workstation software - thermo fisher...

Expedite™ 8900Workstation Software

User’s Guide

© Copyright 2001, Applied Biosystems. All rights reserved.

Printed in the United States of America. This book or parts thereof may not be reproduced in any form without the written permission of the publishers.

For Research Use Only. Not for use in diagnostic procedures.

NOTICE

Applied Biosystems supplies or recommends certain configurations of computer hardware, software, and peripherals for use with its instrumentation. Applied Biosystems reserves the right to decline support for or impose extra charges for supporting nonstandard computer configurations or components that have not been supplied or recommended by Applied Biosystems. Applied Biosystems also reserves the right to require that computer hardware and software be restored to the standard configuration prior to providing service or technical support.

Information in this document is subject to change without notice and does not represent a commitment by Applied Biosystems. Applied Biosystems assumes no responsibility for any errors that may appear in this document. This manual is believed to be complete and accurate at the time of publication. In no event shall Applied Biosystems be liable for incidental or consequential damages in connection with or arising from the use of this manual.

Nucleic acid synthesis reagents sold by Applied Biosystems are covered by U.S. patent RE34,069 and patents in Austria, Belgium, Canada, France, Germany, Japan, Luxembourg, Netherlands, Sweden, Switzerland, and U.K.

Applied Biosystems is a registered trademark, and Expedite is a trademark, of Applera Corporation or its subsidiaries in the U.S. and certain other countries.

Microsoft, MS, Windows, and MS-DOS are registered trademarks of Microsoft Corporation.

Table of Contents

Table of Contents

How to Use This Guide ............................................................................. ix

Chapter 1 Expedite Workstation Software1.1 Expedite Workstation Software Features ....................................... 1-2

1.2 Hardware Requirements ............................................................ 1-3

1.3 Software Overview ................................................................... 1-5

1.3.1 Expedite Windows Overview .................................................. 1-5

1.3.2 Menu Overview ...................................................................... 1-9

1.4 Installing the Software ............................................................. 1-13

Chapter 2 Preparing the System2.1 Overview ............................................................................... 2-2

2.2 Starting the Instrument.............................................................. 2-3

2.3 Starting the Software ................................................................ 2-6

2.3.1 Starting the Workstation Software .......................................... 2-6

2.3.2 Configuring Instruments ......................................................... 2-8

2.3.3 Communication Between Workstation and Instrument ...........2-10

2.4 Specifying the Operating Environment ......................................... 2-13

2.4.1 Setting the Control Mode ......................................................2-13

2.4.2 Specifying the Operator Name and Folder ............................2-16

2.4.3 Setting Alarms ......................................................................2-17

2.5 Checking Instrument Setup ....................................................... 2-20

Chapter 3 Performing a Synthesis3.1 Overview of a Synthesis ............................................................ 3-2

3.2 Creating or Editing the Sequence ................................................ 3-3

3.3 Preparing and Loading the Reagents............................................ 3-5

3.3.1 Installing the Reagents .......................................................... 3-6

3.3.2 Priming the System ................................................................ 3-8

Expedite 8900 Workstation Software User’s Guide iii

Table of Contents

3.4 Starting the Synthesis .............................................................. 3-12

3.4.1 Specifying the Synthesis Parameters ....................................3-12

3.4.2 Transferring Sequence Sets ..................................................3-18

3.4.3 Checking Reagent Resources ...............................................3-20

3.4.4 Installing the Columns ...........................................................3-21

3.4.5 Starting the Instrument ..........................................................3-22

3.5 Monitoring the Synthesis .......................................................... 3-23

3.5.1 Instrument Window ...............................................................3-23

3.5.2 Trityl Viewer ..........................................................................3-28

3.5.3 Status Window ......................................................................3-30

3.6 Adding Operator Notes to the Run Log ........................................ 3-32

3.7 Stopping a Synthesis ............................................................... 3-36

3.7.1 Holding a Synthesis ..............................................................3-36

3.7.2 Stopping a Synthesis ............................................................3-39

3.7.3 Aborting a Synthesis .............................................................3-40

Chapter 4 Using the Expedite Database4.1 Overview of the Database.......................................................... 4-2

4.2 Importing and Exporting ............................................................ 4-3

4.2.1 Importing ............................................................................... 4-3

4.2.2 Exporting ............................................................................... 4-7

4.3 Managing Data in the Database ................................................. 4-12

4.4 Managing Folders ................................................................... 4-14

4.5 Deleting and Moving Files......................................................... 4-17

4.6 Filtering and Sorting the Data Displayed....................................... 4-19

4.7 Creating a List-by Filter ............................................................ 4-20

4.7.1 Specifying Filter Criteria ........................................................4-25

4.7.2 Specifying Sort Criteria .........................................................4-26

iv Applied Biosystems

Table of Contents

Chapter 5 Viewing and Printing Reports5.1 Overview of Reports ................................................................. 5-2

5.2 Displaying Reports ................................................................... 5-3

5.3 Using the Report Window .......................................................... 5-6

5.4 Displaying Trityl Data................................................................ 5-7

5.5 Printing a Report .................................................................... 5-10

5.5.1 Setting Up the Report ...........................................................5-10

5.5.2 Printing a Report ...................................................................5-12

5.5.3 Printing Multiple Reports .......................................................5-12

5.6 Renaming a Run .................................................................... 5-14

5.7 Saving a Run Report as Text ..................................................... 5-15

5.8 Report Viewer Menus .............................................................. 5-16

Chapter 6 Using the Sequence Editor6.1 Overview of the Sequence Editor................................................. 6-2

6.2 Creating and Editing Sequences ................................................. 6-3

6.2.1 Opening a Sequence ............................................................. 6-3

6.2.2 Using the Sequence Editor Windows ..................................... 6-6

6.2.3 Creating or Editing a Sequence ............................................6-10

6.2.4 Printing a Sequence ..............................................................6-13

6.2.5 Saving and Closing a Sequence ...........................................6-14

6.2.6 IUB Mix Codes, Numeric Codes, Extended Cycle, Lowercase Codes ...................................................................................6-17

6.3 Using Foreign Sequences ......................................................... 6-21

6.4 Viewing Sequence Information ................................................... 6-25

6.4.1 Displaying the Complement of a Sequence ...........................6-25

6.4.2 Displaying Sequence Statistics .............................................6-26

6.4.3 Displaying Summary Information ...........................................6-29

6.4.4 Changing Base Grouping ......................................................6-31

Expedite 8900 Workstation Software User’s Guide v

Table of Contents

6.5 Customizing the Sequence Editor ............................................... 6-33

6.5.1 Setting Sequence Editor Preferences ...................................6-33

6.5.2 Setting Molecular Weights ....................................................6-35

6.6 Searching for Specific Base Combinations .................................... 6-37

6.7 Proofreading Sequences .......................................................... 6-38

6.8 Sequence Editor Menus ........................................................... 6-39

Chapter 7 Using the Protocol Editor7.1 Overview of the Protocol Editor ................................................... 7-2

7.2 Understanding Protocols ........................................................... 7-3

7.2.1 Cycles in Protocols ................................................................ 7-4

7.2.2 Subcycles (Operations) in Cycles .......................................... 7-6

7.2.3 Steps in Subcycles ...............................................................7-10

7.2.4 Delivery Modes in Steps .......................................................7-12

7.2.5 Functions in Steps ................................................................7-14

7.2.5.1 Fluidic Functions ..................................................7-15

7.2.5.2 Special Functions .................................................7-18

7.2.6 Description of the Adenosine (A) Cycle .................................7-19

7.3 Determining the Reagent Delivery Volumes for Protocols ................. 7-23

7.4 Creating and Editing Protocols ................................................... 7-26

7.4.1 Opening a Protocol ...............................................................7-26

7.4.2 Using the Protocol Editor Windows .......................................7-30

7.4.3 Creating a New Protocol .......................................................7-32

7.4.4 Setting Scale and Chemistry for a Protocol ...........................7-33

7.4.5 Editing a Protocol ..................................................................7-34

7.4.5.1 Inserting or Editing a Step ....................................7-34

7.4.5.2 Editing a Cycle .....................................................7-36

7.4.5.3 Finding and Replacing Text ..................................7-38

7.4.6 Printing a Protocol ................................................................7-41

vi Applied Biosystems

Table of Contents

7.4.7 Displaying Summary Information ...........................................7-43

7.4.8 Saving and Closing a Protocol ..............................................7-44

7.4.9 Validating a Protocol .............................................................7-47

7.5 Protocol Editing Examples ........................................................ 7-49

7.5.1 Editing Standard Protocols to Enhance Trityl Intensity ..........7-49

7.5.2 Creating an RNA Protocol from a THIO Protocol ...................7-51

7.5.3 Editing Standard Protocols for Trityl Quantitation ..................7-54

7.5.4 Editing Standard Protocols to Add a Specialized Monomer ...7-57

7.6 Protocol Editor Menus.............................................................. 7-60

Appendix A Installing the Serial Board ....................................... A-1

Appendix B Warranty/Service Information ................................ B-1

Appendix C Technical Support and Training ........................... C-1

Index

Expedite 8900 Workstation Software User’s Guide vii

1
How to Use This Guide
Purpose of thisguide

The Applied Biosystems Expedite 8900 Workstation Software User‘s Guide describes the features and use of the Expedite workstation software.

Audience This guide is intended for novice and experienced Expedite workstation users who are synthesizing nucleic acids.

Structure of thisguide

Applied Biosystems Expedite 8900 Workstation Software User’s Guide is divided into chapters. Each chapter page is marked with a tab and a header to help you locate information within the chapter.

The following table describes the material covered in each chapter.

Chapter 1, Expedite Workstation Software

Describes the features of the software and how to install the software.

Chapter 2, Preparing the System

Describes how to start up the Expedite Nucleic Acid Synthesis instrument and the Expedite 8900 Workstation Software. It also tells you how to set the operating environment.

Chapter 3, Performing a Synthesis

Describes how to create, run, and monitor a synthesis.

Chapter 4, Using the Expedite Database

Describes how to import and export, store, manage, and view information in the Expedite workstation database.

Chapter 5, Viewing and Printing Reports

Describes how to generate, view, and print reports.

Expedite 8900 Workstation Software User’s Guide ix

How to Use This Guide

1

MicrosoftWindowsversions

The Expedite Workstation software runs on either Microsoft® Windows® version 3.1 software or Microsoft Windows 95 software. All screen examples shown in this book are from the Windows 3.1 software. Windows 95 software screens have the same functionality.

Conventions This guide uses the following conventions to make text easier to understand.

Generalconventions

• Bold indicates user action:

“Type 0 and press Enter for the remaining fields.”

• Italic text denotes new or important words, and is also used for emphasis:

“Before analyzing, always prepare fresh matrix.”

Chapter 6, Using the Sequence Editor

Includes procedures for using the Sequence Editor.

Chapter 7,Using the Protocol Editor

Describes cycles and protocols, and includes procedures for using the Protocol Editor.

Appendix A,Installing the Serial Board

Contains procedures for configuring and installing the board, and connecting the workstation to the instrument.

Appendix B,Warranty/Service Information

Contains warranty, service, return, and spare parts information.

Appendix C, Technical Support and Training

Describes how to contact Technical Support, obtain technical documents, and obtain cutomer training information.

x Applied Biosystems

1
Notes, Cautions,
and WarningsA note calling out important information to the operator appears as:

NOTE: Record your result before proceeding with the next step.

A caution calling out information to avoid damage to the system or equipment appears as:

CAUTION

Changing reagent bottles during a synthesis is not recommended. Check the reagent resources prior to initiating a synthesis to make sure that there is a sufficient supply.

A warning calling out information essential to the safety of the operator appears as:

WARNING

The Expedite cabinet weighs 102 pounds (46 kg). Two people are required to safely lift the instrument cabinet.

Expedite 8900 Workstation Software User’s Guide xi

1
1Expedite WorkstationSoftware
This chapter contains the following sections:

1.1 Expedite Workstation Software Features ... 1-2

1.2 Hardware Requirements ............................ 1-3

1.3 Software Overview .................................... 1-5

1.4 Installing the Software ............................. 1-13

Expedite 8900 Workstation Software User’s Guide 1-1

Chapter 1 Expedite Workstation Software

1
1.1 Expedite Workstation Software Features
Expediteworkstation

The Expedite Workstation Software provides monitoring and control of the Expedite Nucleic Acid Synthesis System. The Expedite Workstation software runs on either Microsoft® Windows® version 3.1 software or Microsoft Windows 95 software.

The Expedite Workstation software allows you to:

• Control up to six Expedite instruments

NOTE: If any Expedite instrument includes a Multiple Oligo Synthesis System (MOSS) unit, you can control only four instruments from the Expedite Workstation.

• Create and edit sequences and protocols

• Check reagent resources and reset reagent volumes

• Start and stop syntheses

• View and print reports

• Store sequence, protocol, and report information in the Expedite Workstation database

• Search, view, filter, and sort information in the database

Tasks youperform on the

Expediteinstrument

The Expedite Workstation software allows you to perform most synthesis preparation and control tasks. However, you must perform these tasks on the Expedite instrument:

• Set the Instrument Address (Tools:Config:Host)• Specify the User Profile (Tools:Config:Profile)• Select the Chemistry (Tools:Config:Profile)• Run diagnostics tests (Tools:Diag)• Prime the reagent passages (Prime)

This manual tells you when you need to perform a task on the Expedite instrument and refers you to the Expedite Nucleic Acid Synthesis System User’s Guide for detailed information.

1-2 Applied Biosystems

Hardware Requirements

1
1.2 Hardware Requirements
Expeditehardware

The Expedite Workstation hardware consists of:

• RS-422 serial board• RS-422 communications cable (14 ft)

Computerhardware

The Expedite Workstation software requires a minimum configuration of:

• PC-compatible 386SX 16MHz computer with a dedicated COM port

NOTE: The Expedite Workstation requires a dedicated COM port. The COM port cannot be connected to or configured for any other device.

• 4 MB RAM minimum, 8 MB RAM recommended

• 60 MB hard disk, 5 MB free

• 3.5-inch disk drive

• VGA color graphics monitor

• MS-DOS® 5.0 or higher

• Microsoft Windows version 3.1, configured in 386 enhanced mode, or Microsoft Windows 95 software

• Serial mouse



1
NOTE: Parallel mouse devices interfere with proper operation of the Expedite Workstation.
• 16-bit soundblaster-compatible sound board for sequence reading, supplied by the user

See Appendix A, Installing the Serial Board, for information on installing the Expedite serial board in a computer, and for connecting instruments to the Expedite Workstation.


Software Overview

1
1.3 Software Overview
This section describes:

• Expedite windows overview• Expedite menu overview

1.3.1 Expedite Windows Overview

This Expedite Workstation software includes:

• Instrument window• Sequence Editor window• Reports window• Protocol Editor window

Instrumentwindow

The Instrument window (Figure 1-1) is displayed when you start the Expedite Workstation software or start a synthesis. The Instrument window monitors the Expedite Nucleic Acid Synthesis instruments and provides access to other Expedite windows.

Figure 1-1 Expedite Instrument Window



1
The Instrument window allows you to:
• Set up and control syntheses on up to six Expedite Nucleic Acid Synthesis instruments

NOTE: If any instrument includes a MOSS unit, you can control only four instruments from the Expedite Workstation.

• Monitor syntheses

• Add comments to the run log

• View trityl data

• Automatically transfer information from individual instruments to the Workstation for long term storage

• Access the Sequence Editor, Report Viewer, and Protocol Editor

Sequence Editorwindow

The Sequence Editor window (Figure 1-2) allows you to create new sequences, edit existing sequences, and manage database storage and display of sequences.

Figure 1-2 Sequence Editor Window


Software Overview

1
To access the Sequence Editor, do one of the following:
• Select Run Sequence Editor from the Edit menu in the Instrument window.

• Click Edit Sequence in the Run Synthesis dialog box.

• If the Expedite Workstation software is not running, you can run the Sequence Editor in stand-alone mode by double-clicking the Sequence Editor icon in the Expedite window in the Program Manager.

Reports window The Reports window (Figure 1-3) allows you to view and print run statistics, runtime log, and trityl data for completed runs.

Figure 1-3 Reports Window

To access Reports, do one of the following:

• Select Run Report Viewer from the File menu in the Instrument window.

• If the Expedite Workstation software is not running, you can run the Report Viewer in stand-alone mode by double-clicking the Reports icon in the Expedite window in the Program Manager.



1
Protocol Editorwindow
The Protocol Editor window (Figure 1-4) allows you to modify existing protocols or create new protocols.

.

Figure 1-4 Protocol Editor Window

To access the Protocol Editor, do one of the following:

• Select Run Protocol Editor from the Edit menu in Instrument window.

• If the Expedite Workstation software is not running, you can run the Protocol Editor in stand-alone mode by double-clicking the Protocol Editor icon in the Expedite window in the Program Manager.


Software Overview

1
1.3.2 Menu Overview
This section gives an overview of the menus available from the Instrument window (Figure 1-5).

Figure 1-5 Instrument Window Menus



1
Table 1-1 Main Menu
Menu Command Function

File Operator ID Change the Operator ID. See Section 2.4.2, Specifying the Operator Name and Folder.

Run Report Viewer

Select a completed run to review and print results. See Chapter 5, Viewing and Printing Reports.

Import Import sequence, protocol, and result files into the database. See Section 4.2.1, Importing.

Export Export sequence, protocol, and result files for archiving or use on other systems. See Section 4.2.2, Exporting.

Exit Exit Expedite Workstation software.

Edit Run Sequence Editor

Create, modify, manage, or review sequences. See Chapter 6, Using the Sequence Editor.

Run Protocol Editor

Create, modify, manage, or review protocols. See Chapter 7, Using the Protocol Editor.

Instrument selector

Add, remove, or change instrument names and addresses. See “Switching to a different instrument” on page 3-27.

Retry communications

Establish link with each configured instrument. See “Retry communications” on page 2-11.


Software Overview

1
Customize Show status
windowShow the multi-instrument status window. See Section 3.5.3, Status Window.

Show instrument selector

Show the instrument selector window. See “Switching to a different instrument” on page 3-27.

Customize status window

Customize the multi-instrument status window. See Section 3.5.3, Status Window.

Change control mode

Select local or remote mode of operation. See Section 2.4.1, Setting the Control Mode.

Run Synthesis Enter synthesis parameters for each column and start the synthesis. See Section 3.4.1, Specifying the Synthesis Parameters.

Hold synthesis Set a hold on one or both columns. See Section 3.7.1, Holding a Synthesis.

Abort synthesis Clear the synthesis on one or both columns. See Section 3.7.3, Aborting a Synthesis.

Trityl Viewer Display trityl data. See Section 3.5.2, Trityl Viewer.

Operator Notes Review the run logs and add text to the logs. See Section 3.6, Adding Operator Notes to the Run Log.

Resources Review and print the current resource requirements. See Section 3.4.3, Checking Reagent Resources.

Start Start a synthesis. See Section 3.4, Starting the Synthesis.

Stop Stop a synthesis. See Section 3.7.2, Stopping a Synthesis.

Table 1-1 Main Menu (Continued)




1
Setup Alarms Configure the system alarms. See Section 2.4.3,
Setting Alarms.

Reagents Check resource requirements or set new volumes.See Section 3.4.3, Checking Reagent Resources.

Sequence Set Send a group of Expedite or foreign sequences to an instrument. See Section 3.4.2, Transferring Sequence Sets.

View Instrument Setup

Displays chemistry and column support parameters. See Section 2.5, Checking Instrument Setup.

Window Tile Arrange windows so that all are visible and not overlapped.

Cascade Arrange windows so that all are the same size and staggered.

List of instrument window captions

Activate the selected window.

Help Contents Displays online help.

Table 1-1 Main Menu (Continued)



Installing the Software

1
1.4 Installing the Software

• Exporting from the current version• Installing the new version• Importing older versions of sequences and protocols• Deleting the old version of Expedite software

Exporting fromthe current

version

If you want to keep sequences or protocols from the current version of software, export them from the current version database before you install the new software. See Section 4.2.2, Exporting, for information.

After you install the new version of software, you can import the sequences and protocols into the database of the new version of software. See Section 4.2.1, Importing, for information.

Installing To install the Expedite software:

1. At the C:\> prompt, type WIN to start Microsoft Windows.

2. Place the Expedite disk in the A: (or B:) drive.

3. Go to the correct subsection below for Windows 3.1 or 95.

Windows 3.1 1. From the Program Manager File Menu, select Run.

The Run dialog box (Figure 1-6) is displayed.

Figure 1-6 Run Dialog Box

2. In the Command Line, type A:setup (or B:setup) and click OK.



1
Windows 95 1. Click Start and then click Run.
The Run dialog box appears.

2. Type a:\setup and click OK.

Both versions The Expedite Workstation Setup screen (Figure 1-7) is displayed.

.

Figure 1-7 Expedite Workstation Setup

3. Click Continue.

The setup program searches for previously installed versions of the Expedite Workstation software.

NOTE: Do not install the new version of software into a directory that contains an older version of software. Install into a new directory.


Installing the Software

1
4. Type the name of the directory to install into. Include the version number in the name of the installation directory. For example, type C:\EXP_23 when you install version 2.3 software.
5. Click Continue.

The Select Communications Port dialog box(Figure 1-8) is displayed.

Figure 1-8 Select Communications Port Dialog Box

6. Select a base address and interrupt for the Expedite serial board, or click the Apply Defaults button to use the factory defaults.

COM2 is selected by default because COM1 is often used for the mouse.

The setup program searches for previously installed versions of the Expedite Workstation software.

NOTE: Select a base address and interrupt that match the current setting on the serial board. See Appendix A, Installing the Serial Board.



1
NOTE: The COM port you select on the computer must be dedicated to the Expedite Workstation. It cannot be connected to or configured for any other device.
7. Click Continue.

8. Insert disks as prompted.

A message is displayed when installation is complete.

Importing olderversions of files

After installing the software, import sequences, protocols and reports from the previous version into the current Expedite database. For detailed information, see Section 4.2.1, Importing.

Deleting the oldversion of

software

After exporting sequences and protocols from the old version of software, delete the directory that contains the old version.

WARNING

Do not keep more than one version of Expedite Workstation software installed on your computer. Keeping more than one installed version of the software will cause communication errors.


2Preparing the System 2
2.1 Overview ................................................... 2-2

2.2 Starting the Instrument .............................. 2-3

2.3 Starting the Software ................................. 2-6

2.4 Specifying the Operating Environment ..... 2-13

2.5 Checking Instrument Setup...................... 2-20


Chapter 2 Preparing the System

2

2.1 Overview

This chapter describes how to prepare the system and the steps you perform to run a synthesis.

These procedures are used for the initial set up of the system. You do not need to perform them every time you run a synthesis.

Steps inpreparing the

system

To prepare the Expedite 8900 Nucleic Acid Synthesis System to run a synthesis:

On the instrument:

1. Insert the boot diskette in the instrument disk drive and turn on the Expedite instrument. See “Powering up the instrument” on page 2-3.

2. Specify the instrument address. See “Setting the instrument address” on page 2-4.

3. Specify the chemistry to use. See “Specifying the chemistry” on page 2-5.

On the Expedite Workstation:

1. Start the Expedite Workstation software. See Section 2.3, Starting the Software.

2. Set up communications between the instrument and the computer. See Section 2.3.2, Configuring Instruments.

3. Specify the operating environment. See Section 2.4, Specifying the Operating Environment.


Starting the Instrument

2

2.2 Starting the Instrument

Before you start the Expedite Workstation software, perform the following tasks on the instrument:

• Power up the Expedite instrument• Set the instrument address• Specify the chemistry

Powering up theinstrument

To power up the instrument:

1. Make sure that there is a bottle firmly attached to each reservoir position in the instrument.

The bottles should be “finger tight.” Do not overtighten the bottles because this deforms the sealing O-rings and may cause gas leakage.

2. Insert the boot diskette in the instrument disk drive.

CAUTION

The boot diskette contains instrument operating instructions and the current operational parameters. Do not insert or remove the diskette while the instrument is operating.

To remove the diskette without damage to either the diskette or diskette drive, click the Stop button in the instrument window and wait 15 seconds. Power down the instrument and remove the diskette.

3. Power up the instrument by pressing the on/off switch at the left rear of the unit.

For more information, see the Expedite Nucleic Acid Synthesis System User’s Guide, Section 2.2, Powering Up the System.



2

Setting theinstrument

address

Each instrument connected to the Expedite Workstation must have a unique numeric address.

NOTE: Instruments that are not connected to the Expedite Workstation are automatically set to an address of 0 and Autonomous access mode. See Section 2.4.1, Setting the Control Mode, for more information.

To specify the instrument address:

1. In the Main menu (Figure 2-1) select Tools.

Figure 2-1 Instrument Main Menu

2. In the Tools menu, select Config.

The Tools:Config screen (Figure 2-2) is displayed.

Figure 2-2 Tools Configuration Menu


Starting the Instrument

2

3. Select Host. The Tools:Config:Host screen (Figure 2-3) is displayed.

Figure 2-3 Tools:Config:Host Screen

NOTE: Specify the access (control) mode from the Expedite Workstation. See 2.4.1, Setting the Control Mode.

4. Press the address key to set the instrument address(1 to 32).

5. Press Exit until the Main menu is displayed.

Specifying thechemistry

The default chemistry used on the Expedite Nucleic Acid Synthesis System is the β-cyanoethyl phosphoramidite DNA method. The standard User Profile specifies this chemistry.

You can change the type of chemistry that the system performs in two ways:

• Change the chemistry in the User Profile. See the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 3.6.7, Changing the Chemistry, to modify the User Profile.

• Change the case of the base designators in the sequence:

Chemistry Uppercase Lowercase

DNA DNA Thio

Thio Thio DNA

RNA RNA DNA



2

2.3 Starting the Software

NOTE: Power up the instrument before starting the Expedite Workstation software. See Section 2.2, Starting the Instrument.


• Starting the workstation software• Configuring instruments• Specifying instrument addresses

2.3.1 Starting the Workstation Software

Windows 3.1 1. Type WIN at the C:\ prompt to display the Program Manager window (Figure 2-4).

Figure 2-4 Program Manager Window

2. Double-click the Workstation icon.

Double-click here


Starting the Software

2

Windows 95 1. Type WIN at the C:\ prompt.

The Windows 95 screen appears.

2. Click Start, point to Programs, point to Expedite Workstation, and then click Expedite Workstation.

NOTE: If you selected a program folder other than Expedite Workstation during installation, the workstation software appears on the Start menu in the program folder you selected. To start the workstation software, click Start, point to the program folder you selected during installation, and then click Expedite Workstation.

NOTE: You can create a shortcut on the desktop for the Expedite Workstation software. See the Introducing Microsoft Windows 95 manual for instructions.

Both versions The software is initialized and the system looks for configured instruments. When communication is established with an instrument, the Instrument window (Figure 2-5) is displayed.

Figure 2-5 Instrument Window

NOTE: If no instruments are configured to communicate with the Expedite Workstation, a message is displayed. See Section 2.3.2, Configuring Instruments, for information.



2

Expedite CommServer

When you start the Expedite software, an Expedite Comm Server icon appears in the lower left corner of the Windows desktop.

The Expedite Comm Server is a software program that runs in the background and communicates between the instrument and the Expedite Workstation.

Do not close the Expedite Comm Server software. If you do, communication between the instrument and the Expedite Workstation is disrupted.

2.3.2 Configuring Instruments

To allow communication between the Expedite Workstation and Expedite instruments, configure the instruments in the Expedite Workstation software.


• Adding instruments• Changing instrument names and addresses• Removing instruments

Addinginstruments

To add instruments:

1. From the Edit menu in the Instrument window, select Instrument Selector.

The Edit Instrument Selector dialog box (Figure 2-6) is displayed.

Figure 2-6 Edit Instrument Selector Dialog Box



2

2. Click Add. The Add Instrument dialog box is displayed.

3. Enter a unique name of up to 10 characters in the Name text box.

4. Enter the instrument address you specified in “Setting the instrument address” on page 2-4.

5. To display instrument names instead of numbers in the Instrument Selector (used to switch between instruments when monitoring a synthesis), select Show Names.

6. Click OK.

Changinginstrument names

and addresses

To change instrument names and addresses:


2. Select the instrument to change.

3. Click Change.

4. Change the name or address as needed.

5. Click OK.

Removing aninstrument

To remove an instrument from the Expedite Workstation configuration:


2. Select the instrument to remove.

NOTE: You cannot remove an active instrument. Power down the instrument or disconnect the communications cable before you remove it from the list of configured instruments.

3. Click Remove.

4. Click OK.



2

2.3.3 Communication Between Workstation and Instrument

Communicationbetween

workstation andinstrument

When an instrument is actively communicating with the Expedite Workstation, an asterisk (*) is displayed beside the address number in the upper left corner of the instrument display (Figure 2-7).

Figure 2-7 Instrument Display Showing Communication

NOTE: If communication between the Expedite Workstation and the instrument is disrupted for more than 60 seconds, the instrument is automatically put into Autonomous access mode, and no asterisk is displayed next to the address.

The Expedite Comm Server polls each active instrument and updates synthesis information (from Expedite Workstation to instrument and from instrument to Expedite Workstation) every two seconds.

In addition, run log information is uploaded from configured instruments to the Expedite Workstation when you:

• Start the Expedite Workstation software

• Display the Operator Notes window, create a new operator note, or change the column selected in the Operator Notes window

• Display the Report viewer

Asterisk (*)indicates activecommunicationwithworkstation



2

If communicationis disrupted

(timeout occurs)

If communication is disrupted for more than 30 seconds, a Timeout dialog box (Figure 2-8) is displayed.

Figure 2-8 Timeout Dialog Box

Timeouts can be caused by the following:

• Instrument is powered off

• Instrument address does not match Expedite Workstation address

• Cable between the Expedite Workstation and an instrument, or the cables between instruments, are disconnected or faulty

• Boot diskette is removed from the instrument or is damaged

Retrycommunications

If a timeout occurs:

1. Click Try Again.

2. If communication is not established, click Disable.

3. Check the system to determine the cause of the problem and correct the problem.

4. Select Retry communications from the Edit menu.

NOTE: If a power outage has caused the timeout, the instrument address may be reset to 0. You may need to reset the instrument address to match the address assigned on the Expedite Workstation before you can establish communication. See “Setting the instrument address” on page 2-4.



2

The system initializes the configured instruments and establishes communication. During the process the dialog box shown in Figure 2-9 displays the name and address of each configured instrument.

Figure 2-9 Initializing Instruments Message


Specifying the Operating Environment

2

2.4 Specifying the Operating Environment

The Expedite Workstation and instrument software allows you to specify:

• Control mode• Operator Name and folder• Alarms

2.4.1 Setting the Control Mode

Remote and Localmode

Control Mode determines how the Expedite Workstation communicates with instruments connected to the Expedite Workstation:

• Remote mode—Instrument is controlled primarily from the Expedite Workstation. You cannot perform certain activities, such as sequence editing, from the instrument. Remote mode is useful when the Expedite Workstation and the instrument are not near each other.

You must start the instrument from the instrument keypad.

• Local mode—Less restrictive than Remote, allows you to control the instrument from the instrument or the Expedite Workstation, including editing sequences and starting the instrument.

Changing theControl mode

To change the control mode:

1. In the Instrument window, select Change control mode from the Customize menu.

The Change Control Mode dialog box (Figure 2-10) is displayed.



2

Figure 2-10 Change Control Mode Dialog Box

The currently selected mode is noted.

2. Click the desired mode.

3. Click OK.

4. Select Exit from the File menu and restart the Expedite Workstation software to activate the new control mode.

NOTE: Closing the Instrument window does not disrupt operation of connected instruments.



2

Active communication between the Expedite Workstation and the instrument is reflected in two screens that appear on the instrument display:

• An asterisk (*) is displayed beside the address number in the upper left corner of the Main display(Figure 2-7).

Figure 2-11 Instrument Display Showing Communication

• The control mode is displayed in the Host Parameters screen. This screen is found in the Tools: Configuration menu (Figure 2-12).

Figure 2-12 Set Host Parameters Screen

NOTE: If communication between the Expedite Workstation and the instrument is disrupted for more than 60 seconds, the instrument is automatically put into Autonomous access mode, and no asterisk is displayed next to the address.

Asterisk (*)indicates activecommunicationwithworkstation



2

2.4.2 Specifying the Operator Name and Folder

Operator Name is:

• Associated with reports, sequences, and protocols generated and edited on the Expedite Workstation

• Displayed on the information line in the Instrument window

To set the operator name:

1. In the Instrument window, select Operator ID from the File menu.

The Operator ID dialog box (Figure 2-13) is displayed.

Figure 2-13 Operator ID Dialog Box

2. Type (up to 30 characters) or select a name in the Operator Name text box. The ten most recently entered names are retained in the drop-down list.

When you select a name, the default folder associated with the operator is displayed.

All data generated by the operator is stored in the folder you specify.

3. Select a folder if needed.

To create a new folder see Section 4.4, Managing Folders.

4. Click OK.



2

2.4.3 Setting Alarms

For a description of how the system monitors gas leaks, see the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 4.2, Gas Leak Diagnostics.

Configuring thealarms

You set alarms on the Expedite Workstation to notify you if gas leak test, trityl yield, electronics, or power failures occur.

From the Setup menu, select Alarms. The Setup Alarms dialog (Figure 2-14) is displayed.

Figure 2-14 Setup Alarms Dialog Box

Select the alarms and click OK.

Alarms are described in Table 2-1, “Expedite Instrument Alarms,” on page 2-19.



2

If failures occur If a test for which you set an alarm fails, an Exception message is displayed (Figure 2-15), and the synthesis is put on hold.

Figure 2-15 Exception Message

If an exception is displayed:

• Investigate and correct the problem as soon as possible• Click Acknowledge

NOTE: If more than one instrument displays an exception, the alarm dialog boxes may be displayed on top of each other.

When you click Acknowledge, the synthesis is restarted. If the conditions that caused the alarm have not been corrected, the Exception dialog box reappears in about 15 seconds and the synthesis is again put on hold.

NOTE: If the end of the cycle is reached before you acknowledge the alarm, you must press Start to resume the synthesis.



2

Alarmdescriptions

Table 2-1 describes alarms, their functions, and the actions to take if an alarm condition occurs.

Table 2-1 Expedite Instrument Alarms

Alarm Function Solution

High pressure system failure

Pressure has been below 10 psi for 5 seconds.

• Gas tank may be empty.

• Check tank regulator gauge and set to 20 psi. Replace tank if necessary.

• Check gas inlet line for leaks.

Low pressuresystem failure

Pressure has been below 4 psi for 5 seconds.

• Missing reagent reservoir.

• Loose cap.

• Defective O-ring.

• Check the reagent reservoirs. Replace the O-rings if necessary.

• 8909 only—Check the external reagent tray bottles.

Valve driver fault Electronic driver circuits failed.

Call Applied Biosystems Technical Support.

Trityl total yield failure: column 1

Yield from a synthesis below an acceptable level.

Abort the synthesis or continue.

Trityl total yield failure: column 2

Gas saver low pressure leak failure

Low pressure below 4 psi when the instrument has been idle for less than 60 seconds.

• Missing reagent reservoir, loose cap, or defective O-ring.

• Check the reagent reservoirs. Replace the O-rings if necessary.



2
2.5 Checking Instrument Setup
From the Setup menu, select View Instrument Setup to:

• Display the Chemistry Type selected—RNA, DNA, THIO or USER, or PNA

• Display the Universal support option setting.

When you select View Instrument Setup from the Setup menu, the Instrument Setup dialog box is displayed (Figure 2-16).

Figure 2-16 Instrument Setup Dialog Box

NOTE: The default profile sets the Chemistry type to DNA and disables the Universal support option.

Startup low pressure leak failure

The startup gas leak test failed.

• Check gas supply.

• Check reagent reservoirs.

UPS power protection

Power failure. Check main power. A power failure may have occurred.

Table 2-1 Expedite Instrument Alarms (Continued)

Alarm Function Solution


3Performing a Synthesis 3
3.1 Overview of a Synthesis ......................... 3-2

3.2 Creating or Editing the Sequence ........... 3-3

3.3 Preparing and Loading the Reagents...... 3-5

3.4 Starting the Synthesis........................... 3-12

3.5 Monitoring the Synthesis ...................... 3-23

3.6 Adding Operator Notes to the Run Log ...................................... 3-32

3.7 Stopping a Synthesis ............................ 3-36


Chapter 3 Performing a Synthesis

3

3.1 Overview of a Synthesis

This chapter describes the step-by-step procedure for performing a synthesis on the Expedite Nucleic Acid Synthesis System using the Expedite Workstation. This tutorial supplements the Expedite 8900 Nucleic Acid Synthesis System User‘s Guide, Chapter 2, Performing a Synthesis, which describes setting up a synthesis on the instrument.

For instrument-related procedures, see the Expedite 8900 Nucleic Acid Synthesis System User’s Guide.

Key steps in asynthesis

The keys steps to perform a synthesis are:

1. Create or edit the sequence. See Section 3.2, Creating or Editing the Sequence.

2. Install the reagents. See Section 3.3.1, Installing the Reagents.

3. Prime the fluidic system. See Section 3.3.2, Priming the System.

4. Specify the synthesis parameters. See Section 3.4.1, Specifying the Synthesis Parameters.

5. Install the reaction columns. See Section 3.4.4, Installing the Columns.

6. Start the synthesis. See Section 3.4.5, Starting the Instrument.

7. Monitor the synthesis. See Section 3.5, Monitoring the Synthesis.

8. Cleave the product from the reactor support. See the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 2.7, Post-synthesis Procedures.

9. Perform post-synthesis base deprotection of the product. See the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 2.7, Post-synthesis Procedures.

10. Optionally, analyze and purify the product.


Creating or Editing the Sequence

3

3.2 Creating or Editing the Sequence

In the Instrument Window:

1. From the Edit menu, select Run Sequence Editor.

The empty Sequence Editor is displayed (Figure 3-1).

Figure 3-1 Sequence Editor

2. Select New or Open from the Sequence menu.

NOTE: The four most recently accessed sequences appear at the bottom of the Sequence menu. Click on the desired sequence to open it.

3. Enter sequences by typing in the one-letter code for each base.



3

NOTE: Sequence entry is case-sensitive:DNA protocol: uppercase=DNA, lowercase=ThioThio protocol: uppercase=Thio, lowercase=DNARNA protocol: uppercase=RNA, lowercase=DNA

See Chapter 6, Using the Sequence Editor, for more information.


Preparing and Loading the Reagents

3

3.3 Preparing and Loading the Reagents


• Installing the reagents• Priming

WARNING

Most of the reagents and solvents used in nucleic acid synthesis are hazardous. Wear a lab coat, gloves, and eye protection when handling reagents. Adequate ventilation is essential and working under a fume hood is recommended.

The reagents used in nucleic acid synthesis are extremely hygroscopic. As it is essential that the reagents remain anhydrous, work quickly to minimize the exposure to air. Monomer bottles are usually stored in a freezer (-20oC). At least two hours before you will open the bottles, take the bottles out of the freezer and leave them at room temperature. By leaving the bottles at room temperature for at least two yours, you minimize any moisture contamination that may occur when the bottles are opened for filling with diluent.

CAUTION

When you change the chemistry type, rinse out the fluidics module with acetonitrile. See the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 3.5.7, Shutdown.



3

3.3.1 Installing the Reagents

The procedures for preparing and installing the reagents are described in the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 2.4.2, Installing the Reagents.

WARNING

Use only the plastic-coated glass bottles provided in the start-up kit in the external solvent tray. Uncoated glass bottles may explode under pressure.

Installing Use the Bottle Change Tool (on the Expedite instrument keypad select Tools:Bottle). Install one reagent at a time in the following order:

1. Wash A (WSH A—Model 8909 only)

2. Deblock (DBLK)

3. Oxidizer (OX)

4. Capping reagents (CAP A, CAP B)

5. Wash reagent (WSH)

6. Activator (ACT)

7. Amidites

Resettingvolumes

This section describes how to reset bottle volumes.

NOTE: The instrument cannot detect the volume of fluid in reagent bottles. The instrument tracks reagent consumption based on the volumes you enter when you reset bottle volumes. Bottle volume information is reliable only if you update the bottle information whenever you change the reservoirs.



3

To reset bottle volumes using the Expedite Workstation software:

1. Select Reagents from the Setup menu in the Instrument window.

The Setup Reagents dialog box (Figure 3-2) is displayed.

Figure 3-2 Setup Reagents Dialog Box

The list displays the volume of reagents required to complete the current synthesis and the estimated current volume in each reagent reservoir. If the required volume of reagent is less than or equal to its current volume, it is flagged with an exclamation point (!).



3

2. Perform the appropriate step:

4. Click OK.

3.3.2 Priming the System

NOTE: Prime using the instrument keypad.

When to prime Prime the fluidics system three times for each column position after installing new reagents or after the instrument has been idle for more than 12 hours.

Priming is described in detail in the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 2.4.3.

NOTE: During the priming procedure, watch the waste line to ensure that every injector is delivering liquid. Remember several prime cycles may occur before fluid begins to exit the end of the waste tube.

To... Do this...

reset all bottles

1. Select the appropriate kit size or select Specify and enter a volume.

2. Click Set All.

reset individual bottles

1. Select a bottle.

2. Select the appropriate kit size or select Specify and enter a volume.

3. Click Set.



3

Calculating primevolumes

The following table gives the volume of every element that connects the reagent to the base of the column. Use this table to calculate prime volumes.

FritTube to

PlatePlate

VolumePlate to Column

Total Volume from Frit to Base of

Column

A 250 70 7 105 432

C 250 70 11 105 436

G 250 70 16 105 441

T 250 70 20 105 445

5 250 70 24 105 449

6 250 70 27 105 452

7 250 70 30 105 455

8 250 70 34 105 459

9 250 70 37 105 462

Act 250 120 43 105 518

Wash 250 120 46 105 521

Dblk 250 1200 6 105 1561

Aux 250 120 9 105 484

Ox 250 120 14 105 489

Cap B 250 120 18 105 493

Cap A 250 120 22 105 497

Wsh A 250 1200 26 105 1581



3

Priming 1. Install unions in place of the reaction columns. See the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 2.4.3, Priming the System.

CAUTION

Do not install the column before you prime the reagent passages. The priming procedure delivers reagents through the column positions in an order which may adversely affect the synthesis (for example, the order of reagent delivery may cap the free sites on the column).

2. In the Main menu, select Prime.

3. In the Prime menu, Select 2 - Prime all.

NOTE: You can press Stop or Cancel on the Expedite instrument keypad to stop priming at any time.

Priming Column 1 4. Select Column 1.

5. Press OK.

Reagent passages are primed sequentially. During the prime, the current action is displayed on the Expedite instrument screen and the message “Prime Enabled” is displayed in the Instrument window in the Expedite Workstation software (Figure 3-3).



3
Figure 3-3 Instrument Window During Priming
6. When the priming routine is complete, press Cycle to prime a second time.

7. When the priming routine is complete, press Cycle to prime a third time.

8. Press cancel to return to the Prime menu.

The Prime menu is displayed.

9. If you are running a synthesis on both columns, select 2 - Prime all.

Priming Column 2 10. Select Column 2 and prime three times.

11. When all the fluidic passages are primed, select cancel. The Prime menu is displayed.

12. Select Exit to return to the Main menu.



3

3.4 Starting the Synthesis

After you enter the sequence, load reagents, and prime, do the following:

• Specify the synthesis parameters• Check the reagent resources• Install the columns• Start the synthesis

Running systemdiagnostics

Periodically before starting a synthesis, run the Diagnostics routines to check the pneumatic and electronic systems for malfunctions.

NOTE: Run diagnostic routines using the instrument keypad.

See the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 3.6.1, Diagnostic Routines.

3.4.1 Specifying the Synthesis Parameters


• Specifying parameters• Transferring the synthesis• Before you start the synthesis

Specifyingparameters

From the Instrument window:

1. From the Run menu, select Synthesis.

NOTE: Run and Setup menus are only available when the Expedite Workstation is communicating with an instrument and the Instrument Window is active. The commands on the Run and Setup menus apply to the selected instrument.


Starting the Synthesis

3

NOTE: Universal support products are not currently available.

The Run Synthesis dialog box (see Figure 3-4) is displayed.

Figure 3-4 Run Synthesis Dialog Box

Columns 2. Select a column. The position selected is displayed at the top of the dialog box (Figure 3-4).

You can click Clear Item or Clear All to remove current settings.

Sequences 3. Select a Sequence from the Sequence drop-down list.

You can synthesize the same sequence on both columns or a different sequence on each column.

Selectedcolumn



3

Click Edit Sequence to edit the selected sequence if needed. For more information, see Chapter 6, Using the Sequence Editor.

NOTE: If you click Edit Sequence when a foreign sequence is selected, the Windows Notepad Editor opens instead of the Sequence Editor.

Protocols 4. Select a Protocol from the Protocol drop-down list.

Only protocols for the selected chemistry type (DNA, RNA, Thioate, User, or PNA) are listed. To change Chemistry type, see “Specifying the chemistry” on page 2-5.

Hint: You can click Set Protocol for All to set all columns to the selected protocol.

You can apply the same protocol (scale) to both columns or a different protocol to each column.

DMT 5. To specify removal of the 5' DMT, click the DMT Off button.

If you select DMT On, the 5' DMT is retained. You can remove the DMT manually after the synthesis is complete. For information, see the Expedite 8900 Nucleic Acid Synthesis System User’s Guide, Section 3.5.5, Final Deblock.

Hint: You can click Set DMT for All to set all columns to the selected DMT status.

NOTE: The observed intensity of the orange-colored solution released by the final deprotection is a qualitative indication of the success of a synthesis. The degree of intensity does not necessarily reflect the coupling efficiency.



3

6. Select the next column and set sequence, protocol, and DMT as described above.

7. Repeat for all columns.

Printing 8. To print a list of synthesis parameters for all columns, click Print List.

Transferring thesynthesis

When all parameters are set in the Run Synthesis dialog box (Figure 3-4), click OK to transfer the sequences, protocols, and synthesis parameters to the instrument.

NOTE: Click Cancel to close the dialog box without transferring the synthesis to the instrument.

NOTE: To transfer multiple sequences, see Section 3.4.2, Transferring Sequence Sets.

The sequences, protocols, and synthesis parameters are transferred to the instrument. During the transfer, the dialog box shown in Figure 3-5 is displayed.

Figure 3-5 Transferring the Protocols

Before you startthe synthesis

When all information is transferred, the Reminder dialog box shown in Figure 3-6 is displayed.



3

Figure 3-6 Reminder Dialog Box

NOTE: The reminder to prime is only displayed if the instrument has been idle for more than 12 hours, or if this is the first synthesis run since powerup or since reagents have been changed or replenished.

1. Click OK.

The Instrument Window is displayed (Figure 3-7) with the selected sequence, protocol, and synthesis information.



3
Figure 3-7 Instrument Window Ready for Synthesis
2. Perform the following steps if needed before you start the synthesis:

• Check the reagent resources and waste containers. See Section 3.4.3, Checking Reagent Resources.

• Prime the system. See Section 3.3.2, Priming the System.

• Install columns that match the 3' end of the sequences.

CAUTION




3

3.4.2 Transferring Sequence Sets

If you are running a single sequence, skip this section and proceed to Section 3.4.3, Checking Reagent Resources.

Sequence sets A sequence set is a group of up to 63 foreign or Expedite sequences. Sequence sets are useful when:

• You need to synthesize a large number of sequences on multiple instruments, and

• You need to share the workstation with someone else

Overview ofsequence sets

You follow these steps to use sequence sets:

As soon as you transfer a sequence set to the instrument, the sequence set disappears from the workstation window. You cannot store or reuse a sequence set.

1. Create the sequence sets at the workstation and transfer them to the instruments. See “Creating and transferring sequence sets” on page 3-19.

2. At the instrument, enter any necessary data. Start the synthesis. See Section 3.4, Starting the Synthesis.



3

Creating andtransferring

sequence sets

Transfer sequence sets when no sequences are running on the instrument.

To create and transfer a sequence set:

1. From the Setup menu, select Sequence Set.

The Setup Sequence Set dialog box (Figure 3-8) is displayed.

Figure 3-8 Setup Sequence Set Dialog Box

2. To select Expedite sequences for the sequence set, click Database. Select the sequences and click OK.

The selected sequences are displayed in the Sequences list in the Setup Sequence dialog box.

3. To select foreign sequences for the sequence set, click Foreign. Select the sequences and click OK.

The selected sequences are added to the Sequences list in the Setup Sequence dialog box.

4. Select the desired starting position (column number) on the instrument by clicking on the up or down arrow in the dialog box, next to the Start set at sequence position.

5. Click OK to send the sequence set to the instrument.



3

3.4.3 Checking Reagent Resources

NOTE: The Expedite 8900 software slightly overestimates the amount of reagent used during a synthesis. Therefore, after a synthesis, there is often more reagent left in the bottles than the software calculation indicates.

To check the reagent resources:

1. Select Reagents from the Setup menu in the Instrument window.

The Setup Reagents dialog box (Figure 3-9) is displayed.

Figure 3-9 Setup Reagents Dialog Box

Insufficientvolumes

If the required volume of any reagent is less than or equal to the current volume, the reagent is flagged with an exclamation point (!).

Filling reservoirs If any reservoirs require filling, see Section 3.3.1, Installing the Reagents, for information on installing and resetting.



3

NOTE: Always reset bottle volumes after filling reservoirs. The instrument cannot detect the volume of fluid in reagent bottles. The instrument tracks reagent consumption based on the volumes you enter when you reset bottle volumes. Bottle volume information is reliable only if you update the bottle information whenever you change the reservoirs.

3.4.4 Installing the Columns

After filling reagents and priming, install the columns.

CAUTION




3

3.4.5 Starting the Instrument

NOTE: You can start two syntheses at the same time or at different times in the Run Synthesis dialog box.

To start the synthesis:

The synthesis begins and the Instrument window is updated with information for the current synthesis.

If Control Mode is...

Start the synthesis by...

Local Clicking Start in the Instrument window

or

Selecting Start from the Run menu in the Instrument window

or

Pressing Start on the Expedite instrument keypad

Remote Pressing Start on the Expedite instrument keypad


Monitoring the Synthesis

3

3.5 Monitoring the Synthesis

You can monitor syntheses in:

• Instrument window—Displays status on one instrument at a time. You can switch between instruments using the Instrument Selector.

• Trityl viewer—Displays trityl histograms for the current instrument.

• Status window—Displays information for all active instruments.

3.5.1 Instrument Window

Instrumentwindow

After you start a synthesis, the Instrument Window (Figure 3-10) displays the status for one instrument at a time. You can select any instrument to see its status.



3
Figure 3-10 Instrument Window
The Instrument window displays:

• Current cycle with a green bar and completed cycles in grey

• Column and instrument status, described in “Instrument status” on page 3-25 and “Column status” on page 3-26

• Sequence shown in the 3'-5' direction, the direction in which the synthesis occurs

• Sequence and protocol name

• Current subcycle and step in the protocol

• Time required to complete the synthesis

Current instrument

Sequence

Synthesis information

Column status

Current cycle

Completed cycle(dimmed)

(green bar)

Synthesisstatus



3

Sequence You may see the following symbols in the sequence display:

Instrument status Instrument status labels you may see include:

Symbol Description

$ 5' DMT is to be removed

5' DMT is retained

Pending hold

See Section 3.7.1, Holding a Synthesis

Status Description

Idle No synthesis in progress

Running Synthesis in progress on at least one column

Halted Synthesis stopped at a point potentially unsafe for one or both syntheses

Prime Priming

Diagnostic Running diagnostics



3

Column status Column statuses you may see include:

Information line The information line displays the following:

• Current date and time of day• Operator name

In addition, a “Waiting” message may appear during a lengthy communications transaction or while waiting after user input.

NOTE: Always check the information line before clicking the mouse cursor on the screen. If “Waiting” is displayed, do not click the mouse. Clicking may slow down system operation.

Status Description

Idle No sequence selected for the column.

NOTE: Column state is Idle if a synthesis is aborted

Ready Sequence selected but not started

Running Synthesis in progress

Hold-pending

Synthesis in progress but a future hold position is set

Holding Synthesis suspended at the end of a cycle, waiting to be restarted

Waiting Synthesis in progress but column is waiting for fluidic train currently in use by the other column

Halted Synthesis stopped at a potentially unstable point in the cycle

Done Synthesis run to completion



3

Switching to adifferent

instrument

To switch between instruments:

1. From the Customize menu in the Instrument window, select Show Instrument Selector.

The Instrument selector is displayed (Figure 3-11).

Figure 3-11 Instrument Selector

Instrument names or numbers are displayed. See “Adding instruments” on page 2-8 for information on changing.

If no Instrument window is displayed, click a button in the selector to open the Instrument window.

If an instrument is not responding to communications, the selector button is dimmed.



3

Esti

3.5.2 Trityl Viewer

The Trityl Viewer allows you to display and print trityl data.

To display the trityl data for the current synthesis, do one of the following:

• Select Trityl Viewer from the Run menu• Click Trityl in the Instrument window

The Trityl Viewer window (Figure 3-12) is displayed.

Figure 3-12 Trityl Viewer

NOTE: To display trityl data for a completed synthesis, see Section 5.4, Displaying Trityl Data.

mated scale

Response

Sequence



3

Trityl display The Trityl window includes:

• A histogram bar for each cycle in the synthesis.

• Response value for the highest bar (excluding the first bar) that is a qualitative indication of coupling efficiency.

NOTE: Do not rely on histogram intensity for quantitative information.

• Theoretical scale value based on the response. If the theoretical scale is lower than the scale of the protocol you ran, it may indicate a problem with the synthesis.

NOTE: If “Low” or “0.2” is displayed for scale, or if the scale is much lower than the scale you are running, it may indicate a problem with the synthesis.

Autoscaling Data is automatically sized to the highest bar. You can rescale by double-clicking on any bar to autoscale all other bars to the selected bar. Bars that are higher than the selected bar are empty (indicating they are offscale).

Printing To print trityl data (Figure 3-13), select Print from the File menu.



3
Figure 3-13 Trityl Data Printout
3.5.3 Status Window

Use the Status window to monitor all active instruments.

To display the Status window (Figure 3-14), select Show status window from the Customize menu.

Figure 3-14 Status Window



3

Instrument and column numbers are displayed at the left side of the screen. Remaining information displayed is determined by the items selected in the Customize Status Window dialog box.

NOTE: The Run and Setup menus, which are instrument specific, are not available when the Status Window is activated.

To customize the display in the Status window, select Customize Status Window from the Customize menu.



3

3.6 Adding Operator Notes to the Run Log

During a synthesis, you can add comments to the run log for the synthesis by using the Operator Notes window.

NOTE: You cannot add operator notes to a run log after a synthesis has completed. Use Reports to view the log of a completed run or to add comments to the completed report. See Chapter 5, Viewing and Printing Reports.

Adding anOperator Note

1. Display the Operator Notes window (Figure 3-15) for the active Instrument window by doing one of the following:

• From the Run menu, select Operator Notes

• Click Notes

Figure 3-15 Operator Notes Window

2. Click the column number.

Run log

Type text here

for selectedcolumn


Adding Operator Notes to the Run Log

3

3. Type or paste text (up to 250 characters) into the bottom pane of the window.

NOTE: Do not paste more than 250 characters from the Windows Clipboard. Pasting longer text strings can cause the software to crash.

4. Click Save.

The Save Note dialog box (Figure 3-16) is displayed.

Figure 3-16 Save Note Dialog Box

5. Click the columns for which to save the note.

If a synthesis is not running on a column, the check box is dimmed.

Printing the runlog

To print the Run Log before creating a Report:

Select Print log from the File menu in the Operator Notes window.

Setting thedefault report

name

To set a default name for reports:

1. From the Options menu, select Set default name.

The Default Report Name Options dialog box (Figure 3-17) is displayed.



3

Figure 3-17 Default Report Name Options

2. Select a default name based on:

NOTE: The instrument name is not displayed if the run is started from the instrument keypad.

Name format Example Name

Date/Time and Instrument

Sequence Name

07/29/97 14:17 Lab 1 (1) 2

Date Start Instrument

Instrumentaddress

nametimeColumnnumber

Date Start Sequence

Instrumentaddress

name timeColumnnumber

Seq1 07/29/97 14:17 (14) 1


Adding Operator Notes to the Run Log

3

NOTE: You can rename reports manually before a run is complete using the Rename Run command in the Operator Notes window, or after a run is complete, using the Rename command in the Report Viewer. See Section 5.6, Renaming a Run.

3. Click OK.



3

3.7 Stopping a Synthesis


• Holding• Stopping• Aborting

3.7.1 Holding a Synthesis

If you need to pause a synthesis, use the Hold option. Hold interrupts a synthesis at the completion of a cycle. Chemically, this is the safest point to interrupt the synthesis because the column is washed with acetonitrile before the instrument halts. In addition, the support is in the capped state with the 5' DMT attached.

You can set a hold point in two ways:

• Using the menu• Using the mouse

Using the menusto set a hold point

To set a hold point with the menu:

1. Display the Hold Synthesis dialog box (Figure 3-18) by doing one of the following:

• Click the Hold at button at the bottom of the window display.

• In the Run menu, select Hold synthesis.


Stopping a Synthesis

3

Figure 3-18 Hold Synthesis Dialog Box

2. Select a column.

3. Click the appropriate button:

4. Click Close.

Click... To...

Hold now Hold at the end of the current cycle.

The instrument halts the synthesis on the selected column at the end of the current cycle (usually within 5 minutes). The synthesis remains halted until you restart the instrument.

Hold at Set a hold point at a cycle number. The synthesis stops before the cycle number you enter.

Clear Remove any hold from the selected column.



3

Using the mouseto set a hold point

To set a hold point using the mouse:

1. Double-click on the space between the bases where you want to set the hold. A red hand is displayed (Figure 3-19).

Figure 3-19 Setting a Hold Using the Mouse

2. To move a hold point, click-drag the red hand to a new location.

3. To clear a hold point, double-click the red hand, then click-drag the red hand off the screen.

Double-clickbetween bases

to set hold


Stopping a Synthesis

3

3.7.2 Stopping a Synthesis

To stop a synthesis immediately, click Stop in the Instrument window.

CAUTION

Stopping a synthesis for extended periods in the middle of a cycle may be detrimental to the synthesis. If you use the Stop button, restart the synthesis as soon as possible. Use the Hold option to pause the synthesis at a safe stopping point.

When you click Stop, all fluid delivery operations are immediately halted and remain halted until you start the Expedite instrument again. See “Restarting the instrument” on page 3-39.

Restarting theinstrument

To restart the instrument after a synthesis has been interrupted:

If Control Mode is...

Restart the synthesis by...

Local Click Start in the Instrument window

or

Select Start from the Run menu in the Instrument window

or

Press Start on the Expedite instrument keypad

Remote Press Start on the Expedite instrument keypad



3

3.7.3 Aborting a Synthesis

Use the Abort command to terminate a synthesis after the instrument has been halted.

To abort a synthesis:

1. Click Hold to pause all operations on both columns at the end of the current cycle.

2. When the synthesis has reached the hold point, click Stop to halt the instrument.

3. From the Run menu, select Abort synthesis.

The Abort Synthesis dialog box (Figure 3-20) is displayed.

Figure 3-20 Abort Synthesis Dialog Box

4. Select the column on which to abort the synthesis.

5. Click OK.


4Using the ExpediteDatabase 4


4.1 Overview of the Database ......................... 4-2

4.2 Importing and Exporting ............................ 4-3

4.3 Managing Data in the Database .............. 4-12

4.4 Managing Folders ................................... 4-14

4.5 Deleting and Moving Files ....................... 4-17

4.6 Filtering and Sortingthe Data Displayed .................................. 4-19

4.7 Creating a List-by Filter ........................... 4-20


Chapter 4 Using the Expedite Database

4

4.1 Overview of the Database

The Expedite workstation database stores sequences, protocols, and reports.

The Expedite database allows you to filter, sort, and search for items in the database using summary information that you enter for the items.

Accessing itemsin the database

You can access sequences, protocols, and reports only through the database. You cannot see these items as files listed in the Windows Program Manager or Windows Explorer.

Importing andexporting

To add items to the database, such as sequences generated on another Expedite workstation, you must import the items.

To remove items from the database for use on another system, you must export. To insert items from another version of software or from another system into the database, you must import.

Controlling thenumber of

database files

When more than 400 files accumulate in the database, you must either delete or export enough files to bring the total number of database files below 400.


Importing and Exporting

4

4.2 Importing and Exporting


• Importing• Exporting

4.2.1 Importing


• When to import• Importing• Saving imported files• Modifying older versions of protocols

When to import Use the Import command on the File menu to:

• Restore information you have exported and archived.• Incorporate information from other workstations.• Incorporate information from older versions of software.

Importing files To import files:

1. Select Import from the File menu.

The Import dialog box (Figure 4-1) is displayed.

Figure 4-1 Import Dialog Box



4

2. In the Drives list box, select the drive to import from.

3. In the Directories list box, select the directory that contains the files to import.

4. In the List Files of Type list box, select the file type:

• seq—sequence

• pro—protocol

• run—report

NOTE: After importing older versions of protocols, you must edit them to make them compatible with version 2.3 software. For instructions, see “Modifying older versions of protocols” on page 4-6.

5. Select the file names to import.

Hint: To select several items in a row, click the first item with the left mouse button, hold down the SHIFT key, and click the last item with the left mouse button. To select separate items, hold the CTRL key while clicking the left mouse button. Click Invert to deselect currently selected items and select the unselected items.

6. Click OK.



4

Saving importedfiles

After selecting the files for importing, the Save Import as Dialog box (Figure 4-2) is displayed.

.

Figure 4-2 Save Import as Dialog Box

To save imported files:

1. In the Folders list, double-click the destination folder name.

2. To keep the current names and import all files, deselect the Prompt for each name check box.

To rename files as they are imported, select the Prompt for each name check box.

3. Click OK.

4. If an imported file name already exists in the database, the Import overwrite dialog box is displayed (Figure 4-6).

NOTE: You cannot save more than one file of a given type (for example, a sequence) with the same name, even if the files are stored in different folders. Names can be stored only one time in the Expedite database.



4

Figure 4-3 Import Overwrite Dialog Box


Modifying olderversions of

protocols

To use older versions of protocols in DMT-On synthesis, you must include a plus cycle in each protocol.

If you do not add the plus cycle, an error message is displayed, indicating the “+” plus cycle is missing.

From the Instrument window:

1. Select Run Protocol Editor from the Edit menu.

2. Open the imported protocol. The first cycle in the protocol appears in the active window.

Click... To...

Yes Replace the existing file with the imported file.

Yes All Save all imported files and overwrite any existing files with the same names.

No Close the dialog box, without saving the item. Any previously imported files are saved.

Cancel Close the dialog box and cancel all operations. No files are saved.



4

3. Open the version 2.3 standard protocol of the same scale as the imported protocol (follow steps 1 and 2 above).

4. Select Select Cycle from the Search menu and select the + Final DMT On cycle from the list.

5. Select all text in the cycle.

6. Select Copy from the Edit menu.

7. Switch to the imported protocol.

8. Select New cycle from the Edit menu to create a new cycle in the imported protocol. Type “+” in the Identifier field.

9. Position the cursor at the beginning of the new cycle and select Paste from the Edit menu to paste the protocol text from the clipboard.

10. Select Save from the Protocol menu to save the edited protocol with the new cycle. Choose an appropriate name and complete the Summary Information dialog for the converted protocol.

4.2.2 Exporting

When to export Use the Export command on the File menu to:

• Remove files to keep the total number of database files below 400. If the database contains more than 400 files, database searches become unacceptably slow.

• Archive files for permanent storage.

• Export files for use on other Workstations.

• Produce protocol files that can be copied to an instrument disk.



4

Exporting items To export:

1. Select Export from the File menu.

The first screen of the Export dialog box (Figure 4-4) is displayed.

Figure 4-4 Export Dialog Box 1

2. Double-click the folder that contains the files to export.

3. In the Export Files of Type list box, select the file type to export.

4. If desired, select a List-by filter to display only selected runs in the Open dialog box.

For more information, see Section 4.6, Filtering and Sorting the Data Displayed.

5. Select the files to export.



4

Hint: To select several items in a row, click the first item with the left mouse button, hold down the SHIFT key, and click the last item with the left mouse button. To select separate items, hold the CTRL key while clicking the left mouse button. To select all but a few items, highlight the ones not intended for selection and press Invert.

6. Click OK.

The second screen of the Export dialog box (Figure 4-5) is displayed.

Figure 4-5 Export Dialog Box 2

A default file name is generated from the item name.



4

7. Name the files for exporting by doing one of the following:

• Type a new name.

• Deselect the Prompt for each file name check box to use default file names and export all files.

NOTE: When exporting files to an instrument disk, name each file as protox.pro, where x is a number from 8 to 16. The standard protocol names are proto1.pro through proto7.pro. Choose a protocol name greater than proto7.pro to avoid overwriting the standard protocols.

8. Click OK.

If an exported file has a name that already exists in the selected destination directory, the Export overwrite dialog box shown in Figure 4-6 is displayed.

Figure 4-6 Export Overwrite Dialog Box



4


Click... To...

Yes Replace the existing file with the imported file.

Yes All Save all imported files and overwrite any existing files with the same names.

No Close the dialog box, without saving the item. Any previously imported files are saved.

Cancel Close the dialog box and cancel all operations. No files are saved.



4

er

r

4.3 Managing Data in the Database

Use the Organize Folders dialog box to manage files. Organize Folders allows you to:

• Create or delete folders• Move, add, and delete information in the database • Organize information in folders• Sort files• Use filters to locate specific information• Display the contents of one or all folders

AccessingOrganize Folders

To access the Organize dialog box (Figure 4-7), select Organize Folders from the File menu in the Sequence Editor, the Protocol Editor, or the Report Viewer.

Figure 4-7 Organize Dialog Box

Display list

Current fold

List-by

Folder List

Number of

Total numbe

displayed

name

items

filter

of items in database


Managing Data in the Database

4

The display list contains the items in the selected folder. If you specify a List-By filter, only the items that match the List-By criteria are displayed.

The number of selected items in the selected folder (for example, 1 of 5) is displayed the bottom left of the display list. The total number of items in the database is displayed at the bottom right of the display list.

For more information, see:

• Section 4.4, Managing Folders• Section 4.5, Deleting and Moving Files• Section 4.6, Filtering and Sorting the Data Displayed



4

4.4 Managing Folders


• Folders• Combined and Miscellaneous folders• Opening a folder• Creating a new folder• Deleting a folder and keeping the contents• Deleting a folder and its contents

Folders Folders allow you to organize sequences, report results, and protocols in the expedite database.

Folders:

• Must have unique names • Can contain any combination of items• Cannot contain other folders

You cannot save an item with the same name in more than one folder. Uniquely named sequences, report results, or protocols can only be saved once in the Expedite database.

Combined andMiscellaneous

folders

Combined and Miscellaneous folders are default folders supplied with the software.

All items in the database are listed in the Combined folder. If you do not specify a folder for a synthesis, items are placed in the Miscellaneous folder.

You cannot delete the Combined or Miscellaneous folders.

Opening a folder To open a folder, double-click on the folder name or select the folder name and click OK.


Managing Folders

4

Creating a newfolder

To create a new folder:

1. Select Organize Folders from the File menu in the Sequence Editor, the Protocol Editor, or the Report Viewer.

2. Click New.

The New Folder dialog box (Figure 4-8) is displayed.

Figure 4-8 New Folder Dialog Box

3. Enter a name (up to 30 characters) for the new folder.

4. Click OK.

Deleting a folderand keeping its

contents

To delete a folder but keep its contents:

1. Select the folder.

2. Click the Delete button at the bottom of the folders list.

The message shown in Figure 4-9 is displayed.

Figure 4-9 Delete Folder Message

3. Click Yes to delete the folder and move the contents to the Miscellaneous folder.



4

Deleting a folderand its contents

To delete an existing folder and its contents:

1. Open the folder.

2. Click Reset.

3. Click Invert.

4. Click the Delete button at the top of the display list.

5. Click the Delete button at the bottom of the folder list.

6. Click OK.


Deleting and Moving Files

4

4.5 Deleting and Moving Files

Deleting files When you delete items, they are permanently removed from the database. You may need to periodically delete files to keep the total number of database files below 400. If the database contains more than 400 files, database searches become unacceptably slow.

You cannot delete standard protocols supplied with the Expedite Workstation from the Expedite database.

To delete items from the database:

1. Select Organize Folders from the File menu in the Sequence Editor, the Protocol Editor, or the Report Viewer.

2. Double-click on the folder name containing the items to delete.

3. Select the items to delete.

Hint: To select several items in a row, click the first item with the left mouse button, hold down the SHIFT key, and click the last item with the left mouse button. To highlight separate items, hold the CTRL key while clicking the left mouse button. To select all but a few items, highlight the ones not intended for selection and press Invert.

4. Click the Delete button above the display list.



4


Moving files To move items to another folder:

1. Open the source folder.

2. Select the items to move.

Hint: To select several items in a row, click the first item with the left mouse button, hold down the SHIFT key, and click the last item with the left mouse button. To highlight separate items, hold the CTRL key while clicking the left mouse button. To select all but a few items, highlight the ones not intended for selection and press Invert.

3. Single-click the destination folder.

4. Click Move to.

5. Click OK.

Click... To...

Yes Delete each item one at a time

Yes All Delete all selected files

No Skip a file

Cancel Close the dialog box and cancel all operations. No files are deleted


Filtering and Sorting the Data Displayed

4

4.6 Filtering and Sorting the Data Displayed

The Organize Folders and Open dialog boxes allow you to filter and sort information by selecting a List By filter.

For example, you can display items:

• Alphabetically by name in ascending or descending order

• Alphabetically by name, grouped by sequence type in ascending or descending order

• By date

List-by filters The software includes default filters. Default filters are displayed at the top of the List-by drop-down list.

You can also create custom filters. User-created filters are added to the list after the default filters. The most recently applied filter is displayed below the default filters.

The List-By list can contain up to fourteen filters.

For more information, see Section 4.7, Creating a List-by Filter.

Applying List-byfilters

To apply a list-by filter, do one of the following:

• Type a new list-by expression in the available area and click OK.

• Select a list-by filter from the drop down list.

• Click Reset to list alphabetically by name.



4

4.7 Creating a List-by Filter


• Creating• Example

Creating 1. Display the Set List Criteria dialog box (Figure 4-10) by clicking Change in the Organize Folders dialog box or the Open Folders dialog box.

Figure 4-10 Set List Criteria Dialog Box

2. If you are creating a new filter, delete the contents of the List by text box.

3. Click the arrow next to the Add Filter list and select one or more filters. See Section 4.7.1, Specifying Filter Criteria, for information.

4. Click the arrow next to the Sort By list and select the parameter to sort by. Click Ascending or Descending. See Section 4.7.2, Specifying Sort Criteria, for information.

5. Click OK.


Creating a List-by Filter

4

Example This example shows you how to create a list by that:

• Selects only reports of DNA sequence runs that are ten bases long or less and that finished on the instrument “Lab1” after 3 pm on April 1,1997.

• Sorts reports alphabetically by name in ascending order.

The completed List-By contains the following:

SeqType=DNA and SeqLength<=10 and Instrument=Lab1 and TimeFinished>04/01/97,15:00 sortby Name

1. Display the Set List Criteria dialog by clicking Change in the Organize Folder dialog box or the Open File dialog box.

2. If a name is displayed in the List By text box, delete it.

Filtering bysequence type

3. Select SeqType from the Add Filter By list. The Filter by SeqType dialog box (Figure 4-11) is displayed.

Figure 4-11 Filter by SeqType Dialog Box

4. Select DNA from the Value list.

5. Click OK.



4

Filtering bysequence length

6. Select SeqLength from the Add Filter By list. The Filter by SeqLength dialog box (Figure 4-12) is displayed.

Figure 4-12 Filter by SeqLength Dialog Box

7. Enter 10 in the Value text box.

NOTE: The conjunction or does not imply exclusivity. If the list-by expression above contains “Type=DNA or SeqLength <=10”, the list will include all sequences that are less than ten bases long (regardless of sequence type) and all DNA sequences (regardless of length). However, if the expression contains “Type=DNA and Length <=10”, then the list will include only DNA sequences that are ten bases long or less.

8. Select <= (is less than or equal to) from the Operator drop down list.

9. Click OK.



4

Filtering byinstrument

10. Select Instrument from the Add Filter By list. The Filter by Instrument dialog box (Figure 4-13) is displayed.

.

Figure 4-13 Filter by Instrument Dialog Box

11. Enter Lab1 in the Value text box.

12. Click OK.

Filtering by dateand time

13. Select TimeFinished from the Add Filter By list. The Filter by TimeFinished dialog box (Figure 4-14) is displayed.

Figure 4-14 Filter by TimeFinished Dialog Box



4

14. Type:

• 04 in the Month text field, 01 in the Day text field, and 97 in the Year text field.

• Type 15 in the Time text field.

15. Click OK.

Sorting 16. Select the Name from the Sort by list.

17. Click Ascending.

18. Click OK.



4

4.7.1 Specifying Filter Criteria

You can filter the data displayed with the following criteria:

• Name• Sequence type• Date created• Date modified• Sequence length• Chemistry type• Sequence• Revision (number of times file has been saved)• Summary information entered, including Author,

Project, Sample, Keywords, Comment. For more information, see “Entering summary information” on page 6-15.

When you select a filter in the Set List Criteria dialog box (Figure 4-10 on page 4-20), a dialog box is displayed in which you set the criteria for the filter. Specify the following:

Parameter Description

Conjunction Select:

And—This filter and the preceding filter must match before data is displayed.

Or—This filter or the preceding filter must match before data is displayed.

Not displayed for all filters.

Variable Displays the filter you selected.

Operator Select the arithmetic expression of equality or inequality that identifies one value or a specific group of values. For example, if you select “equal to”, the filter excludes all values that are not equal to the value entered.

Value Enter a specific value, or enter ? to allow users to enter a single character or * to enter a string of characters.



4

4.7.2 Specifying Sort Criteria

You can filter the data displayed with the following criteria:

• Name• Date created• Date modified• Sequence type• Chemistry type• Sequence• Sequence length• Revision (number of times file has been saved)• Summary information entered, including Author,

Project, and Sample

To specify sort by criteria:

1. Select the sort by criterion.

2. Click Ascending or Descending.


5Viewing and PrintingReports 5


5.1 Overview of Reports............................... 5-2

5.2 Displaying Reports ................................. 5-3

5.3 Using the Report Window....................... 5-6

5.4 Displaying Trityl Data ............................. 5-7

5.5 Printing a Report .................................. 5-10

5.6 Renaming a Run .................................. 5-14

5.7 Saving a Run Report as Text ................ 5-15

5.8 Report Viewer Menus ........................... 5-16


Chapter 5 Viewing and Printing Reports

5

5.1 Overview of Reports

The Report Viewer allows you to display, print, and search the database for the following information for a completed run:

• Synthesis information

• Runtime log, which includes events, alarms, and operator notes that occur during the run

• Trityl data

Definition of acompleted run

A completed run is the synthesis that occurs on a single column. A run consists of all the information accumulated for the column from the time the synthesis starts to the time the column reaches Done status or is aborted.


Displaying Reports

5

5.2 Displaying Reports


• Accessing the Report Viewer• Displaying a report when the Report Viewer is open• Displaying other runs in the current folder• Exiting the Report Viewer

Accessing theReport Viewer

You can access the Report Viewer in the following ways:

• Select Run Report Viewer from the File Menu.

• If the Expedite Workstation is not running, you can also access the Report Viewer directly from the Windows Program Manager by double-clicking the Reports Icon.

A blank Report Viewer window is displayed.

Opening a report 1. Select Open from the Report menu.

The Open Run dialog box (Figure 5-1) is displayed.

Figure 5-1 Open Run Dialog Box



5

A list of runs in the current folder is displayed.

NOTE: After you open a run, the report viewer allows you to quickly view all runs in a folder, one at a time, by pressing F7 and F8 keys to view next and previous runs.

Runs are listed with the default name format you assign (see “Setting the default report name” on page 3-33) unless you rename a run (see Section 5.6, Renaming a Run).



3. Select a run and click OK.

The Report is displayed with the selected run (Figure 5-2).

Figure 5-2 Report Window with Run


Displaying Reports

5

Displaying areport when the

Report Viewer isopen

If the Report Viewer is open when a synthesis completes, the results are not automatically displayed in the Report Viewer. To display the results, select Scan Run Logs from the Options menu in the Report Viewer.

Displaying otherruns in the

current folder

The Report Viewer allows you to display other runs in the current folder without opening them.

To display other runs:

• Select Previous from the Report menu or press the F7 key on the keyboard.

• Select Next from the Report menu or press the F8 key on the keyboard.

Exiting the ReportViewer

To exit the Report Viewer, select Exit from the Report menu.



5

5.3 Using the Report Window

The Report window (Figure 5-3) can display one run at a time.

Figure 5-3 Report Window

The Report window includes sequence information, a report summary, and a run log.

Viewing summaryinformation

To display and edit the summary information associated with the current report, select Summary Info from the Report menu.

Edit the information as needed. See “Entering summary information” on page 6-15.

Click OK.

Viewingsequencestatistics

To view statistics for the current run, select Sequence Statistics from the View menu.

See Section 6.4.2, Displaying Sequence Statistics, for more information and methods of calculation.

Run

Sequence

Reportsummary

log


Displaying Trityl Data

5

5.4 Displaying Trityl Data


• Displaying trityl data• Autoscaling• Setting bar width• Exiting

Displaying Select Show Trityl Data from the Options menu to display the Trityls window (Figure 5-4).

Figure 5-4 Trityls Window



5

The Trityls window includes:

• A histogram bar for each cycle in the synthesis.

• Response value for the highest bar (excluding the first bar) that is a qualitative indication of coupling efficiency.

NOTE: Do not rely on histogram intensity for quantitative information.

• Theoretical scale value based on the response. If the theoretical scale is lower than the scale of the protocol run, it may indicate a problem with the synthesis.

Autoscaling Double-click on a bar to autoscale all other bars to the selected bar. Bars that are higher than the selected bar are empty (indicating they are offscale).

Selecting the barwidth

To specify the width of the bars in the trityl display:

1. Select Bar width in the Options menu.

The submenu shown in Figure 5-5 is displayed.

Figure 5-5 Bar Width Submenu


Displaying Trityl Data

5

2. Click the desired bar width or Best Fit.

If you select Best Fit, the software selects the bar width that displays the data without horizontal scrolling. If the software cannot display the data without scrolling, thin bars are displayed.

NOTE: Bar width affects the appearance of the printout. If you set a bar width that is too narrow, sequence labeling of trityl bars may not print.

Exiting Select Exit from the File menu to close the Trityls window.



5

5.5 Printing a Report


• Setting up the report• Printing a report• Printing multiple reports

5.5.1 Setting Up the Report

Before printing:

• Customize the display as needed• Select the items to include in the report• Set the trityls bar width• Enter measured OD if needed

Customizing thedisplay

If desired, you can customize the sequence display:

• Change the grouping of the displayed bases by selecting Change Grouping from the View menu. For more information, see Section 6.4.4, Changing Base Grouping.

• Change the direction of the sequence display by selecting Display As from the View menu.

Select the itemsto include in the

report

To select the items to include in the printed report:

1. From the Options menu, select Modify Output.

The Report Options dialog box (Figure 5-6) is displayed.


Printing a Report

5

Figure 5-6 Report Options Dialog Box

2. Select the items to include.

3. Click OK.

Selecting tritylsbar width

If you select trityl data in Report Options, select the bar width appropriate for the printed report. See “Selecting the bar width” on page 5-8.

Entering themeasured OD

To include the measured OD in a report:

1. From the Options menu, select Optical Density.

The Optical Density dialog box (Figure 5-7) is displayed.

Figure 5-7 Optical Density Dialog Box



5

2. Enter the measured optical density.

3. Click OK.

5.5.2 Printing a Report

To print a report:

1. From the Report menu, select Print.

2. Click OK.

A typical printout is shown in Figure 5-8.

5.5.3 Printing Multiple Reports

To print multiple reports:

1. From the Report menu, select Print Multiple.

The Print Multi dialog box is displayed.



3. Select the runs to print, then click OK.

A typical printout is shown in Figure 5-8.


Printing a Report

5
Figure 5-8 Typical Run Report
********************************************************************************

* Synthesis Report: "12/19/94 13:38 Beta 5(5)2" Page 1 *

* Expedite(TM) Nucleic Acid Synthesis System (Workstation) *

* Thu May 18 13:27:01 1995 *

********************************************************************************

Started: Mon Dec 19 13:38:48 1994

Finished: Mon Dec 19 15:32:36 1994

Status: Ran to completion

Instrument: Beta 5 (5) Column 2

Operator: wendy

Protocol: sbd nominal 1U

Final DMT: Removed

Sequence Name: 31 dna 1-4

Sequence: (5') GATTGCCTACCATCCGTTAGCAACTGGTGAT

Seq Type: DNA

Seq Length: 31

Composition: 22.6% 7 A

25.8% 8 C

22.6% 7 G

29.0% 9 T

Purine/Pyrim: 0.82

Molecular wt: 9486.26

uMolar ExtCoeff: 294.6

O.D.:

Melting temp: 65.4 deg C

Runtime Log:

[12/19/94 13:39:15] Instrument started

[12/19/94 15:32:36] Trityl data recorded

[12/19/94 15:32:36] Synthesis complete

Trityl Data:

Estimated scale: 1 umole

Maximum value: 1.63E6

Raw integrated values (read 3'-5' left to right):

1.26E6 1.63E6 1.33E6 1.48E6 1.24E6 1.25E6 1.48E6 1.54E6

1.37E6 1.38E6 1.39E6 1.24E6 1.42E6 1.37E6 1.33E6 1.25E6

1.31E6 1.29E6 1.22E6 1.23E6 1.23E6 1.17E6 1.15E6 1.17E6

1.17E6 1.09E6 1.01E6 1.07E6 1.07E6 1.08E6 1.13E6



5

5.6 Renaming a Run

You can change the name of a stored run.

NOTE: You can choose between two default names for Expedite runs. For more information, see “Setting the default report name” on page 3-33. Or you can rename a stored run.

Renaming a runreport

To rename an Expedite run with a different name:

1. From the Report menu, select Rename.

The Rename dialog box (Figure 5-9) is displayed.

Figure 5-9 Rename Dialog Box

2. Enter a name.

3. Click OK.


Saving a Run Report as Text

5

5.7 Saving a Run Report as Text

To make the report information accessible to applications that can read ASCII text, save the report as a text file.

Before saving Before saving, use the Modify Output command to select the information to include in the report. See “Select the items to include in the report” on page 5-10 for more information.

NOTE: Trityl histograms are not included in the text file.

Hint: To include the trityl histogram in a text report, make a “screen capture” (an electronic image) of the Trityl Viewer window showing the trityl histogram. Press Alt/Print Screen to capture the screen, save the image in Windows Paintbrush, then paste the image into the text file.

Saving a runreport as a text

file

To save the Expedite run in the active window as a text file:

1. From the Report menu, select Save as Text.

The Save As Text File dialog box (Figure 5-10) is displayed.

Figure 5-10 Save as Text File

2. Enter a file name.

3. Click OK.



5

5.8 Report Viewer Menus

This section gives an overview of Report Viewer menus:

Figure 5-11 Report Viewer Menus


Report Viewer Menus

5

Table 5-1 Reports Menu Bar

Menu Option Function

Reports Open Select a stored report for viewing or printing. See “Accessing the Report Viewer” on page 5-3.

Rename Save run with a new name. See Section 5.6, Renaming a Run.

Save as text Save run with .txt extension. See Section 5.7, Saving a Run Report as Text.

Print Print the currently selected report. See Section 5.5, Printing a Report.

Organize Folders Manage placement, movement deletion and display of reports in different folders. See Section 4.3, Managing Data in the Database.

Summary Info Enter or edit summary information. See “Viewing summary information” on page 5-6.

Previous Open the previous report in the list. See “Displaying other runs in the current folder” on page 5-5.

Next Open the next report in the list. See “Displaying other runs in the current folder” on page 5-5.

Exit Exit Reports. See “Exiting the Report Viewer” on page 5-5.



5

View Display as 5'-3' or 3'-5'

Change orientation of current sequence. See “Customizing the display” on page 5-10.

Grouping Change the sequence display grouping. See “Customizing the display” on page 5-10.

Trityl data Show the trityl data window. See Section 5.4, Displaying Trityl Data.

Sequence statistics Show nucleic acid statistics. See “Viewing sequence statistics” on page 5-6.

Options Scan run logs Update the Report window with current information. See “Displaying a report when the Report Viewer is open” on page 5-5.

Modify Output Change options for printed report. See “Select the items to include in the report” on page 5-10.

Optical Density Allows you to add the measured optical density of currently displayed synthesis to the report. See “Entering the measured OD” on page 5-11.

Help Contents Accesses online help.

Table 5-1 Reports Menu Bar (Continued)



6Using the SequenceEditor 6


6.1 Overview of the Sequence Editor............ 6-2

6.2 Creating and Editing Sequences............. 6-3

6.3 Using Foreign Sequences..................... 6-21

6.4 Viewing Sequence Information ............. 6-25

6.5 Customizing the Sequence Editor ......... 6-33

6.6 Searching for Specific Base Combinations ....................................... 6-37

6.7 Proofreading Sequences ...................... 6-38

6.8 Sequence Editor Menus........................ 6-39


Chapter 6 Using the Sequence Editor

6
6.1 Overview of the Sequence Editor
The Sequence Editor allows you to:

• Enter sequences

• Edit and store sequences

• Open foreign sequences (sequences generated on non-Expedite systems)

• View sequence composition dynamically as you enter the sequence

• Search and sort sequences stored in the database


Creating and Editing Sequences

6
6.2 Creating and Editing Sequences

• Opening sequences• Using the Sequence Editor windows• Entering and editing sequences• Printing a sequence• Saving and closing sequences• IUB Mix Codes, Numeric Cycles, Extended Cycle,

Lowercase Codes

6.2.1 Opening a Sequence


• Accessing the Sequence Editor• Opening a sequence

Accessing theSequence Editor

You can access the Sequence Editor in the following ways:

• Select Run Sequence Editor from the Edit menu in the Instrument window.

• Click the Edit Sequence button in the Run Synthesis dialog box (see Figure 3-4 on page 3-13).

• Double-click the Sequence Editor icon in the Program Manager any time the Workstation application is not open.

The Sequence Editor (Figure 6-1) is displayed.



6

Figure 6-1 Sequence Editor

NOTE: If a sequence is selected when you click Edit Sequence, it is displayed in the edit window. If no sequence is selected, a blank sequence window temporarily named “Sequence1” is displayed.

Opening asequence

To open an existing Expedite sequence in the Sequence Editor window:

NOTE: For information on opening sequences from other systems, see Section 6.3, Using Foreign Sequences.



6
1. From the Sequence menu, select Open.
The Open dialog box (Figure 6-2) is displayed.

Figure 6-2 Open Dialog Box

NOTE: The last four sequences opened are listed at the bottom of the Sequence menu. You can select one of these sequences to open it, instead of selecting Open.

2. If desired, select a List-by filter to display only selected sequences in the Open dialog box.




6
3. Select the sequence to open.
The Sequence Editor is displayed with the sequence (Figure 6-3).

Figure 6-3 Sequence Editor with One Sequence

6.2.2 Using the Sequence Editor Windows


• Opening multiple sequences• Sequence window• Information line• Moving the cursor



6
Opening multiple
sequencesYou can open and edit several Sequence windows simultaneously. The title bar of the active sequence window is darkened (Figure 6-4).

Figure 6-4 Sequence Editor Window with Two Open Sequences

Sequence window Each sequence is displayed in a separate window in the Sequence Editor. The title bar for each sequence includes:

• Sequence name• Sequence type (DNA or RNA)• Display orientation (3'-5' or 5'-3')

NOTE: If you open the same sequence more than one time (the same sequence is displayed in more than one window), a window number is appended to the sequence name, for example “Seq:1” and “Seq: 2”. Changes you make to the sequence in one window are reflected simultaneously in the other window.

Two opensequences

Information linefor active

sequence



6
Information line The information line (Figure 6-5) corresponds to the sequence
in the active window.

Figure 6-5 Information Line

The information line includes:

• Edit status—Displays “Modified” if any changes have been made. Space is blank if the sequence has not been changed.

• Position (Pos)—Base position of the cursor in the sequence.

• Length (Len)—Length of the sequence.

• Selected Positions [1,1]—Position of the bases selected. For example, [1,5] indicates that positions 1 through 5 are select. Blank if no bases are selected.

• Insert or Replace—Mode of entry. Insert adds new bases, Replace overwrites current bases. Press the Insert key to switch between modes.

Edit status

Position

Length

Selected base positions

Entry mode



6
Moving the cursor The table below describes the keyboard keys you can use to
move the cursor during sequence editing:

Press... To move the cursor...

Left Arrow One character to the left.

Right Arrow One character to the right.

Up Arrow Up one row.

Down Arrow Down one row.

Page Up Up by the number of visible rows.

Page Down Down by the number of visible rows.

Home Before the first base in the sequence.

End After the last base in the sequence.

Tab Forward the number of bases defined for a group. See Section 6.4.4, Changing Base Grouping.

Shift+Tab Backward by the number of bases in a group.



6
6.2.3 Creating or Editing a Sequence

• Specifying sequence type and direction• Entering base codes• Entering lowercase codes• Editing• Changing the sequence type


NOTE: As you enter sequence information, you can display additional sequence information such as base composition or molecular weights. See Section 6.4, Viewing Sequence Information.

Specifyingsequence type

and direction

To specify sequence type and direction for a new sequence:

1. From the Sequence menu, select New.

2. Place the cursor in the sequence window.

3. From the Modify menu, select DNA or RNA to set the sequence type.

4. From the Modify menu, Switch Terminals to display the sequence in the 3' or 5' direction.

NOTE: Sequences are synthesized in the 3' to 5' direction, regardless of the direction specified in the sequence.



6
Entering base
codesType in the one letter code for each base. The system accepts only defined codes. The sequence type determines the characters you can enter into a sequence.

To enter IUB, numeric, or lowercase codes, select the appropriate command from the Modify menu. Then enter the code. To turn off the codes, deselect them from the Modify menu.


For information on the monomers that correspond to non-standard base codes, see Section 6.2.6, IUB Mix Codes, Numeric Codes, Extended Cycle, Lowercase Codes.

Sequence Type Allowable Codes

DNA (also applies to Thio, User, and PNA)

• A, C, G, T

• Lowercase a, c, g, t

• IUB codes

• Numeric codes 5 - 9

• X (extended cycle)

RNA • A, C, G, U

• Lowercase a, c, g, t

• IUB codes

• Numeric codes 5 - 9

• X (extended cycle)



6
NOTE: Only lowercase a,c,g,t are available cycles in the standard protocols. If you use other lowercase characters, you must create or modify a protocol to synthesize the sequence. See Section 7.4, Creating and Editing Protocols, for more information.
Enteringlowercase codes

To type lowercase base codes, do one of the following:


• Select Lower case from the Modify menu before you type the base code

• Type an uppercase base code, select the code, then select Change Case from the Modify menu

Editing To edit a sequence, do the following as needed:

To... Do this...

Select codes Select Select All from the Edit menu.

Click-drag the cursor over the desired positions.

Delete all codes Select Clear from the Edit menu.

Delete codes 1. Select the codes.

2. Select Delete from the Edit menu.

Move codes 1. Select codes.

2. Select Cut from the Edit menu.

3. Place the cursor in the new location.

4. Select Paste from the Edit menu.



6
Changing
sequence type foran existing

sequence

If you change the sequence type for an existing sequence, the software prompts you to alter the sequence to match the new type.

For example, if you change the type for the sequence “ATGC” from DNA to RNA, a dialog box is displayed to ask if you want to change T (Thymidine) to U (Uridine).

6.2.4 Printing a Sequence

Select Print from the Sequence menu to print the active sequence.

A typical sequence printout is shown in Figure 6-6.

Figure 6-6 Typical Sequence Printout

********************************************************************** * Sequence Report: "AT24" 1 * * Expedite(TM) Nucleic Acid Synthesis System (Workstation) * Thu May 18 12:26:16 1995 **********************************************************************

Created: Thu May 18 12:22:32 1995 Modified: Thu May 18 12:22:32 1995 Project: Testing Sample: 24-mer Author: SBD Keywords: Test Length: 24 Type: DNA Composition: 20.8% 5 A 33.3% 8 C 16.7% 4 G 29.2% 7 T Purine/Pyrim: 9.00/15.00 = 0.60 Molecular wt: 7263.812 uM ext coeff: 219.4 Theor. OD: 138.3 (1 umole scale) Melting temp: 60.4 deg C Comments: This is a test sequence.

Sequence: (5') AGT TCC AGT GCC TAC CTT AAG CCT



6
6.2.5 Saving and Closing a Sequence

• Sequence names• Saving• Entering summary information• Saving in foreign sequence format• Closing a sequence• Exiting the Sequence Editor

Sequence names Sequence, protocol, and report names:

• Can contain up to 30 characters

• Can contain any combination of keyboard characters, including spaces

• Must be unique regardless of case, within each category (for example, sequences)

NOTE: Names are stored according to the case you enter, but are not case-sensitive. That is, SEQ1 and Seq1 are seen as the same name.

Saving To save the sequence in the active window:

1. From the Sequence menu, select Save or Save As:

• If you are saving a previously saved sequence, the sequence is saved with the same name.

• If you are saving a new sequence, the Save Sequence As dialog box (Figure 6-7) is displayed.



6

Figure 6-7 Save Sequence As Dialog Box

2. Select the folder in which to save the sequence.

3. Enter the sequence name.

4. If needed, click Info to enter Summary Information. See “Entering summary information” on page 6-15.

NOTE: If the sequence Editor is set to automatically prompt for summary information, this dialog box is displayed when you click OK.

5. Click OK.

Enteringsummary

information

Summary information is information that you can use to filter sequences when searching and sorting in the database.

To enter summary information:

1. Display the sequence of interest.

2. From the Sequence menu, select Summary Info.



6
The Summary Information dialog box (Figure 6-8) is displayed.
NOTE: You can also access summary information by clicking the Info button in the Save Sequence As dialog box (Figure 6-7).

.

Figure 6-8 Sequence Summary Dialog Box

3. Type information as needed in the following text boxes:

• Author (up to 30 characters)

• Sample (up to 30 characters)

• Project (up to 30 characters)

• Keyword (up to 60 characters)

4. Type in a comment as needed. Press Ctrl+Enter to create a line break.

5. Select the folder in which to store the sequence.

6. Click OK.



6
Saving in foreignsequence format
To save the sequence in the active window in a foreign format:

1. From the Sequence menu, select Save as foreign.

2. Enter a file name.

3. From the Save File As Type list, select the desired format (see Table 6-2 on page 6-22 for more information):

• ASCII Delimited

• EMBL

• GenBank

• CODATA

• DNA*Star

• Biosearch 8750/8800

• GCG (Wisconsin)

4. Click OK.

Closing asequence

To close a sequence window:

• From the Sequence menu, select Close.• From the Window menu, select Close all.

Exiting theSequence Editor

Select Exit from the Sequence menu to close the Sequence Editor.

6.2.6 IUB Mix Codes, Numeric Codes, Extended Cycle, Lowercase Codes

This section describes the modified codes you can enter in a sequence:

• IUB mix codes• Numeric codes • Extended cycle• Lowercase codes



6
IUB mix codes IUB (International Union of Biochemistry) codes include:
Table 6-1 IUB Group Codes

If you select IUB from the Modify

menu and enter...

Corresponds to...

Complement of IUB code

is...

Hints for remembering IUB

codes...

A A T Adenine

C C G Cytosine

G G C Guanine

T T A Thymine (DNA only)

U U A Uracil (RNA only)

R A, G Y puRines

Y C, T/U R pYrimidines

M A, C K aMino

K G, T/U M Keto

S G, C S Strong (3H-bonds)

W A, T/U W Weak (2H-bonds)

H A, T/U, C D not G

B G, T/U, C V not A

V G, A, C B not T/U

D G, A, T/U H not C

N G, A, T/U, C N aNy



6
Numeric codes You can enter numeric codes (5-9) to incorporate special or
modified bases into the sequence.

To enter numeric codes, select Numeric from the Modify menu, then enter the codes.

Numeric codes correspond to reservoir positions. When the instrument encounters a numeric code during a synthesis, it performs a standard coupling cycle and delivers monomer from the reservoir number specified.

If you enter a numeric code, load the corresponding reagent in the reservoir number specified.

NOTE: You can also use numeric codes 0–4. If you use 0–4, create a protocol that includes the appropriate cycles.

Lowercase Lowercase codes allow you to perform syntheses using mixed chemistries. For example, lowercase codes in a DNA chemistry specify THIO cycles.

To enter lowercase codes, do one of the following:

• Select Lower case from the Modify menu before you type the base code

• Type an uppercase base code, select the code, then select Change Case from the Modify menu

NOTE: Only lowercase a,c,g,t are available cycles in the standard protocols. If you use other lowercase characters, you must create or modify a protocol to synthesize the sequence.



6
Lowercase codes include:
Extended cycle(X)

The extended cycle code (X) defines a cycle in which the monomer is delivered from position 5 on the instrument with an extended coupling time.

If you enter...

Corresponds to cycle...

a

in DNA chemistry

in RNA chemistry

in Thio chemistry

THIO A cycle DNA A cycle DNA A cycle

c THIO C cycle DNA C cycle DNA C cycle

g THIO G cycle DNA G cycle DNA G cycle

t THIO T cycle DNA T cycle DNA T cycle


Using Foreign Sequences

6
6.3 Using Foreign Sequences
Using foreignsequences

The Expedite Workstation Software is compatible with several third-party DNA database programs. You can open sequences in the following formats:

• GenBank• DNA*Star• EMBL• CODATA• ASCII Delimited • Comma Separated Values (CSV) format• Biosearch 8750/8800• GCG (Wisconsin)

You do not need to import foreign sequences into the Expedite database before use. You can open them directly.

Foreignsequences

A foreign sequence is a file generated on a system other than the Expedite system.

Table 6-2 describes the foreign sequence formats that you can open and use on the Expedite system.



6
Table 6-2 Foreign Sequence Formats Compatible with Expedite Software
Format Description Example

ASCII Delimited (CSV Format)

Contains A, C, G, T, and U base codes.

Sequence can be followed by the sequence type and name, separated by commas.

ACGGTTC,DNA, SEQ1

EMBL Distinguished by the identifiers ID (identity) and SQ (sequence).

The file always begins with the ID.Keywords are on a line that begins KW. The last line begins with SQ. The sequence starts on the line following the SQ line. The file ends with // (double slash) on a line by itself.

ID SEQ1

KW LAB1

SQACGGTTC

//

GenBank Distinguished by the identifiers LOCUS (identity) and ORIGIN.

The file always begins with the LOCUS. Keywords are on a line that begins KEYWORDS. The last line of text begins with ORIGIN. The sequence starts on the line following the ORIGIN line. The file ends with a // (double slash) on a line by itself.

LOCUS SEQ1

KEYWORDS LAB1

ORIGINACGGTTC

//

CODATA Distinguished by the identifiers ENTRY (identity) and SEQUENCE.

The file always begins with the ENTRY. Keywords are on a line that begins KEYWORDS. The last line of text is not uniquely marked. The SEQUENCE identifier is optional, but if present marks the last line of text.The sequence starts on the next line.The file ends with a // (double slash) on a line by itself.

ENTRY SEQ1

KEYWORDS LAB1

SEQUENCE

ACGGTTC//


Using Foreign Sequences

6
DNA*Star File format does not directly support
identity or keywords, except as a general commentary preceding the sequence.

The sequence is between ^^(double caret) and the end of the file.The file ends with a // (double slash) on a line by itself.

^^

ACGGTTC

//

Biosearch 8750/8800 Synthesizer

File format compatible with Biosearch 8750/8800 DNA Synthesizer (filename.dna).

File name and length are on top line followed by comment lines that begin with semicolons(;).

Sequence is in unique format that incorporates explicit mixed-site codes (not single-letter IUB codes).

File:

C:\EXPEDITE\MYSEQ.DNA 8mer

;This is a comment

5'-ACG-TAC-G[AC]-3'

GCG (Wisconsin)

File format contains commentary at top that ends in two periods (..) and a carriage return.

Sequence begins on the following line and continues on numbered lines through end of file.

This is a comment

C:\EXPEDITE\FOREIGN\MYSEQ.GCG Length: 8..

1 ACGTACGM

Table 6-2 Foreign Sequence Formats Compatible with Expedite Software (Continued)

Format Description Example



6
Opening a foreign
sequenceYou do not have to import a foreign sequence into the Expedite database before opening.

To open a foreign sequence:

1. From the Sequence menu, select Open foreign.

The Synthesize Foreign Sequence dialog box (Figure 6-9) is displayed.

Figure 6-9 Synthesize Foreign Sequence Dialog Box

2. Select the foreign sequence to open.

NOTE: Do not open a SEQ file that you export from the Expedite database or that you created in a version of software earlier than version 2.0. Expedite SEQ files are not foreign files. You must import .SEQ files into the database. For information, see Section 4.2.1, Importing.

3. Click OK.


Viewing Sequence Information

6
6.4 Viewing Sequence Information

• Displaying the complement of a sequence• Displaying sequence statistics• Displaying summary information• Changing base grouping

6.4.1 Displaying the Complement of a Sequence

To display the complement of a sequence, select Complement from the Modify menu.

When you display a complement:

• Base codes and IUB codes are changed to their complements. See Table 6-1, IUB Group Codes, on page 6-18.

• Numeric codes remain unchanged.



6
6.4.2 Displaying Sequence Statistics
Select Sequence Statistics from the View menu to display the Nucleic Acid Statistics dialog box (Figure 6-10).

Figure 6-10 Nucleic Acid Statistics Dialog Box

The Nucleic Acid Statistics dialog box includes:

• Purine and pyrimidine ratio• Molecular weight• Theoretical optical density• Base % composition• Melting temperature• Micromolar extinction coefficient

The values in the statistics window are updated dynamically as you continue to edit the sequence.

Purine andpyrimidine ratio

The purine and pyrimidine ratio is a decimal quotient of the total number of purines (A, G) over the total number of pyrimidines (C, T, U). If there are no pyrimidines, asterisks are displayed (*.**). The count and percentage of all codes are also shown.

The purine/pyrimidine computation assumes an even distribution of mixed bases. For example, M (A, C) is considered to contribute one-half purine and one-half pyrimidine.



6
Molecular weight The molecular weight is the sum of the component molecular
weights of all bases, with mixed bases contributing proportionately, and a final negative correction factor to account for the loss of PO2 on the 3'-O end and the addition of H at the 5'-O group.

Molecular weightcalculation

Mol Wt = (PA * WA) + (PC * WC) + (PG * WG) + (PT/U * WT/U) - WCORR

Where PA = # of A’s and WA = component weight of A.

The default molecular weights used in the calculation are listed in Table 6-3.

To change molecular weight values used or to assign values to lower case bases and numeric codes, see Section 6.5.2, Setting Molecular Weights.

Table 6-3 Default Molecular Weights of the Bases

DNA RNA Thioate

WA 313.2114 329.2108 329.2760

WC 289.1863 305.1857 305.2509

WG 329.2108 345.2102 345.2754

WT/U 304.1981 306.1704 320.2627

Wa 329.2760 313.2114 313.2114

Wc 305.2509 289.1863 289.1863

Wg 345.2754 329.2108 329.2108

Wt/u 320.2627 304.1981 304.1981

WCORR 61.9646 61.9646 78.0292



6
Micromolar
extinctioncoefficient

The micromolar extinction coefficient is an indication of how much light a product absorbs at a particular wavelength. The calculation for the approximate extinction coefficient at 254 nm is as follows:

[(8.8*PT/U + (7.3*PC) + (11.7*PG) + (15.4*PA)]*0.9

Where PA = # of A’s, PG = # of G’s, and so on

Meltingtemperature

One of the following calculations is used to find the approximate melting point in degrees Celsius:

For all sequences under 18 bases in length:

Tm = 4*NGC + 2*NAT

where NGC is the total number of C or G bases and NAT is the total number of A or U bases.

For longer DNA sequences:

Tm = 81.5 + 16.6*Log10[Na+] + 0.41*PGC - 600/N

For longer RNA sequences:

Tm=79.8 - 18.5*Log10[Na+] +

0.58 PGC + 11.8*[PGC /100]2 - 820/N

where:

PGC is the whole percentage of G and C bases

N is the sequence length

[Na+] is 0.1 M

NOTE: This calculation may be unreliable for sequences longer than 70 bases and for thioated DNA.

Theoretical ODcalculation

The OD (optical density) calculation which is based on a 1 µmol scale assumes:

1 OD per 33 µg of product

98% coupling efficiency at each synthesis cycle

The OD is calculated as follows:

(0.98)n-1

Where n = sequence length

33OD =

MW *



6
6.4.3 Displaying Summary Information
To display summary information:

1. Select Summary Info from the Sequence menu to display the Summary Information dialog box (Figure 6-11) for a sequence.

Figure 6-11 Summary Information Dialog Box

The Summary Information dialog box displays information entered when the sequence was saved.

2. Click Statistics to display the Sequence File Statistics window (Figure 6-12).



6

Figure 6-12 Sequence File Statistics Window

The Sequence File Statistics window includes:

• Date and time the sequence was created

• Date and time the sequence was last saved

• Revision (number of times file saved)

• Sequence type (DNA, RNA)

• Sequence length

3. Click OK to close the window.

4. Click Chemistry to display the Sequence Chemistry dialog box (Figure 6-13).

Figure 6-13 Sequence Chemistry Type Dialog Box

5. If desired, select a different chemistry type to select the associated molecular weights. The molecular weights are used to calculate the molecular weight that appears in sequence statistics and printouts.



6
6.4.4 Changing Base Grouping
Select Change Display Grouping from the View menu to:

• Change the displayed sequence to show monomers in groups of 3, 5, 10.

• Change the displayed sequence to show the monomers ungrouped.

• Change the display of a sequence using the Frame Offset Scroll Bar.

To change the grouping of the displayed bases:

NOTE: When you change grouping from the View menu, only the current sequence is changed. Set Editor Preferences to set the default grouping for all new sequences. See Section 6.5.1, Setting Sequence Editor Preferences, for information.

1. Select Grouping from the View menu.

The Change Grouping dialog box (Figure 6-14) is displayed.

Figure 6-14 Change DNA Grouping Dialog Box

2. Select the desired grouping.

Frame Offset scroll bar



6
3. If you select a a grouping other than None, you can use
the Frame Offset scroll bar to determine the number of bases that appear in the first base group.

If you set a group size of 5 and a frame offset of 1, the first group contains four bases (group size minus 1). If you set a a frame offset of 2 (Figure 6-15), the first group contains three bases (group size minus 2).

This feature is useful for aligning codons, if the sequence does not begin at a codon boundary.

Figure 6-15 Sequence with Group Size=5, Frame Offset=2


Customizing the Sequence Editor

6
6.5 Customizing the Sequence Editor

• Setting Sequence Editor preferences• Prompting for summary information• Specifying grouping• Setting molecular weights

6.5.1 Setting Sequence Editor Preferences

You can set the following defaults for new sequences:

• Sequence type• Sequence display mode• Entry mode• Sequence grouping

To set defaults:

1. From the Sequence menu, select Editor Preferences.

The Editor Preferences dialog box (Figure 6-16) is displayed.



6

Figure 6-16 Editor Preferences Dialog Box

2. Select the defaults.

NOTE: Oligomers are always synthesized in the 3' to 5' direction, regardless of the display direction.

3. Click Grouping.

The Change DNA Grouping dialog box (Figure 6-17) is displayed.

Figure 6-17 Change DNA Grouping Dialog Box


Customizing the Sequence Editor

6
4. Set the grouping and frame offset as needed. See
Section 6.4.4, Changing Base Grouping, for more information.

5. Click OK to close the Grouping dialog box.

6. Click OK to close the Editor Preferences dialog box.

NOTE: Changes you make to Editor Preferences are not activated until you open a new sequence. Currently displayed sequence windows are not affected. Use the Modify menu to change the active window.

6.5.2 Setting Molecular Weights

Select Constants from the Sequence menu to display the Nucleic Acid Sequence Constants dialog box (Figure 6-18).

Figure 6-18 Nucleic Acid Sequence Constants Dialog Box



6
1. Select a chemistry.
2. Enter the molecular weights for the primary base codes (A,C,G,T/U), extended cycle code (X), modified base codes (a,c,g,t/u) and numeric codes (0-9).

NOTE: Molecular weights for the IUB mix codes are an average of the individual bases which make up the mix.

3. Enter the correction factor which is the amount subtracted from the total to compensate for the lack of a phosphate group on the 3' end base.

4. If needed, click Reset to Default values to set all codes to defaults.

5. Repeat as needed for all chemistries.

6. Click OK.


Searching for Specific Base Combinations

6
6.6 Searching for Specific Base Combinations
To find a specific combination of bases:

1. From the Edit menu, select Find.

The Find Next dialog box is displayed (Figure 6-19).

Figure 6-19 Find Next Dialog Box

2. Enter the combination of bases to find.

Hint: If you select a portion of a sequence before you select Find, the selected text is displayed in the Find field when you open the Find dialog box.

3. Specify the direction of the search.

4. Click OK.



6
6.7 Proofreading Sequences
The Workstation Software can read your sequence data out loud. Audio proofreading makes is much easier to double-check your sequences.

To audio proofread sequences:

1. Select the portion of the sequence to proofread. Skip this step if you want to proof the entire sequence.

2. Select Whole Sequence or Selected Bases from the Read menu.

Set readpreferences

To set the voice style and reading speed of the voice for audio proofreading.

1. From the Read menu, select Reading Preferences.

The Reading Preferences dialog box (Figure 6-20) is displayed.

Figure 6-20 Reading Preferences Dialog Box

2. Select voice speed.

3. Select Voice A or B.

4. Click OK.


Sequence Editor Menus

6
6.8 Sequence Editor MenusThis section gives an overview of Sequence Editor menus.
NOTE: If no sequences are open, only the Sequence and Help menus are available.

Figure 6-21 Sequence Editor Menus



6
Table 6-4 Sequence Editor Menus
Menu Command Description

Sequence New Create a new sequence. See Section 6.2, Creating and Editing Sequences.

Open Open an existing sequence. See Section 6.2.1, Opening a Sequence.

Open foreign Open a sequence from a foreign format file. See Section 6.3, Using Foreign Sequences.

Save Save the sequence in the active window. See Section 6.2.5, Saving and Closing a Sequence.

Save as Assign a new name and save the sequence in the active window. See Section 6.2.5, Saving and Closing a Sequence.

Save as foreign Save a sequence in a foreign file format. See Section 6.2.5, Saving and Closing a Sequence.

Print Print the sequence that is displayed in the active window. See Section 6.2.4, Printing a Sequence.

Organize folders Manage sequences in different folders. See Section 4.3, Managing Data in the Database.

Constants Set molecular weights for base codes. See Section 6.5.2, Setting Molecular Weights.

Editor

Preferences

Select default sequence type, insert mode, and entry codes. See Section 6.5.1, Setting Sequence Editor Preferences.

Summary Info Display summary information. See “Entering summary information” on page 6-15 and Section 6.4.3, Displaying Summary Information.



6
Sequence (continued)
Sequence list Displays the four most recently used sequences.

Exit Exits the Sequence Editor. See “Exiting the Sequence Editor” on page 6-17.

Edit Undo Undo the last editing change.

Cut Remove the selected text and put it in the Clipboard.

Delete Erase the selected text.

Copy Copy the selected text to the Clipboard.

Paste Paste the contents of the Clipboard at the cursor location.

Select all Select (highlight) the whole sequence in the active window.

Clear Delete the entire sequence in the active window.

Find Search for sequence fragments. See Section 6.6, Searching for Specific Base Combinations.

Modify Switch terminals Display 3' or 5' terminal at the left to the Sequence Editor.

Complement Display the complement of the nucleic acid sequence. See Section 6.4.1, Displaying the Complement of a Sequence.

Change case Change selected bases from upper to lower case or lower to upper case. See “Entering lowercase codes” on page 6-12, and “Lowercase” on page 6-19.

Table 6-4 Sequence Editor Menus (Continued)




6
Modify (continued)
DNA Set sequence type to DNA.

RNA Set sequence type to DNA.

IUB mix codes Enable or disable IUB code entry. See “Entering base codes” on page 6-11, and Section 6.2.6, IUB Mix Codes, Numeric Codes, Extended Cycle, Lowercase Codes.

Numeric cycles Enable or disable numeric codes (0-9) entry. See “Entering base codes” on page 6-11, and Section 6.2.6, IUB Mix Codes, Numeric Codes, Extended Cycle, Lowercase Codes.

Lower case Enable lowercase code entry. See “Entering base codes” on page 6-11, and Section 6.2.6, IUB Mix Codes, Numeric Codes, Extended Cycle, Lowercase Codes.

View Display as 5'-3' (3'-5')

Display sequence in the opposite order (5'-3' or 3'-5').

Sequence Statistics

Show sequence composition, molecular weight. See Section 6.4.2, Displaying Sequence Statistics.

Change Display Grouping

Set the default grouping for the displayed sequence (3,5,10 or none). See Section 6.4.4, Changing Base Grouping.

Read Whole sequence Audio proofread all sequence bases. See Section 6.7, Proofreading Sequences.

Selected bases

Reading

preferences





6
Window Tile Arrange windows so that all are visible and not
overlapped.


Close all Close all sequence windows.

Help Contents Displays Sequence Editor online help.




7Using the ProtocolEditor 7


7.1 Overview of the Protocol Editor ............... 7-2

7.2 Understanding Protocols ......................... 7-3

7.3 Determining the Reagent Delivery Volumes for Protocols .............. 7-23

7.4 Creating and Editing Protocols .............. 7-26

7.5 Protocol Editing Examples ..................... 7-49

7.6 Protocol Editor Menus ........................... 7-60


Chapter 7 Using the Protocol Editor

7

7.1 Overview of the Protocol Editor

Protocol Editor The Protocol Editor allows you to:

• Customize existing protocols

• Develop new protocols

• Organize and manage protocol data in the database

Using standardprotocols

Standard protocols are provided on the Expedite Workstation. Use the standard protocols as a starting point for creating new protocols, and edit as needed.

Before creatingnew protocols

You should have a thorough understanding of the following topics before you create new protocols:

• Nucleic acid synthesis.

• Requirements of the chemistry you are performing.

• Chemical reaction rates and reagents you are using.

• Organization of a chemical cycle, described in Section 7.2.2, Subcycles (Operations) in Cycles.

• Fluidic system of the Expedite Nucleic Acid Synthesis System. When you create a protocol, you must ensure that a protocol delivers the appropriate reagent volumes at the appropriate times. See Section 7.3, Determining the Reagent Delivery Volumes for Protocols.

• Fluidic functions and special functions used by the system, described in Section 7.2.5, Functions in Steps.

• How to use the Protocol Editor, described in Section 7.4, Creating and Editing Protocols.


Understanding Protocols

7

7.2 Understanding Protocols

Overview of aprotocol

A Protocol is a set of instructions that control the functions performed by the instrument during nucleic acid synthesis. A protocol is made up of cycles, subcycles (operations), and steps that contain the functions required to add each base to a sequence (Figure 7-1).

A protocol must contain a cycle for each type of base added during a synthesis. For example, a standard DNA protocol contains A, C, G, and T cycles. A protocol may also contain additional cycles that perform functions other than base addition, such as the removal of the final DMT group.


• Cycles in protocols• Subcycles (operations) in cycles• Steps in subcycles• Delivery modes in steps• Functions in steps• Description of the Adenosine (A) cycle

Figure 7-1 Overview of a Protocol

Sample DNA Protocol

A CycleDeblock subcycle

Step/FunctionStep/Function

Capping subcycleStep/FunctionStep/Function

C CycleDeblock subcycle



G CycleDeblock subcycle



Adds A

Adds C

Adds G

continued



7

7.2.1 Cycles in Protocols

A cycle is a complete block of information needed to add a base to a sequence. A cycle includes a series of subcycles, which contain steps and functions, that perform the addition.


• Cycles in standard protocols• Creating and editing cycles

Cycles instandard

protocols

Cycles that are available by default in the Protocol Editor and are included in the standard protocols are listed in Table 7-1.

Cycles in standard protocols differ only in the position of monomer delivery. You can edit any cycle to optimize for unique conditions or applications.

NOTE: Section 7.2.6, Description of the Adenosine (A) Cycle, includes a description of each line in a cycle.

Table 7-1 Cycles in Standard Protocols

Cycle Function

A, C, G, T Adds DNA or Thio bases

A, C, G, U Adds RNA bases

5, 6, 7, 8, 9 Delivers monomer from the specified vial

NOTE: On 8905 systems, only vial 5 is available

X Performs extended coupling cycle, delivers reagent from vial 5



7

Creating andediting cycles

You can use the Protocol Editor to create new cycles or edit existing cycles. Note the following:

• To create a new cycle, copy an existing cycle, rename, and edit as needed, to ensure that you include all necessary subcycles, steps, and functions. Creating a cycle from scratch is complicated.

• Include a cycle for each base you are adding to the sequence.

• If you edit one cycle in a protocol, it does not change other cycles. Edit all the appropriate cycles in a protocol with the desired changes.

See Section 7.4.5.2, Editing a Cycle, for more information.

R, Y, M, W, S, K, D, H, V, B, N

Adds mixed site bases (IUB bases). See “IUB mix codes” on page 6-18 for a description of the bases that each cycle adds

a,c,g,t Depends on chemistry selected in protocol:

• DNA—Adds thioated bases• RNA—Adds DNA bases• Thio—Adds DNA bases

* (asterisk) Performs initial cycle for Universal Support

+ (plus) Performs final cycle (DMT on)

- (minus) Performs final deblocking cycle (DMT off)

Table 7-1 Cycles in Standard Protocols (Continued)

Cycle Function



7

7.2.2 Subcycles (Operations) in Cycles

Cycles are made up of subcycles (operations) that perform related sets of steps needed to add a base to a sequence, such as deblocking or activating.


• Subcycles in standard protocols• During a Deblocking subcycle• During a Coupling subcycle• Creating and editing subcycles

Subcycles instandard

protocols

The subcycles included standard protocol cycles are described in Table 7-2.

Each subcycle line listed in a cycle begins with a $ character.

Table 7-2 Subcycles for Typical Monomer Addition

Reagent Train

Subcycle (Operation)

Description

A $Deblocking Removes the 5'-DMT protecting group in preparation for the coupling step.

See “During a Deblocking subcycle” on page 7-7 for more information.

B $Coupling Activates and adds the protected monomer to the support.

See “During a Coupling subcycle” on page 7-8 for more information.

A $Capping Terminates any unreacted sites.

$Oxidizing Converts phosphite to more stable phosphate (DNA and RNA) or thiophosphate (THIO).

$Capping Dries and washes the support for the next cycle.



7

During aDeblocking

subcycle

The Deblocking subcycle removes the final 5'-DMT protecting group from a base.

When the system encounters a Deblocking subcycle, it skips back to the preceding cycle in the protocol and performs the appropriate deblock on the preceding base coupled to the solid support.

For example, assume you are coupling an A monomer to a T monomer. The system reaches the Deblocking subcycle in the A cycle. It skips back to the T cycle and performs the Deblocking in the T cycle to remove the DMT group from the T monomer.

Figure 7-2 Deblocking Example

The base attached to the solid support is not deblocked at the end of a cycle (instead is deblocked at the start of the next cycle) for two reasons:

• To leave the base in a protected state at the end of the cycle, in the event that an error or hold occurs.

• Allows retention of the DMT group at the end of the synthesis.

DeblockCappingDeblock

Capping

T cycle A cycle

System reaches Deblock

Skips back to Deblockin previous cycle

After deblocking previous base,proceeds with next subcycle in

current cycle



7

If the DMT Off cycle (-) is included in the protocol, the system does not skip back to previous cycle Deblock. The DMT off cycle includes deblock steps, a final wash, and gas-dry of the column.

During a Couplingsubcycle

The Coupling subcycle performs the activation and addition of a monomer unit to the solid support.

During coupling, the B train and the column are:

• Flushed with wash solvent

• Primed with activator

• Quickly pulsed with monomer and activator to saturate the column

• Pulsed with additional activator chase pulses if the number of pulses of monomer and activator has not forced the activated monomer to the column

• Slowly pulsed with wash to allow time for the activated monomer to react

The number of pulses required during each part of a coupling subcycle depends on the scale of the protocol and the physical location of the monomer on the B train. A monomer that is farther away from the column may require more chase pulses to properly position the monomer.

See Section 7.3, Determining the Reagent Delivery Volumes for Protocols.

Creating andediting a subcycle

You can use the Protocol Editor to create new subcycles or edit existing subcycles. Note the following:

• Include A train functions in A train subcycles (Deblocking, Capping, and Oxidizing) and B train functions in the Coupling subcycle.

CAUTION

If you include A train functions in B train subcycles (or the reverse), reagent is delivered to the wrong column.



7

• Select functions from the Edit dialog boxes in a subcycle (instead of typing function numbers directly in the subcycle) because the Edit dialog boxes list only the allowed functions for each subcycle.

• To optimize the time required for two-column synthesis, set the duration of the A-train subcycles (Deblocking, Capping, Oxidizing, and Capping) equal to the duration of the B-train subcycle (Coupling).

When A-train functions are performed on one column, B-train functions are performed on the other column. A two-column synthesis with equal A train and B train durations takes the same amount of time as a one-column synthesis.

NOTE: A train and B train durations in the standard 0.05, 0.2, and 1 µmole DNA protocols are equal. They are not equal in the 15 µmole protocols. A two-column synthesis using the larger scale protocol requires more time than a one-column synthesis using the larger scale protocol.



7

7.2.3 Steps in Subcycles

A step is a single line of a cycle that performs a specific function. For example, a step may deliver reagent for a specified duration, or actuate the external event.


• Parts of a step• Creating and editing steps

Parts of a step An example step is shown in Figure 7-3.

Figure 7-3 Example of a Step

12 /* Wsh A */ PULSE 20 0 "Flush system with Wsh A"

Function #

Function

Quantity

Duration

Step Description Delivery

name

mode



7

A step includes:

Creating andediting steps

You can use the Protocol Editor to create new steps or edit existing steps. Note the following:

• Pulse mode is recommended for most applications.

• To perform a function in a step as quickly as possible, enter a duration of 0. When the system encounters a 0 (or a value less than the minimum time required for the function), it performs the function as quickly as possible, and is limited only by the pulse time defined in the function.

Component Description

Function # Specifies the function. Functions are described in Section 7.2.5, Functions in Steps.

Function Name

Description of function (up to 12 characters). Starts and ends with /* and */, for example /* Wsh A to Cl*/

NOTE: Function Name is generated by the system. You cannot modify it. To include comments about a function, add text to the step description field.

Delivery Mode Defines reagent delivery. See Section 7.2.4, Delivery Modes in Steps.

NOTE: “NA” indicates that the step is not performing a delivery function. Delivery mode for special functions is usually “NA.”

Quantity (Arg1)

Specifies volume of reagent delivered and duration of the function.

NOTE: Quantity and Duration may not apply to special functions numbered above 127. Special functions are defined in Table 7-7.

NOTE: Duration (time) is always expressed in seconds. You can type a decimal point and one digit to specify tenths of seconds.

Duration (sec) (Arg 2)

Step Description

Comment (up to 34 characters) that describes the step. Step description is displayed in the Status window when the step is performed during a synthesis.



7

7.2.4 Delivery Modes in Steps

The Expedite Nucleic Acid Synthesis System injectors deliver pulses of reagent (16 µ l per pulse) to the reaction columns. The delivery modes you can specify for the reagent pulses are:

• Pulse• Volume• Flow• Wait



7

ModeDelivers from the injectors specified in

the function...Number of pulses delivered

is equal to...

Pulse Number of pulses specified in the Quantity field over the Duration specified.

Value in Quantity field

Volume Volume specified in the Quantity field over the Duration specified.

(Quantity)/(16 µ l pulse volume)

Any fraction of a pulse remaining is considered a full pulse

Flow Flow rate (µ l/min) specified in the Quantity field over the Duration specified.

NOTE: Maximum flow rate is defined by the pulse volume (16 µ l) and the minimum pulse time for the function.

If you enter a flow rate that exceeds the maximum flow rate allowed by the function, the system delivers reagent at the maximum possible flow rate and extends the Duration to deliver the specified volume of reagent.

(Flow rate x Duration)/ pulse volume (16 µ l)

Any fraction of a pulse remaining is considered a full pulse

Wait No reagent.

Specifies a hold period for the Duration specified.

NOTE: Quantity is not used in Wait Mode. The software enters a 0 in the Quantity field in a step with Wait Mode specified.

None



7

7.2.5 Functions in Steps

There are two types of functions:

• Fluidic functions• Special functions

Fluidic functions The fluidic functions (0–127), specify a combination of valves and pumps that deliver reagent through a given path in the fluidic plate.

Include A train functions in A train subcycles (Deblocking, Capping, and Oxidizing) and B train functions in the Coupling subcycle. To ensure that you include the proper types of functions in a cycle, select functions from the Edit dialog boxes, instead of typing in functions.

CAUTION

If you include A train functions in B train subcycles (or the reverse), reagent is delivered to the wrong column.

Fluidic functions include:

• Single reagent functions—Deliver monomer from one bottle. Described in Table 7-3.

• Chlorinated waste functions—Divert the waste stream to chlorinated waste. Described in Table 7-4.

• Monomer/activator (B-train) functions—Deliver monomer and activator from two bottles. Described in Table 7-5.

• IUB monomer/activator functions—Deliver IUB (mixed site) monomers and activator from multiple bottles. Described in Table 7-6.

Special functions The special functions (128–255) perform specific electromechanical tasks such as controlling external events or acquiring trityl data. Described in Table 7-7.



7

7.2.5.1 Fluidic FunctionsTable 7-3 Single Reagent Functions

Function No.

Bottle Train Pulse TimeFlows the following through the column to

organic waste...

0 none n/a n/a Waits for the specified duration

1 Wsh (1) B 0.36 sec Wash (Bottle 1)

2 Act (4) B 0.36 sec Act (Bottle 4)

3 5 B 0.36 sec Monomer 5

4* 6 (8909 only) B 0.36 sec Monomer 6




8 A B 0.36 sec Monomer A

9 C B 0.36 sec Monomer C

10 G B 0.36 sec Monomer G

11 T/U B 0.36 sec Monomer T (DNA, THIO, USER) or U (RNA)

41 Gas B B 1 sec Gas B

12 Wsh A (8909) Wsh (8905) A 0.22 sec Wsh A through

13 Cap A/Cap B A 0.36 sec Cap A and Cap B simultaneously

15 Ox/SOx A 0.36 sec Ox (DNA, RNA, USER) or SOx (THIO)

17** Aux/SOx (8909) A 0.36 sec Aux (DNA, RNA, USER) or SOx (THIO)

39 Gas A A 1 sec Gas A

40 Gas A A 1 sec Gas A

*When using the 8905, any step with this function number is skipped. 8905 does not include these reservoirs.**When using the 8905, any step with this function number delivers from Ox reservoir. 8905 does not have Aux reservoir.



7

.

Table 7-4 Chlorinated Waste Functions

Function No.

Bottle Train Waste Pulse TimeFlows the following through the column to

chlorinated waste...

16 Dblk A Trt 0.36 sec Deblock

38 Wsh A A Trt 0.22 sec Wsh A

39 Gas A A Trt n/a Gas A

Table 7-5 Monomer/Activator Functions

Function No.

Bottle Train Pulse TimeFlows the following through the column to

organic waste...

18 A, Act B 0.36 sec Monomer A and Act simultaneously

19 C, Act B 0.36 sec Monomer C and Act simultaneously

20 G, Act B 0.36 sec Monomer G and Act simultaneously

21 T/U, Act B 0.36 sec Monomer T (DNA, THIO, USER) or U (RNA) and Act simultaneously

22 5, Act B 0.36 sec Monomer 5 and Act simultaneously







7

Table 7-6 IUB Monomer/Activator (Mixed Sites) Functions

Function No.

Bottle TrainPulse Time

Flows the following through the column to organic waste...

27 A, G, Act B 0.36 sec Monomers A and G (R) and Act simultaneously

28 C, T/U, Act B 0.36 sec Monomers C and T or U (Y) and Act simultaneously

29 A, C, Act B 0.36 sec Monomers A and C (M) and Act simultaneously

30 A, T/U, Act B 0.36 sec Monomers A and T or U (W) and Act simultaneously

31 C, G, Act B 0.36 sec Monomers C and G (S) and Act simultaneously

32 G, T/U, Act

B 0.36 sec Monomers G and T or U (K) and Act simultaneously

33 A, G, T/U, Act

B 0.36 sec Monomers A, G and T or U (D) and Act simultaneously

34 A, C, T/U, Act

B 0.36 sec Monomers A, C and T or U (H) and Act simultaneously

35 A, C, G, Act

B 0.36 sec Monomers A, C and G (V) and Act simultaneously

36 C, G, T/U, Act

B 0.36 sec Monomers C, G and T or U (B) and Act simultaneously

37 A, C, G, T/U, Act

B 0.36 sec Monomers A, C, G and T or U (N) and Act simultaneously



7

7.2.5.2 Special Functions

Table 7-7 Special Functions

Function No Function Arg 1 Arg2 Comment

129 Event 1 out 0—Toggle

1—Set

2—Clear

3—Pulse 100 ms

4—Timed pulse

Not used

Not used

Not used

Not used

Pulse time

Contact closure on external event ports 1 and 2.

Do not use for fraction collector control, because they disregard the active column.

130 Event 2 out

134 Stop Not used Not used Stops instrument. Both columns are halted immediately.

135 Hold Not used Not used Holds each column at the completion of the current cycle.

141 Trityl Monitor 1—Start/acquire Not used Starts sample acquisition at 50Hz for the appropriate column.

0—Stop/integrate Not used Completes data acquisition and generates result.

142 Blow gas, A train Not used Time May be used to force fluid from the A and B trains with gas blanket pressure.143 Blow gas, B train

144 Fraction collect same as 129 same as 129 Same as 129/130 except that the event out is based on the currently running column.



7

7.2.6 Description of the Adenosine (A) Cycle

The Adenosine (A) cycle in the 0.05 µmole DNA standard protocol is shown in Figure 7-4. Line numbers are included at the beginning of each line.

Each cycle includes subcycles (operations) that are delineated by lines beginning with a $ character.

Table 7-8 contains a description of each line in the displayed cycle.



7

Figure 7-4 Adenosine Cycle 0.05 µmole DNA Protocol

/* ----------------------------------------------------------------------------------

*/

/* Function Mode Amount Time(sec) Description */

/* /Arg1 /Arg2 */

/* ----------------------------------------------------------------------------------

*/

$Deblocking

144 /*Index Fract. Coll. */ NA 1 0 "Event out ON"

0 /*Default */ WAIT 0 1.5 "Wait"

141 /*Trityl Mon. On/Off */ NA 1 1 "START data collection"

16 /*Dblk */ PULSE 10 0 "Dblk to column"

16 /*Dblk */ PULSE 50 49 "Deblock"

38 /*Diverted Wsh A */ PULSE 40 0 "Flush system with Wsh A"

141 /*Trityl Mon. On/Off */ NA 0 1 "STOP data collection"

144 /*Index Fract. Coll. */ NA 2 0 "Event out OFF"

$Coupling

1 /*Wsh */ PULSE 5 0 "Flush system with Wsh"

2 /*Act */ PULSE 5 0 "Flush system with Act"

18 /*A + Act */ PULSE 3 0 "Monomer + Act to column"

2 /*Act */ PULSE 4 0 "Chase with Act"

2 /*Act */ PULSE 3 47 "Couple monomer"

1 /*Wsh */ PULSE 3 47 "Couple monomer"

1 /*Wsh */ PULSE 12 0 "Flush system with Wsh"

$Capping

12 /*Wsh A */ PULSE 20 0 "Flush system with Wsh A"

13 /*Caps */ PULSE 8 0 "Caps to column"

12 /*Wsh A */ PULSE 6 15 "Cap"


$Oxidizing

15 /*Ox */ PULSE 15 0 "Ox to column"


$Capping

1

23

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

31

32



7

Table 7-8 Description of Adenosine (A) Cycle

Line Number

Operation (Subcycle)

Function Number

Description

1 to 4 n/a n/a Header text.

5 Start of the deblocking operation.

6 Deblocking

144 Sends a signal to the appropriate event port (depends on active column) to advance a fraction collector for trityl collection.

7 0 A 1.5 second wait to prevent reagent delivery while the fraction collector is advancing.

8 141 Starts data collection from the trityl monitor.

9 16 Delivers 10 pulses of deblock solution to the column quickly to initially saturate the solid support.

Column output is directed to the trityl waste line.

10 16 Deblocks the solid support by delivering 50 pulses of deblock solution over a duration of 49 seconds.


11 38 Quickly flushes the column with 40 pulses Wsh A.


12 141 Stops data collection from the trityl monitor and sends integrated result to the trityl bar graph.

13 144 Stops sending a signal to the event port.

14 Start of the Coupling operation.

15 Coupling 1 Quickly flushes the B train with 5 pulses of Wsh through the column in preparation for delivery of the monomers and activator.

16 2 Quickly flushes the B train with 5 pulses of Act through the column.

17 18 Delivers 3 pulses of monomer A and Act simultaneously to the column.



7

18 Coupling 2 Chases with 4 pulses of Act to push the slug of monomer and activator onto the column.

19 2 Delivers 3 pulses of Act over 47 seconds to slowly push the activated monomer through the column and allow the coupling reaction to occur.

20 1 Delivers 3 pulses of Wsh over 47 seconds to slowly push the activated monomer through the column and allow the coupling reaction to occur.

21 1 Quickly flushes the B train with 12 pulses of Wsh through the column.

22 Start of the first Capping operation.

23 Capping 12 Quickly flushes the A train and column with 20 pulses of Wsh A in preparation for the delivery of the capping reagents.

24 13 Quickly delivers 8 pulses of Cap A and Cap B solutions simultaneously to the column to initially saturate the solid support.

25 12 Delivers 6 pulses of Wsh A over 15 seconds to slowly push the capping solution through the column and allow the capping reaction to occur.

26 12 Quickly flushes the A train and column with 14 pulses of Wsh A in preparation for the delivery of the oxidizing reagent.

27 Start of the Oxidizing operation.

28 Oxidizing 15 Delivers 15 pulses of Ox solution to the column to perform the oxidation.

29 12 Quickly flushes the A train and column with 15 pulses of Wsh A.

30 Start of the second Capping operation.

31 Capping 13 Quickly delivers 7 pulses of Cap A and Cap B solutions simultaneously to the column to perform any additional capping and dry the column.

32 12 Quickly flushes the A train and column with 30 pulses of Wsh A in preparation for the next cycle.

Table 7-8 Description of Adenosine (A) Cycle (Continued)

Line Number

Operation (Subcycle)

Function Number

Description


Determining the Reagent Delivery Volumes for Protocols

7

7.3 Determining the Reagent Delivery Volumes for Protocols

If you are creating a protocol, you must determine the appropriate number of pulses or volume to specify to ensure that reagents reach the column at the appropriate times.

Volume per pulse The delivery volume for a pulse from each injector is approximately 16 µ l.

Pulses for eachreagent

Table 7-9 lists the monomer positions and the approximate number of pulses from the monomer injector to the bottom (inlet) of the column.

Functions that deliver monomer and activator (see Table 7-9 and Table 7-6) deliver a multiple of 16 µ l. For example, a function that delivers 5 pulses of monomer and activator simultaneously is actually delivering 10 pulses of reagent volume.

Table 7-9 Monomer positions and pulses to column

Monomer Position Pulses to column

A 7

C 7

G 8

T/U 8

5 8

6 8

7 8

8 9

9 9



7

Determiningvolume delivered

for a step

The volume delivered for a step is determined by the Delivery mode and the function selected. This section gives examples of how to determine the volume delivered in steps that specify:

• Pulse mode• Volume mode• Flow mode• Wait mode

Pulse mode The example shown in Figure 7-5 specifies delivery of 3 pulses as quickly as possible (Duration of 0) using Function 18.

Figure 7-5 Example of Pulse Mode

Function 18 delivers Monomer A and Activator simultaneously and specifies a minimum pulse time of 0.36 sec.

Therefore, 48 µ l (16µ l* 3 pulses = 48 µ l) of Monomer A is delivered and 48 µ l of Activator is delivered over 1.1 sec (0.36 sec * 3 pulses = 1.10 sec).

Volume mode The example shown in Figure 7-6 specifies delivery of 50 µ l as quickly as possible (Duration of 0) using Function 18.

Figure 7-6 Example of Volume Mode


18 /* A + Act */ PULSE 3 0 "Monomer + Act to column"

18 /* A + Act */ VOLUME 50 0 "Monomer + Act to column"


Determining the Reagent Delivery Volumes for Protocols

7

Therefore, 4 pulses (50 µ l ÷ 16 µ l/pulse rounded up to 4) of Monomer A are delivered and 4 pulses of Activator are delivered over 1.4 sec.

NOTE: Actual delivery volume in this example is 64 µ l and not 50 µ l because the instrument can deliver only in discrete 16 µ l pulses.

Flow mode The example shown in Figure 7-7 specifies delivery at a flow rate of 60 µ l/min for 120 seconds.

Figure 7-7 Example of Flow Mode


Therefore, 8 pulses (60µ l/min x 2 min ÷16 µ l/pulse rounded up to 8) of Monomer A are delivered and 8 pulses of Activator are delivered over 120 seconds.

The maximum flow rate is 2,667 µ l/min (16 µ l ÷ 0.36 seconds, see Figure 7-7).

Wait mode The example shown in Figure 7-8 specifies a waiting period of 1.5 seconds during which no reagent is delivered.

Figure 7-8 Example of Wait Mode

18 /* A + Act */ FLOW 60 120 "Monomer + Act to column"

0 /* Default */ WAIT 0 1.5 "Wait"



7

7.4 Creating and Editing Protocols


• Opening protocols• Using the Protocol Editor windows• Creating a new protocol• Setting scale and chemistry• Editing a protocol• Printing a protocol• Saving and closing protocol• Validating protocols

7.4.1 Opening a Protocol


• Accessing the Protocol Editor• Opening a protocol

Accessing theProtocol Editor

You can access the Protocol Editor in the following ways:

• Select Run Protocol Editor from the Edit menu in the Instrument window.

• You can also access the Protocol Editor by double-clicking the Protocol Editor icon in the Program Manager, if the Workstation application is not opened.


Creating and Editing Protocols

7

The Protocol Editor (Figure 7-9) is displayed.

Figure 7-9 Protocol Editor

Opening aprotocol

To open an existing Expedite protocol in the Protocol Editor window:

1. From the Protocol menu, select Open.

The Open dialog box (Figure 7-10) is displayed.



7

Figure 7-10 Open Dialog Box

NOTE: The last four protocols opened are listed at the bottom of the Protocol menu. You can select one of these protocols to open it, instead of selecting Open.

2. If desired, select a List-by filter to display only selected protocols in the Open dialog box.




7

3. Select the protocol to open.

The Protocol Editor is displayed with the first cycle in the protocol (Figure 7-11).

Figure 7-11 Protocol Editor with First Cycle Displayed

Viewing cycles ina protocol

Only one cycle is displayed at a time. To view other cycles, you can select the following commands from the Search menu:

• Select Cycle• Previous Cycle (or press F7)• Next Cycle (or press F8)



7

7.4.2 Using the Protocol Editor Windows


• Opening multiple protocol windows• Protocol window• Information line

Opening multipleprotocol windows

Each cycle in a protocol is displayed in a separate window.

You can open several protocol windows simultaneously to allow you to:

• Cut and paste steps from one protocol to another • Cut and paste steps from one cycle to another • View cycles in the same protocol

NOTE: To view more than one cycle in a protocol, you must open the same protocol multiple times and advance to the cycle of interest.

The title bar of the active protocol is darkened (Figure 7-12).

Figure 7-12 Protocol Editor Window with Multiple Windows

Two openprotocol

Information linefor activeprotocol

windows



7

Protocol window Each cycle is displayed in a separate window in the Protocol Editor. The title bar for each protocol includes:

• Cycle name• Protocol name

NOTE: If you open the same protocol more than one time (the same protocol is displayed in more than one window), a window number is appended to the protocol name, for example “Cycle A (Adenosine) DNA 0.2 mmole:1” and “Cycle C (Cytosine) DNA 0.2 mmole:2”. Changes you make to the protocol in one window are reflected simultaneously in the other window.

Information line The information line (Figure 7-13) corresponds to the protocol in the active window.

Figure 7-13 Information Line

The information line includes:

• Edit status—Displays “Modified” if any changes have been made. Space is blank if the protocol has not been changed.

• Row/column (1:1)—Position of the cursor in the protocol.

• Subcycle—Subcycle in which cursor is positioned.

• Step—Step number in which the cursor is positioned, relative to entire cycle, not within subcycle.

Edit status

Row/Column

Subcycle Step



7

7.4.3 Creating a New Protocol

To create a new protocol:

1. Select New from the Protocol menu.

The Select Protocol Template dialog box (Figure 7-14) is displayed. Existing protocols are listed in alphabetical order.

Figure 7-14 Select Protocol Template Dialog Box

2. If desired, select a List-by filter to display only selected protocols in the Open dialog box.


3. Select the protocol template to open.

4. Click OK.

The template is displayed with a temporary name of Protocol1.



7

5. From the Protocol menu, select Save As to assign a name to the new protocol.

6. Edit the protocol as needed.

7.4.4 Setting Scale and Chemistry for a Protocol

To set the scale and chemistry:

1. From the Protocol menu, select Summary Info.

2. The Summary Info dialog box (Figure 7-15) is displayed.

NOTE: The Summary Info dialog box is automatically displayed when you select Save As from the Protocol menu.

Figure 7-15 Summary Info Dialog Box

3. Select Scale and Chemistry and click OK.



7

7.4.5 Editing a Protocol


• Inserting or editing a step• Editing a cycle• Finding and replacing text

NOTE: To ensure that you include the correct types of functions in a cycle, use the Edit Step and Insert Step dialog boxes to modify protocols. Only the appropriate functions are displayed for each cycle in these dialog boxes.

7.4.5.1 Inserting or Editing a Step


• Inserting a new step• Editing an existing step

Section 7.5.3, Editing Standard Protocols for Trityl Quantitation, includes an example of inserting steps.

Inserting a newstep

To insert a new step:

1. Place the cursor on the line below which you want to insert the step (the step is inserted above the cursor).

2. Select Insert Step from the Edit menu.

The Step dialog box (Figure 7-16) is displayed.

Figure 7-16 Step Dialog Box



7

3. Enter the appropriate parameters:

4. Click OK to insert the step.

Parameter Description

Description Enter up to 34 characters. Description appears in the instrument window while the step is running.

Function Select a function for the step (see Section 7.2.5, Functions in Steps). Only functions available for the selected chemistry type and subcycle are displayed:

• Only A-train functions are listed deblocking, capping, and oxidizing subcycles.

• Only B-train functions are listed for coupling subcycles.

• Special functions are listed for all cycles.

Operation Select the subcycle (operation). See Section 7.2.2, Subcycles (Operations) in Cycles.

Mode Select the Delivery mode. See Section 7.2.4, Delivery Modes in Steps.

NOTE: Delivery mode is not available if special functions are selected.

Quantity(Arg1)

For functions 0–127, enter the volume of reagent to deliver. Units depend on delivery mode. See Section 7.2.4, Delivery Modes in Steps.

For functions ≥128, enter argument 1 as defined for the function. See Table 7-7, Special Functions, on page 7-18.

Duration (Arg 2)

For functions 0–127, enter the duration of the step in seconds.

For functions ≥128, enter argument 2 as defined for the function. See Table 7-7, Special Functions, on page 7-18.



7

Editing anexisting step

To edit an existing step:

1. Place the cursor on the line to edit, or select Go to line from the Search menu, enter a line number, and click OK.

2. Select Step from the Edit menu.

The Edit Step dialog box is displayed with the parameters for the current step.

3. Edit the parameters as needed. Parameters are described on page 7-35.

4. Click OK to modify the step.

7.4.5.2 Editing a Cycle


• Creating a new cycle• Displaying cycles for editing• Deleting a cycle• Moving a cycle in a protocol

Creating a newcycle

To create a new cycle.

1. Select New cycle from the Edit menu.

The New Cycle dialog box (Figure 7-17) is displayed.

Figure 7-17 New Cycle Dialog Box



7

2. Enter a single-letter identifier. Standard cycles contain identifiers A, C, G, T/U, 5, 6, 7, 8, 9, X, B, D, H, K, M, N, R, S, U, V, W, Y, a, c, g, t. Additional valid identifiers are 0,1, 2, 3, 4, b, d, g, h, k, m, n, r, s, u, v, w, x, y.

NOTE: Identifiers must be unique, so you cannot use an identifier used by cycles in the standard protocols.

3. Enter a description (up to 25 characters).

4. Select the Copy Steps From check box and select the cycle to copy from.

NOTE: Always copy from an existing cycle to ensure that you include all needed parts of a cycle.

5. Click OK.

Displaying cyclesfor editing

To change the cycle displayed in the active protocol window, you can select the following commands from the Search menu:

• Select Cycle• Previous Cycle (or press F7)• Next Cycle (or press F8)

Deleting a cycle To delete the current cycle:

1. Select Delete cycle from the Edit menu.

2. Click Yes.

3. The next cycle in the protocol is displayed.

Moving a cycle ina protocol

To change the order in which cycles are listed in the protocol:

NOTE: Moving a cycle in a protocol does not affect the final result of the synthesis.



7

1. Select Arrange cycle from the Edit menu.

The Arrange Cycles dialog box (Figure 7-18) is displayed.

Figure 7-18 Arrange Cycles Dialog Box

2. Select the cycle to move and click Remove.

3. Select the cycle below which you want to insert the cycle and click Insert.

7.4.5.3 Finding and Replacing Text


• Finding• Replacing

Section 7.5.1, Editing Standard Protocols to Enhance Trityl Intensity, includes an example of finding and replacing text.

Finding To find a text string:

1. Select Find from the Search menu.

The Find Next dialog box (Figure 7-19) is displayed.



7
Figure 7-19 Find Next Dialog Box
2. Type the text to search for in the Find text box.

Hint: If you select text before you select Find, the text is displayed in the Find text box when the dialog box is displayed.

3. Click Forward or Backward to specify the direction of the search.

4. Select as needed:

• Case sensitive—To search only for text that exactly matches the upper and lower case letters entered in the Find text box.

• All cycles—To search all the cycles in the protocol.

5. Click OK.

The Find dialog box stays open during the search.

If the text is found, it is highlighted in the active cycle window. You can continue searching by clicking OK.



7

Replacing To replace a text string:

1. Select Replace from the Search menu.

The Find and Replace dialog box (Figure 7-20) is displayed.

Figure 7-20 Find and Replace Dialog Box

2. Type the text to search for in the Find text box.

Hint: If you select text before you select Replace, the text is displayed in the Find text box when the dialog box is displayed.

3. Type the text to substitute in the Replace With text box.

4. Click Forward or Backward to specify the direction of the search.

5. Select as needed:

• Case sensitive—To search only for text that exactly matches the upper and lower case letters entered in the Find text box.

• All cycles—To search all the cycles in the protocol.



7

6. Click Next to start the search.

The Find and Replace dialog box stays open during the search.

If the text is found, it is highlighted in the active cycle window. You can:

• Click Replace to replace the current text and find the next occurrence of the text.

• Click Replace All to replace all occurrences of the text.

• Click Next to find the next occurrence of the text without replacing the current entry.

7. Click Close to exit the Find and Replace dialog box.

7.4.6 Printing a Protocol


• Print cycle• Print protocol

Print cycle To print the cycle, including summary information:

1. Select the cycle to print.

2. Select Print cycle from the Protocol menu.

The selected cycle prints. A typical cycle printout is shown in Figure 7-21.



7

.

Figure 7-21 Cycle Printout

Print protocol To print the entire protocol, including summary information, select Print protocol from the Protocol menu. The format of the protocol printout is similar to the cycle printout.

Applied Biosystems

Expedite (TM)Nucleic Acid Synthesis System (Workstation)



7

7.4.7 Displaying Summary Information

To display summary information:

1. Select Summary Info from the Protocol menu to display the Summary Information dialog box (Figure 7-22) for a sequence.

Figure 7-22 Summary Information Dialog Box

The Summary Information dialog box displays information entered when the protocol was saved.



7

2. Click Statistics to display the Protocol File Statistics dialog box (Figure 7-23).

Figure 7-23 Protocol File Statistics

The Protocol Statistics dialog box displays:

• Date and time the protocol was first created• Date and time it was last saved• Number of cycles• Total number of steps

3. Click OK to close the dialog box.

7.4.8 Saving and Closing a Protocol


• Protocol names• Saving• Entering summary information• Closing a protocol• Exiting the Protocol Editor

Protocol names Sequence, protocol, and report names:

• Can contain up to 30 characters

• Can contain any combination of keyboard characters, including spaces

• Must be unique regardless of case, within each category (for example, protocols)



7

NOTE: Names are stored according to the case you enter, but are not case-sensitive. That is, PRO1 and Pro1 are seen as the same name.

Saving To save the protocol in the active window:

1. From the Protocol menu, select Save or Save As:

• If you are saving a previously saved protocol, the protocol is saved with the same name.

• If you are saving a new protocol, the Save Protocol As dialog box (Figure 7-24) is displayed.

Figure 7-24 Save Protocol As Dialog Box

2. Select the folder in which to save the protocol.

3. Enter the protocol name.

4. Click OK.



7

The Summary Information dialog box (Figure 7-25) is displayed. See “Entering summary information” on page 7-46.

Enteringsummary

information

Summary information includes the scale and chemistry for the protocol, as well as information that you can use to filter protocols when searching and sorting in the database.

To enter summary information:

1. Display the protocol of interest.

2. From the Protocol menu, select Summary Info.

The Summary Information dialog box (Figure 7-25) is displayed.

NOTE: The Summary Info dialog box is automatically displayed when you select Save As from the Protocol menu.

.

Figure 7-25 Protocol Summary Dialog Box



7

3. Type information as needed in the following text boxes:

• Author (up to 30 characters)• Project (up to 30 characters)• Source (up to 30 characters)

4. Type in a comment as needed. Press Ctrl+Enter to create a line break.

5. Click OK.

Closing aprotocol

To close a protocol, select Close from the Protocol menu.

Exiting theProtocol Editor

Select Exit from the Protocol menu to close the Protocol Editor.

7.4.9 Validating a Protocol

The text entered in the protocol window is automatically validated (checked for errors) when you select:

• Next Cycle or Previous Cycle from the Search menu. If an error occurs, the next or previous cycle is not displayed.

• Save or Save as from the Protocol menu. If an error occurs, the protocol is not saved.

NOTE: You can manually validate by selecting Validate from the Protocol menu.

During validation During validation, the software checks for proper spelling and arrangement of the protocol. It formats and adds spaces to the protocol where needed.



7

If validation fails If an error occurs (validation fails), a message provides a description of the error and the line number. Table 7-10 describes validation error messages. These errors are often caused by manually editing a protocol, or cutting and pasting information, instead ofusing the Edit dialog boxes.

Table 7-10 Validation Error Messages

Message Explanation

Invalid function number

You specified a special function number (≥128), that is not supported.

NOTE: Unsupported function number for fluidic functions (0–128) are noted as “/* Unknown */” after validation.

Number is out of range

Special Functions—arg 1 and arg 2 must be ≥0.

Fluidic Functions:

• Quantity must be >0 or <6,550.

• Duration must be >0 or <6,550.

Bad token, or Invalid Subcycle

You specified a subcycle other than the valid operations (subcycles) Deblocking, Coupling, Oxidizing and Capping.

Invalid delivery mode Bad or missing Delivery Mode.

String is too long Step description is longer than 34 characters or does not include final quotation mark.

Nested comments are not allowed

A “/*” character sequence is followed by another “/*” without a “*/” between them.

Comment block is not terminated

A “/*” character sequence is not followed by “*/”.


Protocol Editing Examples

7

Correctingvalidation errors

If validation errors occur, edit the protocol to correct the error specified.

Hint: You can display a standard protocol to examine the correct format of a protocol.

7.5 Protocol Editing Examples

This section includes the following:

• Editing standard protocols to enhance trityl intensity • Creating an RNA protocol from a THIO protocol • Editing standard protocols for trityl quantitation • Editing standard protocols to add a specialized

monomer

7.5.1 Editing Standard Protocols to Enhance Trityl Intensity

NOTE: This section illustrates how to find and replace text in a protocol.

Trityl fractions collected with standard protocols may fade because a small quantity of base from the final capping subcycle remains in the line after the column.

To prevent fading, edit the protocol to increase the end of cycle wash from 30 to 45 pulses.

Editing To edit the protocol:

1. Open the protocol to edit.

2. Advance to the last line of the Capping subcycle (function 12, End of cycle wash).



7

3. Click-drag over the last line to select it (Figure 7-26).

Figure 7-26 Typical Final Capping Subcycle Before Editing

4. Select Replace from the Search menu.

5. In the Find and Replace dialog box, type 12 /*wsh A */ 7 Pulse 45 “End of cycle wash” in the Replace with box.

NOTE: You do not need to enter the text between the /* and */ because this is text the software automatically inserts based on the function number. Spacing and capitalization do not matter because the software will format approximately when the cycle is validated.

6. Select All Cycles. Click Replace All.

7. When the Next Cycle dialog box appears, click Yes.

8. When the Next Cycle dialog box is displayed again, click No.

9. Press F7 or F8 to view all cycles and Inspect for a complete and accurate change.

$Capping

13 /* Caps */ PULSE 7 0 "Caps to Column"

12 /* Wsh A */ PULSE 7 30 "End of cycle wash”



7

The edited subcycle displaying the new pulse times in bold appears similar to the one in Figure 7-27.

Figure 7-27 Modified Final Capping Subcycle for Trityl Collection

10. Select Save from the Protocol menu.

7.5.2 Creating an RNA Protocol from a THIO Protocol

NOTE: This section illustrates how to copy and paste text in a protocol.

Standard protocols are provided to synthesize DNA with a thiophosphate backbone. However, no RNA protocol is provided to synthesize RNA with a thiophosphate backbone.

You can create the RNA protocol by copying the Oxidizing subcycle from the THIO 1 µmole protocol and pasting it into the Oxidizing subcycle of the RNA 1 µmole protocol. This alters the RNA protocol by adding:

• Function to add SOx• Extra wash

Editing To create the RNA protocol:

1. Open the THIO 1 µmole protocol in the Protocol Editor.

$Capping

13 /* Caps */ PULSE 7 0 "Caps to Column"

12 /* Wsh A */ PULSE 7 45 "End of cycle wash”



7

2. Open the RNA 1 µmole protocol in the Protocol Editor.

3. From the Window menu, select Tile, to display the windows side-by-side so you can easily view both.

4. Click the THIO protocol. Advance to the Oxidizing subcycle (Figure 7-28).

Figure 7-28 Oxidizing Subcycle from THIO 1 umole

Copying 5. Click-drag the cursor over the entire Oxidizing subcycle to select it.


7. Click the RNA protocol. Advance to the Oxidizing subcycle (Figure 7-29).

Figure 7-29 Oxidizing Subcycle from RNA 1 umole

8. Delete the two existing lines (Function 15 and 12).

Pasting 9. Select Paste from the Edit menu.

The Oxidizing subcycle from the THIO 1 µmole protocol is included in the RNA 1 µmole protocol.

$Oxidizing

17 /* SOx */ PULSE 15 0 "SOx to column"

12 /* Wsh A */ PULSE 6 60 "Slow pulse to thioate"

12 /* Wsh A */ PULSE 9 0 "Flush system with Wsh

$Oxidizing 15 /* Ox */ PULSE 20 0 "Ox to column"12 /* Wsh A */ PULSE 15 0 "Flush system with Wsh A"



7

10. Paste the oxidizing information into all necessary cycles.

After validation, the new Oxidizing subcycle should be similar to Figure 7-30.

Figure 7-30 New Oxidizing Subcycle


Thioated RNAmolecular

weights

The RNA protocol does not accurately calculate the molecular weight for the thioated RNA.

If needed, you can add 16.06 to the molecular weights in the Constants dialog box (Section 6.5.2, Setting Molecular Weights), or manually calculate the correct molecular weight for a fully thioated sequence using the formula below:

Thioated MW = MW + (length-1)* 16.06

$Oxidizing 17 /* Aux */ PULSE 15 0 "SOx to column" 12 /* Wsh A */ PULSE 6 60 "Slow pulse to thioate" 12 /* Wsh A */ PULSE 9 0 "Flush system with Wsh A"



7

7.5.3 Editing Standard Protocols for Trityl Quantitation

NOTE: This section illustrates how to insert steps and copy and paste in a protocol.

Qualitativeanalysis

Standard protocols are designed for qualitative evaluation of trityls only. Standard protocols deliver a portion of the trityls from two cycles to each tube.

Quantitativeanalysis

To collect the trityls for a quantitative assay, edit protocols so that the trityl fraction from one cycle is delivered to a single tube. Edit the protocol to do the following:

• Increase the wash after the deblocking • Blow out the line to the tube with diverted Gas A

NOTE: To maintain proper scale estimation, do not change the Deblocking subcycle before the trityl monitor is turned off (function 141, Stop data collection).



2. Advance to the Deblock subcycle.

Figure 7-31 shows a typical Deblocking subcycle from a standard protocol.



7
Figure 7-31 Typical Deblocking Subcycle Before Editing
3. Position the cursor on the last line of the Deblocking subcycle (function 144, Event out OFF).

Inserting step todivert Gas A

4. Select Insert step from the Edit menu.

5. In the Insert Step dialog box select the following:

6. Click OK.

$Deblocking

144 /*Index Fract. Coll. */ NA 1 0 "Event out ON"

0 /*Default */ WAIT 0 1.5 "Wait"

141 /*Trityl Mon. On/Off */ NA 1 1 "START data collection"

16 /*Dblk */ PULSE 10 0 "Dblk to column"

16 /*Dblk */ PULSE 50 49 "Deblock"

38 /*Diverted Wsh A */ PULSE 40 0 "Flush system with Wsh A"

141 /*Trityl Mon. On/Off */ NA 0 1 "STOP data collection"

144 /*Index Fract. Coll. */ NA 2 0 "Event out OFF"

Function: 39: Diverted Gas A

Operation: Deblocking

Mode: Pulse

Quantity: 1

Duration: 5



7

Inserting step todivert Wsh A

7. Select Insert step from the Edit menu.

8. In the Insert Step dialog box select the following:

9. Click OK.

The edited subcycle should be similar to Figure 7-32.

Figure 7-32 Typical Deblock Subcycle after Editing

Copying the editedsubcycle to

remaining cycles

Changes you make to one cycle do not change information in other cycles. Copy the changes to remaining cycles:

1. Click-drag the cursor over the two inserted lines to select them.


3. Press F8 to go to the next cycle.

Function: 38: Diverted Wsh A

Operation: Deblocking

Mode: Pulse

Quantity: 40

Duration: 0

$Deblocking 144 /*Index Fract. Coll. */ NA 1 0 "Event out ON" 0 /*Default */ WAIT 0 1.5 "Wait" 141 /*Trityl Mon. On/Off */ NA 1 1 "START data collection" 16 /*Dblk */ PULSE 10 0 "Dblk to column" 16 /*Dblk */ PULSE 50 49 "Deblock" 38 /*Diverted Wsh A */ PULSE 40 0 "Flush system with Wsh A" 141 /*Trityl Mon. On/Off */ NA 0 1 "STOP data collection" 38 /*Diverted Wsh A */ PULSE 40 0 "Diverted Wsh A" 39 /*Diverted Gas A */ PULSE 1 5 "Diverted Gas A" 144 /*Index Fract. Coll. */ NA 2 0 "Event out OFF"



7

4. Place the cursor at the beginning of the last line of the Deblocking subcycle (to insert the two copied lines above the last line).

5. Select Paste from the Edit menu.

6. Repeat step 3 through step 5 for all appropriate cycles.


7.5.4 Editing Standard Protocols to Add a Specialized Monomer

NOTE: This section illustrates how to replace steps in a protocol.

You can add a specialized monomer by installing it in Bottle 5, then editing the corresponding cycle.

NOTE: This example assumes that the coupling time required for complete incorporation is two times the coupling time in the standard protocol.



2. Press F8 until Cycle 5 is displayed.



7

Figure 7-33 shows the Coupling subcycle from Cycle 5 of the DNA 0.05 µmole protocol.

Figure 7-33 Cycle 5 Coupling Subcycle Before Editing

3. Place the cursor on the fifth line of the Coupling subcycle (function 2, Couple monomer).


5. In the Edit Step dialog box, change the Duration from 31 to 62 sec.

6. Place the cursor on the sixth line of the Coupling subcycle (function 1, Couple monomer).


8. In the Edit Step dialog box, change the Duration from 63 to 126 sec.

$Coupling

1 /*Wsh */ PULSE 5 0 “Flush system with Wsh”

2 /*Act */ PULSE 5 0 “Flush system with Act”

22 /*5 + Act */ PULSE 3 0 “Monomer + Act to column”

2 /*Act */ PULSE 5 0 “Chase with Act”

2 /*Act */ PULSE 2 31 “Couple monomer”

1 /*Wsh */ PULSE 4 63 “Couple monomer”




7

The edited subcycle should be similar Figure 7-34.

Figure 7-34 Cycle 5 Coupling Subcycle After Editing

Hint: Specialized reagents are often used in small quantities and can be very expensive. To minimize waste, prime using Prime All or Prime Monomers from the Prime menu. These routines prime the monomers with only 10 pulses. Prime Individual routines use 20 pulses for all reagents and monomers.

$Coupling


2 /*Act */ PULSE 5 0 “Flush system with Act”

22 /*5 + Act */ PULSE 3 0 “Monomer + Act to column”

2 /*Act */ PULSE 5 0 “Chase with Act”

2 /*Act */ PULSE 2 62 “Couple monomer”

1 /*Wsh */ PULSE 4 126 “Couple monomer”




7

7.6 Protocol Editor Menus

This section gives an overview of Protocol Editor menus.

NOTE: If no protocols are open, only the Protocol and Help menus are available.

Figure 7-35 Protocol Editor Menus


Protocol Editor Menus

7

Table 7-11 Protocol Editor Menus


Protocol New Create a new protocol. See Section 7.4.3, Creating a New Protocol.

Open Open an existing protocol. See Section 7.4.1, Opening a Protocol.

Close Close all windows associated with the protocol in the active window. See Section 7.4.8, Saving and Closing a Protocol.

Save Save the protocol in the active window. See Section 7.4.8, Saving and Closing a Protocol.

Save as Assign a new name and save the protocol in the active window. See Section 7.4.8, Saving and Closing a Protocol.

Validate Check for errors in the protocol in the active window. See Section 7.4.9, Validating a Protocol.

Print cycle Print the text in the active window. See Section 7.4.6, Printing a Protocol.

Print protocol

Print the entire protocol. See Section 7.4.6, Printing a Protocol.

Organize folders

Manage protocols within folders. See Section 4.3, Managing Data in the Database.



7

Protocol (continued)

Summary Info

Display summary information for individual protocols. Allows you to change Chemistry type. See Section 7.4.7, Displaying Summary Information.

Protocol List View and/or access four most recently used protocols.

Exit Exit the Protocol Editor. See “Exiting the Protocol Editor” on page 7-47.

Edit Undo Undo the last editing change.

Cut Remove the selected text and put it in the Clipboard.

Delete Erase the selected text.

Copy Copy the selected text to the Clipboard.

Paste Paste the contents of the Clipboard at the cursor location.

Insert Step Insert a new step before the step above the cursor. See Section 7.4.5.1, Inserting or Editing a Step.

Step Edit the step at the cursor location. See Section 7.4.5.1, Inserting or Editing a Step.

New cycle Create a new cycle from a template. See Section 7.4.5.2, Editing a Cycle.

Delete cycle Delete the cycle from the protocol. See “Deleting a cycle” on page 7-37.

Arrange cycles

Change the order of cycles in the protocol listing. See “Moving a cycle in a protocol” on page 7-37.

Table 7-11 Protocol Editor Menus (Continued)



Protocol Editor Menus

7

Search Find Locate a specific text string. See Section 7.4.5.3, Finding and Replacing Text.

Replace Locate a specific text string and replace it with another. See Section 7.4.5.3, Finding and Replacing Text.

Select cycle Locate a cycle by name. See “Viewing cycles in a protocol” on page 7-29.

Previous cycle

Display the previous cycle. See “Viewing cycles in a protocol” on page 7-29.

Next cycle Display the next cycle. See “Viewing cycles in a protocol” on page 7-29.

Go to line Locate a specific line number in the active window.

Window Next Activate the next window.

Tile Arrange windows so that all are visible and not overlapped.


Message Create or activate the Message Window.

Window List Lists the most recent cycles open.

Help Contents Displays online help.

Table 7-11 Protocol Editor Menus (Continued)



AInstalling the SerialBoard A

This appendix contains the following sections:

A.1 Configuring the Serial Board ................... A-2

A.2 Installing the Serial Board ....................... A-3

A.3 Connecting the Workstation to the Instrument .................................... A-4

Hardwarerequirements

See Section 1.2, Hardware Requirements.

Expedite 8900 Workstation Software User’s Guide A-1

Appendix A Installing the Serial Board

A
A.1 Configuring the Serial Board
The serial board is preconfigured with an address of 238-23F. If this address conflicts with another device on your computer, you can use any of the addresses listed below. Refer to the instructions provided with the serial board to set the new address.

Table A-1 Serial Board Address Options

Dip Switch Address Comment

S1-1 238-23F HEX Default address

S1-2 2B8-2BF HEX

S1-3 338-33F HEX

S1-4 3B8-3BF HEX Cannot be used if monochrome adapter is installed

S1-5 278-27F HEX May conflict with a printer connected to LPT2

S1-6 2F8-2FF HEX COM2—Avoid if possible

S1-7 378-37F HEX May conflict with a printer connected to LPT1

S1-8 3F8-3FF HEX COM1—Avoid if possible

Note: To disable the port, leave all the switches open.

A-2 Applied Biosystems

A
A.2 Installing the Serial Board
To install the serial board in the computer that will run your Expedite 8900 Workstation Software:

WARNING

Power down and unplug the computer before performing this procedure.

1. Remove the top cover from the computer.

2. Remove the blank metal slot cover from expansion slot 2, 3, or 4 in the computer.

NOTE: Do not install the serial board in slot 1 (the top slot) because the adapter will not fit into the DB25 connector on the board.

Figure A-1 Expansion Slots

Expansion Slots



A
3. Insert the serial board in the expansion slot.
4. Replace the screw to secure the SI0-485 GT serial board.

5. Replace the cover on the computer.

6. Attach the RJ-45 adapter to the DB 25 connector (25 pin) on the SI0-485 GT serial board in the computer rear panel.

A.3 Connecting the Workstation to the Instrument

To connect the workstation to the instrument:

1. Insert one end of the communications cable into the RJ-45 adapter on the rear panel of the workstation.

2. Connect the other end of the communications cable to one of the RS-422 ports on the top cover of the instrument (Figure A-2).

NOTE: Do not connect the communications cable to the port labeled “Option.”

Figure A-2 Connect Communications Cable to RS422 Port

UPS EVENT OUT

1 2

PRINTER RS-422 OPTION

RS422 Ports


A
3. If required, connect one end of a second communications
cable to the second RS-422 port and connect the other end to the RS-422 port of a second instrument.

You can connect up to six instruments in to one workstation. Do not exceed a total cable length of 6,000 feet.

NOTE: If any instrument includes a Multiple Oligo Synthesis System (MOSS) unit, you can control only four instruments from the Expedite Workstation.

Extending theRS-422 Cable

The communications cable provided with workstation is 14 feet long. If necessary, you can extend the length of the RS–422 cable:

• Create a length of 8–conductor wire and connect the RJ–45 connector so that pin 1 mates with pin 1, and so on.

• Use an RJ–45 wall mounted jack. Connect pins 2, 4, 6, 8 of the first jack to pins 2, 4, 6, 8 pairing 2 with 4, and 6 with 8 as shown in Figure 1-3. (The other pins (1,3,5,7) do not need to be connected).



A

Figure 1-3 RJ-45 to RJ-45 Connections to Extend the RS-422 Cable

Installing thesoftware andestablishing

communications

Install the Expedite Workstation software (see Section 1.4, Installing the Software) and select the appropriate address and interrupt numbers.

NOTE: If the Expedite Workstation is already installed, run the installation program a second time. You can exit the installation program after you select the appropriate communications port address and interrupt numbers.

Establish communications between the workstation and the instruments as described in Chapter 2, Preparing the System.

12345678 12345678

orange

red

yellow

grey

TxD +

TxD –

RxD +

RxD –


BWarranty/ServiceInformation B

Applied Biosystems supplies or recommends certain configurations of computer hardware, software, and peripherals for use with its instrumentation. Applied Biosystems reserves the right to decline support for or impose extra charges for supporting non-standard computer configurations or components that have not been supplied or recommended by Applied Biosystems. Applied Biosystems also reserves the right to require that computer hardware and software be restored to the standard configuration prior to providing service or technical support.

B.1 Limited Product Warranty

Warranty period Applied Biosystems warrants that the software designated for use with the instrument will execute its programming instructions when properly installed on the product. Applied Biosystems does not warrant that the operation of the instrument or software will be uninterrupted or error free. Applied Biosystems will provide any software corrections or “bug-fixes”, if and when they become available, for a period of one (1) year after installation.

Expedite 8900 Workstation Software User’s Guide B-1

Appendix B Warranty/Service Information

B

Warranty periodeffective date

Any applicable warranty period will begin on the date of installation, but no later than fifteen (15) months from the date of shipment, for software installed by Applied Biosystems personnel. For software installed by the buyer or any person other than Applied Biosystems, the applicable warranty period will begin the date the product is received.

Warrantyexceptions

The above warranties shall not apply to defects resulting from misuse, negligence, or accident, including without limitation, installation of software or interfacing not supplied by Applied Biosystems or modification of the instrument or the software not authorized by Applied Biosystems.

Warrantylimitations

THE FOREGOING PROVISIONS SET FORTH APPLIED BIOSYSTEMS SOLE AND EXCLUSIVE REPRESENTATIONS, WARRANTIES, AND OBLIGATIONS WITH RESPECT TO THE PRODUCTS, AND APPLIED BIOSYSTEMS MAKES NO OTHER WARRANTY, REPRESENTATION, GUARANTEE OR AGREEMENT OF ANY KIND WHATSOEVER, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE, WHETHER ARISING FROM A STATUTE, CUSTOM, PRIOR ORAL OR WRITTEN STATEMENTS BY APPLIED BIOSYSTEMS, OR OTHERWISE IN LAW OR FROM A COURSE OF DEALING OR USAGE OF TRADE. SUCH LIMITED WARRANTY IS GIVEN ONLY TO THE BUYER OF THIS PRODUCT FROM APPLIED BIOSYSTEMS OR APPLIED BIOSYSTEMS AUTHORIZED DISTRIBUTOR, AND NOT TO ANY THIRD PARTY. LAWS FROM TIME TO TIME IN FORCE IN A TERRITORY MAY IMPLY WARRANTIES WHICH CANNOT BE EXCLUDED OR CAN ONLY BE EXCLUDED TO A LIMITED EXTENT. THE FOREGOING LIMITATIONS SHALL BE READ AND CONSTRUED TO EXCLUDE ALL WARRANTIES, EXPRESS OR IMPLIED, TO THE FULLEST EXTENT PERMITTED BY ANY SUCH STATUTORY PROVISIONS.

B-2 Applied Biosystems

B

Limited remedies THE REMEDIES PROVIDED HEREIN ARE BUYER'S SOLE AND EXCLUSIVE REMEDIES. WITHOUT LIMITING THE GENERALITY OF THE FOREGOING, IN NO EVENT SHALL APPLIED BIOSYSTEMS BE LIABLE, WHETHER IN CONTACT, TORT, WARRANTY OR UNDER ANY STATUTE (INCLUDING WITHOUT LIMITATION ANY TRADE PRACTICE, UNFAIR COMPETITION OR OTHER STATUTE OF SIMILAR IMPORT) OR ON ANY OTHER BASIS, FOR DIRECT, INDIRECT, PUNITIVE, INCIDENTAL, CONSEQUENTIAL, OR SPECIAL DAMAGES SUSTAINED BY BUYER OR ANY OTHER PERSON OR ENTITY, WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT APPLIED BIOSYSTEMS HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES, INCLUDING WITHOUT LIMITATION, DAMAGES ARISING FROM OR RELATED TO LOSS OF USE, LOSS OF DATA, FAILURE OR INTERRUPTION IN THE OPERATION OF ANY EQUIPMENT OR SOFTWARE, DELAY IN REPAIR OR REPLACEMENT, OR FOR LOSS OF REVENUE OR PROFITS, LOSS OF GOOD WILL, LOSS OF BUSINESS OR OTHER FINANCIAL LOSS OR PERSONAL INJURY OR PROPERTY DAMAGE.

B.2 Damages, Claims, Returns

Damages Please unpack any shipments promptly after receipt to check for any damage.

If you discover damage, stop unpacking. Contact the shipping carrier and request inspection by a local agent. Secure a written report of the findings to support the claim. Do not return damaged goods to Applied Biosystems without first securing an inspection report, and contacting Applied Biosystems Technical Support for a Return Authorization (RA) number.

Forward any damage inspection report immediately to Applied Biosystems.

Expedite 8900 Workstation Software User’s Guide B-3

Appendix B Warranty/Service Information

B

Claims After a damage inspection report is obtained, subject to any necessary investigation, Applied Biosystems will supply replacements if warranted, and process or provide reasonable assistance in processing any claim.

Returns Do not return any material without prior notification and authorization.

If any material is to be returned, please contact Applied Biosystems Technical Support, or your nearest Applied Biosystems subsidiary or distributor for a Return Authorization (RA) number and forwarding address.

Place the RA number in a prominent location on the outside of the shipping container, and return the material to the appropriate address.

B-4 Applied Biosystems

C Technical Supportand Training C

This appendix contains the following sections:C.1 Contacting Technical Support .......................... C-2

C.2 Obtaining Technical Documents ...................... C-9

C.3 Obtaining Customer Training Information........ C-11

Expedite™ 8900 User’s Guide C-1

Appendix C Technical Support and Training

C

C.1 Contacting Technical Support

Overview You can contact Applied Biosystems for technical support:

• By e-mail• By telephone or fax• Through the Applied Biosystems Technical Support

web site

NOTE: For information on obtaining technical documents such as Applied Biosystems user documents, MSDSs, and certificates of analysis, see “Obtaining Technical Documents” on page -9.

By E-mail You can contact technical support by e-mail for help in the product areas listed below.

Product/Product Area E-Mail Address

Genetic Analysis (DNA Sequencing) [email protected]

Sequence Detection Systems and PCR [email protected]

Protein Sequencing, Peptide, and DNA Synthesis [email protected]

BiochromatographyPerSeptive DNA, PNA and Peptide Synthesis systemsFMAT 8100 HTS SystemCytoFluor® 4000 Fluorescence Plate ReaderMariner Mass SpectrometersVoyager Mass SpectrometersMass Genotyping Solution 1™ (MGS1) System

[email protected]

LC/MS (Applied Biosystems/MDS Sciex)

[email protected]

Chemiluminescence (Tropix) [email protected]

C-2 Applied Biosystems

C

By telephone orfax (NorthAmerica)

To contact Applied Biosystems Technical Support in North America, use the telephone or fax numbers in the table below.

NOTE: To schedule a service call for other support needs, or in case of an emergency, dial 1.800.831.6844, then press 1.

Product/Product Area Telephone Fax

ABI PRISM ® 3700 DNA Analyzer 1.800.831.6844, then press 81

1.650.638.5981

DNA Synthesis 1.800.831.6844, press 2, then press 11

1.650.638.5981

Fluorescent DNA Sequencing 1.800.831.6844, press 2, then press 21

1.650.638.5981

Fluorescent Fragment Analysis (including GeneScan® applications)

1.800.831.6844, press 2, then press 31

1.650.638.5981

Integrated Thermal Cyclers (ABI PRISM® 877 and Catalyst 800 instruments)

1.800.831.6844, press 2, then press 41

1.650.638.5981

ABI PRISM® 3100 Genetic Analyzer 1.800.831.6844, press 2, then press 61

1.650.638.5981

Peptide Synthesis (433 and 43x Systems)

1.800.831.6844, press 3, then press 11

1.650.638.5981

Protein Sequencing (Procise® Protein Sequencing Systems)

1.800.831.6844, press 3, then press 21

1.650.638.5981



C

PCR and Sequence Detection 1.800.762.4001, then press:

1 for PCR1

2 for TaqMan® applications and Sequence Detection Systems including ABI Prism‚ 7700, 7900, and 57001

6 for the 6700 Automated Sample Prep System1

or

1.800.831.6844, then press 51

1.240.453.4613

Voyager MALDI-TOF Biospectrometry Workstations

Mariner ESI-TOF Mass Spectrometry Workstations

Mass Genotyping Solution 1™ (MGS1) System

1.800.899.5858, press 1, then press 32

1.508.383.7855

Biochromatography (BioCAD®, SPRINT, VISION, and INTEGRAL® Workstations and POROS® Perfusion Chromatography Products)

1.800.899.5858, press 1, then press 42

1.508.383.7855

Expedite Nucleic Acid Synthesis Systems

1.800.899.5858, press 1, then press 52

1.508.383.7855

Peptide Synthesis (Pioneer and 9050 Plus Peptide Synthesizers)

1.800.899.5858, press 1, then press 52

1.508.383.7855



C

By telephone orfax (outside North

America)

To contact Applied Biosystems Technical Support or Field Service outside North America, use the telephone or fax numbers below.

PNA Custom and Synthesis 1.800.899.5858, press 1, then press 52

1.508.383.7855

FMAT 8100 HTS System

CytoFluor® 4000 Fluorescence Plate Reader

1.800.899.5858, press 1, then press 62

1.508.383.7855

Chemiluminescence (Tropix) 1.800.542.2369 (U.S. only),or 1.781.271.00453

1.781.275.8581

LC/MS (Applied Biosystems/MDS Sciex)

1.800.952.4716 1.508.383.7899

1. 5:30 A.M. to 5:00 P.M. Pacific time.

2. 8:00 A.M. to 6:00 P.M. Eastern time.

3. 9:00 A.M. to 5:00 P.M. Eastern time.


Region Telephone Fax

Africa and the Middle East

Africa (English Speaking; Fairlands, South Africa)

27 11 478 0411 27 11 478 0349

Africa (French Speaking; Courtaboeuf Cedex, France)

33 1 69 59 85 11 33 1 69 59 85 00

South Africa (Johannesburg) 27 11 478 0411 27 11 478 0349



C

Middle Eastern Countries and North Africa (Monza, Italia)

39 (0)39 8389 481 39 (0)39 8389 493

Eastern Asia, China, Oceania

Australia (Scoresby, Victoria) 61 3 9730 8600 61 3 9730 8799

China (Beijing) 86 10 64106608 or86 800 8100497

86 10 64106617

Hong Kong 852 2756 6928 852 2756 6968

India (New Delhi) 91 11 653 3743/3744 91 11 653 3138

Korea (Seoul) 82 2 5936470/6471 82 2 5936472

Malaysia (Petaling Jaya) 60 3 79588268 603 79549043

Singapore 65 896 2168 65 896 2147

Taiwan (Taipei Hsien) 886 2 2358 2838 886 2 2358 2839

Thailand (Bangkok) 66 2 719 6405 662 319 9788

Europe

Austria (Wien) 43 (0)1 867 35 75 00 43 (0)1 867 35 75 11

Belgium 32 (0)2 532 4484 32 (0)2 582 1886

Czech Republic and Slovakia (Praha) 420 2 35365189 420 2 35364314

Denmark (Naerum) 45 45 58 60 00 45 45 58 60 01

Finland (Espoo) 358 (0)9 251 24 250 358 (0)9 251 24 243

France (Paris) 33 (0)1 69 59 85 85 33 (0)1 69 59 85 00

Germany (Weiterstadt) 49 (0) 6150 101 0 49 (0) 6150 101 101

Hungary (Budapest) 36 (0)1 270 8398 36 (0)1 270 8288

Italy (Milano) 39 (0)39 83891 39 (0)39 838 9492

Norway (Oslo) 47 23 12 06 05 47 23 12 05 75



C

Poland, Lithuania, Latvia, and Estonia (Warszawa)

48 22 866 4010 48 22 866 4020

Portugal (Lisboa) 351.(0)22.605.33.14 351.(0)22.605.33.15

Russia (Moskva) 7 502 935 8888 7 502 564 8787

South East Europe (Zagreb, Croatia) 385 1 34 91 927/838 385 1 34 91 840

Spain (Tres Cantos) 34.(0)91.806.1210 34.(0)91.806.12.06

Sweden (Stockholm) 46 (0)8 619 4400 46 (0)8 619 4401

Switzerland (Rotkreuz) 41 (0)41 799 7777 41 (0)41 790 0676

The Netherlands (Nieuwerkerk a/d IJssel)

31 (0)180 392400 31 (0)180 392409 or31 (0)180 392499

United Kingdom (Warrington, Cheshire)

44 (0)1925 825650 44 (0)1925 282502

All other countries not listed (Warrington, UK)

44 (0)1925 282481 44 (0)1925 282509

Japan

Japan (Hacchobori, ChuoKu, Tokyo) 81 3 5566 6230 81 3 5566 6507

Latin America

Caribbean countries, Mexico, and Central America

52 55 35 3610 52 55 66 2308

Brazil 0 800 704 9004 or 55 11 5070 9654

55 11 5070 9694/95

Argentina 800 666 0096 55 11 5070 9694/95

Chile 1230 020 9102 55 11 5070 9694/95

Uruguay 0004 055 654 55 11 5070 9694/95




C

Through theTechnical Support

web site

To contact Technical Support through the Applied Biosystems web site:

T

1. Access the Applied Biosystems Technical Support web site at www.appliedbiosystems.com/techsupp.

2. Under the Troubleshooting heading, click Support Request Forms, then select the support region for the product area of interest.

3. In the Personal Assistance form, enter the requested information and your question, then click Ask Us RIGHT NOW.

4. In the Customer Information form, enter the requested information, then click Ask Us RIGHT NOW.

Within 24 to 48 hours, you will receive an e-mail reply to your question from an Applied Biosystems technical expert.


C

C.2 Obtaining Technical Documents

Overview You can obtain technical documents, such as Applied Biosystems user documents, MSDSs, certificates of analysis, and other related documents for free, 24 hours a day. You can obtain documents:

• By telephone• Through the Applied Biosystems Technical Support

web siteOrdering

documents bytelephone

To order documents by telephone:

1. From the U.S. or Canada, dial 1.800.487.6809, or from outside the U.S. and Canada, dial 1.858.712.0317.

2. Follow the voice instructions to order documents (for delivery by fax).

NOTE: There is a limit of five documents per fax request.

Obtainingdocumentsthrough the

web site

To view, download, or order documents through the Applied Biosystems Technical Support web site:

1. Access the Applied Biosystems Technical Support web site at www.appliedbiosystems.com/techsupp.

2. Under the Resource Libraries heading, select the type of technical document you want.

3. In the search form, enter or select search criteria, then click Search.



C

4. In the results screen, do any of the following:

• Click to view a PDF version of the document.

• Right-click , then select Save Target As to download a copy of the PDF file.

• Select the Fax check box, then click Deliver Selected Documents Now to have the document faxed to you.

• Select the Email check box, then click Deliver Selected Documents Now to have the document (PDF format) e-mailed to you.

NOTE: There is a limit of five documents per fax request, but no limit on the number of documents per e-mail request.


C

C.3 Obtaining Customer Training Information

The Applied Biosystems Training web site at www.appliedbiosystems.com/techsupp/training.html provides course descriptions, schedules, and other training-related information.


I

DEX

N

Index

Numerics and Symbols! in Resources dialog box 3-7$ in protocol cycle 7-6✄ in sequence 3-25* (asterisk)

in instrument address 2-10, 2-15in purine/pyrimidine ratio 6-26

AA and B train

cycle durations 7-9required location 7-8, 7-14

Aborting a synthesiscolumn state 3-26when to use 3-40

Address, instrumentand power outage 2-11asterisk (*) next to 2-10changing on workstation 2-9does not match workstation 2-11set to zero (0) 2-4, 2-11setting on instrument 2-4setting on workstation 2-8valid entries 2-5

Address, serial board 1-15, A-2Adenosine (A) cycle description 7-19Alarms

configuring 2-17gas saver 2-19high pressure failure 2-19low pressure failure 2-19restarting synthesis after 2-18startup low pressure 2-20trityl total yield failure 2-19UPS power protection 2-20valve driver fault 2-19

when failures occur 2-18Amount, see QuantityArchiving files 4-7Arguments

Argument (1) 7-11Argument (2) 7-11Argument 1 quantity 7-35Argument 2 duration 7-35pump mode 7-12

ASCII formatopening files 6-21, 6-22saving as 6-17saving report as 5-15

Authorprotocol 7-47sequence 6-16

Autonomous access modewhen activated 2-4, 2-10, 2-15where displayed 2-15

BB train, see A and B trainBase codes

allowed for chemistry and sequence types 6-11

changing to complements 6-25composition and percentages 6-26entering molecular weights 6-36extended cycle 6-20IUB mix 6-18lowercase 6-12, 6-19modified 6-17molecular weights, default 6-27molecular weights, setting 6-35numeric 6-19searching for 6-37X 6-20

Expedite 8900 Workstation Software User’s Guide Index-1

I

DEX

N

Biosearch 8750/8800 format 6-17, 6-21Boot diskette

damaged 2-11description 2-3do not remove 2-3exporting protocol to 4-10

Bottle change tool 3-6Bottle requirements, external reagent

tray 3-6Bottle volumes

checking 3-20resetting 3-7validity of information 3-6

CCable, RJ-45

connecting A-4disconnected 2-11extending A-5total length A-5

Calculationsmelting temperature 6-28micromolar extinction

coefficient 6-28molecular weight 6-27molecular weight, correction for

thioated 6-36, 7-53optical density 6-28

Capping definition 7-6Certificates of analysis

obtaining C-9Checking reagent resources 3-20Chemistry

available types 6-30changing by changing case of

bases 2-5, 6-10default 2-5, 2-20displaying type 2-20rinsing fluidics when changing 3-5setting on instrument 2-5

setting sequence type 6-10CODATA format 6-17, 6-21, 6-22, 6-23Codes

see Base codessee IUB codes

Codons, aligning 6-32Column

done 3-26halted 3-26holding 3-26hold-pending 3-26idle 3-26installing 3-21ready 3-26running 3-26status 3-24, 3-26waiting 3-26when to install 3-10, 3-17, 3-21

COM portdisabling 1-16requirement for Expedite 1-3setting address 1-15

Communication disrupted 2-10Communications cable, see Cable,

RJ-45Communications port, see COM portComplement

displaying 6-25IUB mix codes 6-18

Composition of sequence 6-26Computer

configuration requirement B-1hardware requirements 1-3, 1-16installing the serial board A-1technical support for altered

configuration B-1Configuring

instrument 2-8, 2-9serial board A-2

Constants 6-35Contact closure function 7-18

Index-2 Applied Biosystems

I

DEX

N

Control modeactivating 2-14autonomous 2-4, 2-10, 2-15changing 2-13determining current 2-14local 2-13remote 2-13

Correction factormolecular weight 6-27thioated molecular weight 6-36,

7-53Coupling subcycle 7-8

description 7-6extended 6-20steps in 7-8

CSV format 6-21Customer training, information C-11Customizing

operating environment 2-13protocols 7-2reports 5-10sequences 6-33Status window 3-31

Cycle, see Protocol cycle

DDamage, reporting B-3Database

deleting items from 4-17duplicate names 4-14entering search criteria for

protocol 7-46entering search criteria for

reports 5-6entering search criteria for

sequence 6-15exporting 4-7filtering the data displayed 4-13,

4-19importing older versions of

files 1-16importing sequences, protocols,

and reports 4-3managing information 4-12moving items 4-18overview 4-2searching 4-12sorting 4-19, 4-26

Deblocking subcycle 7-6, 7-7Default

chemistry 2-20folders 4-14list-by filters 4-19molecular weights for bases 6-27report name 3-33Sequence Editor settings 6-33sequence type, setting 6-33

Deletingfolder and deleting contents 4-16folder and keeping contents 4-15items from database 4-17old version of software 1-16sequences, protocols, and

reports 4-17Delivery mode

"NA" 7-11description 7-12determining volume delivered 7-24Flow example 7-25in protocol step 7-11Pulse example 7-24Volume example 7-24Wait example 7-25

Deprotection, intensity of orange color in solution 3-14

Diagnosticsstatus 3-12, 3-25when to run 3-12

Dipswitch settings, serial board A-2Disk space requirements 1-3Diskette, instrument, see Boot diskette


I

DEX

N

DMTDeblocking subcycle 7-7removing during synthesis 3-14,

7-7removing manually 3-14

DMT Off cycle (-) 7-8DNA*Star format 6-17, 6-21, 6-23Done status 3-26Downloading sequence sets 3-19Duration

0, meaning of 7-11argument (2) 7-11units 7-11

EEditing

protocol 7-34protocol cycle 7-36protocol step 7-34, 7-36sequence 6-10

Electronics, checking 3-12E-mail

contacting technical support C-2EMBL format 6-17, 6-21, 6-22Entry mode, setting 6-34Environment, see Operating

environmentError codes, validating protocols 7-48Example

cycle printout 7-42determining volume delivered in

steps 7-24list-by 4-21protocol editing 7-49protocol step 7-10report printout 5-13sequence printout 6-13

Exception displayed when alarm occurs 2-18

ExitingExpedite workstation software 2-14Protocol Editor 7-47Report Viewer 5-5Sequence Editor 6-17

Expedite Comm Serverfunction 2-8polling frequency 2-10when displayed 2-8

Expedite database, see DatabaseExpedite functions, see FunctionsExpedite instrument

adding to workstation 2-8address, see Address, instrumentand power outage 2-11autonomous mode 2-10, 2-15chemistry, see Chemistrycommunicating with

workstation 2-10configuring 2-9connecting to workstation A-4copying protocols between 4-7data uploaded to workstation 2-10displaying name on workstation 2-9local mode 2-13name, maximum length 2-9number controlled from

workstation 1-2polling 2-10powering up 2-3preparing for synthesis 2-2remote mode 2-13restarting 3-39running synthesis from

workstation 3-2sequences, maximum number

of 3-18setup, checking 2-20starting 3-22status 2-10, 3-25tasks you must perform using 1-2


I

DEX

N

Expedite Nucleic Acid Synthesis System, see Expedite instrument

Expedite workstation softwareadding instruments 2-8address does not match

instrument 2-11communicating with

instrument 2-10computer 1-3data uploaded from

instrument 2-10downloading synthesis information

to instrument 3-15during prime 3-11exiting 2-14features 1-2hardware requirements 1-3installing 1-13instrument address, setting 2-8instrument, removing 2-9not on Start menu 2-7number of instruments

controlled 1-2overview 1-5running a synthesis from 3-2starting 2-6tasks you cannot perform using 1-2timeout 2-11transferring sequence sets 3-18

Exportingfiles 4-7protocol naming conventions 4-10reports as ASCII text 5-15to instrument disk 4-10

Extended coupling time 6-20Extinction coefficient, see Micromolar

extinction coefficient

FField Service in North America,

contacting C-3Files

archiving 4-7deleting 4-17duplicate names 4-5, 4-14exporting 4-7hint for selecting 4-4importing 4-3moving 4-18

Filtersee also List-byby Instrument 4-23by sequence length 4-22by sequence type 4-21by time 4-23database information

displayed 4-13setting criteria 4-21

Findingbases in sequence 6-37text in protocol 7-38

Flow delivery modedescription 7-13determining volume delivered 7-25example 7-25

Flow rate, maximum 7-13Fluidic functions 7-14Fluidics, rinsing when changing

chemistry 3-5Folder

Combined 4-14creating 4-15default 2-16deleting 4-15, 4-16deleting items from 4-17description 4-12, 4-14, 4-15, 4-17duplicate file names 4-14Miscellaneous 4-14


I

DEX

N

moving items 4-18number of items in 4-13opening 4-14

Foreign sequences, see Sequence, foreign

Frame offset scroll bar 6-32Functions

chlorinated waste 7-16contact closure 7-18description 7-11fluidic 7-14IUB monomer/activator

delivery 7-17location in subcycles 7-8, 7-14monomer delivery 7-15monomer/activator delivery 7-16number 7-11overview 7-14special 7-14, 7-18special, delivery mode for 7-11step 7-35

GGas saver, alarm 2-19GCG format 6-17, 6-21GenBank format 6-17, 6-21, 6-22Grouping, bases

in Reports 5-10in Sequence Editor 6-31setting default 6-34

HHalted status 3-25, 3-26Hand symbol 3-38Hardware

computer 1-3installation A-1requirements 1-3

Hazard warning, reagents 3-5

High pressure failure, alarm 2-19Hints

checking standard protocols to correct validation errors 7-49

including trityl histogram in text file 5-15

remembering IUB codes 6-18selecting files 4-4selecting text for finding 6-37, 7-39

Holding a synthesis 3-36Hold-pending status 3-25, 3-26

IIdle status 3-25, 3-26Importing

files 4-3modifying imported protocols 4-6older versions of files 1-16prompt for each name 4-5sequences, protocols, and

reports 4-4Information line

Instrument window 3-26Protocol Editor 7-31Sequence Editor 6-8

Injectorpulse mode 7-13pulse volume 7-23

Insert entry mode 6-34Inserting protocol step 7-34Installing

installation directory name 1-15reagents 3-6serial board A-1software 1-13

Instrument Selectorbutton dimmed 3-27displaying names instead of

numbers 2-9


I

DEX

N

monitoring another instrument 3-27Instrument window

displaying 3-27information line 3-26menu overview 1-9monitoring synthesis 3-23overview 1-5parts of 3-24Run and Setup menus not

available 3-12switching to another

instrument 3-27Instrument, see Expedite instrumentInterrupt, setting 1-15Interrupting a synthesis 3-36Invert button 4-4IRQ, setting 1-15IUB codes

complement 6-18, 6-25corresponding to base mix 6-18definition 6-17hints for remembering 6-18molecular weight 6-36

KKeyboard shortcuts, Sequence

Editor 6-9Keyword

foreign sequence 6-22protocol 7-46reports 5-6sequence 6-16

LList-by filter

"or" conjunction 4-22applying 4-19creating 4-20default 4-19

example 4-21wildcards in 4-25

Local, mode of operationdescription 2-13starting synthesis 3-22, 3-39

Log, see Run logLow pressure failure, alarm 2-19Lowercase base codes

entering 6-12, 6-19entering molecular weights 6-36impact on chemistry 2-5in standard protocols 6-12, 6-19

MMelting temperature

calculation 6-28calculation, limitation 6-28in Sequence Editor 6-26

Memory requirements 1-3Menus

Instrument window 1-9Protocol Editor 7-60Reports 5-16Sequence Editor 6-39

Micromolar extinction coefficientcalculation 6-28in Sequence Editor 6-26

MicrosoftWindows 3.1 1-2Windows 95 1-2

Mode of operationautonomous 2-4changing 2-13local 2-13remote 2-13

Modified base codes 6-17Molecular weight

calculation 6-27calculation, correction for

thioate 7-53


I

DEX

N

changing for a sequence 6-30defaults for bases 6-27displaying 6-27IUB mix codes 6-36sequence 6-26thioate correction 6-36, 7-53

Monitoring the synthesisInstrument window 3-23monitoring multiple

instruments 3-30Status window 3-30trityl data 3-28

Monomer addition 7-8MOSS unit 1-2, 1-6, A-5Mouse requirements 1-4MS-DOS version 1-3MSDSs, obtaining C-9

NName

protocol 7-44report 3-33, 5-4report, changing 5-14report, default 3-33run 3-33, 5-4run, changing 5-14sequence 6-14sequence, does not include

instrument 3-34Nucleic acid sequence constants, see

ConstantsNumeric base codes

description 6-19entering molecular weights 6-36

OOD, see Optical densityOligomers, direction of synthesis 6-34

Openingfolder 4-14foreign sequence 6-24protocol 7-27reports 5-3sequence 6-4

Operating environmentcontrol mode 2-13operator name and folder 2-16specifying 2-13

Operation, see Protocol subcycleOperator

ID 2-16name 2-16

Operator Notes windowadding notes 3-32displaying 3-32pasting text 3-33printing 3-33

Optical densitycalculation 6-28measured, in reports 5-11theoretical, in Sequence

Editor 6-26Organize Folders

list-by, changing 4-19opening a folder 4-14overview 4-12

Overstrike entry mode 6-34Overview

database 4-2preparing the system 2-2protocol 7-3Protocol Editor 7-2reports 5-2Sequence Editor 6-2synthesis 3-2

Oxidizing definition 7-6


I

DEX

N
PPneumatic system, checking 3-12Power outages, impact on
instrument 2-11Powering up 2-3Preparing the Expedite instrument 2-2Priming

before running synthesis 3-8fluidics system 3-8minimizing waste 7-59status 3-25when to prime 3-8, 3-16window in workstation

software 3-10Printing

cycle 7-41Operator Notes 3-33protocol 7-42reports 5-12run log 3-33sequence 6-13synthesis parameters 3-15trityl data for completed

synthesis 5-10trityl data for current synthesis 3-29trityl histogram sequence

labels 5-9PRO files 4-4Project

protocol 7-47sequence 6-16

Prompt for each name when importing 4-5

Proofreading sequences 6-38Protocol

see also Protocol cycle, Protocol Editor, Protocol step, Protocol subcycle, Protocol validation, Protocol, standard

author 7-47chemistry, setting 7-33copying to another instrument 4-7creating 7-32date and time created 7-44deleting 4-17delivery mode 7-11description 7-3editing 7-34editing examples 7-49error messages 7-48exporting 4-7exporting to instrument

diskette 4-10filtering 4-19importing 4-3, 4-4keywords for database

searching 7-46location of functions in

subcycles 7-8, 7-14moving 4-18moving cycles in 7-37names 7-44naming conventions when

exporting to disk 4-10older versions 1-13opening 7-26, 7-27operation, see Protocol subcycleoverview 7-3parts of 7-3printing 7-42project 7-47pump mode 7-35saving 7-45saving and closing 7-44scale, setting 7-33selecting 3-14source 7-47statistics 7-44summary info 7-46summary information 7-46template 7-32validating 7-47


I

DEX

N

viewing cycles in 7-29Protocol cycle

$ in 7-6Adenosine (A), description 7-19arranging display order 7-37capping 7-6coupling 7-6creating 7-5creating new 7-36deblocking 7-6deleting 7-37description 7-3, 7-19displaying next 7-29, 7-37in standard protocols 7-4moving 7-37oxidizing 7-6printing 7-41subcycle definitions 7-6

Protocol Editoraccessing 7-26creating a protocol 7-26examples 7-49exiting 7-47finding and replacing text 7-38information line 7-31menus 7-60multiple windows open 7-30overview 1-8, 7-2replacing text 7-38, 7-40requirements for using 7-2summary information 7-43

Protocol step"NA" delivery mode 7-110 duration 7-11argument (1) 7-35argument (2) 7-11, 7-35components of 7-10creating and editing 7-11delivery mode 7-11, 7-12description 7-10, 7-11, 7-35determining volume delivered 7-24duration 7-11

editing 7-36example 7-10functions, see Functionsinserting 7-34performing as quickly as

possible 7-11quantity 7-11

Protocol subcyclecoupling 7-8creating and editing 7-8deblocking 7-7description 7-6in standard protocols 7-6

Protocols, standardA and B train durations 7-9adding specialized monomer 7-57Adenosine (A) cycle 7-19creating RNA from Thio 7-51cycles in 7-4deleting 4-17enhancing trityl intensity 7-49quantitating trityl data 7-54subcycles in 7-6

Pulse delivery modedescription 7-13determining volume delivered 7-24example 7-24

Pulse, volume of reagent per pulse 7-12, 7-23

Pump modearguments 7-12description 7-35

Purine/pyrimidine ratio in Sequence Editor 6-26

QQuantity in protocol step 7-11


I

DEX

N
RRA number B-3RAM requirements 1-3Ready status 3-26Reagent pulse, volume per pulse 7-12,
7-23Reagent tray, external bottle

requirements 3-6Reagents

checking resources 3-20hazard warning 3-5installing 3-6preparing 3-5resetting bottle volumes and

sizes 3-7, 3-20storage and handling 3-5validity of volumes 3-6

Reminder dialog box 3-15Remote mode of operation

description 2-13starting synthesis 3-22, 3-39

Renaming a run 3-35, 5-14Replace entry mode 6-34Replacing text 7-40Report name

changing 5-14format 3-34setting default 3-33

Report Viewer, see ReportsReports

see also Runaccessing 5-3customizing 5-10deleting 4-17displaying trityl data 5-7entering keywords for database

searching 5-6example of printed 5-13exiting 5-5exporting 4-7

filtering 4-19importing 4-3, 4-4menus 5-16moving 4-18name, default 3-33names 5-4opening 5-3overview 1-7, 5-2printing 5-12renaming 3-35, 5-14save as text file 5-15selecting contents 5-10summary information 5-6trityl data 5-7, 5-8trityl histogram in text file 5-15trityl histogram sequence labels do

not print 5-9viewing new 5-5viewing other runs in current

folder 5-4, 5-5window 5-6

Restarting the instrument 3-39Retry communications 2-11Return Authorization (RA) number B-4Returning damaged items B-3Revision, sequence 6-30RNA

protocol, creating 7-51thioated molecular weights 7-53

RS-422 cable, see Cable, RJ-45Run

see also Reportsdefinition of complete 5-2displaying trityl data 5-7importing 4-3name format 3-34names 5-4opening report for 5-3printing reports for 5-12renaming 3-35, 5-14save as text file 5-15sequence statistics 5-6


I

DEX

N

viewing other runs in current folder 5-4, 5-5

RUN files 4-4Run log

comments 3-32displaying for completed run 5-6displaying for current run 3-32printing for completed run 5-11printing for current run 3-33

Run menu not available 3-12, 3-31Run Synthesis dialog box 3-13Running status 3-25, 3-26

SSafety precautions, reagent

handling 3-5Sample, sequence 6-16Saving

foreign sequence 6-17imported files 4-5protocol 7-44Run Report as a Text File 5-15sequence 6-14

Scale, protocol 7-33Scan Run Logs 5-5Scissor symbol (✄) in sequence 3-25Searching

for bases in Sequence Editor 6-37for text in Protocol Editor 7-38

SEQ files 4-4, 6-24Sequence

✄ in 3-25author 6-16base codes 6-11, 6-20complement 6-25composition 6-26creating 3-3date and time created 6-30deleting 4-17

direction 6-10direction in reports 5-10direction, setting default 6-34editing 6-12, 6-19exporting 4-7filtering 4-19frame offset scroll bar 6-32grouping, changing in Reports 5-10grouping, changing in Sequence

Editor 6-31importing 4-3, 4-4keywords for database

searching 6-15lowercase letters in 3-4, 6-12, 6-19maximum number per

instrument 3-18molecular weight calculation 6-27molecular weights, setting 6-35moving 4-18name, does not include

instrument 3-34names 6-14OD (optical density)

calculation 6-28older versions 1-13opening 6-4other formats 6-21printing 6-13project 6-16proofreading 6-38sample 6-16saving 6-14selecting 3-13statistics 6-26summary information 6-15, 6-29thioate correction 7-53type 6-10

Sequence Editoraccessing 3-3, 6-3constants 6-35creating a sequence 6-10customizing 6-33exiting 6-17


I

DEX

N

features 6-2information line 6-8keyboard shortcuts 6-9lowercase letters in 6-10menus 6-39moving the cursor 6-9multiple windows open 6-7overview 1-6, 6-2preferences 6-33searching for bases 6-37summary information 6-29

Sequence setsdefinition 3-18maximum number of

sequences 3-18transferring to instrument 3-18

Sequence statisticsdisplaying for completed run 5-6in Reports 5-6in Sequence Editor 6-26, 6-30

Sequence typebase codes allowed 6-11changing 6-13displaying 6-7, 6-30selecting 6-11setting default 6-33

Sequence, foreignaccepted formats 6-21definition 6-21description 6-21opening 6-24saving 6-17

Serial boardaddress A-2configuring A-2dipswitch settings A-2disabling a port A-2disabling COM 2 1-16installing A-3setting address 1-15software settings 1-15

Set Read Preferences 6-38

Setup menu not available 3-12, 3-31Show Names in Instrument selector 2-9Software

see also Expedite workstation software

Expedite not on Start menu 2-7starting Expedite 2-6version, including in directory

name 1-15versions required 1-3

Sorting the database 4-19, 4-26Source, protocol 7-47Special functions 7-14Start menu, Expedite software not

shown 2-7Startup low pressure, alarm 2-20Statistics

in Reports 5-6protocol 7-44sequence 6-26, 6-30

Statuscolumn 3-24, 3-26instrument 3-25synthesis 3-23

Status windowcustomizing 3-31displaying 3-30monitoring multiple

instruments 3-30monitoring the synthesis 3-30Run and Setup menus not

available 3-31Step, see Protocol stepStopping a synthesis 3-39Subcycle, see Protocol subcycleSummary information

protocol 7-43, 7-46report 5-6sequence 6-29

Synthesis


I

DEX

N

aborting 3-40adding comments 3-32DMT removal 3-14holding (safest option) 3-36intensity of orange color 3-14interrupting 3-36key steps 3-2monitoring, Instrument

window 3-23monitoring, Status window 3-30monitoring, trityl data 3-28name, see Runoptimizing the time required 7-9overview 3-2parameters, printing 3-15parameters, setting 3-12preparing instrument and

workstation 2-2priming the system 3-8protocol, selecting 3-14reagents, preparing and

loading 3-5restarting after alarm 2-18run diagnostics 3-12sequence, creating 3-3sequence, selecting 3-13starting 3-12, 3-22starting in Local mode 3-22, 3-39starting in Remote mode 3-22, 3-39stopping (emergency) 3-39transferring information to

instrument 3-15transferring sequence sets to

instrument 3-18

TTechnical documents, obtaining C-9Technical support

for computers with altered configuration B-1

Technical support, contacting

Africa and the Middle East C-5Eastern Asia, China, Oceania C-6e-mail C-2Europe C-6Japan C-7Latin America C-7telephone or fax in North

America C-3Template, protocol 7-32Text file

including trityl data 5-15saving report as 5-15

Theoretical optical density, see Optical density

Thioation correction factor 6-36, 7-53Timeout

correcting problem 2-11when displayed 2-11

Trityl datadisplaying for completed run 5-7displaying for running

synthesis 3-28does not print sequence labels 5-9editing standard protocol for 7-54enhancing intensity 7-49in reports 5-7in text files 5-15including histogram in text file 5-15including in reports 5-10interpreting intensity of orange

solution 3-14printing 3-29printing for completed

synthesis 5-10printing for current synthesis 3-29sequence labels in trityl histogram

do not print 5-9total yield failure 2-19viewing 3-28

Trityl Vieweraccessing 3-28monitoring the synthesis 3-28


I

DEX

N

rescaling data 3-29Troubleshooting

alarms 2-19diagnostics 3-12establishing communication with

instrument 2-11Run and Setup menus not

available 3-31sequence labels in trityl histogram

do not print 5-9timeouts 2-11

UUniversal support, displaying

setting 2-20UPS power protection, alarm 2-20

VValidating

error messages 7-48protocols 7-47

Valve driver fault, alarm 2-19Version number, including in directory

name 1-15Volume delivery mode

description 7-13determining volume delivered 7-24example 7-24

Volumeschecking 3-20delivered in protocols 7-23per reagent pulse 7-12, 7-23resetting 3-7validity of information 3-6

WWait delivery mode

description 7-13example 7-25

Waiting status 3-26Warning

bottle requirements for reagent tray 3-6

reagent handling 3-5Warranty

damages, claims, returns B-3exceptions B-2for computers with altered

configuration B-1Wildcards in list-by filter 4-25Window menu, arranging windows 1-12Windows

see also Microsofttiling and cascading 1-12tiling for easy viewing 7-52

Workstationsee also Expedite workstation

softwareconnecting to instruments A-4extending the cable A-5


Headquarters850 Lincoln Centre DriveFoster City, CA 94404 USAPhone: +1 650.638.5800Toll Free: +1 800.345.5224Fax: +1 650.638.5884

Worldwide Sales OfficesApplied Biosystems vast distribution and

service network, composed of highly trained support and applications personnel, reaches into 150 countries on six continents. For international office locations, please call our local office or refer to our web site at www.appliedbiosystems.com.

www.appliedbiosystems.com

Applera Corporation is committed to providing the world’s leading technology and information for life scientists. Applera Corporation consists of the Applied Biosystems and Celera Genomics businesses.

Printed in the USA, 06/2001Part Number PB601249 Rev. 2

an Applera business