wwandin parkandin park · 2020. 2. 6. · wwandin parkandin park iinternational horse...
TRANSCRIPT
WANDIN PARKWANDIN PARKINTERNATIONAL HORSE EVENTINTERNATIONAL HORSE EVENT
Saturday 17th & Sunday 18th March 2018Saturday 17th & Sunday 18th March 2018
Photo supplied by Trot-Shots
maroondahprinting
Wandin Seville Community Bank® Branch
Phone 5964 4595
2
Celebrating 30 Years
For more information visit - www.prydes.com.au
100% quality guaranteed - Australian made & owned
Katie Classon
Tas / South Aust / Vic
Ph: 0488 552 540
Orla LyonsHunter Valley / Syd BasinPh: 0498 998 088
Mitchell Pryde
Marketing Manager
Ph: 0427 487 963
Matthew Pryde
National Sales Manager
New South Wales
Ph: 0427 172 023
SE QLD / NE NSW
Ph: 0427 423 912
Rod Kidner
Nth & Central QLD & NT
Ph: 0427 423 966
Jessica Jackson
Southern NSW
Ph: 0427 464 242
Samantha Kilgour
NW Victoria
Ph: 0438 493 620
Kristie Clark
SE QLD / NE NSW
Ph: 0429 233 496
made & owned d
EasiResponse• Cool extruded feed for calm, responsive energy
• So easy to digest, feed less for a great result
EasiResult• Our tastiest feed yet - your horse will love it!• Cool extruded feed for calm, responsive energy• Omega oils and quality protein for coat shine and muscle
100% quality guara
iResultr tastiest feed yet -
ur horse will love it!ol extruded feed form, responsive energyega oils and qualitytein for coat shine
d muscle
y
Emily Anker
Tegan Lush
Murray Lam
perd
Craig Barrett
Will Enzinger
Wandin Park Horse Event - Saturday 17th MarchDressage Main
ArenaRings Showjumping Cross Country Young Event Horse
7.00am - 9.00am8.00am - 11.54am Train 4 (a) 98.30am - 11.48am Train 4 (b) 108.30am - 11.48am Train 4 (c) 118.30am - 11.32am CIC* (a) 68.30am - 11.38am EVA95 ( a) 88.30am - 11.38am Train 3 (a) 18.30am - 11.38am Train 3 (b) 28.30am - 11.50 am EVA 8 0 (b) 38.30am - 11.44 am EA80 (c) 48.30am - 11.50am EA80 (d) 58.30am - 12.26pm EVA 105 (a) 712 noon - 2.00pm 12 noon - 1.00pm EVA80 (d) Sand Arena R112.30pm - 1.06pm Training 4 (a)12.30pm - 1.35pm Conformation1.00pm - 3.10pm CIC** 51.00pm - 3.25pm Train 2 21.00pm - 3.50pm EVA 95 (d) 61.00pm - 4.08pm CIC* (b) 71.00pm - 4.08pm EVA95 (c) 31.00pm - 4.08pm EVA95 (b) 11.00pm - 4.20pm EVA80 (a) 81.00pm - 4.56pm EVA105 (b) 41.02pm - 1.58pm Training 3 (a) Sand Arena R11.07pm - 1.42pm Training 4 (b )1.43pm - 2.18pm Training 4 (c)2.00pm - 2.56pm Training 3 (b) Sand Arena R12.00pm - 3.12pm Training 4 (a) Sand Arena R22.40pm - 3.09pm EVA80 (c) 3.10pm - 3.40pm EVA80 (d)3.14pm - 4.24pm Training 4 (b) Sand Arena R23.40pm - 4.50pm CIC*** 53.41pm - 4.09pm Training 3 (a) 4.00pm - 4.58pm EVA80 (c) Sand Arena R14.10pm - 4.38pm Training 3 (b)4.26pm - 5.36pm Training 4 (c) Sand Arena R24.30pm - 5.35pm Dressage Ring 14.50pm - 5.55pm Paces
Sunday 18th MarchCross Country Show Jumping
8.00am - 8.30 am EVA80 (a)8.31am - 9.01am EVA80 (b) 9.00am - 9 45am Young Event Horse Ring 2 Sand Arena9.00am - 9.54am CIC* (a) Main Grass Arena9.10am - 9.38am EVA95 (a)9.39am - 10.07am EVA95 (b)9.56am - 10.52am CIC* (b) Main Grass Arena10.00am - 11.00am EVA80 (a) Sand Arena R210.08am - 10.36am EVA95 (c)10.30am - 11.26am EVA95 (a) Sand Arena R1 10.37am - 11.02am EVA95 (d)11.02am - 12.02pm EVA80 (b) Sand Arena R211.03am - 11.23am Training 211.15am - 11.47am CIC** Main Grass Arena11.30am - 12.26pm EVA95 (b) Sand Arena R111.40am - 12.16pm EVA105 (a)12.17pm - 12 .54pm EVA105 (b) 12.20pm - 12.40pm CIC*** Main Grass Arena12.30am - 1.36pm EVA95 (c) Sand Arena R11.10pm - 1.37pm CIC* (a) 1.28pm - 2.18pm EVA95 (d) Sand Arena R1
1.30pm - 2.42pm EVA105 (a) Main Grass Arena1.38pm - 2.06pm CIC*(b)2.20pm - 3.00pm Training 2 Sand Arena R12.25pm - 2.41pm CIC**2.44pm - 3.58pm EVA105 (b) Main Grass Arena3.00pm - 3.30pm CIC***
3
Inspection FEI Identifi cation Informal trot up Red sand arena
Inspection FEI Identifi cation Informal trot up main arena warm up area
Presentations Un mounted -1st Horse required
4
Wandin Park Horse Event 2018
Trophies and PrizesClass 1st 2nd 3rd 4th 5th 6th 7th 8th 9th
Pryde's CIC*** $1,100 $850 $650 $450 $250
Kentaur CIC** Voucher $700 $510 $300 $150
Lilydale Isuzu CIC* $350 $280 $220 $130 $50 Rosette Rosette Rosette
Vienna Woods EVA105 $300 $220 $160 $110 $70 Rosette Rosette Rosette Rosette
MecWorma Young Event Horse $210 Trophy $170 $140 Rosette
Equissage EVA95 Rosette Rosette Rosette Rosette Rosette Rosette Rosette
Horseware Australia EVA80 Rosette Rosette Rosette Rosette Rosette Rosette Rosette Rosette
Horseland Training 2 Rosette Rosette Rosette Rosette Rosette Rosette
Horseland Training 3 Rosette Rosette Rosette Rosette Rosette Rosette Rosette
Horseland Training 4 Rosette Rosette Rosette Rosette Rosette Rosette Rosette Rosette Rosette
Australian Japanese Challenge Trophy Medal
Welcome everyone to our 38th Year of events at fabulous Wandin Park, and special welcome to our International and Interstate, Delegates, Stewards, judges, visitors and competitors.
Once again we have record entries, with a weekend of thrilling horse riding action.
With the support of our voluntary dedicated committee, we have facilitated an event which encourages riders to experience one of the best equestrian facilities.
This event we welcome a new sponsor Lilydale Isuzu Ute. On behalf of the organizing committee I sincerely thank Lilydale Isuzu and all our sponsors for their support: - Pryde’s EasiFeed, Equissage, Horseland Lilydale, Vienna Woods, Kentaur, 7 Eleven, Domain Chandon, Multcube, Maroondah Printing, Wandin/Seville Community Bank, Rider Video and Horseware Australia.
The ‘Young Event Horse’ section is always hotly contested with high quality entries. We are most grateful to MecWorma International Animal Health for their continued support.
My special thanks to all our volunteers, especially parents and students from Wandin Riding Academy, their help with Jump Judging and in so many areas is outstanding.
My particular thanks to all on Committee, their contribution is greatly valued and appreciated. Wandin Park Committee is indeed fortunate in the dedication and commitment of so many supporters.
Thanks to John and Angela Anker for making their beautiful property available. Together with their staff, John, Angela and William and family have over the year continued to improve Wandin Park grounds. The organizing committee appreciates their donation of time, staff and property, and also all volunteers who work behind the scenes.
We are continuing supporting Motor Neurone Disease Association with donations from the entry gate, The Freshman’s & trade fair. Thank you all for supporting this cause.
We are again holding the Australia / Japan trophy, presented each year. Good luck to both teams.
Saturday night will be a great time with Live Band and Pizza, for all camping and others to enjoy.
I wish all competitors a safe and enjoyable weekend.
Heather Dynes President Wandin Park Association Inc.
President’s Welcome
The Association also thank the following:Sponsors• Pryde’s Easi Feed• International Animal Health• Equissage• Isuzu Lilydale Ute• 7 Eleven• Vienna Woods• Bendigo Wandin - Seville Community Bank• Horseware Australia – Presenatation Rugs• Horseland Lilydale – Presentation Rugs• Kentaur Saddlery- Voucher towards a custom made saddle
or Purchase at online store• Multicube Stock Feeds• Rider Video• Domaine Chandon for donation of Sparkling Wine• Maroondah Printing - Printing Fliers
Suppliers:• AGPOWER• Isuzu Ute Lilydale- Vehicles for Arch.• Polvin Fencing
Finally the Committee of the Wandin Park Association express their gratitude to Neil Clinton, Lorraine & Peter Burgi also Sue & Brian Hodgson and Angela & John Anker for offering their hospitality, and hosting offi cials over the event weekend.
The committee also thanks all the volunteers who give their time to make this event possible.
AcknowledgementsThe Wandin Park Association sincerely thanks John & Angela, for the use of their beautiful property ‘Wandin Park,’ and for giving time staff, machinery and materials at a huge cost to them. This is greatly appreciated.
5
President: Heather DynesHonorary Organiser: John Anker Jarryd StanleyEntry Secretary: Nicole Rouget Lynne Brown Offi ce Assist Jacky Priestley Sandy Garland Lisa Tyrrell Jenelle Landsmeer Jo DarbyTreasurer: Elizabeth CampbellEntries: NominateHospitality Co-ordinators: Angela Anker Julie TaftCatering For Volunteers: Jill Meyer Gillian Uren Edwina Pignato Robyn Gibb Bay Fildes Berwyn PrenticeBar: Brad WhitelawGates: Motor Neurone DiseaseTrade Exhibits: Nan ClevenFEI-EFA Tech Delegate Ian Coulson Neil Clinton Robyn Brown FEI Steward: Doris RidettFEI Steward Assist Christine Wallis Suzy BurdonMedical Offi cers: Event Medical teamFEI Vet: Dr Kurt EnzingerTreating Vet: Dr Merridith Flash Farrier: Charles EastGround Manager: William AnkerGround Maintenance: John & Miriam StokesCommentators: Chris Smith Rebecca AnkerChief Scorers: Michael Boucher Anne Burgi Prue Short Sonia Thompson Sarah Larcombe Lucy Baker Wendy Nash
DressageCo-ordinator Hanna Millott
Judges:CIC*** Sumiko Suziki Lyn RoycroftCIC** Lyn Roycroft Sumiko SuzikiCIC* Bev Shandley Heather Buckland Sue NevettEvA 105 Caroline ColbyEvA 105 Barry Roycroft EvA 95 Catrina Corten EvA 95 Pam EdwardsEvA 95 Jacqueline SayersEvA 80 Cheryl BeckettEvA 80 Fiona NormandEvA 80 Caroline ColbyEvA 80 Heather Buckland Training 2 Lihla Wyles Training 3 Lyn RoycroftTraining 3 Jacqueline SayersTraining 4 Cathie McCadie Training 4 Veronica HarrisTraining 4 Claire Hartnet
Pencillers: Barbara Jeffrey Ron Beckett Jessica Marriner Alison Kingston Di Harvey Sharon Stanley Edwina Pignata Sue Lisa Moore Amy Weller Eva Sun Carol OsborneMarshalls: Henrick Qvist Amelia Qvist Denise Qvist Mark Trevorrow
Cross CountryCourse Controller Andrew Garland Course Design /Builders: Ewan Kellet John Anker TrentStanley Jarryd StanleyCourse Crew: William Anker Trent Stanley Brendan McKenna Josh McKenna Rebecca AnkerPaint Crew: Tony Johnson Henrick Qvist Denise Qvist
Radios: Trish Enzinger Bill Rewick Tanya Walker Anna BakerCross Country Coords: Mark Symes Hayley PloseMarshall: Jonathan AmblerStart: Troy Collins Rachel Collins Finish: Jacky Priestley Robert SuterJump Judge: Jaz Staunton Melanie Gibb Holly Fowler Anya Hynamen Alex Phelan Sam Dixon Robyn O’Sullivan Chantelle McNally Pam Barlkey Lynne Brown Jenny Smith Ella Trevorrow Lily Trevorrow Karen Treverrow Kasey Nyhouse Georgia Alexis Lily Calloway Olivia Duck Hannah Landsmeer Bella Braag Jess Tyrrrell Camilla Baker
Show JumpingCoordinators: Arthur Taft Rachel Massih Vicki Brown John DarbyDesigner: Garry BaxterJudges: Dr Anne Jones Carole Jacobs Liah GrahamPencillers: Georgia Fontana Denise Qvist Marshall/ Crew Henrick Qvist Amelia Qvist Lily O.Brien Meredith Lawson Ruby Lamont Marg Lamont Phil Thompson Briar Sutherland Tim Thompson Melissa Bowden Vanessa Smiley Helen Turner Fiona Fell Harriet Clappen – Fell Zara Baker Ava Bowden Ruby Smiley Taya Piccioli
‘MecWorma’ Young Event HorseCo ordinator: Bridgett CurrenJudges: Conformation: Nina Clark Dressage: Barry RoycroftShowing of Paces: Angela TivendaleShow Jumping: Tracey Baker
Freshman’s Cross Country Little Wandin Wandin Park Adult Riding Club
Wandin Park Association Offi cials
The committee thanks all who have volunteered over the weekend after the program went to press.
6
Wandin Park Trade Stands - 17th & 18th March 2018
Trade Name: Contact Phone Email SummaryCatering:
Clarke Bros Soft Serve Dave Clarke 0411 072 583 Ice Cream Van
Red Hot Coffee Amanda 0447 075 695 [email protected] Coffee, soft drinks, Frappes, Milkshakes
Twisty Chips John Stokes Hot Food
Wandin -Yallock Primary School
Veronica 5964 4276 Hot Food
MAJOR SPONSORSHorseland Sponsor
Prydes Easi Feed Katie Classon Sponsor
Equissage Katie Classon Sponsor
Horseware Australia Sarah Jane Colhoun 03. 9832 0800 Sponsor
TRADE STANDS 2018Trade Name Contact Phone Email Summary
Arch & Alex Cai Lin Tan13 Plymouth StGLEN WAVERLEY VIC 3150
0458 385 111 [email protected] Arch & Alex stock a range of exclusive brands, all with a focus on style, innovation and quality, without the expensive price tag. Their brands include the Caldene, Harry Hall, Tottie and Protechmasta Infra-red brands from the UK. They also have their own unique tee shirts and candles designed here in Melbourne, and a stunning equestrian inspired jewellery collection.
Black Horse Clothing
Tracey Button98 Waterloo Flat RoadBULLENGAROOK VIC 3437
0418 545 703 [email protected] High quality women’s riding apparel - affordable style with a great fi t!
Castlefi n Equestrian
Peta ElstrekP O Box 281WOORI YALLOCK VIC 3139
0427 500 865 info@castlefi n.com.au Top quality safety equipment from around the world
Diamond Boots Australia
Jule Syme26 Buckmaster DriveMT EVELYN VIC 3796
0467 721 572 [email protected]
Australian made Horse Boots for every discipline.We also stock Premier Equine products
The Dungbeetle Rachel Regan4 Queen StreetNUNAWADING VIC 3131
0417 159 940 [email protected] Meet the DUNGBEETLE – The incredible horse poo scoop that shovels sh*t like a champion. Strong and durable; Picks up poop, leaves the arena and bedding behind; Stows neatly; Safer for Neddy; Made in Australia; 8 Awesome colours
Horse In The Box Erika Kovaks17 Lawler LaneCOLDSTREAM VIC 3770
0412 610 553 [email protected] Clothing - Competition and casual. Helmets, Boots, Saddle pads,Stirrups
L P Designs Australia
Michelle Lando3891 Melba HighwayGLENBURN VIC 3717
0425 711 463 [email protected] Quality Equestrian wear at affordable prices
NGK Farrier Supplies Pty Ltd
Ganesh Kardile3 Cameo CourtNARRE WARREN VIC 3805
0411 508 115 [email protected] Equine Product; Hoof Oil, Nails, shoes, Tools, etc
Ocean Easy Stables
Angela SausmanP O Box 581MOSSMAN QLD 4873
0448 029 880 [email protected] Innovation & PerformanceProducts sourced from around the world. Exclusive distributor / retailer of Tech Stirrups ARP Equestrian in Australia
Ride With Elegance Jessica McLean30 Meadow RoadDEVON MEADOWS 3977
0438 977 955 [email protected] Ride with Elegance pride themselves with stocking many of the eventers needs at a reasonable price. They stock Premier Equine, HAAS Brushes, Capriole Rugs, Supastuds and their own line of leather products
The Saddlery Shop Kim Anning648 Warburton HighwaySEVILLE VIC 3139
0412 141 171 [email protected] Saddlery & Equestrian clothing
Signature Equestrian
Maureen HouseP O Box 668EDMONTON QLD
0408 654 903 info@ signatureequestrian.com.au Signature Equestrian is a range of classic riding wear for the whole family
Southern Stars Saddlery
Michelle Nichols46 Andrew RoadGISBORNE VIC 3437
0421 726 557 michelle@ southernstarssaddlery.com
Quality made Eventing Equipment, designed by Riders, for Riders
Valleyhorsewear Sue Symonds45 Williams RoadDON VALLEY VIC 3139
0432 193 363 [email protected] Quality Equestrian needs at affordable prices
Vivid Energy Electrical Solutions
Lukas Morse22 Parkside CloseLILYDALE VIC 3140
0408 500 726 [email protected] Vivid energy electrical provides tailored specialist lighting solutions for equestrian arenas and stable facilities
7
Horse Event
The Wandin Park Event, is held over two days, with three phases of competition: dressage, showjumping and cross country. Each requires precision, boldness and skills acquired through training. The horse must demonstrate controlled discipline in the dressage test, yet possess the stamina to jump many cross country fences placed over a distance of approximately 3km. The horse must then be able to show suffi cient suppleness after the endurance test to complete a clear showjumping round. The competition is scored on a penalty point basis, the horse and rider with the least penalty points wins. Ten classes will be contested at the Wandin Park Horse Event 2016. The classes are: CIC***/**/*, EA105, EA95, EA80, Training 2, Training 3, Training 4 and the MecWorma Young Event Horse.
DressageIn the dressage test a series of movements are executed. Each movement is marked by the judges. Marks are also given for the general performance of the test. During the test, the judge looks for the horse that is moving eagerly forward whilst remaining responsive to the rider’s direction. Dressage tests are ridden in a 20m x 60m arena. The rider must execute the test from memory. Penalty points accumulated in dressage are carried forward to the cross country and showjumping phases. Dressage Tests: CLASSES:CIC*** Dressage Test: FEI CIC *** (B) (2015) CIC** Dressage Test: FEI CIC ** (B) (2015) CIC* Dressage Test: FEI CIC * (B) (2015)EA105 Dressage Test: EvA105 Test 2 (2016)EA95 Dressage Test: EvA 80&95 Test 3 (2016)EA80 Dressage Test: EvA 80&95 Test 1 (2016)Unoffi cial Training 2 Dressage Test: EvA 80&95 Test 3 (2016)Unoffi cial Training 3 Dressage Test: EvA 80&95 Test 1 (2016)Unoffi cial Training 4 Dressage Test: EvA 80&95 Test 1 (2016)
Cross CountryWandin Park Event has eight separate cross country courses originally designed by Captain Mark Phillips and Mike Etherington - Smith (the designer of the 2000 Olympic Games Course). In the CIC*** there are 32 efforts over 20 fences, the CIC** there are 30 efforts over 20 fences, in the CIC* there are 28 jumping efforts over 18 fences, in EA105 there are 23 jumping efforts over 17 cross country jumps, EA95 has 21 efforts over 17 fences, EA80 has 21 efforts over 17 fences and Training 4 has 15 efforts over 12 fences.CIC*** Height 1.20m Speed 570 m/minCIC** Height 1.15m Speed 550 m/minCIC* Height 1.10m Speed 520 m/minEA105 Height 1.05m Speed 500 m/minEA95 Height 0.95m 450 m/minEA80 Height 0.80m 400 m/minTraining 4 Height 0.65m 320 m/min
Penalties:1st refusal, run out or circle of horse at jump 20pts2nd refusal, run out or circle of horse at jump 40pts3rd refusal, run out or circle of horse at jump(CIC***/**/*) Elimination4th refusal, run out or circle of horse at jump(EA105 & below) EliminationFall of horse and / or rider EliminationError of course not rectifi ed EliminationOmission of obstacle, boundary or fl ag 50ptsRe-taking of an obstacle already jumped EliminationJumping obstacle in wrong order Elimination3 refusals, run outs or circle at jumps EliminationMore than 20 seconds under time 0.4pts/per secondExceeding the time limit EliminationBreaking of approved safety device on cross country fences 11ptsExceeding the time limit (which is twice the time allowed) Elimination
ShowjumpingThe showjumping consists of one round.The maximum height of obstacles, and the average speed necessary to complete the round within the allowed time, are as follows for each class:CIC*** Height 1.25m Speed 375m/minCIC** Height 1.20m Speed 350m/minCIC* Height 1.15m Speed 350m/minEA105 Height 1.05m Speed 300m/minEA95 Height 0.95m Speed 300m/minEA80 Height 0.80m Speed 300m/min
PenaltiesFirst disobedience 4 penalty pointsSecond disobedience (***/**/*) EliminationSecond disobedience (EA105 & below) 8 penalty pointsThird disobedience (EA105 & below) EliminationKnocking down an obstacle 4 penalty pointsFall of horse or rider EliminationError of course not rectifi ed EliminationRe-taking of an obstacle already jumped EliminationJumping obstacle in wrong order EliminationFor every second commenced in excess of allowed time 1 penalty point
8
BN Rider Name Horse Name Dressage Cross Country Show Jumping
1 Andrew Cooper TASMAN PARK OVATION 15:40 15:00 12:20
2 Murray Lamperd TORONTO 15:47 15:03 12:22
3 Callum Buczak MATAVIA CHEVAL 15:54 15:06 12:24
4 Emily Anker GLENWOOD PARK COOPER STREET 16:01 15:09 12:26
5 Andrew Cooper LAGOES CHOICE 16:08 15:12 12:28
6 Rebecca Mccrae HI TIDE 16:15 15:15 12:30
7 James Lang MOUSETANG 16:22 15:18 12:32
8 Chelsea Priestley SKANSEN PURIST 16:29 15:21 12:34
9 Paul Chow NED FLANDERS LCF 16:36 15:24 12:36
10 Laura Wallace VAN HECK 16:43 15:27 12:38
11 Andrew Cooper HUNTERS HILL 16:50 15:30 12:40
12 Jessica Grosmann BELMONT BACKSTAGE 16:57 15:33 12:42
Section 1 Dressage Sat, Ring 5 Showjumping Sun, Main Arena Cross Country Sun, Cross Country Course
PRYDE’S CIC ***
Cross Country Fencesy
1 Rider Video Productions Train 1 Rider Video Productions Train 1 Rider Video Productions Train 1 Rider Video Productions Train
2 Wandin Park Arch 2 Wandin Park Arch 2 Wandin Park Arch 2 Wandin Park Arch3 Equissage Manor 3 Equissage Manor 3 Equissage Manor 3 Equissage Manor
4AB Stockman’s Hut 4AB Stockman’s Hut 4AB Stockman’s Hut 4 Stockman’s Hut5AB Anker 5AB Bendigo Bank 5AB Bendigo Bank 5AB Lake
6 Zig Zag Brush 6 Oxer 6 Cannon 6 Multi Cube Banana Log7ABC Gully Gap 7AB Anker 7ABC Lake 7 Palisade
8 Domain Chandon 8 Domain Chandon 8 Oxer 8ABC Ditch and Rails9AB Lake 9ABC Lake 9AB Palisades 9 Horseland Hurdle10 Shed 10 Oxer 10 Horseland Hurdle 10 Wandin Which Way
11AB Multi Cube Rolling Hills 11AB Multi Cube Rolling Hills 11 Log Oxer 11AB Kentaur Quarry12 Horseland Hurdle 12 Horseland Hurdle 12AB Wandin Which Way 12AB Kentaur Quarry13 Log Oxer 13 Log Oxer 13ABC Kentaur Quarry 13 Keyhole
14ABC Wandin Which Way 14AB Wandin Which Way 14 Keyhole 14AB Hayrack & Brush15ABC Kentaur Quarry 15AB Kentaur Quarry 15ABC Angled Brushes 15 7 Eleven Slurpee Cup
16 Hotel 16 Hotel 16 Ag Power Mall 16 Ayres Rocks17ABC Pryde's Wagon 17ABC Pryde's Picnic Table 17 Ayres Rock 17 Isuzu Fly Through
18 Ag Power Mall 18 Ag Power Mall 18 Isuzu Fly Through19 Pryde’s Fat Rat 19 Pryde’s Fat Rat20 Isuzu Fly Through 20 Isuzu Fly Through
Distance 3420m Distance 3200m Distance 2815m Distance 2500mTime 6m Time 5m 50sec Time 5m 25sec Time 5mSpeed 570mpm Speed 550mpm Speed 520mpm Speed 500mpmEfforts 32 Efforts 30 Efforts 28 Efforts 23
CIC**Green
CIC*** EA105PinkBlue Yellow
CIC*
Distance 2250m Distance 2065m Distance 1625mTime 5m Time 5m 10sec Time 5m 5secSpeed 450mpm Speed 400mpm Speed 320mpmEfforts 21 Efforts 21 Efforts 15
Distance 2250m Distance 2065m Distance 1625m
1 Rider Video Productions Train 1 Rider Video Productions Train 1 Rider Video Productions Train
2 Phase A 2 Phase A 2 Phase A3 Equissage Manor 3 Equissage Manor 3 Equissage Manor
4AB Stockman’s Hut 4AB Stockman’s Hut 4AB Stockman’s Hut5AB Bendigo Bank 5 Trakhener 5 Yellow Peril
6 Helsinki Steps 6AB Bendigo Bank 6AB Lake7 Woodmill 7 Woodmill 7 Multi Cube Sunken Road
8AB Lake 8AB Lake 8 Vienna Woods Playground9 Multi Cube Sunken Road 9 Multi Cube Sunken Road 9AB Scrabble
10 Yarra Valley Hay 10 Yarra Valley Hay 10 7 Eleven Slurpee Cup11 Rolling Hills 11 Rolling Hills 11 Farm12 Windmill 12 Windmill 12 Instagram13 Vienna Woods Playground 13 Vienna Woods Playground
14AB Wagon 14AB Wagon15 Ag Power Mall 15 Ag Power Mall16 Farm 16 Farm17 Instagram 17 Instagram
Training 4 OrangeWhite
Training 3 / EA 80Training 2 / EA95Red
9
BN Rider Name Horse Name Dressage Cross Country Show Jumping
15 Andrew Cooper OAKS ONYX 13:00 14:25 11:15
16 Usman Khan AL BURAQ 13:07 14:26 11:19
17 Penelope Johnson BB BOOM 13:14 14:27 11:17
18 Georgie Batten IRISH REIGN 13:21 14:28 11:23
19 Charlotte Curwen LP JANVIER 13:28 14:29 11:25
20 Nicole Cahill ASCENDED MASTER 13:35 14:30 11:21
21 Hannah McLean INCY WINCY SPIDER 13:42 14:31 11:27
22 Isabel Houghton BLOOMFIELD RODERICK 13:49 14:32 11:29
23 Andrew Cooper DOUBLED VISION 13:56 14:33 11:31
24 Samuel Jeffree JAYBEE CALYPSO 14:03 14:34 11:33
25 Paul Buckland FREEDOM GRANDUER 14:28 14:35 11:35
26 Chelsea Priestley ROSSO ASIAGO 14:35 14:36 11:37
27 Rebecca Barling ON YOUR MARK 14:42 14:37 11:39
28 Lucy Thorman JAZDAN DUKE VEH 14:49 14:38 11:41
29 Florence Goodwin KENDALEE QUANTUM LEAP 14:56 14:39 11:43
30 Jessica Forth RUADHAN 15:03 14:40 11:45
31 Bianca Sigismundi ROYAL CHANEL 15:10 14:41 11:47
32 Molly Barry LA MUSO 15:17 14:42 11:49
33 Jessica Grosmann EQUUS SPENCER 15:24 14:43 11:51
Section 2 Dressage Sat, Ring 5 Showjumping Sun, Main Arena Cross Country Sun, Cross Country Course
KENTAUR CIC **
10
BN Rider Name Horse Name Dressage Cross Country Show Jumping
36 Sophie Negre CARD SHARP 08:30 13:10 9:00
37 Jessica Walsh BARRABADEEN CAPTAIN 08:36 13:11 9:02
38 Bianca Welland KIRBY PARK TAMARISK 08:42 13:12 9:04
39 Nicky Paxton ICARUS SARAH 08:48 13:13 9:06
40 Tarah Lawson JIVE JAYE 08:54 13:14 9:08
41 Yona Lloyd BALLAHOWE OSPREY 09:00 13:15 9:10
42 Murray Lamperd SEBASTIAN 09:06 13:16 9:12
43 Sharni Stewart JENJAN LATIN LOVER 09:12 13:17 9:14
44 Erika Grant MY ACROBAT 09:18 13:18 9:16
45 Emily Dewing KIRBY PARK IRISH POSEIDON 09:24 13:19 9:18
46 Lucy Gunn AIM HIGH 09:30 13:20 9:20
47 Leesa Bartlett DELEGATE THE DETAILS 09:36 13:21 9:22
48 Paula Balchin DON OSCARDO 09:42 13:22 9:24
49 Lincoln Spiers ZOMPARE 09:48 13:23 9:26
50 Natalie Umbers LIBERTY FORCE 09:54 13:24 9:28
51 Sam Jeffree KOYUNA TACTICIAN 10:20 13:25 9:30
52 Shahira Ameen LUMBERJACK 10:26 13:26 9:32
53 Ellyse Davis CASSILIS PARK PEPPER 10:32 13:27 9:34
54 Leesa Clausing WILLTONY GARNETT 10:38 13:28 9:36
55 Bree Cocks TORLEA ENVY 10:44 13:29 9:38
56 Emily Cuthbert KIRBY PARK IRISH TOM 10:50 13:30 9:40
57 Asha Warnock LANE END BOND 10:56 13:31 9:42
58 Brooke Howarth SUMMER DELAGO 11:02 13:32 9:44
59 Beck Davis ETCHED IN GOLD 11:08 13:33 9:46
60 Jackie Wright LAKEVALE TOYMAN 11:14 13:34 9:48
61 Lucy Long ANOTHER OPTION 11:20 13:35 9:50
62 Mark Phillips LE CONQUEREUR 11:26 13:36 9:52
Section 3 Dressage Sat, Ring 6 Showjumping Sun, Main Arena Cross Country Sun, Cross Country Course
Lilydale Isuzu CIC *-1
1 These horse trials will be conducted under the EFA offi cial rules for horse trials 1999, and any amendments since that date.
2 Neither the Organising Committee, the Wandin Park Association or the EFA accept any liability for any accidents, damage, injury to horses, owners, riders, grooms, offi cials, spectators, ground or any other person or property whatsoever.
3 The organisers reserve the right to (a) cancel any class or event (b) divide any class (c) alter the advertised times (d) refuse any entry with or without providing a reason (e)alter a horse’s class within it’s grading (f) combine any classes.
4 Outside assistance is forbidden under penalty of elimination. Any intervention by a third party, whether solicited or not, with the object of facilitating the task of the rider or helping his horse, is considered forbidden assistance. Similarly, it is forbidden for a competitor to join or accept a lead from another. It is forbidden for a jump judge or offi cial
to call back or assist a competitor by directions to rectify an error of course. Catching a loose horse, helping the rider to adjust their saddlery, or to remount after a fall, is permitted. In such cases, the course must be resumed at the exact place at which it was interrupted. Whether or not a competitor has received forbidden assistance will be decided by the EFA steward.
5 All dogs must be kept on leads at all times.
6 The prize giving will take place at the conclusion of the event. All placegetters from all classes must present themselves correctly attired and unmounted for the presentation of prizes. 1st place horse to be presented.
Conditions – Wandin Park Event
11
BN Rider Name Horse Name Dressage Cross Country Show Jumping
69 Katrina Wallis LORD RUPERT 13:00 13:38 9:56
70 Rebecca Rundle BELLS PARK ARCHIBALD PRIZE 13:06 13:39 9:58
71 Karina Hiern LENEVA 13:12 13:40 10:00
72 Ella Smith JAYBEE ALTIMATE 13:18 13:41 10:02
73 Anna Church VIEWBANK ICON 13:24 13:42 10:04
74 Courtney Fraser ROCKIN IT 13:30 13:43 10:06
75 Anthea Buckland FREEDOM GRAND FINALE 13:36 13:44 10:08
76 Maddison Clark NORTHERN IRRESISTIBLE 13:42 13:45 10:10
77 Allanah Simeth RIMFIRE PARK PARADE 13:48 13:46 10:12
78 Rebecca Mccrae OCEAN DRIVE 13:54 13:47 10:14
79 Melanie Webb COMMAND PRINCE 14:00 13:48 10:16
80 Jessica Grosmann NOBLEWOOD CLOUDBREAK 14:06 13:49 10:18
81 Sarah May CHARLIE BEAN 14:12 13:50 10:20
82 Dylan Gregson WARFARE 14:18 13:51 10:22
83 Briony Deeker-fradd STEPHAN B 14:24 13:52 10:24
84 Sophia Landy ESB GOLDEN GEISHA 14:50 13:53 10:26
85 Sarah Ward ABSTRACT LAD 14:56 13:54 10:28
86 Tarli Preston SOUTHERN BARTOK 15:02 13:55 10:30
87 Murray Lamperd LUSHIOUS LOLA 15:08 13:56 10:32
88 Sophie Fox ISLE OF NEW NORFOLK 15:14 13:57 10:34
89 Usman Khan AL KHYBER 15:20 13:58 10:36
90 Sam Jeffree NORTHERN ISAAC 15:26 13:59 10:38
91 Lincoln Spiers PICNIC BELL 15:32 14:00 10:40
92 Eliza Bullen DARK VENTURE 15:38 14:01 10:42
93 Tamara Campain LAMBOURNE PARK ACADEMIC 15:44 14:02 10:44
94 Sharni Stewart JENJAN LOUVE 15:50 14:03 10:46
95 Yona Lloyd BALLAHOWE WOODSIDE 15:56 14:04 10:48
96 Sharna Kalms WAIKIKI DUKE 16:02 14:05 10:50
97 Jennifer Duffy GRAND AMOUR 16:08 14:06 10:52
Section 4 Dressage Sat, Ring 7 Showjumping Sun, Main Arena Cross Country Sun, Cross Country Course
Lilydale Isuzu CIC *-2
12
BN Rider Name Horse Name Dressage Cross Country Show Jumping
102 Taylor Mciver MARENA CRUISING 8:30 11:40 13:30
103 Riley Perry-parmenter PLAYING THE FIELD 8:36 11:41 13:32
104 Mietta Innes-irons PATANGAS CORDELIA 8:42 11:42 13:34
105 Jenny Bowker EQUINEAFFAIR ECLIPSE 8:48 11:43 13:36
106 Fiona Hawkes KENDOO 8:54 11:44 13:38
107 Tia-rae Wieneroider DOM PEDRO 9:00 11:45 13:40
108 Beck Davis ZENGARRA KEEPING SECRETS 9:06 11:46 13:42
109 Nicole Davis JAPONICUM HIT 9:12 11:47 13:44
110 Jacqueline Feinberg TULLY DANCER 9:18 11:48 13:46
111 Fleur Barling WAKE ME UP 9:24 11:49 13:48
112 Courtney Fraser WYNWOOD RETRO 9:30 11:50 13:50
113 Kate Bailey ACACIA RIDGE BEAU DANCER 9:36 11:51 13:52
114 India Ambler POP THE QUESTION 9:42 11:52 13:54
115 Sophie Fox MR PIG 9:48 11:53 13:56
116 Kylie Pedder ARIS AMERIGO 9:54 11:54 13:58
117 Rebecca Mccrae ELM STREET 10:20 11:55 14:00
118 Hayley Womersley BARE ESSENTIALS 10:26 11:56 14:02
119 Rachel Bartolo HEEZ OUR WONDER 10:32 11:57 14:04
120 Yona Lloyd ALBY TALKATIVE 10:38 11:58 14:06
121 Natalie Umbers LETS FANTASTICA 10:44 11:59 14:08
122 Briony Deeker-fradd BALLAHOWE ON ICE 10:50 12:00 14:10
123 Juliette Darby DEALT A CHANCE 10:56 12:01 14:12
124 James Lang ANOTHER BILLION 11:02 12:02 14:14
125 Chelsea Priestley AROONA PARK JESTER 11:08 12:03 14:16
126 Brittany Armstrong GOSSIP GAL 11:14 12:04 14:18
127 Jessica Grosmann WENDELA PETALUMA 11:20 12:05 14:20
128 Lindsey Constable HYBEAM 11:26 12:06 14:22
129 Zoe Hore GOTHIC CROWN 11:32 12:07 14:24
130 Katie Slocombe JAYBEE AMARILLA 11:38 12:08 14:26
131 Connie Miller DON ROCCARDO 11:44 12:09 14:28
132 Brittany Williams TAINUI LAD 11:50 12:10 14:30
133 Elysha Walles PENNERKAI PARK WILSON 11:56 12:11 14:32
134 Georgia Spangaro PENINSULA PARK PRETTY BOY 12:02 12:12 14:34
135 Maddy Kitto MY FRIEND JACK 12:08 12:13 14:36
136 Emily Cuthbert KIRBY PARK IRISH TOM 12:14 12:14 14:38
137 Amelia Coad PEPPERDENE POM POP 12:20 12:15 14:40
138 Nicole Creed EQUINEAFFAIR BOGART 12:26 12:16 14:42
139 Meg Bishop SOVEREIGN VENTURE 12:32 12:17 14:44
Section 5 Dressage Sat, Ring 7 Showjumping Sun, Main Arena Cross Country Sun, Cross Country Course
Vienna Woods EVA 105-1
13
BN Rider Name Horse Name Dressage Cross Country Show Jumping
140 Sheridan Wilson PL BENTLEY 13:00 12:17 14:44
141 Grace Hill TEAR IT UP 13:06 12:18 14:46
142 Amelia Sutton PAPAS DREAM 13:12 12:19 14:48
143 Sophia Landy HUMBLE GLORY 13:18 12:20 14:50
144 Abby Plant PRACTICE MAKES PERFECT 13:24 12:21 14:52
145 Eliza Harvey EVERGEM PERFECTION 13:30 12:22 14:54
146 Rebekah Italiano MONTINI 13:36 12:23 14:56
147 Julie Bramucci RAFIKI RED ALERT 13:42 12:24 14:58
148 Florence Goodwin KENDALEE LEVITATE 13:48 12:25 15:00
149 Adrian Bright ROCKET ROD 13:54 12:26 15:02
150 Tarnya Brennan ELLA 14:00 12:27 15:04
151 Emily Anker STARS ALIGN 14:06 12:28 15:06
152 Laura Wallace STRAVINSKY PARK AMADEUS 14:12 12:29 15:08
153 Naomi White ADVENTURE TIME 14:18 12:30 15:10
154 Yona Lloyd BALLAHOWE AYURVEDIC 14:24 12:31 15:12
155 SCRATCHED 14:50 12:32 15:14
156 Jackie Wright TETLEY 14:56 12:33 15:16
157 SCRATCHED 15:02 12:34 15:18
158 Madison Buttolph HENSCHKE 15:08 12:35 15:20
159 Jade Kluske LEDAYL DELAGO 15:14 12:36 15:22
160 Daniel Dragt MOUNT ANAKIE CRESCENDO 15:20 12:37 15:24
161 Tara Fuller KALIMNA BAILEY 15:26 12:38 15:26
162 Wilhelm Enzinger DULWICH FEUERSTEIN 15:32 12:39 15:28
163 Sophie Doake GRANDJANY 15:38 12:40 15:30
164 Lara Sherar CLOVELLY LADY MONTANA 15:44 12:41 15:32
165 Kirra Bourke REMLAPS CHOICE 15:44 12:42 15:34
166 Samantha Mclean ALESSIO 15:50 12:43 15:36
167 Alexandra Osullivan ROYAL STORM 15:56 12:44 15:38
168 Keyarra-lee Smith AIRCHILLA 16:02 12:45 15:40
169 Bridget O'Dwyer TYSONS SMOKEY 16:08 12:46 15:42
170 Annalise Turner SPRINGHURST 16:14 12:47 15:44
171 Manon Schey NORTHERN FARRINGTON 16:20 12:48 15:46
172 Georgina Birrell MARLBOROUGH VIEW 16:26 12:49 15:48
173 Mietta Innes-irons LA-WENHERZ 16:32 12:50 15:50
174 Jenny Bowker BMS ALEXEAH 16:38 12:51 15:52
175 Fiona Hawkes ISLE OF TATIANA 16:44 12:52 15:54
176 Tia-rae Wieneroider SECRET MOJO 16:50 12:53 15:56
177 Beck Davis LEO'S HONOR 16:56 12:54 15:58
Section 6 Dressage Sat, Ring 4 Showjumping Sun, Main Arena Cross Country Sun, Cross Country Course
Vienna Woods EVA 105-2
HOT FOOD AND LIVE BANDSaturday 17th March 6.30pm
Woolshed, Wandin ParkFood and Refreshments available for purchase on night.
Competitors and Supporters Welcome!
14
BN Rider Name Horse Name Dressage Cross Country Show Jumping
180 Amy Tucker SHADOWVALLEY REDEMPTION 08:30 9:10 10:30
181 Rachel Riddle TITUS TATIUS 08:36 9:11 10:32
182 Wilhelm Enzinger INNAMINNY 08:42 9:12 10:34
183 Genna Sordello CERA CARA MIA 08:48 9:13 10:36
184 Ethan Height DE LAGO WARRIOR 08:54 9:14 10:38
185 Eliza Mylon REVELWOOD SUMMER HIT 09:00 9:15 10:40
186 Dannielle Mckeon UNDERSTUDY 09:06 9:16 10:42
187 Lauren Hussell SUPER TIME 09:12 9:17 10:44
188 Vicky Henschke AKUPHELI SUPERNOVA 09:18 9:18 10:46
189 Tayor Griffi n REVIN IT UP 09:24 9:19 10:48
190 Leah Rodwell POINT DE VIRAGE 09:30 9:20 10:50
191 Sophie Carroll LITTLE DUCO POP 09:36 9:21 10:52
192 Rachel Beath SPLASH OF CLASS 09:42 9:22 10:54
193 Bianca Austin WILLOWBANK WILD FIRE 09:48 9:23 10:56
194 Edith Kane JAYBEE ARTISTE B 09:54 9:24 10:58
195 Jenny Bowker VULCAN ELMARE 10:20 9:25 11:00
196 Harry Cator KAP PICASSO 10:26 9:26 11:02
197 Tayla Carney MAXICAT 10:32 9:27 11:04
198 Mirella Greco WILD N ROWDY 10:38 9:28 11:06
199 Tahlia Jefcott GOONAMURRAH HILL 10:44 9:29 11:08
200 Nicole Harvey CHUNKYMAN 10:50 9:30 11:10
201 Olivia Holston SKIPCELLOS MYSTIFY 10:56 9:31 11:12
202 Emily Noske-turner MARENA GALA CHIEF 11:02 9:32 11:14
203 Sheridan Wilson PL ARTANE AUDREY 11:08 9:33 11:16
204 Andrew Long HIDDEN OPTION 11:14 9:34 11:18
205 Sophia Landy WOODY BE GOOD 11:20 9:35 11:20
206 Akane Osawa LA PRINCE 11:26 9:36 11:22
207 Jessica Stevens FIFTY SHADES 11:32 9:37 11:24
208 Fleur Timmins LEGALLY BLONDE 11:38 9:38 11:26
Section 7 Dressage Sat, Ring 8 Showjumping Sun, Main Arena Cross Country Sun, Cross Country Course
Equissage EVA 95-1
15
BN Rider Name Horse Name Dressage Cross Country Show Jumping
210 Sarah Ward MANGO COVE 13:00 9:39 11:30
211 Debbie Browell LIMITED EDITION 13:06 9:40 11:32
212 Kylie Pedder ARIS WOODBURY 13:12 9:41 11:34
213 Brittany Armstrong RUWI 13:18 9:42 11:36
214 Kento Nagura ACACIA RIDGE RILEY 13:24 9:43 11:38
215 Mia Bartlett RICOCHET RHYTHM 13:30 9:44 11:40
216 Brookelyn Gagliardi BP MOUSEKETEER 13:36 9:45 11:42
217 Brianna Petrowski CARRAMAR PARK JAMES SQUIRE 13:42 9:46 11:44
218 Tanya Lang CHATSWOOD DELAGO 13:48 9:47 11:46
219 Molly Barry DECEMBER DESTINY 13:54 9:48 11:48
220 Sophie Doake TOPKAPI 14:00 9:49 11:50
221 Sophie Fox ISLE OF ARMARNI 14:06 9:50 11:52
222 Alex Brennan LOCKLEYS PARK ANTES 14:12 9:51 11:54
223 Sam Jeffree WOODMOUNT LOLITA 14:18 9:52 11:56
224 Wilhelm Enzinger WENLOCK MEMORIES 14:24 9:53 11:58
225 Kelly Mort KOYUNA CENTURION 14:50 9:54 12:00
226 Edith Kane RICH BUSINESS 14:56 9:55 12:02
227 Grace Contessi MOJO WORKING 15:02 9:56 12:04
228 Amanda Drummond CALMING INFLUENCE 15:08 9:57 12:06
229 Kayla Hanslo RIMFIRE PARK REASON 15:14 9:58 12:08
230 Nina Hermansen KARINYA PARK HUNTER 15:20 9:59 12:10
231 Georgiana House NAVIGATOR 15:26 10:00 12:12
232 Bianca Karp BALLAHOWE ARTIC 15:32 10:01 12:14
233 India Lamperd SKIPCELLOS SKY HIGH 15:38 10:02 12:16
234 Christine Maxwell ENGRAVE 15:44 10:03 12:18
235 Ashlea Monigatti MARETER COLLINGWOOD 15:50 10:04 12:20
236 Isabel Houghton YOICKS VEGAS 15:56 10:05 12:22
237 James Pettigrew VITAL POINT 16:02 10:06 12:24
238 Nicolette Rippon ASH BIRRE PARK ZAZU 16:08 10:07 12:26
Section 8 Dressage Sat, Ring 1 Showjumping Sun, Main Arena Cross Country Sun, Cross Country Course
Equissage EVA 95-2
16
It starts with
U can fi nd out more at
Bendigo and Adelaide Bank Limited, ABN 11 068 049 178, AFSL 237879. (69995-v1) (9/09/2008)
Wandin Seville Community Bank® Branch, Shop 3, Lot 10 Union Road, Wandin North or phone 5964 4595.
Ordinary occasions become memory-making moments at Chandon
17
18
19
20
Perth 0405525714, Victoria 0428190552Perth 0405525714, Victoria 0428190552Kentaur Australia .com - Online Store Kentaur Australia .com - Online Store
www.kentauraustralia.comwww.kentauraustralia.com
21
BN Rider Name Horse Name Dressage Cross Country Show Jumping
240 Lincoln Spiers FEEL YA FAITH 13:00 10:08 12:30
241 Mia McLean JAROSITE RAFFINO 13:06 10:09 12:32
242 Emily Tyrrell EQUINEAFFAIR CASPER 13:12 10:10 12:34
243 Lucy Thorman BOBBY DAZZLER VEH 13:18 10:11 12:36
244 Stephen Stacey BELLHAVEN ATTICUS 13:24 10:12 12:38
245 Paul Ormrod WG ORLANDO 13:30 10:13 12:40
246 Natalie Jenner THE NEW BLACK 13:36 10:14 12:42
247 Carleen Hefel BURNT SIENNA 13:42 10:15 12:44
248 Phoebe Dixon GLENGOWER COOPERPEDY 13:48 10:16 12:46
249 Tayla-jane Deacon ROYAL GUNN 13:54 10:17 12:48
250 Sarah Boatwood EDENVALE JOSHUA 14:00 10:18 12:50
251 Danielle Apted WARRINA FIREFLY 14:06 10:19 12:52
252 Shoto Kusunoki SANDHILLS PIPER 14:12 10:20 12:54
253 Madeleine O’Callaghan JACKIE CHOO 14:18 10:21 12:56
254 Kelsey Pfeiffer FIRST DOR 14:24 10:22 12:58
255 Emily Bartlett INVINCIBLE GOLD 14:50 10:23 13:00
256 Stacey Briggs MARENGO VALENTINO 14:56 10:24 13:02
257 Shannon Kelly HORATIO 15:02 10:25 13:04
258 Tansy Sagar KIA ORA CHARMA 15:08 10:26 13:06
259 Leah Simmons VAGABOND STAR 15:14 10:27 13:08
260 Ashlee Slavich GENERAL JOHN 15:20 10:28 13:10
261 Haylea Wright PRINCESS KEIKILANI 15:26 10:29 13:12
262 Charlotte Sweeney COMMANDER DELAGO 15:32 10:30 13:14
263 Danica Bordignon ZIGSTAR 15:38 10:31 13:16
264 Nicolette Rippon ASH BIRRE PARK ZAZU 15:44 10:32 13:18
265 Lena Schulz DARWIN PARK SPYDER MAN 15:50 10:33 13:20
266 Chelsea Wilson WILLOW PARK FRANKIE 15:56 10:34 13:22
267 Eddie Quine CALLIGNEE LAD 16:02 10:35 13:24
268 Lena Schulz DARWIN PARK SPYDER MAN 16:08 10:36 13:26
Section 9 Dressage Sat, Ring 3 Showjumping Sun, Sand Arena Ring 1 Cross Country Sun, Cross Country Course
Equissage EVA 95-3
22
BN Rider Name Horse Name Dressage Cross Country Show Jumping
270 Teagan Carney ARIZONA PRINCE 13:00 10:08 12:30
271 Sara-jane Vaughan SOLITAIRE PK EXCLUSIVE ALIBI 13:06 10:09 12:32
272 Joy Tebbens DANCE CHECK 13:12 10:10 12:34
273 Tracey Robertson DANNY STERLING 13:18 10:11 12:36
274 Kylie Robert CARTE BLANCHE 13:24 10:12 12:38
275 Taylah Waugh GOT THE GOLD 13:30 10:13 12:40
276 Ethan Height KOYUNA SMOKEY JOE 13:36 10:14 12:42
277 Melissa Peacock SERENITY LANE ROMEO 13:42 10:15 12:44
278 Leah Rodwell ALMANCIL 13:48 10:16 12:46
279 Amber Mactaggart DASH OF ELEGANCE 13:54 10:17 12:48
280 Sally Jackson WITNESS 14:00 10:18 12:50
281 Amy Gotts - wheeler FIDDLERS BANJO 14:06 10:19 12:52
282 Lola Fregon UNIVERSAL OLYMPIC TOI 14:12 10:20 12:54
283 Sam Feldtmann WITH IMAGINATION 14:18 10:21 12:56
284 Jane Allen MAJESTIC BUD 14:24 10:22 12:58
285 Kate Duignan PRIMROSE LAINE 14:50 10:23 13:00
286 Harry Cator FANTASTIC MR FOX 14:56 10:24 13:02
287 Wilhelm Enzinger BEE BEE PHANTOM 15:02 10:25 13:04
288 Alysha Hart PUFF 15:08 10:26 13:06
289 Tenielle Klapp ULTIMA 15:14 10:27 13:08
290 Georgie Mccarroll BALLAHOWE FUNHOUSE 15:20 10:28 13:10
291 Kyle Mcleod AEA ROMEO 15:26 10:29 13:12
292 Asha Jackson BB MOULIN ROUGE 15:32 10:30 13:14
293 Taisuke Tsukada SCANDIUM 15:38 10:31 13:16
294 Brianna Petrowski ESB IRISH POWER 15:44 10:32 13:18
295 Kate Bromley VANGUARD 15:50 10:33 13:20
296 Amber Cargill EQUINEAFFAIR BURLESQUE 15:56 10:34 13:22
297 Georgia Tivendale STAR ALLURE
Section 10 Dressage Sat, Ring 6 Showjumping Sun, Sand Arena Ring 1 Cross Country Sun, Cross Country Course
DONATIONS FROM THE GATE ENTRY - LITTLE WANDIN SundayFRESHMANS - CROSS - COUNTRY 1-3pm $15 p/round
WANDIN PARK Horse Event 2018WILL BE DONATED TO
MOTOR NEURONE DISEASE
Equissage EVA 95-4
23
BN Rider Name Horse Name Dressage Cross Country Show Jumping
300 Annabelle Webb AVALON MCKNIGHT 13:00 11:04 14:22
301 Kirilee Hosier REGAL RED JASPER 13:06 11:05 14:24
302 Katherine Galloway ENTERPRISE GIRL 13:12 11:06 14:26
303 Ella Tosh STAR ODYSSEY 13:18 11:07 14:28
304 Sabine Ware FIREFLY 13:24 11:08 14:30
305 Demi Thomas KELECYNE SIERRA BLUE 13:30 11:09 14:32
306 Ella Osullivan PANCHO 13:36 11:10 14:34
307 Mel King CATALINA PIERINA 13:42 11:11 14:36
308 Cass Groves SHADOW PHOENIX 13:48 11:12 14:38
309 Jenna Cole PRINCE AZKABAN 13:54 11:13 14:40
310 Karen Buckland BIJOU DAMOUR 14:15 11:14 14:42
311 Charlotte Ambler BOXING DAY 14:22 11:15 14:44
312 Beth Houghton EE UP AND GO 14:29 11:16 14:46
313 Lauren Clark FIELDEND DOUBLE TROUBLE 14:36 11:17 14:48
314 Natalie Logan SHORT & SWEET 14:43 11:18 14:50
315 Tennille Porter KIDS DARE TO DREAM 14:50 11:19 14:52
316 Hailey Chesterfi eld WATCH THIS SPACE 14:57 11:20 14:54
317 Vickey White DESERT MASTER 15:04 11:21 14:56
318 Jacinta West SILVERFERN STRIKAPOSE 15:11 11:22 14:58
319 Grace Wilhelm DIAMANT HOPE 15:18 11:23 15:00
320 Rebecca Thaller BAY OF POETS 15:25 11:24 15:02
Section 11 Dressage Sat, Ring 2 Showjumping Sun, Sand Arena Ring 1 Cross Country Sun, Cross Country Course
Horseland Training 2
Wandin Park is For HireWandin Park is For HireCross Country CourseCross Country Course
– For groups and individual horse and rider– For groups and individual horse and riderCamping and Yard - Toilets / ShowersCamping and Yard - Toilets / Showers
Woolshed / Marquee - Suitable for parties and weddingsWoolshed / Marquee - Suitable for parties and weddings
Price on Application - Contact John AnkerPrice on Application - Contact John Anker5964 4613 or 0418 542 4775964 4613 or 0418 542 477
24
BN Rider Name Horse Name Dressage Cross Country Show Jumping
325 Jess Van bremen HIGHGROVE FLYING COLOURS 13:00 8:00 10:00
326 Manon Schey CP KERAMI BEAU 13:06 8:01 10:02
327 Chloe Windt CHARLIE BEAR 13:12 8:02 10:04
328 Narelle Walker ELLEIAN CORCHITTA 13:18 8:03 10:06
329 Georgina Birrell WHITECHAPEL HILL 13:24 8:04 10:08
330 Claire Rowan HILLSIDES WELTSSOLAR 13:30 8:05 10:10
331 Nichola Payne STATFORD NULLABOR 13:36 8:06 10:12
332 Brad Mccabe HPS KASPERRADO KIMAC 13:42 8:07 10:14
333 Sienna Kasickis KASICKIS PARK WARMNSNUG 13:48 8:08 10:16
334 Sharnae Kalms LADY BLAKENEY 13:54 8:09 10:18
335 Madeline Hayes FREEDOMS PRECIOUS GEM 14:00 8:10 10:20
336 Claudia Figgins AUGUSTUS SWIFT 14:06 8:11 10:22
337 Rosemary Borella GENGHIS KHANAGE 14:12 8:12 10:24
338 Hannah Bird MYSTIQUE 14:18 8:13 10:26
339 Penelope Johnson BLACKWOOD SPELLBOUND 14:24 8:14 10:28
340 Zoe Barbetti SHAW TOUCH 14:50 8:15 10:30
341 Tarryn Proctor WIZARD OF WOZ 14:56 8:16 10:32
342 Grace Davis LYNUS LODGE LUNA ECLIPSE 15:02 8:17 10:34
343 Abigail Van bergeijk PUFF MAN 15:08 8:18 10:36
344 Frances Hughes CASTANO 15:14 8:19 10:38
345 Riley Perry-parmenter RV ROWEYS NEWTOWN 15:20 8:20 10:40
346 Julie Bramucci RAFIKI DE LAGO 15:26 8:21 10:42
347 Madeleine Ocallaghan EA MYSTIQUE 15:32 8:22 10:44
348 Tahlia Pursell JAROSITE JUST FINE 15:38 8:23 10:46
349 Edith Kane FALCON PREMIER 15:44 8:24 10:48
350 Nathan Temby WELBURN 15:50 8:25 10:50
351 Abby-rose Williams CHATSWOOD THOMAS 15:56 8:26 10:52
352 Rachael Wood SHARNELL PARK DELILAH 16:02 8:27 10:54
353 Jessica Wulf AZARENKO 16:08 8:28 10:56
354 Christopher Doherty TIR NA BRYLEI 16:14 8:29 10:58
355 Rebekah Staindl PLAY FAIR 16:20 8:30 11:00
Section 12 Dressage Sat, Ring 8 Showjumping Sun, Sand Arena Ring 2 Cross Country Sun, Cross Country Course
Horseware Australia EVA80-1
25
BN Rider Name Horse Name Dressage Cross Country Show Jumping
356 Ella Williams DAPOINT 08:30 8:31 11:02
357 Claire Patterson INDIAN SUMMER CP 08:36 8:32 11:04
358 Harriet Magee SHARVALLEY LA VIE 08:42 8:33 11:06
359 Madison Jackson METAL GURU 08:48 8:34 11:08
360 Sophia Landy ESB IRISH DAY 08:54 8:35 11:10
361 Harriet Eaton WITHOUT LIMITS 09:00 8:36 11:12
362 Eliza Davidson PATANGA LODGE REVEUR 09:06 8:37 11:14
363 Sam Jeffree MR SPOT 09:12 8:38 11:16
364 Sheridan Wilson TOBY 09:18 8:39 11:18
365 Chloe Brooks IMPULSE CLM 09:24 8:40 11:20
366 Callum Buczak SOCKS 09:30 8:41 11:22
367 Wilhelm Enzinger CAIRO EXTREME 09:36 8:42 11:24
368 Lyn Gamble TALLANGATTA JACK 09:42 8:43 11:26
369 Charlotte Curwen KAISEY DANCER 09:48 8:44 11:28
370 Brookelyn Gagliardi BEYOND BELIEF 09:54 8:45 11:30
371 Sophia Landy ESB GOLDEN CHUCKLE 10:20 8:46 11:32
372 Tia-rae Wieneroider ZEPPELIN 10:26 8:47 11:34
373 Nicolette Avgerinos WOODY 10:32 8:48 11:36
374 SCRATCHED 10:38 8:49 11:38
375 Samantha McLean DIESEL POWER 10:44 8:50 11:40
376 Ellen Sherwood KAPETA TRICKSTER 10:50 8:51 11:42
377 Lucy Gunn TICKAWARRA RENO 10:56 8:52 11:44
378 Neva Brunning RIMONDI D 11:02 8:53 11:46
379 Alexandra Dawe HIDDEN FORTUNE 11:08 8:54 11:48
380 Lillee Ganas KARBON KOPY 11:14 8:55 11:50
381 Sophie Fox YORKSHIRE ENVOY 11:20 8:56 11:52
382 Rebecca Mccrae CROSSROADS 11:26 8:57 11:54
383 Emily Anker KANANDALE MR K 11:32 8:58 11:56
384 Olivia Peacock WHERE'S WALLACE 11:38 8:59 11:58
385 Paula Pilkington WG SPLASHOFCOLOUR 11:44 9:00 12:00
386 Rachel Riddle BUZZ 11:50 9:01 12:02
Section 13 Dressage Sat, Ring 3 Showjumping Sun, Sand Arena Ring 2 Cross Country Sun, Cross Country Course
Horseware Australia EVA80-2
26
BN Rider Name Horse Name Dressage Cross Country Show Jumping
388 Bella Warner REMI ROYAL STAR 08:30 14:40 16:00
389 Brooke Searle AL MAXI 08:36 14:41 16:02
390 Erin Phillips TRITON PARK ECLIPSE 08:42 14:42 16:04
391 Natalie Peacock DEFYING GRAVITY 08:48 14:43 16:08
392 Skye Mckenzie-smith SOMERFORD PARK ROB ROY 08:54 14:44 16:48
393 Stephen Stacey WEST OF THE JORDAN 09:00 14:45 16:10
394 Sam Jeffree MR SPOT 09:06 14:46 16:12
395 Ursula Arifovic CHERISHWOOD OPALESCENT 09:12 14:47 16:14
396 Tim Hart VANISHING CARD 09:18 14:48 16:16
397 Taylah Waugh JUSTICE FIGHTER 09:24 14:49 16:18
398 Maddison Growcott ENTALLY SCHNAPPS 09:30 14:50 16:20
399 Lily Callaway BELLARNY PARK PEE WEE 09:36 14:51 16:22
400 Asha Warnock BLACK CADILLIC 09:42 14:52 16:24
401 Phoebe Anderson BURGHOFF 09:48 14:53 16:26
402 Michelle Allen MANHATTAN TOPROAD 09:54 14:54 16:28
403 Kate Evans KAPETA WILVERLEY 10:20 14:55 16:30
404 Samantha Stiles BP HOLOGRAM 10:26 14:56 16:32
405 Jacqueline Boyle EMMAVILLE OAK 10:32 14:57 16:34
406 Kathleen George HEADWINDS 10:38 14:58 16:36
407 Tiffany Harrington EDENVALE GOLD 10:44 14:59 16:38
408 Samantha Howard RH MARCEL 10:50 15:00 16:40
409 Isabella Clark BEL RAGAZZO 10:56 15:01 16:42
410 Leela Macdonald JIVE BLATH 11:02 15:02 16:44
411 Brendan Mckenzie ABERCORN INCA MOON 11:08 15:03 16:46
412 Sam Jeffree DANCING WITH THE DEVIL 11:14 15:04 16:06
413 Rebecca Lloyd CONCORD CONDO 11:20 15:05 16:50
414 Stevie Gamble RILTEN RUPERT 11:26 15:06 16:52
415 Meg Rac MANOR LODGE OLIVER 11:32 15:07 16:54
416 Hannah Veto HOPELESS ROMANTIC 11:38 15:08 16:56
417 Guin Wilson CRAZY ANTICS 11:44 15:09 16:58
Section 14 Dressage Sat, Ring 4 Showjumping Sat, Sand Arena Ring 1 Cross Country Sat, Cross Country Course
Horseware Australia EVA80-3
Print & Design- Design/Artwork- Business Stationery- Brochures/Catalogues- Newsletters/Mailouts- Docket Books
Digital- Books/Manuals- Newsletters/Programs- Labels- Posters/Flyers- Business Cards
maroondahprinting
Affordable Printing Solutions
Unit 16, 42 New Street Ringwoodwww.maroondahprinting.com.au
9879 [email protected]
27
BN Rider Name Horse Name Dressage Cross Country Show Jumping
420 Phillip Pannell 12 OAKS CROWN OF HEARTS 08:30 15:10 12:00
421 Hannah Zweytzer THORN LEGACY 08:36 15:11 12:02
422 Samantha Young PATANGA LODGE CISCO DELAGO 08:42 15:12 12:04
423 Grace Winkler FREJA 08:48 15:13 12:06
424 Amelia Williams OUTLAW 08:54 15:14 12:08
425 Alannah Whitehead HSV ACCOLADE 09:00 15:15 12:10
426 Mia Spencer RIVERFRONT LITTLE DOZER 09:06 15:16 12:12
427 Joanne Kinross REGENTS POINT 09:12 15:17 12:14
428 Sarah Jelbart VALASQUITA 09:18 15:18 12:16
429 Sophia Goodwin WAY COOL SAMMI 09:24 15:19 12:18
430 Doone Fairchild KARINYA PARK ROGAN 09:30 15:20 12:20
431 David Coleman PRINCE ALBERT 09:36 15:21 12:22
432 Maddison Creber PRETTY HILL HAZELWOOD 09:42 15:22 12:24
433 Christina Avgerinos CHIME 09:48 15:23 12:26
434 Sophia Anderson ANIMADO AZUL 09:54 15:24 12:28
435 Hailey Dawson JAYBEE CARILLION 10:20 15:25 12:30
436 Lily Butterworth AVALEY 10:26 15:26 12:32
437 Jorja Clarke DIXIES MISS HOLLY 10:32 15:27 12:34
438 Meryl Dekker COSTA RICO 10:38 15:28 12:36
439 Sienna Figgins MISSY MOO 10:44 15:29 12:38
440 Robert Harris BERTIE BASSETT 10:50 15:30 12:40
441 Liana Jennings-Allen VULCAN JOURNEY 10:56 15:31 12:42
442 Kylie Mclennan AQUILA MADONNA 11:02 15:32 12:44
443 Sarah Van nooten MATILDA 11:08 15:33 12:46
444 Lily Wickenden EA BERLIN 11:14 15:34 12:48
445 Chloe Brooks ISLE OF CAMEO 11:20 15:35 12:50
446 Sophie Richardson WALDARRAH GALLIANA 11:26 15:36 12:52
447 Rachael Keeton GYPSY MADAME 11:32 15:37 12:54
448 Rachael Leslie EXCHANCELLOR 11:38 15:38 12:56
449 Ben Tyson VON RATKI 11:44 15:39 12:58
450 Lauren Stanton TOBY 11:50 15:40 13:00
Section 15 Dressage Sat, Ring 5 Showjumping Sat, Sand Arena Ring 1 Cross Country Sat, Cross Country Course
Horseware Australia EVA80-4
28
BN Rider Name Horse Name Dressage Cross Country Show Jumping
455 Gabriella Van vuren SUMMER VIEW PAIGE 08:30 15:41 13:02
456 Ashleigh Urry IRISH FLYNNAGIN 08:36 15:42 13:04
457 Ivy Schey CANOPY GROVE RIVERDANCE 08:42 15:43 13:06
458 Madilyn Schellekens CLOVERASH MIRROR IMAGE 08:48 15:44 13:08
459 Laura Peele EBONYTARI 08:54 15:45 13:10
460 Sharni Nish BARTENDER 09:00 15:46 13:12
461 Ellyse Davis HANNAFORD STUD TEXT MESSAGE 09:06 15:47 13:14
462 Katelyn Knox DALGANGLE ROULETTE 09:12 15:48 13:16
463 Emily Kay ELWOOD 09:18 15:49 13:18
464 Kira Hetherton PRINCE SHARMANN 09:24 15:50 13:20
465 Eliza Harris VPH LAKEEERIE 09:30 15:51 13:22
466 Maisey Ford REMINGTON STEEL 09:36 15:52 13:24
467 Andrew Cuthbert WONKY DONKEY 09:42 15:53 13:26
468 Jasmyn Beesley WJ BEYOND GREAT HEIGHTS 09:48 15:54 13:28
469 Juliana Brennan ESB IRISH JUSTICE 09:54 15:55 13:30
470 Jorja Ferrari CURRAWONG PARK SAM 10:20 15:56 13:32
471 Paige Gardiner SPENCERS DAY 10:26 15:57 13:34
472 Sophie Hendricks HARLEQUIN STORM 10:32 15:58 13:36
473 Ella Hunter CLAYTON PETROL 10:38 15:59 13:38
474 Callum Buczak BLUE Change of Rider 10:44 16:00 13:40
475 Candice Lepore SCOOTIE SCOOTIE 10:50 16:01 13:42
476 Alexandra Mcdonough CERA SANTORINI Change of Rider 10:56 16:02 13:44
477 SCRATCHED 11:02 16:03 13:46
478 Rebecca Thaller CJP LA STUPENDA 11:08 16:04 13:48
479 Kirilee Hosier AEA FLYNN 11:14 16:05 13:50
480 Ellie Symes CISCO KID 11:20 16:06 13:52
481 Amy Veenendaal WOODSTOCK BEAU TIES 11:26 16:07 13:54
482 Sophie Richardson DOLLY 11:32 16:08 13:56
483 Camilla Baker PLOVERS REST 11:38 16:09 13:58
Section 16 Dressage Sat, Ring 1 Showjumping Sat, Sand Arena Ring 1 Cross Country Sat, Cross Country Course
Horseland Training 3-1
29
BN Rider Name Horse Name Dressage Cross Country Show Jumping
485 Hayley Crane W P CASPER 08:30 16:10 14:00
486 Chelsea Winter LINMORE SOPHISTICAT 08:36 16:11 14:02
487 Victoria Wilcox SWEET SYMPHONY 08:42 16:12 14:04
488 Astrid Vandenbos BELTAIN PARK MULDOON 08:48 16:13 14:06
489 Margaret Stevens MR. BENSON 08:54 16:14 14:08
490 Debbie Simeth BYRONE 09:00 16:15 14:10
491 Hannah Schey SAMPSON 09:06 16:16 14:12
492 Caitlin Rogers BAYVIEW GLAMOUR 09:12 16:17 14:14
493 April Robinson BOBBY 09:18 16:18 14:16
494 Miranda Norton NETHERWOOD WALDON 09:24 16:19 14:18
495 Paris Murray WESTBURY GLITZEN 09:30 16:20 14:20
496 Lauren Martin FRY 09:36 16:21 14:22
497 Jasper Hill THE FLYING ORANGE 09:42 16:22 14:24
498 Grace George COOPER 09:48 16:23 14:26
499 Elyse Blackley RUSTY 09:54 16:24 14:28
500 Emma Dawes NERREMAN SIR GALLAHAD 10:20 16:25 14:30
501 Rosmary Hazard ESKIMO PIE 10:26 16:26 14:32
502 Jemma Holmyard EYE OF COLOUR 10:32 16:27 14:34
503 Kerry-lee Hood CLAYTON DIESEL N DUST 10:38 16:28 14:36
504 Sarsha Nardella ELMO 10:44 16:29 14:38
505 Karen Paine SURF CITY 10:50 16:30 14:40
506 Maddison Clark INDICA MAJOR 10:56 16:31 14:42
507 Temma Rowe RUBI TUESDAY 11:02 16:32 14:44
508 Gabriella Van vuren TILLY DEVINE 11:08 16:33 14:46
509 Rebecca Stanning AUBAINE COLORADO 11:14 16:34 14:48
510 Jaclyn Strutton WHARTON 11:20 16:35 14:50
511 Melanie Welsh SCOTTY 11:26 16:36 14:52
512 Brookley Williams WATERFORD KHLOE 11:32 16:37 14:54
513 Andrea Wright RANGE VIEW BESET 11:38 16:38 14:56
514 Bridie Wescombe CP THUNDERCAT 11:44 16:38 14:58
Section 17 Dressage Sat, Ring 2 Showjumping Sat, Main Arena Cross Country Sat, Cross Country Course
Horseland Training 3-2
30
BN Rider Name Horse Name Dressage Cross Country Show Jumping
518 Pamela Ormrod ORMROSE CHOCLATTE 8:00 12:30 14:00
519 Jaz Middleton IN THE BLACK 8:06 12:31 14:02
520 Lara Mcnally MERITORIUS 8:12 12:56 14:52
521 Chantal Mcnally FROGSWELL 8:18 12:55 14:50
522 Christie Margin KASPERRADO DUKE 8:24 12:54 14:48
523 Keren Bennett RIVER SONG 8:30 12:35 14:10
524 Jane Hill TOBY ONE KENOBI 8:36 12:52 14:44
525 Karen Dabbs FLAMESTEED 8:42 12:37 14:14
526 Camilla Baker TAPU CHIPPENDALE 8:48 12:38 14:16
527 SCATCHED 8:54 12:39 14:18
528 Amber Cargill JACKIE 9:00 12:40 14:20
529 Rebecca Lloyd CLAYTON EUREKA GOLD 9:06 12:41 14:22
530 Jackie Wright LAKEVALE TOY DANCER 9:12 12:42 14:24
531 Paige Cogger TWIST LICK DUNK 9:18 12:43 14:26
532 Lucy Baker PLAY IN THE ARC 9:24 12:44 14:28
533 Walter Berger FELDALE GRIFFIN 9:30 12:45 14:30
534 Jamee Cousens ARCHIE 9:36 12:46 14:32
535 Lachlan Nicholls HOMEVIEW PARK WILLIAM 10:00 12:47 14:34
536 Bay Fildes EXCEEDS EXPECTATIONS 10:06 12:48 14:36
537 Lucie Ganas DO THE MACARENA 10:12 12:49 14:38
538 Alexandra Greenhill GOLDILOCKS 10:18 12:50 14:40
539 Lily Hall HOOLEY DOOLEY 10:24 12:51 14:42
540 Wilhelm Enzinger LALS HAVEN CAROLINA 10:30 12:32 14:04
541 Jonathan Humfrey GARY 10:36 12:36 14:12
542 Natasha Lloyd SAN DYNA DOC 10:42 12:53 14:46
543 Abbey Mcleod CLYDE'S LITTLE LADY 10:48 12:34 14:08
544 Kiera Mcnally PRINCESS JASMINE 10:54 12:33 14:06
545 Briony Scott WARDANCER 11:00 12:57 14:54
546 Penelope Johnson CONTIKI 11:06 12:58 14:56
547 Crystal Conning GRANDVIIEW JOE STRUMMER 11:12 12:59 14:58
548 Tania Vascon MACKLEBERRY FINN 11:18 13:00 15:00
549 Abbey Walker DK DEEP YELLOW 11:24 13:01 15:02
550 Elise Brookes FELTON PARK FAITH 11:30 13:02 15:04
551 Erin Scanlon FINCH FARM ZAKYNTHOS 11:36 13:03 15:06
552 Lilah Zigmantas SANLIRRA ZULU GOLD 11:42 13:04 15:08
553 Rhonda Hunter CLAYTON FANTALE 11:48 13:05 15:10
554 Julie Bramucci RAFIKI CIELO 11:54 13:06 15:12
Section 18 Dressage Sat, Ring 9 Showjumping Sat, Sand Arena Ring 2 Cross Country Sat, Cross Country Course
Horseland Training 4-1
31
BN Rider Name Horse Name Dressage Cross Country Show Jumping
555 Ruth Curry MILTON 8:00 13:07 15:14
556 Lily Reynolds MALLAWA PARK INYA DREAMS 8:06 13:08 15:16
557 Stacie Prigg TIME TO PAINT 8:12 13:09 15:18
558 Tahlia Jefcott ELMO 8:18 13:10 15:20
559 Alexandra Phelan SIENNA BLACKBERRY 8:24 13:11 15:22
560 Kealy Parke BOOMALACKA 8:30 13:12 15:24
561 Paula Lesjak MOITIE MOITIE 8:36 13:13 15:26
562 Rachael Kennedy ASHLIN 8:42 13:14 15:28
563 Ashlee Henshaw EDDIE 8:48 13:15 15:30
564 Isabella Clark HOBIE CAT 8:54 13:16 15:32
565 Lily Dawes STEELE ROAD 9:00 13:17 15:34
566 Sarah Curry EQUINE AFFAIRS LIGHTENING 9:06 13:18 15:36
567 Peter Choong BANGORE IVY LEAGUE 9:12 13:19 15:38
568 Jonathan Ambler FREEDOM SPLENDEUR 9:18 13:20 15:40
569 Lilly Mcgregor BREZZE 9:24 13:21 15:42
570 Jacqueline Hilton TIANA 9:30 13:22 15:44
571 Gemma Armeni SEASIDE WEEKEND 9:36 13:23 15:46
572 Debbie Browell COLDSTREAM VENUS 10:00 13:24 15:48
573 Carley Daggett MT ROBINSONS GIZMO 10:06 13:25 15:50
574 Tyla Freeman YANJARRA PARK AIRS N GRACES 10:12 13:26 15:52
575 Amelia Harvey BRAMPTON PARK KAHLULA GOLD 10:18 13:27 15:54
576 Edith Kane ROUGE CHATAIGNE 10:24 13:28 15:56
577 Sandra Kingston HAYES PARK WILLIAM 10:30 13:29 15:58
578 Emma Nicol TWOHEARTS CHARGING 10:36 13:30 16:00
579 Katie Parkes JABEL 10:42 13:31 16:02
580 Cordelia Phillips GRACEFUL GAGA 10:48 13:32 16:04
581 Ruby Commerford GLENKIRRA TYSON 10:54 13:33 16:06
582 Isabella Reynolds HEATHVILLE DASH 11:00 13:34 16:08
583 Olivia Garland TOBY 11:06 13:35 16:10
584 Jana Rzepecki EMIRATES FOX TROT 11:12 13:36 16:12
585 Vivienne Tipping BALLAHOWE FIRE AND ICE 11:18 13:37 16:14
586 Clare Weatherby EA THEODORE 11:24 13:38 16:16
587 Kylie Pedder BELCAM ALADDIN 11:30 13:39 16:18
588 Annabelle Ennis-wert LITTLE MISS VALENTINE 11:36 13:40 16:20
589 Melanie Webb MAGIC SPRINGS 11:42 13:41 16:22
590 Annabelle Stobie MONTY 11:48 13:42 16:24
Section 19 Dressage Sat, Ring 10 Showjumping Sat, Sand Arena Ring 2 Cross Country Sat, Cross Country Course
Horseland Training 4-2
32
BN Rider Name Horse Name Dressage Cross Country Show Jumping
592 Ethan Stuart BILLABONG BANJO 8:00 13:43 16:26
593 Hannah Smith KANDINSKI 8:06 13:44 16:28
594 Alisha Sharpe BELLA TECH 8:12 13:45 16:30
595 Fran Saunders EH ARKAMEADIES 8:18 13:46 16:32
596 Janice Preston VALLI VIEW ROOKIE 8:24 13:47 16:34
597 Ruby Pittock MISTER SPYDER 8:30 13:48 16:36
598 Gabriella Phillips NOBLE WILLING TANAMI 8:36 13:49 16:38
599 Natasha Paige KAHEAN PADRAIC 8:42 13:50 16:40
600 Elly Nutbean CAMELOT SIR OSCAR 8:48 13:51 16:42
601 Sheridan Meyles LUCKY PHOENIX 8:54 13:52 16:44
602 Meghan Lyall MADDIE 9:00 13:53 16:46
603 Nicola Johnson-clarke ON GRETA BAY 9:06 13:54 16:48
604 Sharen Gotts SHARVALLEY THUNDER 9:12 13:55 16:50
605 Brittany Bowd APH FLORIANNA 9:18 13:56 16:52
606 Samantha Borg BROOKLYN 9:24 13:57 16:54
607 Holly Fowler THORWOOD BLACK MAGIC 9:30 13:58 16:56
608 Tania Hoare DAKOTA SUNRISE 9:36 13:59 16:58
609 Anna Kramarev MANUKA MVNZ 10:00 14:00 17:00
610 Shaun Mealmaker SHOAL BAY 10:06 14:01 17:02
611 Jasmine Milne BELCAM AVATAR 10:12 14:02 17:04
612 Holly Osullivan MISS ZINGARA 10:18 14:03 17:06
613 Keren Bennett VALLEY VISTA WINDCHIME 10:24 14:04 17:08
614 Lauren Phillips DANCING DARCI 10:30 14:05 17:10
615 Bree Plausinaitis LORD NELSON 10:36 14:06 17:12
616 Lucy Ryguschek SHARVALLEY VALDIVA 10:42 14:07 17:14
617 Jessica Schneider VPH LEAPING LEROY 10:48 14:08 17:16
618 Erin Smith KING LEONARD 10:54 14:09 17:18
619 Shantel Steer CHARLIE 11:00 14:10 17:20
620 Robyn Rees FH OUTBACK JOE 11:06 14:11 17:22
621 Jayde Stuart MR SANDMAN 11:12 14:12 17:24
622 Joanne Vaughan INDIAN HAWK 11:18 14:13 17:26
623 Jessica Welch DJ JACQUES DE NOIR 11:24 14:14 17:28
624 Phoebe Wilhelm LAKE FERGUS 11:30 14:15 17:30
625 Jorja St John QUAMBY PARK RED STAR 11:36 14:16 17:32
626 Emily Noske-turner PARKLANDS REVEILLE 11:42 14:17 17:34
627 Lucy Bullock SQUIDWARD 11:48 14:18 17:36
Section 20 Dressage Sat, Ring 11 Showjumping Sat, Sand Arena Ring 2 Cross Country Sat, Cross Country Course
Horseland Training 4-3
33
Playing Saturday Night
THREE’S COMPANY5 Piece Band - Specialists in weddings &
corporate entertainment
Th ey can be booked as a trio, 4, 5 or 6piece band, adding in extra vocalists and
musicians as required.
www.threescompanytrio.com.au
34
BN Rider Name Horse Name Confi rmation Dressage Cross Country Show Jumping
630 Murray Lamperd VPH STEVIE GEE 12:30 16:30 16:50 09:00
631 Penelope Johnson HIGHGARDEN 12:35 16:35 16:55 09:02
632 Kirilee Hosier ROYAL NIMEESHA 12:40 16:40 17:00 09:04
633 Tarryn Proctor KOYUNA WORK REST PLAY
12:45 16:45 17:05 09:06
634 Molly Barry ROSENKAVALIER 12:50 16:50 17:10 09:10
635 Kelly Mort KOYUNA OCALA 12:55 16:55 17:15 09:12
636 Rebekah Italiano KENLOCK CADILLAC 13:00 17:00 17:20 09:14
637 Murray Lamperd THE GENERAL 13:05 17:05 17:25 09:16
638 Sarah May ROCKEFELLER 13:10 17:10 17:30 09:18
639 Stacey Briggs MARENGO TRAFALGAR 13:15 17:15 17:35 09:20
640 Tarryn Proctor KOYUNA CODE BREAKER 13:20 17:20 17:40 09:08
641 Stephanie Comfort ABSOLUTELY MAGNIFIC 13:25 17:25 17:45 09:24
642 Elisha Laukart KALAHARI LASS 13:30 17:30 17:50 09:26
643 Linda Williams LINBIL BUTTERCUP 13:35 17:35 17:55 09:22
Section 21 Conformation Sat, Red Sand Arena Dressage Sat, Ring 1 Paces Sat, Next to Dressage Showjumping Sun,Sand Arena Ring
MecWorma Young Event Horse
The Young Event Horse class was fi rst introduced to Wandin Park in 1989. The event is designed to recognise and encourage breeders and trainers who produce the type of young horse that is considered to be that which will make a top eventing horse. The class is open to 4 and 5 year old horses. The competition is divided into four sections. Each section has a different judge, and 25% of the total available marks are awarded in each section.
Section 1 – Conformation, Saturday 12.30pm, ‘Sand Arena’ Judge Nina Clark.
The Competitor performs an in-hand work pattern. The Judge is assessing aspects of conformation, overall balance, athleticism and trainability of the Event Horse. Scores will be allocated to each of these aspects.
Section 2 – Dressage, Saturday 4.30pm Ring 1 Judge Barry Roycroft.
A simple dressage test will be ridden in a 60 x 20m arena. The Judge will not mark individual movements, but will consider the overall performance of the horse. The Judge will also take into account the rider’s infl uence on the horse’s performance as it is the horse’s not the rider’s potential they are looking for. The horse should produce three correct, elastic and regular gaits through a swinging back.
Section 3 – Showing of Paces, Saturday 4.50pm adjacent to ring 1. Judge Angela Tivendale.
All horses are to be ridden and will be judged on their paces (including the gallop) and jumping a small cross-country (a single log). The judge will score this section based on paces suitable for eventing.
Section 4 – Showjumping, Sunday 9.00am. Judge Tracey Baker.
The jumping test is over a short course of about seven show jumping fences, no more than 90cm high. The test is de-signed to assess the horse’s overall jumping performance and the judge will score on this basis, rather than conventional jumping penalties. A horse which knocks a fence down through inexperience may score higher than a horse with poor technique that jumps clear.
35You can FREE CALL from our website www.iahp.com.au by clicking onFree Advice Line FREE CALL
Choose Your Weapons...
The importance of rotating wormers by active
NOT by brandname has never been as important
as it is today! Resistance is only a matter of time…
The active in MecWorma & Bot is a member of the “mectin” family whileMecWorma & Tape Allwormer contains a mectin in combination with morantel.Worma Drench and Worma paste are members of the “BZ” family. Worma paste hasa completely different additional active, piperazine, for extra firepower.MecWorma & Tape Allwormer treats and controls tapeworms and is a broad spectrum allwormer.MecWorma & Bot is broad spectrum and controls seasonal bots.Worma paste is broad spectrum, combats BZ resistant small strongylesand sterilises worm eggs within 24 hours of usage, you can even give a 2nd dose 48 hours later if migrating strongyles are a problem.Worma Drench is a liquid formulation which can be administered in various ways (see label) and can be added to feed for those horses that prove difficult to worm.All 4 products have a wide safety margin and are great value for money.
You can FREE CALL from our websitewww.iahp.com.au by clicking onFree Advice Line FREE CALL
TThThThTThThThhhhhhhTTThThhhThhhTTTThThTThThTTThhThTTTThhTTTTThhThheeeeeeeeeeeeeeee iimimimimimimimimmimimmimimimmmmmmmmmimmmpopopopopopopoppopopopopoooooportrtrtrtrtrtrttrrtrttrttrtanananananananananaananancececececececececececcceeecceececeeec oooooooooooooooooooooooooooooooooooofffffffffffffffffff fffffffffffffffff rrorororororooororrorroroororoorrrrrorororororrrrooorotatattatttatatattataatatataatatititititiitititittititittingngngngngngngngngngngngngngn wwwwwwwwwwwwwwwwwwwwwwwwwwwwwworororoororrorororrororoooooooooormemememememememememmemmmmmemmemmemmm rsrsrsrsrssrssrrrsrsrrsrrrssss bbbbbbbbbbbbbbbbbyyy yy yyyyy yy y yyyyyyy y yyyyyyyyyy acacaccacacacaccacacacacacaaccaaacaaccacacacacccacaaaacctititititititiitttitittittitittitttitittittitittitit vevevevevevevevvevevveeeveeveeevevevvevve
NONONNNONNONONONONONOONONNNONOONOOOONOONONNONONNNONNNNNONNN T T TTTTTTTTTT T TTTTTTTT bybbbybybybbbbybybybybybybbybybybyy bbbbbbbbbbbbbbbbbbbbbbrarararararararrraaraaaarr ndndndndndndnddnndndndndndddddnnndn nananannanaanananananannnanammmmmmmmmememememeeeemmeeemmemememmeeemeeememm hhhhhhhhhhhhasasasasasasaasasasas nnnnnnnnnneveveveveveveveveve erererererrerererrrrrrrrrrrrr bbbbbbbbbbbbbbbbbbbbeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeen n n nnn asasasasasasasaaaaaasaas iiiiiiiiiiiimpmpmpmpmpmpmpmpmpmmpmpmpppmpmmppmpmmmmmpppooooooorrrorrrorororrororoooroooroooo tataatatattatatataattaaantntntntntntnnntn
aaaaasasasaaaasasaaaaaaasaaaaasaaaaa iiiiit t t tt isisisisisssssss ttttttttodododoodododododdddayayayayayyyyayyyyyyy!!!!!!!!!!!!!!!!!!!! ReRReRRReeReReReeRReReReReeReRRReReRReReReRReesisisisisisisisissisiststststststststtttststtstttsttstananananananananananaananaanannaanaancececececececcececececececeecececcececec iiiiiiiiiiiiiiiis sss sss sssss s s sssss onononononononononnonoonnnnononnnlyllylyylylylyylylyllylylyllyyy aaaaaaaaa mmmmatatatattataaaattteteteteteteteteteteeeeeeteteteteterr r rrrrrrrrr rrrrr ooofoffofofoofofofoofofofoofofofooofo ttttttttttttttttttttttimimimimimimmimmimimimmme…e…e…e…e…ee…e…e…e…e
ThThThThThhTThThhhhe e e e eeee e acacacacacactitititititiivvveveveveveveveveveevevevevevevevvevevve iiiiiiinnnnnnn MeMeMeMeMeMeMeMM cWcWcWcWcWcWWcWcWororororooroo mamamaaamamamamaaaa &&&&&&&&&&&&& BBBBBBBototottototottt iis ssss aaaaaaaaaaaa mememememememmmm mbmbmbmbmbmbmmmbbmbberereereerer oooooooof ffff ththththththheeeeeeeee “m“m“m“m“m“m“mmececececccectitititititititit n”n”n”n”n”n”n”nnnn ffffffffffamamamammmmamammammaamaa ililililiilly y y y yyyyy whwhwhwhwhwhwhwhwhwhw ililiilililillii eeeeeeeeeeeeeMeMMMMeMeMeMMeMeMeMMeeeMeMMeMeMMeMMMMeMee WcWcWcWcWWcWcWcWcWWWcWcWcWWWWWWWcWcWcWWooooorororororrooooooorooooooo mamamamamammmm &&&&&&&&& TTTTTTTTTapapapapaa eee AlAlAlAlAlAAAAlllwllwlwlwlwlwlwllwwoororororoorororroorormemememmememememememmeer r rr rr cococococcoococococococontnntntntnnntttntaiaiiaiaiaiaiaiaiaiinsnsnsnnnsnsn aaaaaaaaa mmmmmmmmmmmmmececececececececece tittitiitititt nnnnnnn ininnninnininiinn ccccccccomomomomomomomommo bbibibibibibibibibbiibiinanananananananaannatittititititititttitt onononononnonononoon wwwwwwwwwwwwwititiittitititiitititthhhhhhhhhhhhhh momomomomomomomoomomm rrrrrrrrrrrarararaararaarr ntntntntntnnntnntnn eeeeeeeeeleleeleeleleeleell...WoWoWoWoWoWooW rmrmrmrmmrmmmmmmmmmaaaaa DrDrDrDrDDrDrDrDrDDrDrDDDDrrDrDDD eneenennnnchchchchccchcch aaaaaaandndnddndndndnddd WWWWWWWWoroororororormmamamammamamamammaama ppppppppppppasasasassaasssteteteteeteetett aaaaaaarerererrreerer mmmmmmememememmememmemmmmmbbebebebbebebersrsrrssrs ooooooof f ff fff thththththhtththhtththt e eeee “B“B“BBBBBZ”ZZ”Z””Z”Z”Z”Z”Z” ffffffffamamamamammamamamama illliililililillily.y.y.y.y.yy.yy.yy. WWWWWWWWWorororoorororororoo mmmmmmmmmmmmmmaamaaamamaamamamamma ppppppppppaaaaasasasaasssaaasaaasa tetetttetet hhhhhhhhhhhhhhhhaasasaasaaaaaaaaaaaaaaaaaaaaaa cocococooccocooococcocococococompmmpmpmmpmpmpmmpmmmpmmpmpmpm lelelelelleetetetetetetettetetettetetteeettettetelylylylylylylylylylyly ddddddififffififififififfefefefefeeffefefefefeeeferererererererererereentntntnntntntnntntnntn aaaaaaaaaaaddddddddddddddddddddititititittitititiitioiioioioioiionananananan l l lllll acacaccacacaccaa titititititt vevevevevevveeve,,,,,, pipipipipipipiipppipip pepepepeeppeeerarararraarararararrazizizizzizizzizineneneneneenenenene,,,, fofofofofofofofofofofoffof r r rrrrr exexexexexexexexexeeeextrtrtrtrrrrrrtrtrt aa aaaa aa firfirfirfirfirfirfifi epepepepepepeppowowowowowwwwwoowowererereereeeererererer....MMMMeMeMeMeMeMMMMMeecWcWcWcWWcWWWWorororororrmammamamamamaam &&&&&& TTTTTTTapapapapappappaapapeeeeeee AlAlAlAAlAAlAA lwlwlwwlwwwwwwoooororooroororrooro mememememmmmmer r r r trtrtrttrt eaeaeaeaeae tstsstststst aaaaaandnddddddndndndndddnddd ccccccccconoononnononononononono trtrtrtrtrtrtrrtrttrolololollolooolsssssss tatatatatatatatatatapepepeppepepepppepewowowowoww rmrmrmrmrmrmrmmmssssssssss aaananaanaannannaaa ddddd isisisississ aaaaaa bbbbbbrororororooooooadadadadadddadaaddaddad ssssssssppepepeep ctctccttruururum m mmmmmmm alalalalalalalaallwlwlwlwlwllwllwlwworororrrororormemememeemememememeeeerr.r.r.rr.rrrrrMeMeMeMeMeeeeeMeMeeeecWcWcWcWcWcWcWc orororooro mamamamammmm &&&&&&& BBBBBBototototototooottttt iiiiiisssss sss s ss brbrbrbrbrbbbbbbb oaoaoaoaoaoao dddd dddd dddddddd spspsppsppececeecceccctrtrtrttt umumumumuuu aaaaaandndndnddn ccccccconononononnontrtrtrttrrololols s s ss s sesesesesseseseeeseasasasasassasssononononnonnnonoonononononnnalllalallalalaaal bbbbbbbbbbbbotototttootoootoooto sss.s.s.s.sssWoWoWoWoWoWWoWoWoWoWoWoWoWWoW rmrmrmrrmrmmrrmrmmaaaaa papapapapapappapap ststststtstte e ee eee isiisisisisisisisissss bbbbbbbbbbbbrororororoororoadadadadadaddadadaddddddd ssssssssssssssssspepepepepeppppepppp cctctctcccctctcttttruururuuumm,m,mm,mm,m,mmm ccccccomomoommombabababababbabaatsttstststssststss BBBBBBBBBBZZZZZZZZ rerererererreesiisiiisisis stststststtttssttstananananannaananttttttttt smsmmsmsmsmsmsmsmsmmsmsmssmmsmsmssmalalalalalaalalalaaala llll ststststststststststststtrororororoororrororroongngngngngnngnnggnggyylylylylylylyyylylyly eseseseseanananananddddd stststststtsssssterereerere ilililii isisisisisiississsissi eseeseseseseseseeeeeesees wwwororoorororormmmmmmmm egeggeeegggsgsgsssssssssssgsgs wwwwwwwwwwwititiititithihihiihhihh nnnnn 242424444 hhhhhououououuuoursrsrsrsrsrssrsrs ooooooooofffff ususuussususagagagagagga e,e,eeeeee, yyyyyououooouo ccccananana eeeeeveveven n n gigigig vevevee aaa 2222222ndndndn dododododdodoododododod seseseseseseseessses 444444448 8 8 8 hohohooooururrrs s sss lalaal tetetettt r r ififffiff mmmigiggggggggraraarararraratititititttingnngngngnngngngngnnn ssssssstrtrtrtrtrrt ononononononooo gygygygygygyyggggyyg leleleleelell sssss arararararara eeeeee aaaaaaaaa prprprprpprprpprppppp obobobbobboboboboobobobobobobbbbleleleem.m.WoWoWoWoWoWWoWWW rmrmrmrmmmmaaaaaaaaa DrDrDrDrDDrrDrenenenenenenchcchhhchhhhchccc iiis s ssssssss aaaaaa lililililiquququququuq idididiidididiid fffffffffforororooro mumumumumumumum lalalalalalatititittiit onononononononooo wwwwwwwwwwhihihhihihhh chchchhchchchchccchhhhhh cccccccananananaanaanan bbbbbbbbeee e ee e adadaddddadddadadaddaaa mimimmininininn ststerere ededd imi ininiststtererere ededed iinnn vavaririouououuuuuuuus s wawawaaysysys (s(s(ssseeeeeeeeeeeeee llllabababababbbelelell)))) anannaaa dddddddd cacacaccaan n nnnnn bebebebebebebbeb aaaaaaadddddddddddddddddddddedededededeed ttttttttto oo o oooo fefefeffefeffef edededdedeede ffffffffororororooor tttttttthhhhhhohohohhohhooossesese hhhhtthohooohohhosesesessss hhhhhoororororrrrrrsesesesseseseessssssss thththththtththht atatatataatt ppppprororooveveve ddifi ficficululu t t tttoo wwworororororororormm.m.m.m.m.mm.mmmmmmmm..AlAAlAA lllll 44444 pprprododododucucucctstststsss hhhhavavavaveeeeee aaaa wiwiw dddedededeeedeede sssssafafafafaffetetetetetyyAlAlAAlAAlAAAAA lll 44444444 prprprprppprrrrpp ododododododoo ucucucucuucuuctstsstssst hhhhhhhhhavavavaavavavaaa eee aaaaaaaaaa wiwwiww ddddededdddededed ssssssaaaafffetetetttetyyyyy mamamamamaamargrgrgrgrgrgrgrgininininnnnnnninnn aaaaaaandndnndnddddede ssssssssss fafafafaffetetetetetteetty y yy y yyyyy mamamamamamamaaamaaaa grgrgrgrggrgggrgggiininninininininnnnnin aaaaaandndndndndndnddndnndnn arararararareeeeee grgrgrgrg eaeaeaeaae tttttt vavavavaaaalulululuuueeeee fofovaaaluuulue e eeee fofofofof r rr rr momomomoomomomoomomoomommomom neneneneneeeney.y.y.yy.
pppopoppopopopopoppopooortrrtrtrtrtrttr ananaanna
®
Wa
r o
n W
orm
sIAH Sales Pty. Ltd. 18 Healey Circuit, Huntingwood NSW 2148 Australia
Freecall: 1800 801 201 Ph: 02 9672 7944Fax: 02 9672 7988 Email: [email protected] Website: www.iahp.com.au
20595_War on Worms Ad_HorseDeals (19127 v2).indd 1 8/05/12 9:45 AM
36