz et al., 2000).

Mutational analysis unveiled that the antitoxins bind to the DNA through their N-terminal

domain (Afif et al., 2001; Santos-Sierra et al., 2002; Lemonnier et al., 2004; Zhang et al.,

2003; Smith & Magnuson, 2004 ). These DNA binding domains can belong to any of

several common classes of DNA binding domains. The DNA binding motifs so far

described in antitoxins include the ribbon-helix-helix (RHH) motif (as also seen in the

MetJ/Arc/CopG repressors) of CcdA, RelB and ParD (Phillips, 1994; Raumann et al.,

1994; del Solar et al., 2002; Madl et al., 2006; Oberer et al., 2007), the AbrB-type fold of

MazE known as looped-hinge-helix (Vaughn et al., 2001; Kamada et al., 2003; Loris et



al., 2003) and the helix-turn-helix (HTH) motif of HigA as also noticed in λ-cro (Gerdes

et al., 2005). In addition, Phd and YefM display a common fold that is not observed in

DNA binding proteins outside the TA world (Chemy & Gazit, 2004; Kamada &

Hanaoka, 2005). HipB exhibits DNA binding motifs similar to 434 Cro and C.AhdI

(Schumacher et al., 2009) belonging to the family Xre-HTH (helix-turn-helix). VapB

antitoxin exhibit DNA binding motif belonging to at least four different classes: HTH,

RHH, Phd/YefM and AbrB (Gerdes et al., 2005) (Table 2.2).

Table 2.1: The eight classic toxin- antitoxin gene families and ω-ε-ζ

TA Family

(locus)

Toxin Target of toxin Antitoxin Prote-ase Phyletic

Distribution

ccdAB CcdB Replication via DNA

Gyrase poisoning

CcdA Lon A

relBE RelE Translation via mRNA

cleavage

RelB Lon A, B, C

parDE ParE Replication via DNA

gyrase poisoning

ParD Unknown A, B

higBA HigB Translation via mRNA

cleavage

HigA Unknown A, B

mazEF Maz/PemK Translation via mRNA

cleavage

MazE/

PemI

Lon/ClpAP A, B

Phd/doc Doc Translation Via Ribosomes

binding

Phd ClpXP A, B, C

VapBC/Vag VapC Translation via

endoribonuclease action

VapB Unknown A, B, C

hipBA HipA Translation via EF-Tu

phosphorylation

HipB A

ω-ε-ζ Ζ Unknown Ε Unknown B

A-Gram negative; B-Gram positive; C-Archaea. Table Taken from Gerdes et al., 2005 and Van Melderen

& Saavedra De Bast, 2009.



Figure 2.1: Genetic organization of the TA module. Toxin and antitoxins genes along with their products are labeled pink and blue respectively. The figure depicts the general genetic set up of the whole TA module and genetic organization of certain typical TA cassettes. Broken arrows indicate the cellular protease that can degrade the antitoxin either in free form in solution or in complex with the cognate toxin. The right ward arrows indicate the promoter region. Picture reprinted from Gerdes et al., 2005.

Figure 2.2: Negative feed back loop of transcription regulation of the TA module: This Schematic representation is typical for most of the TA module however, there are exception where the third gene involve in the regulation as in case of the three component ω-ε-ζ: where ω-involve in the transcrption regulation. The arced arrow stands for the translational coupling and arrows from the antitoxin/toxin-antitoxin complex indicates tanscriptional auto regulation after binding of the gene product in the own promoter region of toxin and antitoxin. Pictures adapted from Gerdes et al., 2005.



Table 2.2: The DNA binding domains (antitoxin) of the Toxin-Antitoxin gene families

Toxin Family DNA binding protein (Antitoxin) DNA binding motifs in antitoxin

CcdB CcdA MetJ/Arc/CopG

Doc Phd Phd/YefM

HipA HipB Xre-HTH, 434 Cro, C.AhdI

(Schumacher et al., 2009)

HigB HigA cHTH

MazF MazE AbrB/MazE

ParE ParD MetJ/Arc/CopG

RelE RelB; YefM

MetJ/Arc/CopG; Phd/YefM

VapC PIN domain VapB MetJ/Arc/CopG;Phd/YefM;

cHTH; AbrB

Ζ ω MetJ/Arc/CopG

Table reproduced from Gerdes et al., 2005

The ratio of toxin to antitoxin regulates TA operon transcription. When the concentration

of antitoxin equals that of the toxin, there is enough antitoxin to counteract the action of

the toxin. In this case a toxin-antitoxin complex is formed that represses the transcription

from the operon promoter. At high toxin to antitoxin ratios, a different type of toxin-

antitoxin complex is formed that does not bind to operator DNA and allows for

transcription of the operon. This may happen under conditions where the antitoxin

concentration in the cell is still sufficiently high to avoid activation of the toxin, creating

a buffer against accidental toxin activation. A nice and well-studied example is the

regulation of the F-plasmid ccd module. The stoichiometry of CcdA-CcdB complexes

depends on the CcdA/CcdB ratio: if CcdB is in excess, a hexameric CcdA2-CcdB4

complex forms, and when CcdA is in excess, a tetrameric CcdA2-CcdB2 complex forms

(Afif et al, 2001; Dao-Thi et al., 2002, Dao-Thi et al., 2005). The tetrameric CcdA2-



CcdB2 complex binds to operator DNA in vitro whereas the hexameric complex does not

(Afif et al., 2001). Moreover, addition of an excess of CcdB to the operator-bound

tetrameric complex destabilizes DNA binding. These results suggest that the CcdA/CcdB

ratio controls transcription of the ccd operon and also predict that elevated levels of CcdB

would stimulate ccd transcription (Afif et al., 2001). In vitro experiment revealed

destabilization of ParDE promoter complex by high ParE concentration (Johnson et al.,

1996). This possibility is further strengthened by the observation that high cellular levels

of Doc stimulate transcription of the phd/doc operon so that it replenishes the antitoxin

since it transcribes faster than its cognate toxin (Magnuson & Yarmolinsky, 1998).

2.2.3 Structural and Functional Similarities of TA Module

Even if the respective genes of different TA families are not homologous, all TA families

have a remarkable similar genetic organization (Gerdes, 2000). Crystal structure analysis

has until now revealed five different toxin folds. Remarkable is that the toxins from the

CcdB and MazF families display strikingly similar 3D structures despite having different

activities (Fig 2.3) (Loris et al., 1999; Kamada et al., 2003). These similarities suggest a

common ancestor (Buts et al., 2005; Gerdes et al., 2005). Similarly, the RelE and YoeB

families of toxins belong to the same family of microbial ribonucleases that also includes

RNase T1, Barnase and restrictocin (Kamada & Hanaoka, 2005; Takagi et al., 2005) (Fig

2.4). RelE apparently lacks some crucial active site residues and is an activator of

ribosomal endonuclease activity (Pedersen et al., 2003). In contrast, YoeB has intrinsic

RNase activity in agreement with a fully formed active site (Kamada & Hanaoka, 2005).

PIN domain fold is predicted to comprise toxins such as VapC (Arcus et al., 2004). The

PIN domain fold is entirely α-helical and unrelated to any of the above discussed toxin

families but posses significant similarity with RNase H from phage T4 (Buts et al.,

2005).



Figure 2.3: Crystal structure of the dimeric toxins CcdbB, MazF and Kid. Regardless of their functional difference CcdB and MazF family exhibit remarkable structural similarity having the same kind of fold and form the same type of dimer. Toxin Kid from Plasmid R1of E.coli is homolog of the chromosomal toxin MazF. Picture adapted from Buts et al., 2005.

Figure 2.4: Toxins with Ribonuclease folds: The figure depicts the striking structural similarity exhibited by RelE, YoeB with microbial RNase fold that higly resemble RNase T1 of Aspergillus Orygae. β-Strands and α-helices are colored red and yellow respectively placed in identical orientation relative to their homologues. The green color represents the 2´guanosine monophosphate bound in the active site of RNase T1. Picture adapted from Buts et al., 2005.

2.2.4 Features of Toxin and Antitoxin

It is well described that TA systems rely on the difference in in vivo lifetime of the toxin

and cognate antitoxin which is either protein or antisense RNA. Toxins from the given

operon are highly resistant to a given protease while the cognate antitoxin from the same

operon are degraded by specific protease such as Lon, ClpXP or ClpAP shortly after their



translation, antitoxin has short life span, the phenomena that allows the toxin to exert its

action on the target and induce arrest or death of the cell. Susceptibility of antitoxin to

protease seems to results from a combined effect of low thermodynamic stability and

intrinsically unfolded domain of the antitoxins while they are in their free form.

The toxin is either monomeric or homodimeric and exerts its toxic function by interacting

with a cellular target that is usually associated with replication, as in case of CcdB and

ParE (Critchlow et al., 1997; Maki et al., 1992; Gerdes et al., 2005) or translation,

although through different mechanism, as in case of MazF, RelE, HipA, VapC, HigB and

Doc (Christensen & Gerdes, 2003; Pedersen et al.,2003; Zhang et al., 2003; Butts et al.,

2005; Gerdes et al., 2005; Zhang et al., 2005; Budde et al., 2007; Liu et al., 2008;

Schumacher et al., 2009) (Table 2.1). The proteic antitoxin, always a homodimer,

consists of two domains and often smaller than its toxic partner. The intrinsically well

ordered N-terminal DNA binding domain and the intrinsically unordered C-terminal

domain that become ordered up on binding to the toxin. The then complex formed

between toxin-antitoxin is functionally non-toxic than when it appears in its (the toxin)

free form. In other words, binding of antitoxin to the toxin partner will free the cell from

the poisoning effect of the toxin thereby assures the survival of the cell. The complexes

are formed by non covalent protein-protein contact. The mechanism by which antitoxin

abrogates toxin action involve one of the following different ways: the C-terminal part of

the proteic antitoxin (i) binds to the active site of the toxin (e.g. mazEF; Kamada et al.,

2003), (ii) binds to a site where normally a co-factor binds, the co-factor is needed for the

toxin’s action (e.g. ω-ε-ζ; Meinhart et al., 2003), (iii) allosteric binding of the proteic

antitoxin at a site different from the active site or co-factor binding site ( e.g. ccdAB;

N.De Jonge, oral communication), (iv) steric exclusion of the toxin from its cellular

target by extensive wrapping of the entire antitoxin around the toxin or fold

complementation (relBE; Takagi et al., 2005; phd/doc; Garcia-Pino et al., 2008) or (V)

by extensive interaction between the partners with N and C- terminal domains that locks

the enzyme/toxin in to inactive open conformation (hipBA; Schumacher et al.,2009).



2.3 Phyletic and Phylogenetic Distribution of TA Modules

Exhaustive search for two domain TA loci using BLASTP and TBLASTN from fully

sequenced genomes of 126 bacteria and archaea for their content of members belonging

to any of known TA families has revealed significantly reasonable number of loci. The

search identified 671 complete TA loci and 37 toxin genes without closely linked

antitoxin gene named solitary toxin gene (Table 2.3). Some TA modules were discovered

both in bacteria and archaea genome. Others discovered only in bacterial genome. The

two largest gene families, vapBC and relBE, were abundantly represented in bacteria and

archaea. While 22 of the 25 phd/doc represented in the bacteria, the remaining three

exclusively found in archaea. Three TA gene families (mazEF, parDE and higBA) were

confined to gram positive and gram negative bacterial domains. While ccdAB confined to

gram negative bacterial domain (Pandey & Gardes, 2005).

Table 2.3: Phyletic distribution of TA loci and Solitary Toxin genes in 126 organisms

Gene Family relBE parDE higBA vapBC mazEF Phd/doc ccdAB Total

Total in Bacteria 129 59 74 139 67 22 5 495

Total in archaea 27 0 0 146 0 3 0 76

Total TAs in 126

organism

156 59 74 285 67 25 5 671

Solitary Toxin 13 0 2 13 7 2 0 37

(Pandey & Gerdes, 2005).

Human pathogens like Mycobacterium tuberculosis, vibro cholera and staphylococcus

aureus are discovered harboring TA loci. In majority of the cases TA loci are highly

abundant free living prokaryotes giving an idea that TA loci are important for adaptation

to ever changing environmental condition. It was concluded that obligate host associated



organisms do not retain TA loci (Pandey & Gerdes, 2005).The most remarkable example

for this observation comes from the analysis of the genomes of members of the

mycobacterium. Mycobacterium species are members of the phylum Actinobacteria and

are known pathogens of human and animals (wild and domestic animals). It has been

demonstrated that different Mycobacterium species of the genus Mycobacterium display

markedly different life style. Mycobacterium tuberculosis has an extracellular and

intracellular growth phase while Mycobacterium leprae is an obligate intracellular

pathogen. The analysis shows that no functional TA loci in Mycobacterium leprae

whereas there are many different TA loci in Mycobacterium tuberculosis on its 4.4Mb

genome. The striking phylogenetic pattern in Mycobacteria supports the conclusions that

obligate host associated organisms do not retain TA loci while they are beneficial to free-

living organisms.

2.4 Biological Functions of TA Loci

TA families are surprisingly abundant in free-living prokaryotes and almost absent from

obligate host-associated organisms (Pandey & Gerdes; 2005). This striking pattern raises

important questions: what are the functions of all these genes and why do some

organisms have so many whereas others have none. A lot of speculation and hypotheses

have been forwarded for the role of prokaryotic TA module. Plasmids borne TA modules

are proposed to ensure the maintenance of low-copy number plasmids in bacterial

population by mechanism known as postsegregational killing. Cells that retain the

plasmid survive while those who lost the plasmid due to some reason killed by the toxin.

It is evident that the chromosomal TA systems do not serve the purpose of maintenance

of the entire chromosome in the cell and their biological function still remains as a

subject of an extensive research. Chromosomal TA modules have been proposed to

involve in prokaryotic programmed cell death, general prokaryotic stress physiology and

were called “stress managers”, stabilization of plasmid and chromosomal elements or are

proposed to be “selfish DNA” elements. In the following text, TA loci in the context of

the current models that have been proposed to explain the function of TA loci are

described.



2.4.1 Programmed Cell Death

Programmed cell death (PCD) is an active process that results in self-killing of cells and

is an essential mechanism in multicellular eukaryotes. Generally, PCD, also known as

apoptosis in animals, is required for the elimination of potentially harmful cells (Jacobson

et al., 1997; Nagata, 1997). The causative factors for PCD can be cancerous

transformation, microbial infection, and lethal factors such as heat, mutagens, oxidants,

and chemical toxins. These are among responsible factors for generation of potentially

harmful cells in animals. Intracellular death program may be activated and commit

suicide in a controlled manner in conditions such as confrontation with intra- or

extracellular stresses, because ‘compared with the life of the organism, cells are

apparently cheap’ (Raff, 1998). The suicide of certain cells in a multicellular organism is

thus altruistic and serves the purpose of tightly controlling cell members and the

magnitude of tissues by disposing of cells that are in excess or functions as a mechanism

for protecting the organism from dangerous cells that could potentially threaten

homeostasis (Hentgartner, 2000).

Programmed cell death, like multicellular eukaryotes, has also been observed in

unicellular eukaryotes and prokaryotes (Lewis, 2000; Lane, 2008; Rice & Bayles, 2008).

The pathways and molecular components of PCD in these organisms are very different

from what have been observed in animal apoptosis. Unicellular organism such as

prokaryotes very often display a ‘multicellular-like’ behavior as is illustrated by

phenomena such as quorum sensing and formation of biofilms (Hall-Stoodyley et al.,

2004; Hunter, 2008), by implication leading to the conclusion that the notion of

prokaryotes residing as individual organisms in their natural environment appears to be

incorrect (Engelberg-Kulka et al., 2006). Aizenman et al. (1996) proposed a model for

mazEF-mediated PCD in response to severe nutrient starvation. Subsequently, this model

was broadened to include various other stressful conditions such as DNA damage and

thymine starvation, high temperature and oxidative damage, the presence of antibiotics

with different modes of action (Sat et al., 2001; Sat et al., 2003; Hazan et al., 2001;

Hazan et al., 2004). Controlled cell death of individual in prokaryotes could provide the

surviving member of the community with nutrients during starvation condition, prevent



the spread of pathogens like bacteriophages, or lower the mutation rate to protect the

genomic content of the population by eliminating cells that have undergone an alteration

in their DNA by mutation or some kind of damage (Lewis, 2000). However, the

individual bacterium do not benefit from PCD. On the contrary it has been described that

during starvation or amino acid scarcity there is growth arrest rather than PCD. They

refer it as programmed cell survival (Gerdes et al., 2005). The following observation

conflict with PCD hypothesis (i) amino-acid starvation of three laboratory E.coli strains

did not induce PCD (ii) E. coli cells in which MazF is overproduced did not form

colonies. However, cell viability could be fully restored by the induction of transcription

of the MazE antitoxin gene after the overproduction of MazF. Therefore, MazF is

bacteriostatic, not bactericidal (iii) cells that cannot synthesize ppGpp (owing to deletion

of both relA and spoT) have a decreased viability during amino-acid starvation, indicating

that ppGpp aids cell survival during nutritional stress rather than the opposite. Most

importantly, there are obtained evidence that cells inhibited by ectopic over expression of

either RelE or MazF could be resuscitated if transcription of their cognate antitoxins was

induced at a later time (Pedersen et al., 2003).

Other hypotheses state that PCD might also be essential in biofilm formation in that the

release of genomic DNA, which becomes part of the biofilm matrix upon lysis of

individual cells, serve as a ‘glue’ that holds all of the members of the community together

(Bayles, 2007). Despite the afore mentioned explanations Amitai et al. (2004) described a

“point of no return” to show a point where ectopic over expression of cognate antitoxin

(MazE) couldn’t reverse the killing activity of the toxin (MazF). Based on the concept of

point of no return one can envisage a model in which MazF mediated RNA cleavage can

be initial step of PCD pathways so that PCD exist in prokaryotes. The chromosome-

encoded mazEF locus of E.coli is thoroughly described as a system that confers PCD

during amino acid starvation and other stressful conditions and schematically displayed in

Fig 2.5.



Figure 2.5: Schematic Representation of E.Coli MazEF mediated PCD. Picture reproduced from Engelberg-Kulka et al. 2005.

2.4.2 Plasmid Stabilization.

Plasmids are extra chromosomally replicating autonomous genetic elements present in a

cell; size varies from 1 to over 200 kb (Zielenkiewicz & Ceglowski, 2001). Plasmids are

very widely distributed throughout Prokaryotes and, in general, are inherited with a high

degree of stability. Some plasmid genes confer advantage to cells when they are under

selective special environmental conditions. Nevertheless, in many cases, plasmids are

stably inherited over generations without any selective pressure. Thus, there have to exist

mechanisms which enable the maintenance of the plasmid during cell growth in

nonselective conditions. Systems that contribute to this stability are encoded by DNA



cassettes and are, in most cases, independent of one another. A particular plasmid can

carry different stabilizing cassettes. Even more, cassettes from different plasmids may be

combined to give a stable replicon (Zielenkiewicz & Ceglowski, 2001). TA modules are

one type of plasmid stabilizing cassette and were also first discovered as elements that

ensure the stabilization of low-copy number plasmids (Ogura & Hiraga, 1983; Bravo et

al., 1987; Lehnerr et al., 1993; Roberts et al., 1994). The advantage of plasmid born TA

system seems to ensure stable maintenance of the plasmid in a generation/Progeny

daughter cells by selectively eliminating daughter cells that did not inherit a plasmid copy

at cell division. Due to the difference in a life span of the toxin (longer half life) and

antitoxin (shorter in vivo life span) cells that lost the plasmid will die after segregation by

toxic activity of the poison (Fig 2.6).

Figure 2.6: Genetic organization of TA cassette and Plasmid addiction (Mother and daughter right). The

plasmid bearing one or more TA loci is acquired by the cell and toxin and antitoxin are produced. As long

as the plasmid remains in the cell the non-toxic, non-covalent toxin-antitoxin complex is formed and the

cell won’t experience any adverse effect by the toxin’s action (daughter right). When the plasmid is lost

however, the ‘cured’ progeny dies because the toxin (red) is released from its antitoxin (blue) due to the

difference in cellular life-span between proteins (daughter left). Antitoxins are labile to cellular protease

(green). Figure reprinted from Guglielmini et al. (2008).



When a plasmid containing a functional TA operon is introduced into a bacterial cell low

level expression of both toxin and its partner antitoxin is guaranteed. The cell is thus

protected from toxin action due to the formation of non toxic complex between the toxin

and antitoxin. This non-toxic complex, which acts as a repressor, is also responsible for

transcription autoregulation from the operon. This situation remains stable only if the cell

retains at least one copy of the plasmid. If the plasmid is lost, however, the system is

activated. The antitoxin is continuously degraded by a specific protease and, in the

plasmid-free cell the cell cannot able to produce either fresh toxin or fresh antitoxin, the

toxin is freed. Accordingly, the toxin freely accesses its target and exerts its action in

cells that have lost the plasmid, thus inhibits cell growth and eventually killing the cell.

2.4.3 Stabilization of Mobile Genetic Elements (Transposons)

Integrons are segment of DNA that can move around to different position in the genomic

DNA of prokaryotes. They contain components that able to insert promoter less gene

cassettes into a site of the integron structure that is provided with a promoter, leading to

the expression of the introduced genes. Integrons can create operon like structures by the

sequential introduction of multiple gene cassettes. They are usually found to contain

genes associated with virulence and resistance to antibiotics (Saylers & Whitt, 2002b).

The key function of plasmid-encoded TA loci is to prevent the proliferation of plasmid-

free progeny and thereby increase the maintenance of the plasmid in a cell that segregate

with it. By a similar mechanism, chromosomal genes closely linked to a TA locus could

have a selective advantage. In particular, increased maintenance of specific genes might

have an effect on the stability and spreading of mobile genetic elements (Rowe-Magnus

et al., 2003; Christensen-Dalsgaard & Gerdes, 2006). It is interestingly apparent that

Vibrio cholerae’s all 13 putative TA loci are located in the mega-Integron. Some of these

loci encode active TA loci. It is possible that the multitude of TA loci contribute to the

genetic stability of the mega-integron. Alternatively, the TA loci could function as

adaptive elements that increase the fitness of V. cholera (Gerdes et al., 2005).

Nevertheless, it is also identified that loss of transposable elements, plasmids and

enzymes involved in DNA rearrangements contributed superbly to obligate host-

associated organisms to own stable genome (Gerdes et al., 2005; Pandey & Gerdes,



2005). In support of the gene stabilization hypothesis, it could be argued that organisms

with highly stable genomes would not need TA loci to accomplish further gene

stabilization that TA loci function as stress-response elements does not in some cases also

may function to stabilize genes, which is certainly the case for plasmid-borne TA loci. In

fact, a gene stabilization effect may accelerate the horizontal spread of the genes (Gerdes

et al., 2005). This is analogous to restriction-modification systems, which can stabilize

DNA segments and plasmids, but whose main function is to reduce invasion of foreign

DNA (Naito et al., 1995).

2.4.4 Selfish Genes

As discussed above, TA loci can stabilize plasmids by reducing the growth or, in some

cases even kill plasmid-free cells. This is a kind of selfish gene behavior and confers a

selective advantage to the TA locus itself rather than to the cells that harbor them.

(Pandey & Gerdes, 2005). Thus it has been proposed that “Chromosomal toxin-antitoxin

systems are genomic junk, acquired from plasmids or other sources and lost in due

course, albeit at an unusually low rate, due to their addictive qualities” (Magnuson, 2007).

This is a null-hypothesis against which any other hypothesis must be compared.

2.4.5 Stress-Response

A study by Pandey & Gerdes (2005) unveiled that almost all free-living organisms often

harbor a large amount of TA loci apparently this might attributed to changing

environments of their niche. Although the cellular role of these chromosomally carried

TA loci is the subject of controversy, they are believed to be involved in stress response

(Butts et al., 2005; Gerdes et al., 2005). Nutritional stress such as amino acid and glucose

starvation activates RelE and MazF in E.coli. These toxins involve in the mRNA

cleavage, in a ribosome dependent and independent way respectively, thereby inhibits

translation and then arrest cell growth (Christensen et al., 2001; Christensen et al., 2003;

Pederson et al., 2003; Zhang et al., 2003; Munoz-Gomez et al., 2004; Takagi et al., 2005;

Zhang et al., 2005). Therefore, they can be regarded as stress response elements that

function in parallel with ppGpp during stringent response (Christensen et al., 2003;

Christensen & Gerdes, 2003; Pedersen et al., 2003; Gerdes et al., 2005). However, there



are very few fastidious free living bacteria without TA loci. A notable exception to this is

Lactococcus lactis, normally thrives in plants and milk products and seems to contain no

TA modules. Lactococcus lactis, have an obligate requirement for media that contain

nutrients in artificial cultivation. Therefore, L. lactis might not encounter metabolic stress

to the same degree as less fastidious, free-living organisms. In contrast all obligate host-

associated organisms lack TA loci this might be attributed to their constant environment

where they thrive. Indeed, obligate intracellular organisms thrive in constant

environments and are thus expected to encounter minimal metabolic stress. In keeping

with this notion, many obligate intracellular organisms have also lost the relA/spoT gene

that encodes ppGpp synthetase (Pandey & Gerdes, 2005). On the other hand, most of the

organisms that have many TA loci grow in nutrient-limited environments or are

chemolithoautotrophs. These organisms grow very slowly and, intuitively, optimization

of gene expression seems highly important for such organisms (Pandey & Gerdes,

2005).The observed mRNA cleavage following nutritional starvation together with the

abundance of TA modules on free living organisms and their absence in obligate host

associated and fastidious free living microorganisms provides further support to the stress

response role of TA module thus it can be concluded that TA modules may function as

stress response elements that regulate the pace of metabolism in function of a changing

external environment. Thus the phylogenetic pattern of the distribution of TA loci can be

most easily reconciled with the hypothesis that TA loci are stress-response elements that

increase the fitness of free-living prokaryotes (Pandey & Gerdes, 2005).



2.5 Phd/Doc Toxin-Antitoxin Module from Bacteriophage P1

Bacteriophages are obligate intracellular parasites that multiply inside bacteria by making

use of the host biosynthetic machinery. Based on their life style, bacteriophages are

classified into lytic (or virulent) phages and lysogenic (or temperate) phages. Virulent

phages will always multiply and kill the cell at the end of their life cycle. Temperate

phages on the other hand can also choose to lysogenize (stay in a dormant state) before

entering their, lytic cycle.

Bacteriophage P1 is a temperate phage that lysogenizes E.coli and other enteric bacteria,

has a genome size of 93,601 bp, 117 gene and 45 operons (Lobocka et al., 2004). The

virion of Bacteriophage P1 consists of an icosahedral head attached at one vertex to a tail

that bears six kinked tail fibers. After injection into a host cell, the viral DNA circularizes

by recombination between redundant sequences. An inter play between a number of

environmental factors and complex immunity circuitry (C1 gene) of the bacteriophage

dictates the choice between the lytic and temperate phase of the life cycle (Heinrich et al.,

1995).

Bacteriophage P1 can either be transmitted vertically, as a low copy plasmid prophage, or

horizontally as a viral particle (Ikeda & Tomizawa, 1965). Several P1 genes scattered

throughout the genome are expressed in the lysogenic state. Those of primary importance

are involved in plasmid maintenance functions and in inhibition of lytic development. As

a prophage, P1 is a stable plasmid maintained at about one copy per bacterial

chromosome (Lobocka et al., 2004). Among several genes scattered over the genome of

the prophage phd/doc constitutes TA module and are in part responsible for plasmid

maintenance and hence prophage P1 is inherited as genetically stable, extra chromosomal

plasmids.

The phd/doc locus of bacteriophage P1 is organized in an operon that codes a stable 126

residue (13.6 KDa) toxin, Doc (death on curing) and unstable 73 residue (8.1 KDa)

antitoxin, Phd (Prevent host death). Phd avoids Doc toxicity by direct protein-protein

contact. Bacteriophage P1 encoded TA module ensures the maintenance of the prophage

in its plasmidic form by a post-segregational killing (Koyama et al., 1975; Jensen &



Gerdes, 1995; Hazan etal., 2001). This stabilization is moderate: only about seven fold

compared to a phd/doc-free version of P1 (Lehnherr et al., 1993). Doc induced growth

arrest is from within in contrast to the action of colicins or antibiotics that are secreted by

bacteria into their environment as inhibitors of neighboring microorganisms (Hayes,

2003). The antitoxin Phd is selectively degraded by the ClpXP preotease machinery.

Consequently, after curing the prophage, the longer-lived Doc remains to attack its target

and arrest cell growth (Lehnherr & Yarmolinsky, 1995). Actually, the name given to the

TA system owned by prophage P1 was derived from the properties of the antitoxin (Phd)

and the toxin (Doc).

Insilico search by homology from a genome of fully sequenced prokaryotes in a year

2005 divulged chromosomal homologues of the phd/doc family in bacteria and a few

Archaea (Table 2.1) (Pandey & Gerdes, 2005). Curiously, there is a similarity between

Phd and YefM of E.coli, (Pomerantsev, 2001; Grady & Hayes, 2003; Cherny & Garzit,

2004) but Doc has no similarity to YoeB or any other known RelE homologue. By

homology it has been discovered that there is low but significant similarity between

yefMyoeB and relBE family TA module. (Grady & Hayes, 2003; Cherny & Garzit, 2004;

Christensen et al., 2004) thus given the name relBE-3 (Gerdes et al., 2005).

2.5.1 Interaction between Phd and Doc

The N-terminal and C-terminal domains of the Phd contain the interaction sites for DNA

and Doc respectively. In common with other TA module N-terminal region of Phd is

mainly responsible for autoregulation. The toxicity of Doc can be neutralized by the C-

terminal domain of the Phd (Smith & Magnuson, 2004; Mcknley & Magnuson, 2005).

Mutational and structural studies uncovered the six α-helical structure of Doc protein and

Phd, intrinsically unstructured in unbound form, bound to Doc (Fig 2.6). This α-helix is

distinct from known structure of the other TA system. The only conserved surface of Doc

shares a significant similarity with a family of protein fic an indication for evolutionary

and functional relationship of these proteins. This conserved surface differs from the

interaction site with antitoxin but adjascent to the Phd binding site (Fig 2.7 A & B)

(Garcia-Pino et al., 2008).



Experimental evidences demonstrate that Purified Phd and Doc form a hetero trimeric

(P2D) complex which indicates that Phd inhibits Doc through direct protein-protein

contact by binding two separate regions on Doc (Gazit & Sauer 1999). The complex

formation is entirely mediated by side chain atoms (Fig 2.8). The protein-protein

interaction between toxin and antitoxin is stabilized by combination of the underneath

interactions: (i) hydrophobic interaction between a hydrophobic amino acid that compose

the N-terminal segment of Phd in the Doc binding grove, (ii) ionic interaction between

the negatively charged amino acid residues that constitutes the C-teminal segment of the

Phd and positively charged amino acid residues in the Doc binding grove and (iii) some

hydrogen bonding among amino acid residues in the Doc binding groove (Fig 2.6)

(Garcia-Pino et al.,2008). The Doc binding grove is formed by α-helices exclusively of

α1α4α5 (Fig 2.6). Gazit & Sauer (1999) proposed the molecular mechanism through which

Phd blocks the toxic effect of Doc as follows: (i) sterically blocking the Doc from its

cellular target, ribosome, (ii) altering the Doc structure due to the complex formation so

that it holds impaired cellular interaction site. It is interesting; however, complex

formation results in a small change of secondary structure so if this small change in

secondary structure were to involve part of a Doc that could be mechanism of toxin

neutralization. Recent studies on mechanism of toxin neutralization by Phd has lends

further support to the already proposed neutralizing mechanism of antitoxin by Gazit and

Saurer (Garcia-Pino et al., 2008). These kinds of mechanisms of toxin neutralization have

also been suggested for the TA system, yefMyoeB (Kamada & Hanaoka, 2005) and relBE

(Takagi et al., 2005).

The transcription regulation of P1 addiction module is mediated by protein product of the

operon. The protein products of the phd/doc operon repress the transcription from own

promoter (Magnuson et al., 1996). The operon has common promoter for both proteins

and contains 8bp palindromes separated by a region of 13bp, center to center. The Phd

dimer binds cooperatively the palindromes (Magnuson et al., 1996, Gazit & Sauer., 1999)

and the adjacent sites are bound either independently by Phd or cooperatively with Phd

and Doc (Magnuson & Yarmolinsky, 1998). These clearly indicate that the transcription

regulation of bacteriophage P1 toxin-antitoxin module is effected by the Phd alone or

cooperatively with Doc. Doc enhances transcription repression by cooperative binding



only if the two palindromes are present (Buts et al., 2005). Thus the hetero trimeric

complex formed between two Phd and one Doc is both to avert the poisoning effect of the

toxin, Doc, and to auto regulate the transcription of the toxin-antitoxin system (Magnuson

& Yarmolinsky, 1998; Gazit & Sauer., 1999; Smith & Magnuson, 2004; Mcknley &

Magnuson, 2005).

Figure 2.6: Structure of Doc and Phd bound to Doc. The DocH66Y:Phd52-73Se complex stereo view. The Doc

H66Y α-helices and loops are colored cyan and grey respectively. The α-helices are labeled α 1 to α 6. The highly conserved motifs are found in the α 3 and α 4 that are distinct from the Phd interaction site and the conserved sequences, HXFX(D/E)(A/G)N(K/G)R, are highlighted in red and side chains are made known as sticks. The Phd interaction site is not conserved. The α-helices of bound Phd revealed as yellow in binding groove. Figure reprinted from Garcia-Pino et al., 2008.



Figure 2.7: Surface representation of DocH66Y in complex with antitoxin partner Phd represented with yellow helical ribbon. Conserved sequences are shown in blue and residues potentially associated with Doc functional activity are shown in red. Figure reprinted from Garcia-Pino et al., 2008.



Figure 2.8: Phd52-63Se and Doc H66Y interaction: Interacting residues, entirely of side chains, of Doc H66Y (blue) and Phd52-63Se (red and orange). The interaction forces include hydrophobic (arched), hydrogen bonds (dashed lines) and ionic interaction between charged residues not shown. Orange represents the hydrophobic N-terminal segment and the red represents the negatively charged C-terminal segment of the Doc binding C-terminal domain of Phd52-63Se. Figure reprinted from Garcia-Pino et al., 2008.

2.5.2 Cellular Targets of Doc Toxin

To clearly unravel the function of TA loci, it is decisive to realize the cellular targets of

the toxins. Recently phenomena of medical importance like biofilm formation and

bacterial persistence upon antibiotic exposure have already been attributed to

chromosomal TA systems. Knowledge of toxin target are also of pharmaceutical and

biotechnological interest because they could be potential new drug targets in pathogenic

bacteria, and might be useful for creating novel genetic tools (Hayes, 2003; Gerdes et al.,

2005). The toxin component produced by TA cassettes is designed by nature to maim

bacterial cells, which raises the exciting possibility that these factors might be exploited

as novel antibacterial agents in the treatment of infectious diseases (Hayes, 2003).

Though the exact mechanism of toxicity remains to be elucidated, Doc toxicity relies on

the ability of Doc to arrest translation elongation through its association with 30S

ribosomal subunit similar mechanism exhibited by antibiotics hygromycin (Hazan et al.,

2001). Hygromycin, an amino glycoside antibiotic, is known for its action of translation

elongation inhibition (Cabanas et al., 1978; Cabanas et al., 1978; Eustice & Wilhelm,

1984).



It has been proved that hygromycin B resistant mutant cells are also not affected by Doc

this explain the antibiotics and the toxin, Doc, competes for the similar binding site by

implication binding site of hygromycin B also included in the binding site of Doc on the

small ribosomal subunit, 30S ribosomal subunit (Liu et al., 2008). Fig 2.8 schematically

depicts the general path way of phd/doc toxin-antitoxin system and how Doc act on its

cellular target and shutdown protein synthesis thereafter induce postsegregational growth

arrest.

Figure 2.9: Mechanism of action of Doc. When Doc is freed from Phd due to degradation of the antitoxin by the serine protease, ClpXP shortly after curing of plasmid and no fresh supply of the partner antitoxin is available, the long lived toxin causes poisoning by binding to the 30s subunit so then halting translation elongation marked by “X” finally leading to cell “Postsegragational Killing”. Since stalled ribosomes protect mRNA from degradation, mRNA stabilization by doc can also be imagined. In contrast mRNA destablisation is observed on model mRNAs (lpp & dksA) after Doc induction this might be RelE triggered mRNA cleavage (Garcia-Pino et al., 2008). Picture taken from Liu et al., 2008.


3. Aim of the Work

The phd/doc operon of bacteriophage P1, act as an addiction module. It stabilizes the

phage in plasmidic form and prevents it from being lost during cell division of its host

E.coli. When the plasmid is lost neither the Phd nor Doc will be produced. Phd is

regularly degraded by protease, ClpXP, leaving Doc free inside the cell. The freed toxin,

Doc then binds to the ribosomes and shut down protein synthesis ultimately leading to

plasmid cured cell growth arrest. This is called postsegregational killing. Phd counteract

Doc toxicity by protein-protein contact that either appear as interface between toxin and

cellular target, physical blockage, or introducing secondary structural change on toxin

Doc. However, Doc mutant H66Y, produced by mutation is less toxic to the cell. From

crystal structure of Doc and Phd complex the mutation H66Y found not in the Phd

binding region but adjacent to it. Replacing histidine by tyrosine in Doc renders the

monomeric wild type Doc majorly to purify as a dimer. Two possible reasons can be

forwarded for the reduced toxicity: DocH66Y dimer formation or substitution of histidine

residue by tyrosine. To unravel the intriguing event we want to study the killing

mechanism of Doc toxin and rescuing capacity of partner antitoxin, Phd, in vitro.


4. Materials and Methods

4.1 Materials

4.1.1 Bacterial Growth Media

Lysogeny Broth was made by dissolving 10 g tryptone/peptone, 5 g yeast extract and 10

g Nacl in deionised water, PH adjusted to 7 with NaOH to the final volume of 1 L

solution. The LB agar was supplemented with 100 µg/ml of ampicillin.

4.1.2 Bacterial Strains

Escherichia coli strain BL21(DE3). An E.coli strain preferred for expression from

inducible promoter and contains the λ-prophage DE3 in its genome. The λ-prophage DE3

contains an Isopropyl β-D-1-thiogalactopyranoside (IPTG) inducible gene that code for

T7 RNA polymerase. This gene is under transcriptional control of the L8-UV5 lac

promoter. These cells were used for recombinant expression of wild type Doc, Phd and

mutant Doc.

Escherichia coli strain DH5α. An E.coli strain preferred for high yield plasmid DNA

purification. This strain bears a mutation of φ80lacZ∆M15 and lacks the laqIq gene. DH5

α competent cells were used for plasmid construction and transformation of wild type and

mutant clone.

4.1.3 Cloning and Expression Vector

pET-21b (Novagen, Madison, USA). An expression and cloning vector that contains an

ampicillin resistance gene, T7 promoter, transcription start and terminator, T7-Tag

coding sequence, a multiple cloning site, a His-tag coding sequence and the LacI coding

sequence (Fig 4.1). The expression of the insert is controlled by the T7 RNA polymerase

promoter. This vector was used for cloning and expression of all constructs.

Chapter 4: Materials and Methods 29


Figure 4.1: The pET-21a-d(+) vectors. (A) The pET-21 system comes in four variants (a-d). The map of pET-21b(+),pET-21c(+) and pET-21d(+) are the same as pET-21a(+) (shown) with the following exceptions: pET-21b(+) is a 5442bp plasmid: subtract 1bp from each site beyond BamHI at 198. pET-21c(+) is a 5441bp plasmid: subtract 2bp from each site beyond BamHI at 198. pET-21d(+) is a 5440bp plasmid: the BamHI site is in the same reading frame as in pET-21c(+).

(B) Cloning and expression region of pET-21a-d(+) vectors.

4.1.4 Oligonucleotides

‘FP1’ (Sigma, St.Louis, USA). Forward primer for the amplification and site directed

mutagenesis of wild type doc by PCR. ‘FP1’ contains three nucleotide mismatches which

are bold and underlined in the sequence. This primer was used to change Ala61 to Arg61.

5’-AGTCTCCGCCACCTACCTGGTGCGTACAGCGAGAGGGCATATATTC-3’



‘RP1’ (Sigma, St.Louis, USA). Reverse primer for the amplification and site directed

mutagenesis of wild type doc by PCR. ‘RP1’ contains three nucleotide mismatches which

are bold and underlined in the sequence. This primer was used to change Ala61 to Arg61.

5’-GAATATATGCCCTCTCGCTGTACGCACCAGGTAGGTGGCGGAGACT-3’



are bold and underlined in the sequence. This primer was used to change His66 to Ala66.

5’-CTACCTGGTGGCTACAGCGAGAGGGGCTATATTCAATGATGCCAATAAGCGTAC-3’



are bold and underlined in the sequence. This primer was used to change His66 to Ala66.

5’-GTACGCTTATTGGCATCATTGAATATAGCCCCTCTCGCTGTAGCACCAGGTAG-3’



are bold and underlined in the sequence. This primer was used to change His66 to Asn66.

5’-CTACCTGGTGGCTACAGCGAGAGGGAACATATTCAATGATGCCAATAAGCGTAC-3’



are bold and underlined in the sequence. This primer was used to change His66 to Asn66.

5’-GTACGCTTATTGGCATCATTGAATATGTTCCCTCTCGCTGTAGCCACCAGGTAG


mutagenesis of docH66Y by PCR. ‘FP4’ contains three nucleotide mismatches which are

bold and underlined in the sequence. This primer was used to create a mutant Asn78Trp

in docH66Y background.

5’-GATGCCAATAAGCGTACCGCGCTATGGAGTGCGCTGCTATTTCTACGCCGTAA-3’




mutagenesis of docH66Y by PCR. ‘RP4’ contains three nucleotide mismatches which are

bold and underlined in the sequence. This primer was used to create a mutant Asn78Trp

in docH66Y background.

5’-TTACGGCGTAGAAATAGCAGCGCACTCCATAGCGCGGTACGCTTATTGGCATC-3’

4.1.5 Used Kits

QIAprep ® Miniprep Plasmid DNA Purification Kit (QIAGEN ®, California, USA).

A kit used for purification of plasmid DNA.

QIAquick® PCR purification Kit (QIAGEN ®, California, USA). A kit used for the

purification of PCR product.

QIAquick® Gel Extraction Kit (QIAGEN ®, California, USA). A kit used for the gel

extraction or cleanup of DNA.

EasyXpressTM protein synthesis kit (QIAGEN®, California, USA). A kit used for cell

free expression of recombinant proteins.

4.1.6 Enzymes and Antibodies

ExTakara (Takara Bio, Shiga, Japan). DNA polymerase used for amplification during

PCR.

PfuTurbo® DNA Polymerase (Stratagene, La Jolla, California, USA). DNA

polymerase used during amplification and mutagenesis.

T4 DNA ligase (Amersham Bioscience, Uppsala, Sweden). T4 DNA ligase is an

enzyme used for ligation of inserts in to a cloning and/or expression vector.



DpnI Restriction Enzyme (Fermentas St. Leon-Rot, Germany). This is a Restriction

enzyme that has an optimal activity in buffer Tangotm. This enzyme is used for digesting

the parental methylated DNA and specifically cleaves the sequence:

CH3

5'-G A.T C-3'

3'-C T.A G-5'

CH3

The recognition sites on both strands are indicated by vertical arrows.

NdeI (Fermentas St. Leon-Rot, Germany). This is a Restriction enzyme that has an

optimal activity in buffer orange (O). The specific cleavage sites on both strands are

indicated by vertical arrows.

5'-C A↓↓↓↓T A T G-3'

3'-G T A T↓↓↓↓A C-5'

XhoI (Fermentas St. Leon-Rot, Germany). This is a restriction enzyme with an optimal

activity in buffer red (R). The specific cleavage sites on both strands are indicated by

vertical arrows.

5'-C ↓↓↓↓T C G A G -3' 3'-G A G C T ↓↓↓↓C-5'

Primary antibody (Serotec, Oxford, UK). This is mouse anti-histidine antibody for

western blotting.

Secondary antibody (Sigma, St.Louis, USA).Goat anti-mouse IgG conjugated with an

alkaline phosphatase for western blotting.

4.1.7 Molecular Weight Markers

Page RulerTM Prestained Protein Ladder (Fermentas St. Leon-Rot, Germany).

Protein molecular weight marker used during SDS-PAGE and western blot analysis (Fig

4.2 A)



Unstained Protein Molecular Weight Marker (Fermentas St. Leon-Rot, Germany).

Protein molecular weight marker used during SDS-PAGE analysis (Fig 4.2 B).

Bacteriophage λ PstI (Fermentas St. Leon-Rot, Germany). Molecular weight marker

for DNA used during agarose gel analysis (Fig 4.2 C).

Figure 4.2: Molecular Weight Markers used during SDS-PAGE (A &B), Western Blotting (A) and Agarose Gel Electrophoresis (C) analysis.

4.1.8 Stock Solutions

CAPS (10X) (N-cyclohexyl-3-aminopropanesulfonic acid). This buffer consists of 100

mM of CAPS (C9H19NO3S).The PH adjusted to 9 with NaOH.

PBS (10X) (Phosphate Buffered Saline). This buffer comprises137 mM NaCl, 3 mM

KCl, 8 mM Na2HPO4 and 1.75 mM KH2PO4. The PH is adjusted to 7.2 with HCl.

TBE (Tris/Borate/EDTA) . This buffer made of 889.78 mM Tris (C4H11NO3), 31.823

mM EDTA (C10H16N2O8) and 889.535 mM boric acid (H3BO3). The PH is adjusted to 8.3

with NaOH.



4.2 Methods

4.2.1 Cloning and Mutagenesis.

4.2.1.1 Purification of Plasmid DNA.

A plasmid carrying the phd/doc of P1 plasmid addiction operon and a plasmid carrying

docH66Y were transformed by the CaCl2 method (Studier et al., 1990) into DH5α cells

(detailed below). Overnight E. coli cultures bearing a plasmid carrying a phd/doc of P1

plasmid addiction operon or a plasmid carrying docH66Y were harvested by

centrifugation for three minute (8500 rpm and 25°C). Plasmid DNA containing wild type

phd/doc or docH66Y gene were then purified from E.coli DH5α cells using the

QIAprep®Spin Miniprep plasmid purification kit according to manufacturer’s instruction

and verified by sequencing. These plasmids were used in cloning, mutagenesis and

expression.

4.2.1.2 Amplification and Cloning of phd/doc to PET-21b Vector.

Wild type phd/doc from bacteriophage P1 was amplified by PCR using the plasmids

bearing it as a template (Mullis, 1990). A PCR reaction with ExTakara polymerase (5

U/µl) was used to amplify the phd/doc segment of the plasmid. The primers were

designed based on the flanking region of this gene. A PCR mix of 1 ng plasmid DNA in 9

µl of milli-Q water, 5 µl of 10X ExTakara buffer, 1 µl of 20 mM forward primer, 1 µl of

20 mM reverse primer, 4 µl of 2.5 mM dNTP mix, 0.2 µl of ExTakara polymerase

enzyme and 28.8 µl of milli-Q water plus negative control lacking template plasmid

DNA were prepared. PCR were performed in thermal cycler (Gen Amp® PCR system

9700) under the PCR condition:

• denaturation at 94oC for 50 seconds,

• 25 cycles of PCR amlification: denaturation at 94oC for 10 seconds, annealing at

55oC for 30 seconds and extension at 68oC for 1 minute,

• Hold at 72oC for 7 minute and



• Cool to 4 oC

PCR products were purified using the QIAquick® PCR purification Kit as described on

the hand book (QIAGEN®, California, USA). The purified PCR products and pET21b

vector were digested by the restriction enzymes NdeI and XhoI. The digests were

electrophoresed on a standard 1% agarose gel in TBE buffer and the bands were cut from

the gel. DNA was extracted from the gel cuts using the QIAquick® Gel Extraction kit

following the protocol described on the handbook (QIAGEN®, California, USA). The

digests were hybridized and ligated with T4 DNA ligase to create recombinant plasmid

PAG2-2, and subsequently introduced into E.coli strain DH5α by CaCl2 transformation.

Transformants were selected on LB agar in the presence of 2% glucose and 100 µg/ml

ampicillin. Positive clones were plasmid purified and further characterized by sequencing

elsewhere. Sequence validated recombinant plasmid PAG2-2 was used for cloning and

site directed mutagenesis of phd/doc. Moreover, the constructs were introduced into

E.coli strain BL21(DE3) for expression and purification of recombinant proteins.

4.2.1.3 Site Directed Mutagenesis

Mutants of Doc were created in a doc using QuikChange® site-directed mutagenesis

protocol (Stratagene, La Jolla, California, USA). The following three stapes were

performed:

1. Mutant Strand Synthesis

Syntheses of mutant strands were accomplished using PCR technique (Mullis, 1990). But

in this case the product of the PCR reaction is never used as a template. This means that

this is a linear amplification technique, unlike standard PCR where we get exponential

amplification of the product.

Two complementary oligonucleotides (primers) containing three nucleotides mismatches

flanked by unmodified nucleotides sequences were designed by us and synthesized by

SIGMA (sigma.com/oligos) (Fig 4.3). Two PCR tubes with different reagents were setup.

PCR tube one contained reaction mix (sample test reaction): 5 µl of 10X Pfu turbo

reaction buffer, 4 µl of 2.5 mM dNTP mix, 1 µl of 20 mM forward primer (125 ng), 1 µl



of 20 mM reverse primer (125 ng), 2 µl of 50 ng PAG2-2 plasmid DNA template (25

ng/µl) and 36 µl of distilled water. The second PCR tube has also the same mix except it

contains distilled water in lieu the template plasmid PAG2-2. PCR tubes were centrifuged

briefly (short spin), added 1 µl of Pfu turbo polymerase (2.5 U/µl) to both PCR tubes, and

centrifuged again as before. All the tubes were placed in thermal cycler (Gen Amp® PCR

system 9700) and run on the following specified program:

• denaturation at 95oC for 30 seconds,

• 16 cycles of PCR amplification:

o denaturation at 95oC for 30 seconds,

o annealing at 55oC for 1 minute and

o extension at 68oC for 1 minute/kb of plasmid, in our case 6 minute

The two PCR tubes were then briefly cooled to a temperature of ≤ 37 oC on ice. In order

to maximize the success of subsequent experiment PCR products were purified by

QIAquick® PCR purification Kit as described on manufacturer’s instruction (QIAGEN®,

California, USA).

2. Digestion of PCR Amplification Product with DPnI Restriction Enzyme

Following amplification and purification of the reaction mix, the parental DNA was

digested by DpnI restriction enzyme, which selectively digests methylated DNA and

hence leaving the newly synthesized DNA strand intact (Fig 4.3). Restriction digestion

was initiated by adding 1 µl of DPnI restriction enzyme (10 U/µl) in 5 µl of 10X buffer

Tango, mixed gently and thoroughly, centrifuged for 1 min at 13,000 rpm and incubated

for 1 h at 37°C.

3. Transformation of Escherichia coli strain DH5α Competent Cells

In order to make large quantities of plasmid (PAG2-2) with the mutation of interest,

E.coli strain DH5α cells were transformed with DPnI digest by standard CaCl2 method



(Studier et al., 1990). 100 µl of E.coli strain DH5α cells were thawed on ice for a few

minute.

The cells were then divided in two equal volumes (50 µl of cells in two separate

eppendrof tubes). To each tube 5 µl of mutagenesis reaction mixtures with and without

template plasmid DNA (PAG2-2) were added. The mixtures were then again incubated

on ice for 10 minute followed by 2 minute at 42oC, diluted in 2 ml of sterile LB medium

and incubated for at least 1 h at 37oC with aeration in water bath. A pair of LB agar plate

supplemented with 2% glucose and 100 µg/ml of ampicillin was prepared. A 100 µl of

these mixture (cells and mutagenesis reaction) were plated on LB agar (2% glucose and

100 µg/ml ampicillin) labeled diluted. The remaining culture mixtures (cell suspensions)

were then pelleted by centrifugation (13,000 rpm, 25oC). The pellet was resuspended in

100 µl of sterile LB broth, and plated on LB agar plate (2% glucose and 100 µg/ml

ampicillin) labeled concentrated. The plates were incubated overnight at 37oC. Plating

was performed under sterile condition. After overnight incubation of cells, positive

clones were colony picked, precultured overnight at 37oC in LB broth (2% glucose and

100 µg/ml ampicillin), plasmid DNAs (PAG2-2) were purified from E.coli strain DH5α

as described above. PAG2-2 constructs were concentrated to a concentration of 20 ng/µl

and sent somewhere else for sequence validation.

Figure 4.3: Schematic representation of Site Directed Mutagenesis. Following PCR reaction, the product is digested with DpnI restriction enzyme. This restriction digest is crucial. DpnI only recognizes methylated sites, so it digests the template plasmid but not the PCR product. To make sure proper annealing of the primer the mismatch should be placed in the middle of the primer.



4.2.2 Expression and Purification of Wild Type and Mutant Doc, and Phd

4.2.2.1 Expression

Plasmid PAG2-2 or pD21-5AD-9B was transformed into BL21(DE3) E.coli strain cells

(Hanahan et al., 1991) using the CaCl2 method (Studier et al., 1990).

Transformed cells were then colony picked and replated over night at 37oC on LB plate

containing 2% glucose and 100 µg/ml ampicillin. Before large scale expression was

performed, small-scale expression test was conducted. Single colony bearing recombinant

plasmid (PAG2-2) was grown overnight at 37oC in the LB broth (2% glucose and 100

µg/ml) prepared as described by Sambrook et al. (1989). A 2ml aliquot of this culture

was added to 40 ml of the same fresh medium and the bacteria were grown with aeration

and shaking at 37oC (Innova™ 4430) until the absorbance reached OD600nm of

approximately 0.8. The culture was then induced by addition of 1 mM IPTG (isopropyl-

1-thio-D-galactopyranoside) and cells were further incubated for 2-3 h under the same

condition for over expression. Before and after induction aliquots of each culture were

centrifuged and the pellet was resuspended in SDS-PAGE loading buffer (Sambrook et

al., 1989). The proteins were analysed on a 10% SDS-polyacrylamide gel (Invitrogen,

California, USA) and the gel was stained with Coomassie brilliant blue R-250. Similar

protocol was followed for expression from pD21-5AD-9B plasmid.

To start large scale expression, the above mentioned protocol was followed except that in

this case the culture was 10 L culture each prepared in 1 L flask. The individual 1 L

cultures were finally pooled together after cell harvest. After 2-3 h incubation with

aeration and shaking (37oC, 120 rpm) (New Brunswick Scientific) in the presence of 1

mM IPTG, cells were harvested by centrifugation for 20 minutes (7000 rpm, 4oC)

(Beckman coulter® Avanti® J-26XP), pellets were resuspended in lysis buffer (50 mM

Tris PH 7.5, 250 mM NaCl, 0.1 mg/ml AEBSF, 1 µg/ml leupeptin, 1 mM EDTA),

aliquoted in volume of 50 ml, frozen with liquid nitrogen and stored at -70oC.



4.2.2.2 Purification

Purification of Doc, DocA61R, DocH66Y and Phd were performed on Akta Explorer plat

form (Amersham Biosciences,Uppsala, Sweden) by immobilized metal affinity

chromatography (IMAC) (Porath et al., 1975). A nickel-sepharose column (Amersham

Biosciences, Uppsala, Sweden) was packed and equilibrated in buffer A (50 mM Tris PH

7.5, 250 mM NaCl). Prior to purification of His-tagged Doc-Phd, DocH66Y and

DocA61R-Phd, frozen cells were thawed in water at room temperature in the presence of

buffer A (50 mM Tris PH 7.5 and 250 mM NaCl) and the cell suspension was disrupted

by cell cracker. Cell lysate was centrifuged at 12,000 rpm (Beckman coulter® Avanti® J-

26XP) for 45 min at 4oC, supernatant were collected and filtered through 0.45 µM using

60 ml syringe. The filtered supernatant was applied to a nickel-sepharose column

equilibrated with buffer A (50 mM Tris PH 7.5, 250 mM NaCl). Elution of Phd from the

column was performed in step gradient with buffer 1.5 M GdHCl, 0.2 M Tris PH 8.0 and

buffer 3 M GdHCl, 0.2 M Tris PH 8.0 for the first peak and the second peak respectively.

Fractions of elutions from each peak were collected, pooled together and diluted to a final

concentration of approximately 0.3 M GdHCl in Phd refolding buffer 1 (Tris 50 mM PH

8.0, 1 M NaCl) and subsequently dialyzed at 4oC for 3 h against Phd refolding buffer 1,

followed by Phd refolding buffer 2 (Tris 20 mM PH 7.0, 1 M NaCl) overnight. The

overnight dialyzed Phd sample was further dialyzed for 4-6 h against Phd final refolding

buffer (Tris 20 mM PH 7.0, 500 mM NaCl), aliquoted in volume of 1 ml, freezed in

liquid nitrogen and stored at -70 oC.

His tagged Doc was eluted in buffer 3 M GdHCl, 50 mM imidazole, 0.2 M Tris PH 8.0.

Fractions from the last peak were collected , pooled together and diluted to the final

concentration of 0.15 M-0.2 M GdHCl in Doc refolding buffer 1 (Tris 50 mM PH 7.0, 1

M NaCl). This was dialysed overnight against Doc refolding buffer 1 at room

temperature, followed by dialysis in Doc refolding buffer 2 (Tris 20 mM PH 7.0, 500 mM

NaCl) for 4 h. The dialyzed Doc was further dialyzed against Doc stabilization buffer

(Tris 20 mM PH 7.0, 250 mM NaCl) and concentrated at 4oC. This sample was then

loaded onto filtration column (superdex 75HR) for further purification, finally aliquoted

in volume of 1 ml, freezed in liquid nitrogen and stored at -70 oC. Refolding of proteins



(Doc, Phd, DocH66Y and DocA61R) and quality were monitored by circular dichroism

(CD) and SDS-PAGE. Samples were kept on ice all the time.

4.2.2.3 SDS-PAGE Analysis

To verify the expression of proteins and visualize the qualities of purification, aliquots of

cells and pooled samples of purification peaks were prepared and subjected to SDS-

PAGE analysis as described by Laemmli, (1970). Aliquots of 200 µl of bacterial cultures

were taken before induction and after induction with 1 mM IPTG. Cell samples were

centrifuged (5,000 rpm, 25oC) for 10 minutes; pellets were resuspended in 20 µl of milli-

Q water (filtered and sterilized ultra pure laboratory water) and boiled at 100oC for 10

minute. Boiled samples were then cooled to room temperature for a few minutes and

further incubated for 10 minute in the presence of DNase I (5 µg/ml). These samples

were boiled for additional 5 minutes in the presence of 10 µl of 4X NuPAGE® LDS

sample buffer (Invitrogen, California, USA). 30 µl of pooled aliquots from all peaks of

purification process were taken and prepared for SDS-PAGE essentially as described

above except that in this case there was no centrifugation and resuspension step.

Basically the same protocol was followed after in vitro translation assay for western blot

analysis.

The samples were then loaded on NuPAGE® 10% Bis-Tris pre-cast gels (Invitrogen,

California, USA). The electrophoresis was performed in 1X NuPAGE® MES running

buffer (50 mM MES PH 7.2, 50 mM Tris, 0.1% SDS, 1 mM EDTA PH 7.3) for 35

minute (I=120 mA, P=25.0, ∆V= 200 V). Size fractionated proteins were then stained

with Coomassie brilliant blue R-250. Molecular weights were determined using the

unstained protein molecular weight marker or the see Blue® and Page RulerTM prestained

molecular weight marker.



4.2.3 Growth Assay

Two bottles of 40 ml LB broth supplemented with 2% glucose and 100 µg/ml ampicillin

were prepared as described by Sambrook et al. (1989) and inoculated with 2 ml (each) of

an overnight Preculture of recombinant E.coli strain BL21(DE3) bearing plasmid pD21-

5AD-9B with docH66Y construct. The cultures were grown overnight at 37oC. The

absorbance OD600nm was measured at 0 h, 1 h, 2 h, 3 h, 4 h, 6 h, 8 h and 17 h. One bottle

was induced with 0.5 mM IPTG at absorbance OD600nm approximately 0.5 while the

other bottle kept growing uninduced.

4.2.4 In Vitro Translation Assay/Cell Free Expression System

Purified wild type Doc, DocH66Y and DocA61R were tested for toxicity using cell free

expression system. Purified Phd was also tested for its ability to neutralize or reverse

toxicity of Doc using the same assay. This was conducted after knowing the minimum

concentration of Doc inhibiting in vitro translation. The experiment was performed using

EasyXpress protein synthesis kit following manufacturer’s instruction (QIAGEN®,

California, USA). Each reaction mix contained the following solutions: EasyXpress

E.coli extract, EasyXpress positive-control DNA template, EasyXpress reaction buffer,

RNase free water and toxin or antitoxin or both in a reaction volume of 20µl. The assay

was started by adding purified proteins at increasing concentration (1 pM, 500 pM, 750

pM, 1 nM, 100 nM, 250 nM, 500 nM and 1 µM for Doc and DocA61R; 50 nM, 250 nM,

1 µM, 5 µM, 25 µM, 100 µM and 250 µM for DocH66Y and 1 nM, 50 nM, 125 nM, 250

nM, 500 nM, 1 µM, 10 µM for Phd ) followed by incubation for 1h at 37oC and reaction

was stopped by adding 5 µl of 4X NuPAGE® (Invitrogen, California, USA). After

knowing the minimum concentration of Phd required for neutralizing the toxicity of Doc

the same experiment was repeated, in order determine the minimum time required for

Phd to reverse Doc-mediated translation inhibition. This was conducted by adding the

determined concentration of purified Phd at time 0 h, 0.25 h, 0.5 h, 1 h, 1.5 h and 2 h

posterior to Doc. The reactions were then analyzed using western blotting.



4.2.4.1 Western Blotting

The in vitro translation assay was analyzed by Western blotting that was essentially

performed as described by Towbin et al. (1979). In vitro translated proteins were first

subjected to electrophoresis on NuPAGE® 10% Bis-Tris pre-cast gels (Invitrogen,

California, USA) and were then transferred from electrophoretic gel to nitrocellulose

membrane using a constant voltage of 100V during 1 h in CAPS buffer. The

nitrocellulose membrane was then immediately blocked by milk powder in PBS for extra

1 h and subsequently rinsed in PBS + 0.2% Triton X100. The membrane was incubated

for 2 h at room temperature in the mouse anti-histidine antibody (Primary antibody) that

was diluted to a concentration of 1 µg/ml in 5% milk powder in PBS + 0.2% Triton

X100. After rinsing with PBS + 0.2% Triton X100 again, the membrane was further

incubated for 1 h at room temperature in rabbit antimouse-phosphatase (secondary

antibody) that was diluted to a concentration of 5 ng/ml in 5% milk powder in PBS +

0.2% Triton X100 and then rinsed for third time in PBS + 0.2% Triton X100. The blot

was developed by incubating the membrane in the dark for a maximum of 15 minutes at

37oC in 10 ml buffer (0.1 M Tris-HCl PH 9.5, 0.1 M Nacl, 50 mM MgCl2) to which 100

µl of 18.75 mg/ml NBT, 9.4 mg/ml BCIP solution was added.

4.2.5 Circular Dichroism

In order to reveal the impact of mutation on secondary structure of Doc; the CD spectra

of the pure Doc, DocH66Y and DocA61R were taken and compared. Refolding was

monitored by far-UV CD range of 200-260 nm using a cuvette path length of 0.1cm. The

protein concentration used in each case was between 0.1 mg/ml-0.3 mg/ml with the

proteins dissolved in 50 mM Tris PH 7.5, 150 mM NaCl. The CD measurements were

performed on JASCO-J715 spectropolarimeter at room temperature.


5. Results

5.1 Cloning of Phd/doc into pET-21b Vector and Mutagenesis

5.1.1 Construction of PAG2-2 Vector

Over expression of toxic proteins lead to bacterial cell growth inhibition and hence it is

very difficult to obtain large quantities of these toxic proteins. Different strategies are

available to overcome this pitfall:

� Cloning strategy of putting toxin-antitoxin gene as an operon in to a vector

� Introducing mutation in to toxin gene in order to make it less toxic

We used a strategy of cloning phd/doc operon of bacteriophage P1 together to construct

PAG2-2 vector because of the fact that we will be using purified Doc protein for in vitro

toxicity assay and we will need doc as a template for site directed mutagenesis. The

phd/doc of bacteriophage P1 was PCR amplified and ligated in to pET21b vector to

generate PAG2-2 vector. To start cloning of phd/doc in to pET21b, plasmid bearing

phd/doc was purified and PCR amplified (not shown). The amplification product was

double digested with NdeI and XhoI restriction enzymes and cloning/expression vector

pET21b was also digested with these restriction enzymes. The digest was then ligated and

transformed in to E.coli DH5α cells. Positive clones were analyzed, plasmids were

purified from positive clones and sequence verified (data not shown). Sequence

confirmed PAG2-2 plasmids and pET21b vector were digested with NdeI restriction

enzyme for vector validation.

5.1.2 Isolation of Mutations in doc that are Used for In Vitro Toxicity Assay

To investigate mechanism of Doc toxin several different mutations had to be created in

areas believed to be responsible for toxicity and binding region of antitoxin partner. To

identify residues essential for toxicity of Doc we performed site directed mutagenesis

based on the information we obtained from published crystal structures (Garcia-Pino et

al., 2008). Moreover, the previously described less toxic DocH66Y (Magnuson &

Yarmolinsky, 1998) was also used as basis for studying toxicity. This less toxic mutant

was used to generate double mutant assuming that DocH66Y still has in vitro translation

Chapter 5: Results 44


inhibition capacity. DocH66Y purifies as a dimer most of the cases and it is not

established whether reduced toxicity is a consequence of dimer formation or the single

amino acid change.

The following Doc mutants were attempted to be created: DocH66Aand DocH66N in

order to have mutant Doc monomers since the already established less toxic DocH66Y

mostly purifies as a dimer and hence help in establishing the role of residue His66 on Doc

toxicity; double mutants DocA61R/DocH66Y and DocH66Y/DocN78W in the two Phd

binding regions of Doc. These double mutants were to disrupt either of the two Phd

binding sites of Doc. This was assumed to generate toxic mutant that will not be

counteracted by Phd; DocA61R and DocN78W in the Phd binding region of wild type

Doc

We were unable to transform DocH66A, DocH66N and DocN78W mutants after

construction (PCR and DpnI restriction) possibly due to the fact that they are too toxic to

be transformed. Though we were able to construct and transform the double mutants

DocA61R/DocH66Y and DocH66Y/DocN78W, they were not be used for in vitro

toxicity assay because the DocH66Y monomer turned non toxic in vitro (detailed below).

We constructed successfully expression vectors PAG2-2 enabling production of

DocA61R. The codon GCT was replaced by codon CGT in the DocA61R mutant. This

mutant will be used for in vitro toxicity assay (detailed below).

Figure 5.1: The docA61R nucleotide sequence and amino acids sequence. The forward primer used to

generate this mutant is highlighted in green and, the single amino acid change and its codon are shown by

red.



5.2 Expression and Purification of Phd, Doc, DocH66Y and DocA61R

Expression of Phd, Doc and DocA61R from plasmid PAG2-2 and DocH66Y from

plasmid pD21-5AD-9B were first tested at small scale level before going for large scale

expression and purification. Since the operon is under the control of Isopropyl β-D-1-

thiogalactopyranoside (IPTG) inducible promoter, induction of the operon with 1 mM

IPTG led to significant level of expression compared to before induction. This was

evidenced by SDS-PAGE analysis (Fig 5.2 A & B). SDS-PAGE analysis depicts correct

molecular weight of 8 and 13 KDa respectively for Phd and Doc (DocH66Y and

DocA61R) (Fig 5.2 A & B).

Figure 5.2: Small scale expression result of Phd, Doc, DocA61R (A) and DocH66Y (B). SDS-PAGE analysis of small-scale expression as described on material and methods (Expression and Purification). (A) Lane M, Molecular weight marker; Lane 1, Samples before induction; Lane 2, Samples 2 h after induction by 1 mM IPTG; (B) Lane 1; Samples before induction; Lane 2-3, Samples 1 h and 2 h after induction by 1 mM IPTG respectively; Lane M, Molecular weight marker.

After being tested and validated for expression, large scale expression and purification of

Phd, Doc, DocA61R and DocH66Y were performed in order to get enough protein for

further experiment. All proteins were purified from a clone E.coli strain

BL21(DE3)/PAG2-2 for Phd, Doc and DocA61R and BL21(DE3)/pD21-5AD-9B for

DocH66Y, a cell expressing bacteriophage P1 addiction proteins under Plac promoter

control (Blaber, 1998). C-terminally his tagged Doc (wild type and mutant) co expressed

and purified with or without Phd. As can be seen from the chromatogram (Fig 5.3 A) Phd

elutes at two peak step gradients; the first and the second peak that elutes in buffer 1.5 M



GdHCl, 0.2 M Tris PH 8.0 and 3 M GdHCl, 0.2 M Tris PH 8.0 respectively. On the other

hand Doc (both wild type and mutant) elutes in buffer 3 M GdHCl, 50 mM imidazole, 0.2

M Tris PH 8.0. Samples after induction but pre purification and samples of respective

peaks were analyzed by SDS-PAGE, and the result is presented as shown in the Fig 5.3

(B) and confirms induction and identity of each peak.

Figure 5.3: Purification of C-terminally His-tagged Doc (wild type and mutant) and Phd through immobilized metal affinity chromatograph and SDS-PAGE analysis.

(A) Phd elutes at two peaks, Phd1 and Phd2. Step gradient purification was performed. The loosely bound Phd elutes at first peak with the buffer 1.5 M GdHCl, 0.2 M Tris PH 8.0 and the tightly bound Phd elutes at the second peak with the buffer 3 M GdHCl, 0.2 M Tris PH 8.0. Both wild type and mutant Doc elutes at the last peak with the buffer 3 M GdHCl, 50 mM imidazole, 0.2 M Tris PH 8.0.

(B) SDS-PAGE analysis of purification of Phd and Doc (wild type and mutant) from induction of bacterial culture to the elution of the proteins. Lane 1, Samples after induction and cell harvest, Lane 2-3, Samples after two peaks of purified Phd, Lane 4, Samples after peak of purified Doc and Lane M, Unstained Protein Molecular Weight Marker.



5.3 DocH66Y Reduces Cell Growth In Vivo

Plasmid pD21-5AD-9B contains mutated doc, docH66Y, of bacteriophage P1 cloned

downstream of IPTG inducible promoter pET21 of pET21b (Blaber, 1998). E.coli Strain

BL21(DE3)/pD21-5AD-9B was grown exponentially and IPTG added at a point when

absorbance reached OD600nm of approximately 0.5 (Fig 5.4). As seen from the growth

curve, the increase in optical density significantly drops shortly after induction compared

to non-induced culture. Basal level expression of DocH66Y were not found toxic to cell

growth but cells that are experienced DocH66Y over production showed evidence of

reduction in growth (Fig 5.4). The reduction in optical density suggests that either

DocH66Y kills the host cell or promote state in which growth is inhibited. It is very

difficult to transform a plasmid containing doc to pursue expression and toxicity assay in

absence of partner antitoxin, phd.

Figure 5.4: DocH66Y reduces cell growth, Effect of over expression of DocH66Y on cell growth. E.coli strain BL21(DE3) carrying pD21-5AD-9D (pET21b::docH66Y) was grown exponentially in Luria-Bertani (LB) broth plus 2% glucose and 100 µg/ml of ampicillin at 37oC. To induce expression of DocH66Y 0.5 mM IPTG was added when absorbance reached OD600 of approximately 0.5. Point of induction is shown by vertical arrow.



5.4 Doc Inhibits Translation In Vitro

Purified Doc was used to assay if it can inhibits translation in vitro, we used an

EasyXpress E.coli extract. The reaction mixtures were incubated for 1 h at 37oC with

increasing concentration of purified Doc (1 pM, 500 pM, 750 pM, 1 nM, 100 nM, 250

nM, 500 nM, 1 µM). As seen from Fig 5.5 (A), 250 nM Doc inhibited translation . This

in vitro result is in consistent with inhibition of translation observed in vivo (Liu et al.,

2008; Garcia-Pino et al., 2008), and indicates that Doc target may be a component of or

associated with the translation machinery , consistent with the finding that Doc associates

with ribosome’s (Liu et al., 2008).

Chapter 5: Results

Mechanism of Action of Doc (Death on Curing) from Phage

Figure 5.5: In vitro analyses of Doc (A), Phd and against time (E). The reaction mixture was analysed using western blotting post 1h incubation at 37

A. Doc inhibits translation aliquots of EasyXpress reaction mixture.then analysed by western blot

B. Phd neutralizes Doc-mediated inhibition of translation. Increasing concentration of purified Phd was added to 20 µl of aliqThe reaction incubated for 1

C. Doc mutant A61R canwhat is performed for wild type Doc. The reaction was analysed by

D. Doc mutant H66Y canwhat is performed for wild type Doc except that in this case we used higher compared to wild type Doc. The reaction was analysed by

E. Phd can reverse inhibitory action of Doc blotting. “+” indicates positive control.

5.5 Phd Neutralizes Doc

The same assay was used to test if Phd can neutralize the inhibitory action of Doc

and to determine the stoichiometry of the neutralizing complex. The crystal structure of

Doc in complex with Phd indicates two functional Phd binding sites

clear if neutralization by Phd

unpublished results). Here, 250

EasyXpress positive-control DNA template

Chapter 5: Results


analyses of Doc (A), Phd and Doc (B), DocA61R(C), DocH66Y (D) and, Phd and Doc The reaction mixture was analysed using western blotting post 1h incubation at 37

Doc inhibits translation in vitro. Increasing concentration of purified Doc was added to 20aliquots of EasyXpress reaction mixture. The reaction incubated for 1 h at 37then analysed by western blotting.

mediated inhibition of translation. Increasing concentration of purified Phd µl of aliquots of EasyXpress reaction mixture supplemented with 250

The reaction incubated for 1 h at 37oC. The reaction was then analysed by western blottingDoc mutant A61R cannot inhibit translation in vitro. The experimental-set up was very similar to

hat is performed for wild type Doc. The reaction was analysed by western blottingannot inhibit translation in vitro. The experimental-set up was very similar to

what is performed for wild type Doc except that in this case we used higher compared to wild type Doc. The reaction was analysed by western blotting.

inhibitory action of Doc all the time ≤ 2h. The reaction was analysed by . “+” indicates positive control.

eutralizes Doc In Vitro

The same assay was used to test if Phd can neutralize the inhibitory action of Doc


Doc in complex with Phd indicates two functional Phd binding sites on Doc, but it is not

clear if neutralization by Phd requires both to be occupied (Garcia

. Here, 250 nM of purified Doc was added before addition of

ontrol DNA template. We then added increasing am


B), DocA61R(C), DocH66Y (D) and, Phd and Doc The reaction mixture was analysed using western blotting post 1h incubation at 37oC.

. Increasing concentration of purified Doc was added to 20 µl of The reaction incubated for 1 h at 37oC. The reaction was

mediated inhibition of translation. Increasing concentration of purified Phd supplemented with 250 nM Doc.

western blotting. set up was very similar to

western blotting. set up was very similar to

what is performed for wild type Doc except that in this case we used higher concentration as

2h. The reaction was analysed by western

The same assay was used to test if Phd can neutralize the inhibitory action of Doc in vitro


on Doc, but it is not

requires both to be occupied (Garcia-Pino and loris -

nM of purified Doc was added before addition of

. We then added increasing amounts Phd (1



nM, 50 nM, 125 nM, 250 nM, 500 nM, 1 µM, 10 µM) to Doc-treated reaction mixture in

order to determine whether Phd can neutralize in vitro Doc toxicity or not. As seen from

Fig 5.5 (B), in this assay, Phd neutralized the toxic effect of Doc. Neutralization of

inhibition was achieved at concentration of 250 nM of Phd. This result shows that Phd is

functional in vitro and that Phd in this experimental set-up can neutralize Doc mediated

inhibition of translation. Moreover, the result demonstrate that neutralization of toxicity

is possible at equimolar concentration of Phd with Doc and this result suggests that one

of the two binding site of Phd on Doc is enough to reverse toxicity.

Similar experiment was repeated but this time with equimolar concentration of Doc and

Phd against time, to test if Phd can reverse Doc-toxicity a posterior. Here, 250 nM of

purified Doc was added at the start of the experiment and challenged with 250 nM of

purified Phd at times 0 h, 0.25 h, 0.5 h, 1 h, 1.5 h and 2 h. As seen from Fig 5.5 (E), in

this assay, Phd reverses the inhibitory effect of Doc. Reversal of inhibition was achieved

at all time points in this experimental set-up. This result shows that Phd can reverse Doc

mediated inhibition even after 2 h incubation with the toxin Doc. This result suggests that

Doc blocks translation sterically and probably does not enzymatically modifies the

translation apparatus or the mRNA unlike other TA’s that enzymatically cleaves mRNA

to inhibit translation in ribosome dependent and in dependent manner as in case of RelE

and MazF respectively (Christensen et al., 2001; Christensen et al., 2003; Pederson et al.,

2003; Zhang et al., 2003; Munoz-Gomez et al., 2004; Takagi et al., 2005; Zhang et al.,

2005).

5.6 DocA61R and DocH66Y do not Inhibit Translation In Vitro

Next we tested the Doc mutants A61R and H66Y for their ability to inhibit translation in

vitro. These were the only two single point mutations that we were able to introduce in a

wild-type Doc background. DocA61R has one of its Phd binding sites disrupted while

DocH66Y is a mutant that was previously described (Magnuson & Yarmolinsky, 1998).

Although the mutation is located outside the Phd binding regions, it is located in a

conserved surface loop and significantly reduces the toxicity of the protein in vivo. In

contrast to the wild-type protein, DocH66Y purifies as a domain-swapped dimer (Garcia-



Pino and Loris - unpublished results) and it is not known if its reduced toxicity is a direct

consequence of dimer formation, or whether His66 is a crucial residue for interaction

with the ribosome. The in vitro translation assay was used to test if DocA61R and

DocH66Y (in its monomeric form) can inhibit translation. The reaction mixtures were

incubated for 1 h at 37oC with increasing amounts of purified DocA61R (1 pM, 500 pM,

750 pM, 1 nM, 100 nM, 250 nM, 500 nM and 1 µM) and DocH66Y (50 nM, 250 nM, 1

µM, 5 µM, 25 µM, 100 µM and 250 µM). As seen from Fig 5.5 (C & D), neither of the

Doc mutants can inhibit translation in vitro at all concentration tested. This result shows

that DocA61R and DocH66Y are not toxic at this concentration range in vitro and in

contrast, we observed that over expression DocH66Y reduces growth (Fig 5.4). These

results suggest that His66 and Ala61 are involved in the functional activity of Doc.

5.7 DocH66Y and DocA61R Possesses Definite Secondary Structure

In order to establish that the apparent inactivity of DocA61R and DocH66Y is not due to

(partial) unfolding of the proteins, their secondary structure contents was verified with

CD spectroscopy and compared with that of wild-type Doc. The far UV CD spectra of

both mutants are indistinguishable from the CD spectrum of the wild-type protein,

indicating that they are properly folded (Fig 5.6). The observed similar secondary

structure between the wild type and mutant Doc suggests that the failure to inhibit in vitro

translation is rather due to mutation.

Figure 5.6: Far UV-CD Spectra of Doc, DocA61R and DocH66Y. The far UV CD spectrums of these proteins are identical within experimental error and suggest that all proteins are properly folded.


6. Discussion

TA systems characterize the newly discovered defense mechanisms of free-living

bacteria (Gerdes et al., 2005). They are addition to the already enlisted defense

mechanisms of free-living bacteria. TA’s do their job in one of the following way:

Chromosomally encoded TA toxins confers advantage to the free-living bacterial

population by protecting them from stress by initiating signals to pull cells from an active

growth mode into a quasidormant phase (e.g, mazEF); plasmid-encoded toxins facilitate

postsegregational killing to maintain an extra chromosomal element that conveys a

survival advantage to the cell (e.g, P1 bacteriophage).

The toxin components of TA systems are regarded as intracellular time bombs that

detonate upon accidental release from the complex. This means that their release from

complexes with their partner antitoxins can initiate bacterial cell death or cell cycles

arrest (Hayes, 2003). Understanding the activation and mechanism of killing of toxins

could allow the possibility of exploiting the knowledge for designing novel antibacterial

for pathogens of medical importance. TA’s are absent in eukaryotes (Aizenman et al.,

1996; Gerdes, 2000; Christensen et al., 2001; Pedersen et al., 2003). Their absence in

eukaryotes and ubiquitous presence in prokaryotes including pathogens give the exciting

possibilities to use them as antibacterial agent. One possible approach is to target TA

system by preventing toxin and antitoxin components from interacting in vivo, which

would trigger their inhibitory (or lethal) effect on cell growth. The advantage of using TA

system as antibacterial thus provide the opportunities of avoiding drug associated side

effects to the patient. This is unlike the existing conventional antibiotics that may affect

the patient as well.

Studies over the past couple of decades gradually elucidated the molecular mechanisms

of quasidormancy or cell killing initiated by TA toxins. Up to now TA toxins are known

to interfere with one or more vital processes such as DNA replication, RNA transcription

and protein translation- with DNA gyrase, mRNA and ribosomes serving respectively as

toxin target. Doc has been shown to associate with the 70s ribosome and with the 30s

ribosomal subunit in that it inhibits translation through introducing defects of translation

elongation (Liu et al., 2008). Here we showed that Doc inhibits translation in vitro and

Chapter 6: Discussion 53


Phd can rescue Doc mediated in vitro translation inhibition. Introduction of single amino

acid change at and near Phd binding site of Doc completely abolish in vitro translation

inhibition ability of Doc.

Results from previous work on Doc toxin demonstrate that over expression of Doc

inhibited translation very efficiently (Liu et al., 2008; Garcia-Pino et al., 2008). Doc

binds to ribosomes and interferes with translation the same way as antibiotic Hygromycin

B. This was evidenced by Hygromycin B resistant cells that remain also unaffected by

Doc. Hygromycin B primarily function as an inhibitor of translation elongation; it acts at

translocation step by preventing movement of peptidyl tRNA from the A site to P site

(Cabanas et al., 1978; Cabanas et al., 1978; Eustice & Wilhelm, 1984). It has thus been

suggested that Doc hampers translation elongation, as Hygromycin B does, at

translocation step by averting movement of peptidyl tRNA from the A site to P site (Liu

et al., 2008). This gives a clue on mechanism of action of Doc toxin. These in vivo results

are in agreement with in vitro inhibition of translation observed in our experiment (Fig

5.5 A).

Phd could rescue cells inhibited by Doc (Liu et al., 2008; Garcia-Pino et al., 2008) and

can rescue Doc-mediated in vitro translation inhibition all the time post translation

inhibition activation (Fig 5.5 B & E) showing that cells experiencing Doc synthesis are

not killed. Rather, Doc seems to induce a condition in which cells are permanently

stationary and unable to form a colony. Moreover, our in vitro experiment (Fig 5.5 E)

provide a clue that Doc blocks translation sterically and probably does not enzymatically

modifies the translation apparatus or the mRNA unlike other TA’s that enzymatically

cleaves mRNA to inhibit translation in ribosome dependent and in dependent manner as

in case of RelE and MazF respectively (Christensen et al., 2001; Christensen et al., 2003;

Pederson et al., 2003; Zhang et al., 2003; Munoz-Gomez et al., 2004; Takagi et al., 2005;

Zhang et al., 2005) Further studies are nevertheless required to substantiate these finding.

In P1 lysogens, Phd binding spares the cell from Doc-mediated growth arrest by forming

heterotrimeric complex (P2D; 2 Phd : 1 Doc) (Gazit & Saurer, 1999).This means that the

two Phd binding site on Doc need to be occupied for toxin neutralization to occur. This

Chapter 6: Discussion 54


conclusion is argued by our experimental result that demonstrates neutralization of Doc

toxicity at equimolar concentration (Fig 5.5 B). This shows that it might not be essential

for neutralization of toxicity to occur both Phd binding site on Doc need to be occupied.

Complex formation not only spares the cells from Doc action but also protect Phd from

degradation mediated directly or indirectly by the ClpXP protease, which consists of Clp

protease subunit and regulatory ClpX ATPase subunits (Wawrzynow et al., 1995; Wang

et al., 1997; Griamaund et al., 1998). Phd donates its intrinsically non structured C-

terminal domain to form complex with Doc that in turn assist Phd to possess definite

structure and provide protection from degradation by cellular protease and, at the same

time spares cell from Doc action (Garcia-Pino et al., 2008).

Several lines of independent evidence show that Doc induced inhibition of growth are

caused by interference with protein translation: (i) Doc inhibit translation in vivo (Liu et

al., 2008; Garcia-Pino et al., 2008) and in vitro (Fig 5.5 A); (ii) Doc induces RelE

mediated mRNA cleavage (Garcia-Pino et al., 2008); (iii) mutation A61R and H66Y in

Doc did not inhibit translation in vitro (Fig 5.5 B & C) and showed reduced toxicity in

vivo (DocH66Y)( Magnuson & Yarmolinsky, 1998); (iv) addition of Phd neutralized and

reversed in vitro translation inhibition (Fig 5.5 B & E) and simultaneously reversed

inhibition of translation and cell growth (Liu et al., 2008). These studies clearly indicate

that Doc target may be a component of or associated with the translation machinery.

These results lend solid support for the conclusion that Doc-induced cell stasis is caused

by inhibition of translation.

Our result suggest that His66 and Ala61, located near and on Phd binding site

respectively on one face of Doc α-helix, are strongly involved in the functional activity of

Doc. Further studies on these amino acids and others will provide valuable information

for establishing the molecular mechanism and ribosome-binding activity of the Doc toxin

and also for establishing the indispensable binding site for toxin neutralization from the

two Phd sites on Doc.

Reference 55


7. References

Afif, H., Allali, N., Couturier, M. and van Melderen, L. (2001): The ratio between CcdA and

CcdB modulates the transcriptional repression of the ccd poison-antidote system. Mol

Microbiol. 41 (1), 73-82.

Aizenman, E., Engelberg-Kulka, H. and Glaser, G. (1996): An Escherichia coli chromosomal

“addiction module” regulated by guanosine 3′, 5′-bispyrophosphate: a model for

programmed bacterial cell death. Proc Natl Acad Sci USA. 93 (12), 6059-6063.

Amitai, S., Yassin, Y. and Engelberg-Kulka, H. (2004): MazF-mediated cell death in Escherichia

coli: a point of no return. J Bacteriol. 186 (24), 8295-8300.

Arcus, V.L., Bäckbro, K., Roos, A., Daniel, E.L. and Baker, E.N. (2004): Distant structural

homology leads to the functional characterization of an archaeal PIN domain as an

exonuclease. J Biol Chem. 279 (16), 16471-16478.

Bayles, K.W. (2007): The biological role of death and lysis in biofilm development. Nat Rev

Microbiol. 5 (9), 721-726.

Bravo, A., de Torrontegui, G. and Diaz, R. (1987): Identification of components of a new stability

system of plasmid R1, ParD, that is close to the origin of replication of this plasmid. Mol

Gen Genet. 210 (1), 101-110.

Budde, P.P., Davis, B.M., Yuan, J., and Waldor, M.K. (2007): Characterization of a higBA Toxin-

Antitoxin Locus in Vibrio cholerae. J Bacteriol. 189 (2), 491-500

Buts, L., Lah, J., Dao-Thi, M.H., Wyns, L., and Loris, R. (2005): Toxin-Antitoxin modules as

bacterial metabolic stress managers. Trends Biochem Sci. 30 (12), 672-679

Cabanas, M.J., Vazquez, D. and Modolell, J. (1978): Dual interference of hygromycin B with

ribosomal translocation and with aminoacyl-tRNA recognition. Eur J Biochem. 87 (1),

21-27

Cabanas, M.J., Vazquez, D. and Modolell, J. (1978): Inhibition of ribosomal translocation by

aminoglycoside antibiotics. Biochem Biophys Res Commun. 83 (3), 991-997.

Cherny, I. and Gazit, E. (2004): The YefM antitoxin defines a family of natively unfolded proteins:

implications as a novel antibacterial target. J Biol Chem. 279 (9), 8252-826.

Christensen, S.K. and Gerdes, K. (2003): RelE toxins from bacteria and archaea cleave mRNAs

on translating ribosomes, which are rescued by tmRNA. Mol Microbiol. 48 (5), 1389-

1400

Reference 56


Christensen, S.K., Maenhaut-Michel, G., Mine, N., Gottesman, S., Gerdes, K. and van Melderen,

L. (2004): Overproduction of the Lon protease triggers inhibition of translation in

Escherichia coli: involvement of the yefM-yoeB toxin-antitoxin system. Mol Microbiol.

51 (6), 1705-1717.

Christensen, S.K., Mikkelsen, M., Pedersen, K. and Gerdes, K. (2001): RelE, a global inhibitor of

translation, is activated during nutritional stress. Proc Natl Acad Sci USA. 98 (25),

14328-14333.

Christensen, S.K., Pedersen, K., Hansen, F.G., Gerdes, K. (2003): Toxin-antitoxin loci as stress-

response-elements: ChpAK/MazF and ChpBK cleave translated RNAs and are

counteracted by tmRNA. Mol Biol. 332 (4), 809-819.

Christensen-Dalsgaard, M. and Gerdes, K. (2006): Two higBA loci in the vibrio cholera

superintegron encode mRNA cleaving enzymes and stabilize plasmids. Mol Microbiol.

62 (2), 397-411.

Critchlow, S.E., O'Dea, M.H., Howells, A.J., Couturier, M., Gellert, M. and Maxwell, A. (1997):

The interaction of the F plasmid killer protein, CcdB, with DNA gyrase: induction of

DNA cleavage and blocking of transcription. Mol Biol. 273 (4), 826-839.

Dao-Thi, M.H., Charlier, D., Loris, R., Maes, D. Messens, J., Wyns, L. and Backmann, J. (2002):

Intricate interactions within the ccd plasmid addiction system. J Biol Chem. 277 (5),

3733-3742.

Dao-Thi, M.H., Messens, J., Wyns, L. and Backmann, J. (2000): The thermodynamic stability of

the proteins of the ccd plasmid addiction system. Mol Biol. 299 (5), 1373-1386.

Dao-Thi, M.H., van Melderen, L., De Genst, E., Afif, H., Wyns, L. and Loris, R.(2005):

Molecular basis of gyrase poisoning by the addiction toxin CcdB. Mol Biol. 348 (5),

1091-1102.

de la Hoz, A.B., Ayora, S., Sitkiewicz, I., Fernandez, S., Pankiewicz, R., Alonso, J.C. and

Ceglowski, P. (2000): Plasmid copy-number control and better-than-random segregation

genes of pSM19035 share a common regulator. Proc Natl Acad Sci. USA. 97 (2), 728-

733.

del Solar, G., Hernandez-Arriaga, A.M., Gomis-Ruth, F.X., Coll, M., and Espinosa, M. (2002): A

genetically economical family of plasmid-encoded transcriptional repressors involved in

control of plasmid copy number. J Bacteriol. 184 (18), 4943-4951

Reference 57


Engelberg-Kulka, H. and Glaser, G. (1999): Addiction modules and programmed cell death and

antideath in bacterial cultures. Ann Rev Microbiol. 53, 43-70.

Engelberg-Kulka, H., Amitai, S., Kolodkin-Gal, I. and Hazan, R.(2006): Bacterial Programmed

Cell Death and Muticellular Behavior in bacteria. PLos Genet. 2 (10), e135.

Engelberg-Kulka, H., Hazan, R. and Amitai, S. (2005): mazEF: a chromosomal toxin-antitoxin

module that triggers programmed cell death in bacteria. J Cell Sci. 118 (19), 4327-4332

Eustice, D.C. and Wilhelm, J.M. (1984): Fidelity of the eukaryotic codon–anticodon interaction:

Interference by amino glycoside antibiotics. Biochemistry. 23 (7), 1462-1467.

Garcia-Pino, A., Christensen-Dalsgaard, M., Wyns, L., Yarmolinsky, M., Magnuson, R.D.,

Gerdes, K. and Loris, R. (2008): Doc of prophage P1 is inhibited by its antitoxin partner

Phd though folds complementation. J Biol Chem. 283 (45), 30821-30827.

Gazit, E. and Sauer R.T. (1999): The Doc Toxin and Phd Antidote Proteins of the Bacteriophage

P1 Plasmid Addiction System Form a Heterotrimeric Complex. J Biol Chem. 274 (24),

16813-16818.

Gerdes, K. (2000): Toxin-antitoxin module may regulate synthesis of macromolecules during

nutritional stress. J Bacteriol. 182 (3), 561-572.

Gerdes, K. and Wagner, E.G.H. (2007): RNA antitoxins. Curr.Opin.Microbiol. 10 (2), 117-124.

Gerdes, K., Christensen, S.K. and Løbner-Olesen, A. (2005): Prokaryotic toxin-antitoxin stress

response loci. Nat Rev Microbiol. 3 (5), 371-382

Gerdes, K., Gultyaev, A. P., Franch, T., Pedersen, K. and Mikkelsen, N. D. (1997): Antisense

RNA-Regulated Programmed Cell Death. 31, 1-31

Gerdes, K., Helin, K., Christensen, O.W. and Løbner-Olesen, A. (1988): Translational control and

differential RNA decay are key elements regulating postsegregational expression of the

killer protein encoded by the parB locus of plasmid R1. Mol Biol. 203 (1), 119-129.

Gerdes, K., Rasmusen, P.B. and Molin, S. (1986): unique type of plasmid maintenance function:

postsegregational killing of plasmid-free cells. Proc Natl Acad Sci USA. 83 (10), 3116-

3120.

Gogos , A., Mu, H., Bahna, F., Gomez, C.A. and Shapiro, L. (2003): Crystal structure of YdcE

from Bacillus subtilis. Proteins. 53 (2), 320-322.

Reference 58


Gotfredsen, M. and Gerdes, K. (1998): The Escherichia coli relBE genes belong to a new toxin-

antitoxin gene family. Mol Microbiol. 29 (4), 1065-1076

Grady, R. and Hayes, F. (2003): Axe-Txe, a broad-spectrum proteic toxin-antitoxin system

specified by a multidrug-resistant, clinical isolate of Enterococcus faecium. Mol

Microbiol. 47 (5), 1419-1432.

Grimaud, R., Kessel, M., Beuron, F., Steven, A.C. and Maurizi, M.R. (1998): Enzymatic and

Structural Similarities between the Escherichia coli ATP-dependent Proteases, ClpXP

and ClpAP. J Biol Chem. 273 (20), 12476-12481.

Guglielmini, J., Szpirer, C. and Milinkovitch, M.C. (2008): Automated discovery and

phylogenetic analysis of new toxin-antitoxin systems. BMC Microbiol. 8 (104), 1471-

2180.

Hall-Stoodley, L., Costerton, J.W. and Stoodley, P. (2004): Bacterial biofilms: from the Natural

environment to infectious diseases. Nat Rev Microbiol. 2 (2), 95-108.

Hanahan, D., Jessee, J. and Bloom, F.R. (1991): Plasmid transformation of Escherichia coli and

other bacteria. Methods Enzymol. 204, 63-113.

Hargreaves, D., Santos-Sierra, S., Giraldo, R., Sabariegos-Jareno, R., de la Cueva-Me´ ndez, G.,

Boelens, R., Dı´az-Orejas, R. and Rafferty, J.B. (2002): Structural and functional analysis

of the Kid toxin protein from E. coli plasmid R1. Structure. 10 (10), 1425-1433.

Hayes, F. (2003): Toxins-Antitoxins: Plasmid Maintenance, Programmed Cell Death, and Cell

Cycle Arrest. Science. 301 (5639), 1496-1499.

Hazan, R., Sat, B. and Engelberg-Kulka, H. (2004): Escherichia coli mazEF mediated cell death is

triggered by various stressful conditions. J Bacteriol. 186 (11), 3663-3669.

Hazan, R., Sat, B., Reches, M. and Engelberg-Kulka, H. (2001): The postsegregational killing

mediated by the phage P1 `addiction module': phd-doc requires the Escherichia coli

programmed cell death system mazEF. J Bacteriol. 183 (6), 2046-2050.

Heinrich, J., Velleman, M. and Schuster, H. (1995): The tripartite immunity system of phages P1

and P7. FEMS Microbiol Rev. 17 (1-2), 121-126.

Hentgartner, M.O. (2000): The biochemistry of apoptosis. Nature. 407 (6805), 770-776.

Hunter, P. (2008): The mob response. The importance of biofilm research for combating chronic

disease and tackling contamination. EMBO Rep. 9 (4), 314-317.

Reference 59


Ikeda, H. and Tomizawa, J.I. (1965): Transducing fragments in generalized transduction by phage

P1.3. Studies with small phage particles. Mol Biol. 14 (1), 120-129.

Jacobson, M.D., Weil, L. and Raff, M.C. (1997): Programmed cell death in animal development.

Cell. 88 (3), 347-354.

Jensen, R.B. and Gerdes, K. (1995): Programmed cell death in bacteria: proteic plasmid

stabilization systems. Mol Microbiol. 17 (2), 205-210

Johnson, E.P., Strom, A.R. and Helinski, D.R. (1996): Plasmid RK2 toxin protein ParE:

purification and interaction with the ParD antitoxin protein. J Bacteriol. 178 (5), 1420-

1429.

Kamada, K. and Hanaoka, F. (2005): Conformational change in the catalytic site of the

ribonuclease YoeB toxin by YefM antitoxin. Mol Cell. 19 (4), 497-509.

Kamada, K., Hanaoka, F. and Burley S.K. (2003): Crystal structure of the MazE/MazF complex:

molecular bases of antidote-toxin recognition. Mol Cell. 11 (4), 875-884.

Koyama, A.H., Wada, C., Nagata, T. and Yura, T. (1975): Indirect selection for plasmid mutants:

Isolation of ColVBtrp mutants’ defective in self maintenance in Escherichia coli. J

Bacteriol. 122 (1), 73-79.

Laemmli, U.K. (1970): Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature. 227 (5259), 680-685.

Lane, N. (2008): Marine microbiology: origins of death. Nature. 453 (7195), 583-585.

Lehnherr, H. and Yarmolinsky, M.B. (1995): Addiction protein Phd of plasmid prophage P1 is a

substrate of the ClpXP serine protease of Escherichia coli. Proc Natl Acad Sci USA. 92

(8), 3274-3277.

Lehnherr, H., Maguin, E., Jafri, S. and Yarmolinsky, M.B. (1993): Plasmid addiction genes of

bacteriophage P1: doc, which causes cell death on curing of prophage, and phd, which

prevents host death when prophage is retained. Mol Biol. 233 (3), 414-428.

Lemmonier, M., Santos-Siera, S., Pardo-Abario, C. and Diaz-Orejas, R. (2004): Identification of

Residues of the Kid Toxin Involved in Autoregulation of the parD System. J Bacteriol.

186 (1), 240-243.

Lewis, K. (2000): Programmed Death in Bacteria. Microbiol and Molecul Biol. 64 (3), 503-514.

Reference 60


Liu, M., Zhang, Y., Inouye, M. and Woychik, N.A. (2008): Bacterial addiction module toxin Doc

inhibits translation elongation through its association with the 30S ribosomal subunit.

Proc Natl Acad Sci USA. 105 (15), 5885-5890.

Lobocka, M.B., Rose, D.J., Plunkett, G.III, Rusin, M., Samojedny, A., Lehnherr, H., Yarmolinsky,

M.B. and Blattner, F.R. (2004): Genome of Bacteriophage P1. J Bacteriol. 186 (21),

7032-7068.

Loris, R., Dao-Thi, M.H., Behassi, E.M., van Melderen, L., Poortmans, F., Liddington, R.,

Couturier, M. and Wyns, L. (1999): Crystal structure of CcdB, a topoisomerase poison

from E. coli. Mol Biol. 285 (4), 1667-1677.

Loris, R., Marianovsky, I., Lah, J., Laeremans, T., Engelberg-Kulka, H., Glaser, G., Muyldermans

S. and Wyns, L. (2003): Crystal Structure of the Intrinsically Flexible Addiction Antidote

MazE. J Biol Chem. 278 (30), 28252-28257.

Magnuson, R.D and Yarmolinsky, M.B. (1998): Corepression of the P1 addiction operon by Phd

and Doc. J Bacteriol. 180 (23), 6342-6351.

Magnuson, R.D., (2007): Hypothetical Functions of Toxin-Antitoxin Systems. J Bacteriol. 189

(17), 6089-6092.

Magnuson, R.D., Lehnherr, H., Mukhopadhyay, G. and Yarmolinsky, M.B. (1996):

Autoregulation of the Plasmid Addiction Operon of Bacteriophage P1. J Biol Chem. 271

(31), 18705-18710.

Maki, S., Takiguchi, S., Miki, T. and Horiuchi, T. (1992): Modulation of DNA supercoiling

activity of Escherichia coli DNA gyrase by F plasmid proteins. Antagonistic actions of

LetA (CcdA) and LetD (CcdB) proteins. J Biol Chem. 267 (17), 12244-12251.

Mandl, T., van Melderen, L., Mine, N., Respondek, M., Oberer, M., Keller, W., Khatai, L. and

Zangger, K. (2006): Structural Basis for Nucleic Acid and Toxin Recognition of the

Bacterial Antitoxin CcdA. Mol Biol. 364 (2), 170-185.

Marionovsky, I., Aizenman, E., Engelberg-Kulka, H. and Glaser, G. (2001): The regulations of

Escherichia coli mazEF promoter involve an unusual alternating palindrome. J Biol

chem. 276 (8), 5975-5984.

Mcknley, J.E. and Magnuson, R.D. (2005): Characterization of the Phd repressor-antitoxin

boundary. J Bacteriol. 187 (2), 765-70.

Reference 61


Meinhart, A., Alonso, J.C., Strater, N. and Saenger, W. (2003): Crystal structure of the plasmid

maintenance system ε/ζ: Functional mechanism of toxin ζ and inactivation by ε2ζ2

complex formation. Proc Natl Acad Sci USA. 100 (4), 1661-1666.

Mullis, K.B. (1990): The unusual origin of the Polymerase Chain Reaction. Scientific American.

April: 36-43.

Munoz-Gomez, A.J., Santos-Sierra, S., Berzal-Herranz, A., Lemonnier, M. and Diaz-Orejas, R.

(2004): Insights into the specificity of RNA cleavage by the Escherichia coli MazF toxin.

FEBS Lett. 567 (2-3), 316-320.

Nagata, S. (1997): Apoptosis by death factor. Cell. 88 (3) 355-365.

Naito, T., Kusano, K. and Kobayashi, I. (1995): Selfish behavior of restriction-modification

systems. Science. 267 (5199), 897-899.

Oberer, M., Zangger, K., Gruber, K. and Keller, W. (2007): The solution structure of ParD, the

antidote of the ParDE toxin-antitoxin module, provides the structural basis for DNA and

toxin binding. Protein Sci. 16 (8), 1676-1688.

Ogura, T. and Hiraga, S. (1983): Mini-F plasmid genes that couple host cell division to plasmid

proliferation. Proc Natl Acad Sci USA. 80 (15), 4784-4788.

Pandey, D.P. and Gerdes, K. (2005): Toxin-antitoxin loci are highly abundant in free-living but

lost from host-associated prokaryotes. Nucleic Acids Research. 33 (3), 966-976.

Pedersen, K., Zavialov, A.V., Pavlov, M.Y., Elf, J., Gerdes, K. and Ehrenberg, M. (2003): The

bacterial toxin RelE displays codon-specific cleavage of mRNAs in the ribosomal A site.

Cell. 112 (1), 131-140.

Perry, J.J., Staley, J.T. and Lory, S. (2002): Microbial Life, Chapter 15- Genetic exchange, pages

311-330. Sinauer Associates, Inc., Massacheusetts (MA), USA.

Phillips, S.E. (1994): The β-ribbon DNA recognition motif. Annu Rev Biophys Biomol Struct. 23,

671-701.

Pomerantsev, A.P., Golovliov, I.R., Ohara, Y., Mokrievich, A.N., Obuchi, M., Norqvist, A.,

Kuoppa, K. and Pavlov V.M. (2001): Genetic organization of the Francisella plasmid

pFNL10. Plasmid. 46 (3), 210-222.

Porath, J., Carlsson, J., Olsson, I. and Belfrage, G. (1975): Metal Chelate affinity chromatography,

a new approach to protein fractionation. Nature. 258 (5536), 598-599.

Raff, M. (1998): Cell Suicide for beginners. Nature. 396 (6707), 119-122.

Reference 62


Raumann, B.E., Rould, M.A., Pabo, C.O. and Sauer, R.T. (1994): DNA recognition by β-sheets in

the Arc repressor-operator crystal structure. Nature. 367 (6465), 754-757.

Rice, K.C. and Bayles, K.W. (2008): Molecular control of bacterial death and Lysis. Micro Mol

Biol Rev. 72 (1), 85-109.

Roberts, R.C., Strom, A.R. and Helinski, D.R. (1994): The parDE operon of the broad-host-range

plasmid RK2 specifies growth inhibition associated with plasmid loss. Mol Biol. 237 (1),

35-51.

Rowe-Magnus, D.A., Guerout, A.M., Biskri, L., Bouige, P. and Mazel, D. (2003): Comparative

analysis of super integrons: engineering extensive genetic diversity in the Vibrionaceae.

Genome Res. 13, 428-442.

Sambrook, J., Fritisch, E.F., and Maniatis, T. (1989): ‘‘Molecular Cloning: A Laboratory

Manual.’’ Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Santos-Sierra, S., Pardo-Abarrio, C., Giraldo, R. and Diaz-Orejas, R. (2002): Genetic

identification of two functional regions in the antitoxin of the ParD killer system of

plasmid R1. FEMS Microbiol Lett. 206 (1), 115-119.

Sat, B., Hazan, R., Fisher, T., Khaner, H., Glaser, G. and Engelberg-Kulka, H. (2001):

Programmed cell death in Escherichia coli: some antibiotics can trigger the MazEF

lethality. J Bacteriol. 183 (6), 2041-2045.

Sat, B., Reches, M. and Engelberg-Kulka, H. (2003): The Escherichia coli chromosomal `suicide

module' mazEF is involved in thymine-less death. J Bacteriol. 185 (6), 1803-1807.

Saylers , A.A. and Whitt, D.D. (2002a): Bacterial pathogenesis: A molecular approach, chapter 1-

The un easy Truce : Never underestimate the power of bacteria, Pages 3-18. ASM press,

Maryland (MD), USA, Second edition.

Saylers , A.A. and Whitt, D.D. (2002b): Bacterial pathogenesis: A molecular approach, chapter

11-How bacteria become resistant to Antibiotics, Pages 168-184. ASM press, Maryland

(MD), USA, Second edition.

Schumacher, M.A., Piro, K.M., Xu, W., Hansen, S., Lewis, K. and Brennan, R.G. (2009):

Molecular mechanisms of HipA-mediated multidrug tolerance and its neutralization by

HipB. Science. 323 (5912), 396-401.

Smith, J.A. and Magnuson R.D. (2004): Modular Organization of the Phd Repressor/Antitoxin

Protein. J Bacteriol. 186 (9), 2692-2698.

Reference 63


Studier, F.W., Rosenberg, A.H., Dunn, J.J. and Dubendorff, J.W. (1990): Use of T7 rna

polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89.

Takagi, H., Kakuta, Y., Okada, T., Yao, M., Tanaka, I. and Kimura, M. (2005): Crystal structure

of an archaeal toxin-antitoxin RelE-RelB complex with implications for toxin activity

and antitoxin effects. Nat Struct Mol Biol. 12 (4), 327-331.

Tian, Q.B., Ohnishi, M., Tabuchi, A., Terawaki, Y. (1996): A new plasmid-encoded proteic killer

gene system: cloning, sequencing, and analyzing hig locus of plasmid Rts1. Biochem

Biophys Res Commun. 220 (2), 280–284

Towbin, H., Staehelin, T. and Gordon, J. (1979): Electrophoretic transfer of proteins from

polyaccrylamide gels to nitrocellulose sheets: procedure and some applications. Proc

Natl Acad Sci USA. 76 (9), 4350-4354.

van Melderen, L. and Saavedra De Bast, M. (2009): Bacterial Toxin-Antitoxin systems: More

Than Selfish Entities? PLoS Genet. 5 (3), e1000437.

Vaughn, J.L., Feher, V.A., Bracken, C. and Cavanagh, J. (2001): The DNA-binding domain in the

Bacillus subtilis transition-state regulator AbrB employs significant motion for

promiscuous DNA recognition. Mol Biol. 305 (3), 429-439.

Wang, J., Hartling, J.A. and Flanagan, J.M. (1997): The Structure of ClpP at 2.3 A° Resolution

Suggests a Model for ATP-Dependent Proteolysis. Cell. 91, 447-456.

Wawrzynow, A., Wojtkowiak, D., Marszalek, J., Banecki, B., Jonsen, M., Graves, B.,

Georgopoulos, C. and Zylicz, M. (1995): The ClpX heat-shock protein of Escherichia

coli, the ATP-dependent substrate specificity component of the ClpP-ClpX protease, is a

novel molecular chaperone. EMBO J. 14 (9), 1867-1877.

Zhang, J., Zhang, Y. and Inouye, M. (2003): Characterization of the interactions within the mazEF

addiction module of Escherichia coli. J Biol Chem. 278 (34), 32300-32306.

Zhang, Y., Zhang, J., Hara, H., Kato, I. and Inouye, M. (2005): Insights into the mRNA cleavage

mechanism by MazF, an mRNA interferase. J Biol Chem. 280 (5), 3143-3150.

Zielenkiewicz, U. and Ceglowski, P. (2001): Mechanisms of plasmid stable maintenance with

special focus on plasmid addiction systems. Acta Biochim Pol. 48 (4), 1003-1023.

zegeye thesis final (mechanism of action of doc from bacteriophage p1)

Documents