wheat grain avenin-like protein dynamics in relation to ... · the recently discovered non-gluten...

Wheat Grain Avenin-like Protein Dynamics in Relation to Genotypes and

Environments

YUJUAN ZHANG

A thesis submitted to Murdoch University in fulfilment of the requirements for the degree of Doctor of

Philosophy

Australia-China Joint Centre for Wheat Improvement

School of Veterinary and Life Sciences

Murdoch University

Perth, Western Australia

2018

1

ABSTRACT: ....................................................................................................................................................... 4

ACKNOWLEDGEMENTS .................................................................................................................................... 6

1. CHAPTER 1 INTRODUCTION .......................................................................................................................... 9

1.1. WHEAT ............................................................................................................................................................ 9

1.2. WHEAT FLOUR AND KERNEL PROTEINS .......................................................................................................... 10

1.3. CONVALENT AND NON-CONVALENT BONDS FOR THE FORMATION OF WHEAT DOUGH ................................... 11

1.4. WHEAT GLUTEN STRUCTURE AND AMINO ACID COMPOSITION ....................................................................... 12

1.4.1. Gliadins ..................................................................................................................................................... 12

1.4.2. HMW-GS ................................................................................................................................................... 13

1.4.3. LMW-GS .................................................................................................................................................... 15

1.5. WHEAT NON GLUTEN-THE AVENIN-LIKE PROTEINS (ALPS) ........................................................................... 16

1.5.1. Low molecular weight (LMW) gliadins ..................................................................................................... 16

1.5.2. ALPs........................................................................................................................................................... 18

1.5.3. Farinins and Purinins ................................................................................................................................ 19

1.6. CURRENT RESEARCH ON ALPS ...................................................................................................................... 20

1.6.1. Phylogenic and evolutionary analysis of ALPs .......................................................................................... 20

1.6.2. ALPs on wheat Grain quality improvement ............................................................................................... 22

1.6.3. Barley beer ALPs and soy sauce ALPs ...................................................................................................... 23

1.6.4. Brachypodium grain ALPs ......................................................................................................................... 23

1.6.5. Novel insights on ALPs related research ................................................................................................... 24

1.6.6. ALPs as potential target antigens in celiac disease humoral response ..................................................... 25

1.7. AIMS AND OBJECTIVES .................................................................................................................................. 25

2. CHAPTER 2. NEW INSIGHTS INTO THE EVOLUTION OF WHEAT AVENIN-LIKE PROTEINS IN WILD EMMER

WHEAT, TRITICUM DICOCCOIDES ................................................................................................................... 27

2.1. ABSTRACT ..................................................................................................................................................... 27

2.2. INTRODUCTION .............................................................................................................................................. 27

2.3. MATERIALS AND METHODS........................................................................................................................... 28

2.3.1. Plant materials ........................................................................................................................................... 28

2.3.2. Sequence retrieval, orthologous gene identification and protein classification of ALPs .......................... 30

2.3.3. Phylogeny and natural selection analyses ................................................................................................. 30

2.3.4. Gene cloning and sequencing .................................................................................................................... 31

2.3.5. WEW population data acquisition and analysis ........................................................................................ 31

2.3.6. qRT-PCR .................................................................................................................................................... 31

2.4. RESULTS ........................................................................................................................................................ 32

2.4.1. Identification of ALP homologous genes from wheat genome phylogeny .................................................. 32

2.4.2. Transcriptional analyses of TaALP genes in bread wheat under Bgt.-infection. ...................................... 36

2.4.3. Gene cloning and sequencing analyses of 4 selected TdALP genes in WEW ............................................ 39

2.4.4. Population genetics in relation to water and edaphic effects on TdALP gene diversity ............................ 39

2

2.4.5. TdALP-bx-7AS gene clustering analysis and correlation with environmental factors .............................. 41

2.4.6. UPGMA Phylogenetic analysis of TdALP-bx/ay/ax-7AS in WEW populations ......................................... 43

2.4.7. Genetic distance analyses among different WEW populations .................................................................. 43

2.5. DISCUSSION ................................................................................................................................................... 44

2.5.1. Origin, mechanism, and phylogeny of ALP gene evolution ....................................................................... 44

2.5.2. The importance of natural population in highlighting genetic adaptations............................................... 44

2.5.3. Natural Selection of TdALP-bx-7AS genes in WEW .................................................................................. 46

2.5.4. Genetic distance and evolution of TdALP in WEW ................................................................................... 47

2.5.5. Conclusions and prospects ........................................................................................................................ 47

3. CHAPTER 3 CHARATERIZATION OF AVENIN-LIKE PROTEINS (ALPS) DERIVED FROM WHEAT GRAIN

ALBUMIN/GLOBULIN FRACTION BY RP-HPLC, SDS-PAGE, AND MS/MS PEPTIDES SEQUENCING ..................... 84

3.1. ABSTRACT: .................................................................................................................................................... 84

3.2. INTRODUCTION .............................................................................................................................................. 84

3.3. MATERIALS AND METHODS ........................................................................................................................... 86

3.3.1. Reagents and chemicals ............................................................................................................................. 86

3.3.2. Protein extraction ...................................................................................................................................... 86

3.3.3. RP-HPLC ................................................................................................................................................... 86

3.3.4. MALDI-TOF .............................................................................................................................................. 87

3.3.5. SDS-PAGE ................................................................................................................................................. 87

3.3.6. Protein identification by MS/MS ................................................................................................................ 88

3.4. RESULTS ........................................................................................................................................................ 88

3.4.1. ALP identification by RP-HPLC fractionation .......................................................................................... 88

3.4.2. Peptide sequencing showed ALPs were cleaved in mature wheat grain ................................................... 90

3.5. DISCUSSION ................................................................................................................................................... 98

3.6. CONCLUSIONS ............................................................................................................................................. 100

4. CHAPTER 4 FUNCTIONAL CHARACTERIZATION OF WHEAT AVENIN-LIKE PROTEINS REVEALS A NOVEL

FUNCTION IN FUNGAL RESISTANCE .............................................................................................................. 101

4.1. ABSTRACT: .................................................................................................................................................. 101

4.2. INTRODUCTION ............................................................................................................................................ 101

4.3. MATERIALS AND METHODS ......................................................................................................................... 103

4.3.1. Plant Materials ........................................................................................................................................ 103

4.3.2. Disease screening .................................................................................................................................... 103

4.3.3. Promoter analysis .................................................................................................................................... 104

4.3.4. Point inoculation on wheat spikelets ....................................................................................................... 104

4.3.5. Overexpression of TaALP-bx-7AS gene in transgenic wheat lines .......................................................... 105

4.3.6. RNA isolation ........................................................................................................................................... 105

4.3.7. In situ hybridization ................................................................................................................................. 105

4.3.8. Recombinant TaALP production .............................................................................................................. 105

4.3.9. In vitro antifungal activity of recombinant ALPs ..................................................................................... 105

3

4.3.10. GAL4-based yeast two-hybrid assay ........................................................................................................ 106

4.3.11. Statistical analysis for the allelic effect ................................................................................................... 106

4.4. RESULTS ...................................................................................................................................................... 107

4.4.1. In silico analyses revealed pathogenesis-related features on ALP encoding genes ................................ 107

4.4.2. ALP genes were upregulated upon F. graminearum inoculation in developing wheat caryopses .......... 111

4.4.3. ALP genes were expressed in the embryo, aleurone, sub-aleurone and transfer cells ............................ 113

4.4.4. ALPs displayed significant anti-fungal function on F. graminearum ...................................................... 114

4.4.5. ALPs have potential proteases inhibiting effect on metacaspases and beta-glucosidases ....................... 116

4.4.6. Functional ALPs alleles are significantly associated with lower FHB index .......................................... 118

4.4.7. Overexpression of TaALP-bx-7AS gene in transgenic wheat lines revealed decreases in FHB symptoms

119

4.5. DISCUSSION ................................................................................................................................................. 119

4.5.1. Promoter significance of TaALP genes ................................................................................................... 119

4.5.2. Gliadin domain components display antifungal effects ........................................................................... 121

4.5.3. Temporal and spatial expression of TaALP gene under fungal infection ................................................ 121

4.5.4. In vitro antifungal function of ALPs and allelic effect of ALPs on field FHB index ................................ 123

4.5.5. ALPs inhibition hypothesis ...................................................................................................................... 124

4.5.6. Conclusions.............................................................................................................................................. 126

5. CHAPTER 5 DISCUSSION .......................................................................................................................... 127

5.1. SUMMARY OF RESEARCH OUTCOMES ......................................................................................................... 127

5.2. DISCUSSION AND FUTURE RESEARCH ......................................................................................................... 128

5.3. CONCLUSION ............................................................................................................................................... 130

ABBREVIATION ............................................................................................................................................. 131

APPENDICES ................................................................................................................................................. 134

BIBLIOGRAPHY ............................................................................................................................................. 144

4

Abstract:

The recently discovered non-gluten prolamins, avenin-like proteins (ALPs) in wheat can improve flour

baking qualities. In our study, 15 TaALP genes were identified and mapped to chromosomes 7A, 4A

and 7D. Phylogenetic analysis showed that TaALP genes formed three major clades, types a, b, and c.

The allelic variation of ALP genes in a wild emmer wheat (Triticum turgidum ssp. dicoccoides)

populations from Israel were investigated to study the evolution of TdALP genes under different micro

environments. In total, 49 alleles were identified at 4 TdALP loci. Correlations between the sites in

which wild emmer wheat accessions were collected in Israel and the diversity of their ALP allelles

suggested that at least some alleles were selected for by environmental factors.

In this project, we found that TaALP genes are pathogen-inducible. Bioinformatics predicted the

presence of pathogenesis-related nucleotide motifs in the promoter regions of TaALP genes. Expression

levels of TaALP genes and some PR genes were analysed by quantitative RT-PCR in developing

caryopses at 7, 13 and 42 days after pollination. Differential expression patterns of TaALP genes were

identified in plants infected by Fusarium graminearum. Recombinant TaALP-encoded proteins

significantly inhibited the fungal growth in vitro. mRNA in situ hybridization confirmed that TaALP

transcripts were upregulated in aleurone, sub-aleurone, and embryos after infection. Genome-wide

Fusarium head blight (FHB) index association analysis indicated that certain TaALP alleles were

significantly correlated with FHB resistance. The ALPs may act as pathogen resistance proteins

mediated by systemic acquired resistance (SAR). Our research indicated that TaALP genes,

characterized by typical gliadin domains, are broad-spectrum, partial-resistance genes that contribute to

sustainable control of wheat pathogen disease and possibly other fungus-induced disease in wheat. This

exciting finding will be applicable for breeding broad range of disease-tolerant and high-quality wheat

varieties for sustainable wheat production.

5

Declaration

This work contains no material previously submitted for a degree or diploma in any

university or other tertiary institution and, to the best of my knowledge and belief, no

material which has been published or written by any other person except where due

reference is made in the text.

Date

Acknowledgements

I would like to express my sincere gratitude to my principal supervisor Prof. Wujun Ma for the

continuous support of my PhD study and related research, for his patience, motivation, and immense

knowledge. His guidance helped me in all the time of research and writing of this thesis. I could not

have imagined having a better advisor and mentor for my PhD study.

Besides my advisor, I would like to thank the rest of my supervisor panel: Assoc Prof. Steve Wylie,

Prof. Bernard Dell for their insightful comments and encouragement, but also for the hard question

which incented me to widen my research from various perspectives. I would like to acknowledge the

Australia-China Joint Research Centre for Abiotic and Biotic Stress Management in Agriculture,

Horticulture and Forestry between Northwest A & F University and Murdoch University for giving me

the chance to pursue higher Degrees of research. I would like to acknowledge the help from Prof.

Bernard Dell for Murdoch University Strategic Scholarship (MUSS) application.

My sincere thanks also go to Dr. Rongchang Yang, Dr. Angela Juhasz, Dr. Maoyun She, Dr. Shahidul

Islam and Dr. Jingjuan Zhang, Dr. Guixiang Tang from Australia-China Joint Centre for Wheat

Improvement (ACCWI) research team. Without their precious support it would not be possible to

conduct this research. I would like to acknowledge Prof. Una Ryan for her encouragement and support

through my Ph. D. career as my advisory committee chair.

I would like to acknowledge Dr. Angela Juhasz for gene annotation, host-pathogen interaction

experimental design. I would like to acknowledge Dr. Rongchang Yang and Dr. Sadegh Balotf for

showing qrt-PCR techniques. Also special thanks to Dr. Rongchang Yang for sourcing the wheat related

pathogens from Curtin University. I would like to acknowledge the help from Dr. Jingjuan Zhang for

allele specific primer design, Double Haploid population screening, and glasshouse experimental design.

I would like to acknowledge Dr. Maoyun She for teaching me primer design, plasmid construction and

Yeast two hybrid techniques. I would like to acknowledge Dr. Yong Jia for his great help through mRNA

in situ hybridization. I would like to acknowledge Dr. Reza Zareie for his great help during heterologous

expression of avenin-like proteins. I would also like to acknowledge help from Dr. Hua Li for pathogen

inoculation experimental design. I would like to aknowledge fellow Ph. D. candidates Xin Hu from

Huazhong Agricultural University and Zitong Yu in ACCWI research team for their help on RP-HPLC

separation of avenin-like proteins. I would like to acknowledge help from Dr. Shahidul Islam for his

help on mascot peptide sequencing results interpretation. I would also like to acknowledge the great

help obtained from Assoc. Prof. Steve Wylie for thesis revising and editing, and the initial idea on

pathogenesis study experimental design. Special thanks to previous visiting scientist Dr. Yingjun Zhang

from Hebei Academy of Agricultural and Forestry Sciences for teaching me the molecular cloning work

for the first time. Great thanks to Dr. Xueyan Chen, and Dr. Xinyou Cao in Shandong Academy of

7

Agricultural Sciences/National Engineering Laboratory for Wheat and Maize/Key Laboratory of Wheat

Biology and Genetic Improvement in North Yellow and Huai River Valley for transgenic work done on

avenin-like proteins. I would like to thank Profs Zhonghu He and Xianchun Xia and their research group

from the Chinese Academy of Agricultural Sciences for ALP markers screening using Fusarium

inoculated GWAS wheat lines. Thanks to Dr. Pengfei Qi from Sichuan Agricultural University for the

promising host-pathogen interaction work, especially on protein-protein interaction between avenin-like

proteins and Fusarium graminearum proteins.

I am grateful for the financial support from Murdoch University for providing the

postgraduate scholarship. I am also thankful to the State Agricultural Biotechnology Centre (SABC) for

providing me with research facilities. I also thank Mr. Ian Mckernan and Mr. Jose Minetto for their

support in managing glass house experiments and Mr. Gordon Thomson for his assistance in microscopy.

I would also like to extend my thanks to all the excellent people at the SABC especially Dr Dave

Berryman, Frances Brigg and Professor Mike Jones for administrative and technical assistance during

my research work in the lab and all fellow students working together in the lab.

I wish to acknowledge my family: my dear parents, my yonger sisters, Suyue and Jingyu, and all my

relatives. Thanks for always being within touch whenever I need support and encouragement. Whatever

I do and wherever I am, they are always the most important people in my heart and make who I am.

8

Publications and conferences

Zhang, Y. J., Hu, X., Islam S., She, M. Y., Peng, Y. C., Yu, Z. T., Wylie, S., Juhasz, A., Dowla, M.,

Yang, R. C., Zhang, J. J., Wang, X. L., Dell, B., Chen, X. Y., Nevo, E., Sun, D. F., Ma, W. J. 2018.

New insights into the evolution of wheat avenin-like proteins in wild emmer wheat (Triticum

dicoccoides) Proc Natl Acad Sci. Doi.org/10.1073/pnas.1812855115

Zhang, Y. J., Cao, X. Y., Juhasz, A., Islam, S., Qi, P. F., She, M. Y., Zhu, Z. W., Hu, X., Yu, Z. T.,

Wylie, S., Dowla, M., Chen, X. Y., Yang, R. C., Xia, X. C., Zhang, J. J., Zhao, Y., Shi, N., Dell, B.,

He, Z. H., Ma, W. J. 2018. Wheat avenin-like protein and its significant Fusarium Head Blight

resistant functions. bioRxiv 406694 Doi: 10.1101/406694.

Zhang, Y. J., Islam, S., Juhasz, A., Chen, X. Y., He, Z. H., Cao, X. Y., She, M. Y., Ma, W. J. 2018

Evolution and function of wheat grain avenin-like protein. In the 68th Australian Cereal Chemistry

Conference. 11-13 September, Wagga Wagga, New South Wales (Student Travel Award).

Zhang, Y. J., Islam, S., Juhasz, A., Chen, X. Y., He, Z. H., Cao, X. Y., She, M. Y., Ma, W. J.

2018. Characterization of cysteine-rich avenin-like proteins in common wheat. In the 13th International

Gluten Workshop. 14-17 March, Mexico City, Mexico.

Zhang, Y. J., Juhasz, A., Islam, S., Yang, R. C., She, M. Y., Ma, W. J. 2017. Genetic characterization

of cysteine-rich avenin-like protein coding genes. In the First Australia-China Conference on Science,

Technology and Innovation. 3-4 Feburary, Perth, Australia (Outstanding Presentation Award).

Chen, X. Y., Cao, X. Y., Zhang, Y. J., Islam, S., Zhang, J. J., Yang, R. C., Liu, J. J., Li, G. Y., Appels,

R., Keeble-Gagnere, G., Ji, W. Q., He, Z. H., Ma, W. J. 2016. Genetic characterization of cysteine-rich

type-b avenin-like protein coding genes in common wheat. Sci Rep 6:30692. doi:10.1038/srep30692

.

https://doi.org/10.1073/pnas.1812855115

https://doi.org/10.1038/srep30692

9

1. Chapter 1 Introduction

1.1. Wheat

Wheat (Triticum spp.) is a self-pollinating annual plant, belonging to the family Poaceae (grasses), tribe

Triticeae, genus Triticum (1). In the year 2013, the production of wheat was 713 million tonnes

(http://faostat.fao.org/). Despite its high production, wheat has the widest distribution, it can be grown

from within the Arctic Circle to higher elevations near the equator, and from sea level up to the elevation

of 3000 meters. Although grown mostly in temperate climates (between latitudes 30° and 60° north and

south) with an optimum growing temperature of 25°C, wheat can survive at much lower and higher

temperatures, with a minimum and maximum of 3°C and 32°C, respectively (2). As such, it is one of

the most widely cultivated crops with a short growing season and a good yield per unit area. These

attributes make wheat one of the most important commodities in the international market (3).

The two main groups of commercial wheats are durum (Triticum durum L.) and bread wheat (Triticum

aestivum L.) with 28 (4 x 7) and 42 (6 x 7) chromosomes, respectively (4). Only the major species grown

is hexaploid bread wheat, which has evolved only recently (about 10,000 years), probably by

spontaneous hybridization between cultivated tetraploid wheat (emmer) and a related diploid grass in

southeastern Turkey (5). Hexaploid wheat (T. aestivum) accounts for 95% and tetraploid wheat (T.

durum) for the remaining 5% of the worldwide production of wheat (6). Due to the polyploidy nature

of wheat, the frequent gene rearrangements such as point mutations, insertions and deletions of certain

genes can be buffered (7). After ten thousand years, the genetic diversity of domesticated hexaploid

wheat is immense, with over 25,000 varieties adapted to different environments, although more recent

domestication is usually associated with reduced genetic diversity (8, 9). However, the profound gene

diversity, combined with its economic importance, indicates that hexaploid wheat is an excellent system

to explore the potential natural genetic variation within a major crop species.

Wheat kernels comprise of small amout of bran (13–17%) and germ (2–3%), but a large proportion of

endosperm (81–84%), which contains starch mainly (60–75%), and moderate amount of proteins (6–

20%), moisture (∼10%), and lipids (1.5–2%) (10). Three major components, starch, proteins, and

dietary fibre, together account for about 90% of mature wheat grain dry weight, while some minor

components include lipids, terpenoids, phenolics, minerals, and vitamins (5). However, these

components differ greatly in their distribution within the grain kernel. Specifically, starchy endosperm,

which is recovered as white flour on milling, contains about 80% starch and 10% proteins with less

polysaccharides (dietary fibre), minerals and phytochemicals, whereas the pure bran, which comprises

the aleurone layer, pericarp, testa and embryo, contains less starch and is enriched in minor components

with beneficial nutritional effects (5). In wheat, phenolic compounds are mainly found in the form of

10

insoluble bound ferulic acid and are relevant to imparting resistance to wheat fungal diseases (11). In

addition, alkylresorcinols are phenolic lipids present in high amounts in the bran component as well as

the wheat germ fractions (12). As reported, the physiological effects of wheat bran can be split into

nutritional and mechanical effects, mainly due to the existence of nutritional dietary fibre, more

importantly, the antioxidant effects, which arises from the presence of phytochemicals such as phenolic

acid and alkylresorcinols (12). The bran fraction were reported to exhibit higher antioxidant activity

than other milled fractions (13), though additional work had shown that it is the aleurone layer, which

retaines the highest radical scavenging and chelating capacities (14, 15).

1.2. Wheat flour and kernel proteins

Proteins and carbohydrates that accumulate during seed development are not only essential reserves that

support germination and early seedling vigour in plants, but also are critical to humans and animals as

a staple food (16). As known, wheat is a major ingredient in such food as bread, noondles, porridge,

crackers, biscuits, muesli, pancakes, pies, pastries, cakes, cookies, muffins, rolls, doughnuts, gravy, boza,

and breakfast cereals. It is also well known that the seed-storage proteins determine the processing

quality of common wheat flour. Meanwhile, mature wheat grains show a greater variation in protein

content, and contain approximately 7- 22% proteins on a dry weight basis, based on a wider screening

of 212,600 lines in the World Wheat Collection.

Based on the classical fractionation process by Osborne (17), wheat proteins have been separated into

three major groups based on their solubility in a series of solvents, that is water soluble albumins, dilute

salt soluble globulins, and prolamins which include 70%-ethyl-alcohol soluble gliadins and dilute

acids/bases soluble glutenins. Although ‘Osborne fractionation’ is still widely used, it is more usual

today to classify seed proteins into three groups: storage proteins, structural and metabolic proteins, and

protective proteins (18). Furthermore, the ability of wheat flour to be processed into different foods is

largely determined by the gluten proteins rather than non-gluten forming proteins—the albumins and

globulins (19-22). The gluten proteins, which confer the visco-elasticity that is essential for functionality

of wheat flour, constitute up to 80-85% of total flour protein (23). Further, the monomeric gliadins and

polymeric glutenins constitute each around 50% of the gluten proteins located in the starchy endosperm.

During dough formation, the cohesiveness and extensibility of the gluten is attributed to the hydrated

gliadins while hydrated glutenins contribute to the elasticity and strength of gluten (24). Simply put,

gluten is a ‘two-component glue’, in which gliadins can be understood as a ‘plasticizer’ or ‘solvent’ for

glutenins (25). In addition, wheat dough viscoelastic property is lost upon the removal of gluten proteins

from the flour (26). And it is estimated that an appropriate balance between gliadin and glutenin is

crucial for the gluten rheological properties (27).

11

1.3. Convalent and non-convalent bonds for the formation of wheat dough

Researchers worldwide have dedicated themselves to determining the structures and properties of gluten

proteins and to providing a basis for manipulating and improving the end use quality of wheat for more

than 250 years. Cysteines are a small component within the amino acids of gluten proteins (≈2%), yet

they are extremely important for the structure and functionality of gluten (28). They are capable of

forming both intrachain within a protein molecule and interchain bonds between proteins. During kernel

maturation, milling, dough preparation and the baking process, disulfide bonds are mainly related to

redox reactions (29). Additional covalent bonds, such as tyrosine-tyrosine crosslinks between gluten

proteins, or tyrosines-dehydroferulic acid crosslinks between gluten proteins and arabinoxylans are also

formed during the bread making process (30, 31). Although non-covalent bonds (hydrogen bonds, ionic

bonds, hydrophobic bonds) are less energetic than covalent bonds, they are responsible for the

aggregation of gluten proteins and dough structure formation (32). Hydrophobic interactions stabilize

the gluten structure. Since their energy increases with increasing temperature, they provide additional

stability during the baking process. During the processing procedures, the transitions occurring in

protein denaturation and starch gelatinization affect the physical state and textural characteristics of

various foods. Wheat end-product structure can be determined by wheat protein transition during heating

or other physical or chemical procedures. Besides, one of the important functional features of wheat

protein is its hydration during wheat dough formation: water is transferred from gluten to the starch

component during baking, thus supporting the swelling of the starch granules. Gas vesicles are then

fixed and trapped within the viscoelastic network of gluten proteins. Actually, the processes of protein

denaturation results in the spatial rearrangement of the polypeptide chain within the protein molecule

from the typical form of the native protein to a more disordered arrangement, which contributes

significantly to the characteristics of the baked products. The thermal behaviour of dough is very

important to the quality of the final bakery product (26, 33, 34). Glass transition is one of the most

important thermal properties of wheat proteins. It is assumed that the heating process produces enough

free energy to increase the intermolecular and intramolecular cleavages (sulphur bridges), which can

help produce highly crosslinked macromolecular structures. These phenomena help to modify the

rheological properties of dough and are responsible for the solid-like properties of baked products (35).

With the characterization of more new proteins, the novel interactions among different protein fractions

can be formulated in addition to the basic gluten matrix structure, meanwhile, the non-gluten proteins

might be highlighted with the deeper understanding of the representatives of wheat protein families. Our

understanding needs to be rewired to explain how these ‘novel’ interactions contribute to the different

aspects of the gluten structure-function phenomena.

12

1.4. Wheat gluten structure and amino acid composition

1.4.1. Gliadins

Gliadins contain many members with similar amino acid (AA) sequences. They have been previously

classified as α-, γ-, and ω-gliadins based on their electrophoretic mobility in two-dimentional

electrophoresis (2D) (36). The average molecular mass of α- and γ-gliadins are 26~36 kD, due to

significant variations in the lenghth of the repetitive domain. The amino acid (AA) composition of α-

and γ-gliadins resembles each other, with large proportions of sulfur containing AAs (methionine and

cysteine) and fewer proline (P), glutamine (Q), and phenylalanine (F) residues. Around 251 to 341 AAs

comprise the primary structures of α- and γ-gliadins. The AA sequences of α- and γ-gliadins are

characterized by distinctive N-terminal domains of five and twelve residues, respectively, and C-

terminal domains of 140-160 residues, flanking a repetitive central domain conprising 80-160 AAs, that

is particularly rich in proline and glutamine motifs (11). The ω-gliadins have a MW ranging from 44 to

80 kD. The ω-gliadin belongs to the S-poor prolamins as it lacks the sulfur containing AAs (no cysteine

residues, less methionine), but is rich in other basic AAs within the repetitive domain, thus differing a

lot in its AAs composition from the other gliadin subgroups, the α- and γ-gliadins (37) (Figure 1). More

polar AAs, such as alanine (A), threonine (T), and serine (S) occur in the N-terminal region than other

in α-, and γ-gliadins, and, proline (P), glutamine (Q), and phenylalanine (F) residues account for 80%

of the total AAs in ω-gliadins compared to 50–60% for the other gliadins (38). These gliadins have few

charged AAs such as lysine, few basic AAs and moderately higher levels of phenylalanine (F) (39, 40).

Normally, the α-gliadins contain six cysteine residues within the non-repetitive C-terminal domains and

form three intra-chain disulfide bonds, without linking to other gluten matrix components (41). Typical

γ-type gliadins also have a C-terminal domain containing most of the conserved cysteine residues,

forming 4 intra-chain disulfide bonds (42). As reported, the central repetitive domain of typical α- and

γ-gliadins forms extended structures rich in poly-L-proline II helix and β-reverse-turn structures (43),

while the non-repetitive N-, C-domains are rich in α-helix-rich secondary structures, which are

hypothesized to be stabilized with intramolecular disulfide bonds (11). Due to the lack of cysteine

residues in the primary structure of ω-gliadins, they are unlikely to form a compact structure mediated

by intra-chain disulfide bonds. From the circular dichroism spectroscopy results conducted by Tatham

and Shewry (44), and later Raman optical activity spectrum by Blanch and others (45), it is hypothesized

that ω-gliadins have tertiary structures rich in poly-L-proline II and β-reverse-turn structures. Due to

some polar AAs within its sequences, the surface hydrophobicity of ω-gliadins is lower than that of α-

and γ-gliadins. However, free-SH groups were identified for some α-, and γ-gliadins, enabling formation

of intermolecular disulfide bonds, thus they are more likely to interact with gluten matrix (46). Moreover,

Altenbach (47) found that some modified ω-gliadins having one extra cysteine residue and, therefore,

these modified gliadins can act as chain terminators of the gluten matrix structure. Gliadins, thus,

13

normally do not build up the gluten macropolymers, and some subunits are probably harmful for the

matrix formation. However, the non-convalent protein-protein interactions of monomeric gliadins,

mainly based on hydrogen bonds and hydrophobic interactions are primarily responsible for the wheat

flour viscosity and extensibility (48), the gliadins take part in the gluten macropolymer development by

the means of non-convalent protein protein interactions.

By now, no detailed tertiary structure of gliadins are obtained. No consensus was achieved on the

structure of gliadins in solutions, such as aqueous ethanol, dilute acid, or pure water (43). Structural

difference between gliadins in aqueous ethanol, acidic solutions, and pure water are observed from

different studies. Some studies predict the shapes of gliadins molecules at low concentration in alcohol

solution, suggesting a rod model and a prolate ellipsoid model (49, 50). Thomson et al. studied the

structure of γ-gliadins in 1% acetic acid at low protein concentration, assuming a rod model, meanwhile

they also studied the structure of single molecules of γ-gliadins, and acquired images showing two

molecules aggregated head to tail. A most recent study on nanoparticle ensemble of hydrated gliadins

at high concentrations, accurately simulates gliadins behaviour, or the native structure in the gluten of

dough used for bread making (51). Cole and others suggested that α-gliadins have a compact globular

structure (52). Other studies, however, concluded that gliadins, due to their multiple disordered regions,

have unusual strucutres rather than a compact structure (53, 54).

Figure 1 Schematic structures of α-, γ-, and ω-gliadins (37).

The ‘SH’ represents the ‘thiol side chain’ in the amino acid cysteine; the ‘*’ indicates the amino acid ‘cysteine’ in

the schematic map of wheat gliadins.

1.4.2. HMW-GS

High molecular weight glutenin subunits (HMW-GS) occupy a minor proportion within the gluten

protein family (≈10%). Detailed understanding of the structures, sequences, and properties of many

gluten proteins have been obtained based on analyses of purified proteins and of cloned cDNAs and

genes. The HMW-GS can be grouped into two different types, the x- and y-type subunits, defined

14

initially on the basis of their mobility on SDS–PAGE, with MWs ranging from 83~88 kD and 67~74

kD, respectively. The nomenclature on single HMW-GS is based on the coding genome (A, B, D). The

HMW-GS consist of three structural domains (Figure 2): a non-repetitive N-terminal domain

comprising about 80–105 residues, a C-terminal domain of 42 residues, flanking a repetitive central

domain of about 480–700 residues (55). Cysteines, as well as some polar AAs frequently occur within

the N-terminal and C-terminal domains. Central domains contain repetitive hexapeptides (QQPGQG)

as a backbone with inserted hexapeptides (YYPTSP) and tripeptides (QQP or QPG). The x- and the y-

types mainly differ in the N-terminal and central domains. For example, the y-type has an insertion of

18 AAs, including two adjacent cysteines (C-C) in the N-terminal domain, and typical repetitive units

of y-type subunits are more modified and less frequently repeated in the central domains. The x-type

subunits contain tripeptide, hexapeptide, and nonapeptide motifs while the y-type subunits contain only

hexa- and nonapeptides. Major x-type subunits have three cysteines within the N-terminal domain and

one –SH in the C-terminus, forming one intra-chain disulfide bond, while the first and last –SH form

inter-molecular cross links (56) (Figure 2). However, subunit Dx5 has an additional cysteine at the

beginning of the repetitive central domains, and consequently they might form another inter-chain bond

with other low molecular weight-glutenin subunits (LMW-GS), or y-type subunits. The y-type has seven

cysteins in total, five in the N-terminus, one in the central domain near C-terminus, and one in the C-

terminus. So far, inter-chain bonds have only been found for the adjacent cysteines (C-C) of the N-

terminus, linking in parallel with the corresponding C-C residues of another y-type, while the cysteine

in the central domain links to LMW-GS. Because of the major inter-chain disulfide linkages, HMW-GS

usually occurs as polymers in flour dough. Thus, the distribution of cysteine residues is important as

this may determine the structures and properties of the glutenin polymers.

It is now commonly known that glutenins provide an “elastic backbone” to gluten proteins. Spectrum

profile (NMW, Fourier-transform infrared FTIR spectroscopy) of HMW-GS and the peptides based on

the repeat motifs suggests that hydrogen bonding also contribute a lot to the polymer functionality (57).

Gilbert and others found that hydration of glutenins increase the molecule mobility and facilitate the

formation of β-sheet structures, while the dry proteins have a rather disordered structure. Further

hydration increases protein molecule mobility at the expense of the β-sheet. These observations led to

the development of a “loop and train” model (58), illustrating that protein-protein interaction will be

steadily replaced by protein and water molecule interaction, which then leads to the formation of loop

regions. An equilibrium between “loop” and “train” can be gained during the dough formation process

with hydration, which contributes to the elasticity of glutenin, as an extension of dough will lead to

stretching of the “loops” and “unzipping” of the “trains”. Free energy will be stored within the elastic

backbone basis, defying breakdown during dough mixing. Dough weakening occurred after

esterification of glutamines (G), while the presence of deuterium oxide (D2O) instead of normal water

15

increased resistance of dough breakdown, which is further evidence of the presence of hydrogen bonds

in gluten proteins (59).

1.4.3. LMW-GS

Typical LMW-GSs have a MW ranging from 32 to 43 kD, with full-length genes vary from 909 to 1167

bp (60). Their structures can be proposed due to their cDNA clones and their deduced amino acid

sequences (Figure 2). Like the typical prolamins, there are four domains: a signal peptide of 20 AAs, a

short N-terminal domain (13 residues), containing the first cysteine residues; a central repetitive domain

of variant length (12-25 residues); a C-terminal domain: a cysteine-rich domain (5 cysteine residues), a

glutamine-rich domain (with one cysteine) and a rather conserved sequences (containing the last

cysteine) (42). The LMW-GSs are related to α-, and γ-gliadins in MW and AA composition (six

cysteines that form intrachain bonds are quite homologous to α-, and γ-gliadins in distribution) (15).

Insertion or deletions of repeat motifs are observed between allelic genes (61), which are most probably

caused by unequal crossing-over and/or slippage during replication as suggested for the evolution of

other prolamins (62). The hydrophilic characters of LMW-GSs are due to the repetitive domains.

According to the distribution of cysteines within the LMW-GS sequence, they can be classified into

three major types: (i) those with one cysteine in the short N-terminal domain (63); (ii) those with an

extra cysteine residue in the repetitive domain (64); and (iii) those with eight cysteines all within the C-

terminal part of the protein (65). The cysteine distribution differences are responsible for the functional

differences. It is illustrated that the first and seventh cysteine within the LMW-GS sequence form inter-

chain disulfide bonds (Figure 2). They are not able to form an intrachain bond, probably for steric

reasons. Consequently, interchain disulfide bonds with cysteines from different gluten proteins are

generated.

Length variation within the repetitive domain of LMW-GS may influence the accessibility of cysteine

residues involved in inter-molecular crosslinks, as is evidenced by the fact that a LMW-GS with an

extended deletion in this region identified from a wild type wheat cultivar polymerized more readily

during in vitro redox reactions (66). Kasarda and others (Glutenin polymers - USDA ARS) (67)

reviewed that those subunits of LMW-GS, having two free cysteins, able to form only linear polymers,

thus contribute less to dough strength than those HMW-GS who form branched polymers and having

larger repetitive regions, further proving that polymerization capacity are highly correlated to the

number of free cysteines within a protein molecule. And similar to certain modified gliadins discussed

above with odd numbers of cysteines, LMW-GS with one extra cysteine, will possibly terminate

glutenin polymers, if they do not help to prevent the formation of any intra-molecular disulfide bonds

(67).

16

Figure 2. Schematic structure of HMW-GS and LMW-GS.



The above discussion indicates that the structural characteristics of proteins have an influence on

polymerisation behaviour, decided by both the reserved distribution of cysteine residues and glutamine

rich repetitive regions within the molecules. The MW distribution of glutenins has been recognized as

one of the major determinants of dough quality that is highly related to genetic factors (68). The glutenin

macropolymer (GMP) makes the greatest contribution to dough properties and their amount in wheat is

strongly correlated with dough strength (19). Based on structural characteristic, to participate in a

growing polymer, proteins need at least two cysteine residues forming inter-chain disulfide bonds. In

particular, where there are three or more cysteine residues available to form intermolecular disulfide

bonds, glutenin subunits can be seen as “chain branches”; glutenin subunits with two cysteine residues

available, act as “chain extenders”; while glutenin subunits with only one cysteine residue available

within a chain can be considered as “chain terminators” (69). In contrast with the HMW-GSs, who

usually perform as chain extenders or branches, the LMW-GSs might either be chain branches or chain

terminators (25, 70).

1.5. Wheat non gluten-the avenin-like proteins (ALPs)

1.5.1. Low molecular weight (LMW) gliadins

Back in 1979, Salcedo first demonstrated the existence of a further class of storage proteins related to

gliadins and glutenins, that is, “low molecular weight gliadins”. They consist of 10 components with

MWs in the range of 17,000-19,000, which also have similar electrophoretic mobilities at acid pH. Yet

unlike usual gliadins, they have a higher proportion of sulphur amino acid (cysteine (C) and methionine

17

(M)), as well as threonine (T), glycine (G) and alanine (A), but contain lower levels of glutamine (Q)

and proline (P) (71). Subsequently, Anderson et al. and Clarke et al. isolated cDNAs corresponding to

these proteins, with sequence similarity to LMW-gliadins, LMW-GS, and to ε-hordeins. The encoded

proteins are characterized by distinctive N-terminal sequences, a smaller central repetitive domain than

in typical LMW-GS, and the presence of more cysteine residues, which are soluble in

chloroform/methanol mixtures or alcohols (72, 73). Kan and others (74) introduced an EST-based array

procedure to identifiy two genes that were “weakly similar” to avenins of oats in three Aegilops species.

Later sequencing of these two corresponding transcripts demonstrated that each gene was related to a

small family of proteins called avenin-like a type and b type. Sequence analysis illustrated that they

belong to the “prolamin superfamily” of plant proteins, and are closely related to γ-gliadins, LMW

subunits of wheat and avenins of oats. This is the first time that LMW gliadins were named as avenin-

like proteins (ALPs).

Sequence alignments of type a ALPs (74) correspond to the LMW gliadins identified by Salcedo and

later proved by others as well (16, 71-73, 75, 76). Based on the wheat grain EST libraries, the sequences

of the two ALPs related transcripts were used to screen novel transcripts in wheat. After assembling

sequences of the related contigs, new primers were designed to amplify full-length sequences from the

cDNA fraction of bread wheat cv Cadenza. From the sequencing analysis of the a-type transcripts, it is

clearly seen that they are closely related to the LMW gliadins sequences previously reported (72, 73) as

shown by the alignment. In 1979, Salcedo and coworker (71) initially identified the LMW gliadins as

components of the grain protein fraction extracted with chloroform:methanol (2:1, v/v), which contained

about 10 components with MW of 17–19 kDa and exhibiting similar electrophoretic nobilities to

gliadins at acid pH. In 2001, Anderson and coworkers identified a cDNA clone (11dc7) as encoding a

LMW gliadin while in 2000 and 2003 Clarke and coworkers (73, 77) characterised a family of four

cDNAs and genes encoding putative LMW gliadins from wheat cv Wyuna. The LMW gliadins encoded

by the four clones of Clarke et al. (2003) (LMWGli1111, 1058, 1199, 2482) have sequence identities

ranging from 81% to 95%. The a-1, -2 and -3 proteins described here are 94–95% identical to each other,

over 90% identical to the proteins encoded by LMWGli1199 and LMWGli2482 and over 80% identical

to the proteins encoded by LMWGli1111, LMWGli1058 and 11dc7. Clarker and coworkers (73) noted

that the LMW gliadins all contain 14 cysteine residues, among which 8 cysteines form the characteristic

conserved cysteine skeleton of the prolamin superfamily (78). These LMW gliadins differ from the

gliadins and glutenins in lacking repetitive domains, yet a short sequence of proline (P) and glutamine

(Q) residues, also known as polyglutamine stretches, is present at position 13 of the mature protein. It

is also noteworthy that this was the most variable region in the LMW gliadin famlily (73). The lack of

extensive repeated sequences is associated with relatively low contents of glutamine (Q) and proline (P)

residues, with 23 mol% glutamine (Q) and 9.5 mol% proline (P) in the a-1 protein compared with about

30–35 and 15 mol%, in LMW-GS and gliadins (79, 80). Anderson and coworker also noticed this

18

characteristic in assigning the sequences of the 11dc7 protein (72). The existence of proteins related to

LMW gliadins, as a new family of grain prolamin proteins, is also confirmed in barley (81, 82) and rye

(83).

1.5.2. ALPs

As mentioned earlier, Kan et al. (74) characterized two classes of cDNAs encoding ALPs type a and

type b proteins, based on their nearest relatives identified in databases. The molecular mass of a-type

ALPs are about 18 kDa; and each protein contains 14 cysteine residues. ALPs type a proteins are highly

homologous to previously reported LMW gliadin monomers, and are assumed to mediate seven intra-

chain disulfide bonds (71-73). In contrast, ALPs b-type proteins contain 18 or 19 cysteine residues, not

corresponding to any know protein sequences. The genes of ALP type-b have been characterized in 23

species of Triticeae, including 18 species of Aegilops, barley as well as diploid, tetraploid and hexaploid

forms of wheat (84). A few years ago, the ALP type-b protein was detected in the glutenin fraction of

durum wheat cv Svevo and its high content of cysteine residues suggests that it could be integrated via

inter-chain disulfide bonds within the Glutenin subunits polymer, possibly contributing to the functional

quality of gluten (85). The identification of b-type ALPs was supported by acquiring the sequences of a

reasonable number of tryptic peptides and the matches between measured and expected MW and pI (85).

The first 18 amino acid residues of each b-type ALPs were proved to be a signal peptide while the

mature proteins contained 266 amino acid residues having an average molecular mass of 30 kDa (86).

The characterization of b-type ALPs was in good agreement with the gene-derived sequence, with the

exception of glutamine as the N-terminus instead of leucine (86). The μLC-MS/MS (liquid

chromatography-tandem mass spectrometry) analysis conducted by De Caro and coworkers indicated

that cleavage of the signal peptide occurred at position 19, before the glutamine residue. This is at

variance with the cleavage after Gln reported for some LMW-GSs (79) and other gluten proteins (87).

DuPont et al. (76) described a protein isolated from wheat grain as ‘avenin-like’ based on partial amino

sequences determined by mass spectrometry, which is comparable to the protein sequence of a-type

ALPs. However, its mobility on SDS-PAGE is consistent with its identity as a LMW gliadin and the

sequence included the motif LQQCS which also occurs in the a-3, 11dc7, LMWGli1111 and

LMWGli1058 proteins. Similarly, Vensel and coworker (16) identified five avenin-related proteins in a

proteomic analysis of the albumins and globulins at early, 10 days post-anthesis (DPA) and late (36

DPA) stages of grain development, but found that none corresponded in mass or pI to the b-type ALPs.

These studies indicate that other related ALPs also occur in wheat but they do not cast any light on the

identity of the b-type proteins. Avenin-like b type proteins are related to the a-type proteins at the start

of the sequences, but differ later on with an insertion of a sequence of approximately 120 residues. Kan

and his coworkers (74) observed that this inserted sequence is a duplication of the sequence starting at

residue position 13 of the mature b-type protein, which was labeled R1 and R2. Eight perfectly

conserved cysteine residues exist in both domains (R1 and R2), and conservation of cysteines is also

19

found in a-type ALPs. Figure 3 provides a summary of the conservation of cysteine residues within the

sequences of ALPs. Eight conserved cysteines skeleton in the R1 and R2 domains of the b-type ALPs

are likely to, indicate that these two domains may fold separately as well. Type-a ALPs all contain 14

cysteine residues, forming seven intra-chain disulfide bonds, which is typical of monomeric

ALPs/LMW gliadins. In contrast, the b-1 and b-2 ALPs contain 19 cysteines, and b-3 with 18 cysteines

residues, indicating that they could be integrated into glutenin polymers via inter-chain disulfide

linkages. In particular, the two cysteines in the N-terminal domains of the b-type ALPs are not conserved

in the sequences obtained from various Aegilops species, hence suggesting that they may be involved in

inter-chain linkages, and likely participate in branched polymer formation rather than linearized

polymers. Chen and coworkers predicted that b-type ALPs, containing 19 cysteine residues, could form

eight intra-molecular disulfide bonds and then the other three free cysteine residues may be involved in

inter-molecular disulfide bonds (Figure 1.3). So, ALPs type b are likely to act as “chain branches”

increasing the probability of itself and other glutenin subunits to form larger glutenin polymers, which

may improve the mixing properties of doughs. The possibility that b-type ALPs are present in glutenin

polymers raises the question as to whether they play a role in determining the functional rheological

properties of gluten. Due to their high proportion of cysteine residues, it is certainly possible that ALPs

may affect the cross-linking of glutenin subunits via extra inter-chain disulfide bonds. However, either

the inter- or intra-chain disulfide bond can be reformed by introducing outside reducing and oxidizing

reagents, or inside oxidoreductases. Insofar as known, the monomeric a-type ALPs, quite similar to the

gliadins, when mixed in dough, can presumably form disulfide bonds only if they are incorporated by

reduction and reoxidation (73). Nevertheless, more work are needed to assess the real behaviour of the

novel ALPs in the gluten network of dough (88).

1.5.3. Farinins and Purinins

Kasarda et al. (89) characterized a novel avenin-like protein called farinin, composed by two disulphide-

linked small polypeptides subsequent to a proteolytic cleavage of a precursor polypeptide at an Asn-Glu

(N-E) peptide bond. Farinins were originally named as b-type ALPs by Kan et al. (74) based on their

similarity to the avenins of oat. They carry 18 or 19 conserved cys residues in the primary structure, and

have been detected in the smaller glutenin polymers of common wheat and the glutenin fraction of

durum wheat (86, 90). More recently, Chen et al. (91) reported that the homoeologous genes encoding

farinins (ALPs), i.e., TaALP-7A, TaALP-4A, and TaALP-7D, were located on the chromosome arms

7AS, 4AL, and 7DS, respectively. A farinin (ALPs) with 18 cys residues was incorporated into glutenin

macropolymers when transgenically expressed in common wheat, with the transgenic lines exhibiting

significantly improved gluten and dough functionalities (92). This is in line with the finding that allelic

variation in TaALP-7A affected dough parameters, with the superior allele associated with better

processing quality (91). Farinins (ALPs) with different number of cysteines (18 or 19) may differ in

their ability to become incorporated into GMPs, and thus the potential to affect gluten, dough and end-

20

use properties (89, 90). More systematic genomic studies, coupled with gluten, dough and end-use tests,

should help to clarify functional similarities and differences among different farinins (ALPs).

Purinins coding genes have close phylogenetic relationship with ALPs type a genes, and blast results

also suggested that they were also named as avenin-3 (93). Purinins in wheat vultivar Triticum aestivum

Butte 86, were identified as target antigens in celiac disease, exhibiting reactivity to IgG and IgA

antibody, among others as serpins, α-amylase/protease inhibitors, globulins, and farinins (ALPs) (94).

1.6. Current research on ALPs

1.6.1. Phylogenic and evolutionary analysis of ALPs

Prolamin superfamily

The prolamin superfamily was defined initially on the basis of a shared skeleton of cysteine residues

and initially comprised three groups of seed proteins, the major prolamin storage proteins, the alpha-

amylase/trypsin inhibitors (ATI) of cereal seeds (wheat, barley and rye) and the 2S storage albumins

(oilseed rape, castor bean and other dicotyledonous species, and related panicoid cereals) (87, 95), the

α-globulins, the puroindolines (Pins) and grain softness proteins (GSP) of wheat and related cereals and

soybean hydrophobic protein, all of which are seed-specific; and later on, the major prolamins of maize

(b-, g-, d-zeins) and related panicoid cereals (21, 78, 80). It also includes two groups of proteins with

wider distributions, the non-specific lipid transfer proteins (seeds and other tissues) (96) and

hydroxyproline-rich cell wall glycoproteins (97), but all members are restricted to plants with none

recorded in other kingdoms.

Phylogenetic relationship of ALPs and other prolamins

Prolamins are complex polymorphic mixtures of proteins, which can be classified into several groups,

each containing structurally related proteins and are encoded by a complex multigenic locus (95). Most

prolamins share two common structural features. The first is the presence of distinct regions, or domains,

which adopt different structures to each other and may have different origins. The second is the presence

of amino acid sequences consisting of repeated blocks based on one or more short peptide motifs, or

enriched in specific amino acid residues, such as methionine. These features are responsible for the high

proportions of glutamine (Q), proline (P) and other specific amino acids (e.g. histidine (H), glycine (G),

methionine (M), phenylalanine (F)) in some prolamin groups (18). In the prolamins, the major

evolutionary events are the insertion of additional sequences, including large glutamine (Q)- and proline

(P) repetitive domains.

21

Figure 3. Schematic structure of ALPs type a and type b amino acids sequences.



Knowledge of the complete ALPs amino acids sequences comes from the analysis of cDNA and

genomic DNA sequences. The main features of both proteins (ALPs type a and type b) are conserved,

with special regard to the signal peptide, the N- and C-terminal cleavable peptides, and the cysteine

backbone within the repetitive domains. The hydrophobicity and basic identity of the proteins are

generally preserved. As is illustrated in Figure 3, the higher degree of sequence homology between the

R1 and R2 domains implies that they arose from the duplication of a single ancestral sequence. It also

indicates that the R1 domains of type a and type b ALPs are more closely related than the R1 and R2

within type b ALPs. It is suggested that the divergence of R1 and R2 domains is more ancient than the

divergence of the type a and type b ALPs. One simple explanation for this observation is that the

ancestral protein comprised R1 and R2 domains but the latter has subsequently been lost from the type

a ALPs during evolution. Another explanation is that the R2 domains have arisen from a separate related

protein rather than from internal duplication of a sequence within a single protein. It is not known

whether the repetitive domains arose by the insertion of pre-existing repeats into the progenitor gene, or

internal amplification of sequences already present within the genes. However, in all cases, the addition

of the repeats, which are rich in proline (P), glutamine (Q) and aromatic amino acids, appears to have

resulted in the unusual physical properties of the proteins, including their characteristic insolubility in

water or salt solutions, or the way to form disulfide bonds.

As illustrated by the phylogenetic analysis by Kan et al. (74), ALPs are members of the “prolamin

superfamily”, with the conservation of cysteine residues and the presence of a characteristic CysCys

motif, which are consistent with the structural basis of the prolamins. The ALPs form a separate group

within the superfamily being most closely related to the γ-gliadins, LMW-GS of wheat and and avenins

of oats.The encoded proteins are all rich in glutamine (Q) and proline (P) residues, with about 26 mol %

of glutamine and 7.0 mol% of proline. Seventeen cysteines within their sequences are strictly conserved

at positions 24, 49, 57, 75, 82, 83, 95, 137, 145, 166, 174, 192, 200, 212, 257, 265 and 283. Although

they do not contain conserved repeat motifs, unlike other wheat prolamins, the glutamine (Q) residues

are largely clustered in blocks of three to six residues, also known as the polyglutamine stretches.

Insertion or deletion of such blocks may result in size differences.

22

1.6.2. ALPs on wheat Grain quality improvement

Gluten are storage proteins found in the starchy endosperm of barley, wheat and rye kernels. In wheat,

the ALPs can be detected in the gluten-enriched fraction, including among others a range of gliadins,

glutenins, protease inhibitors and lipid transfer proteins (98). Besides, ALPs were also detected in green

wheat, barley and rye (98). The ALPs were named due to sequence homology with avenins of oats (74),

most closely to avenin-3 (93). However in oat, a suite of avenins and globulin-like/glutelin-like proteins

were detected, with the ALPs family absent (98). Nevertheless, avenins were shown to be homologous

to α- and γ-gliadin of wheat, B-hordein of barley and γ-secalin of rye (S-rich group) (93, 99). The

molecular weight of avenins is about 18.5-23.5 kDa and contain two blocks of glutamine (Q)- and

proline (P)-rich repeated sequences, whose length varies from six to eleven residues (100). Avenins are

monomers and only contain intrachain disulphide bonds (101).

The widely-held view of gluten structure was summarized by Shewry et al. (102) who suggested a

structural model for wheat gluten, in which the HMW-GS crosslink with each other in a head-to-tail

fashion by inter-chain disulfide bonds to form an ‘elastic backbone’, while LMW-GS crosslink to this

backbone basis and form ‘branches’. This elastic backbone formed by HMW-GS with branches formed

by the LMW-GS are the glutenin polymers. Gliadins may also interact with the glutenin polymers by

strong covalent and non-covalent forces and contribute to gluten viscosity (6). Potential non-gluten

components contribution to the wheat milling and end-use traits were recently reviewed by Wang et al.

(103).

Based on the phylogenetic relationships of ALPs with sequences of other members of the prolamin

superfamily, it is evident that the ALPs gene sequences form a single cluster within the super-prolamin

family which is close to the avenins of oats and the sulphur-rich prolamins of wheat (α-gliadins, γ-

gliadins, LMW-GS)(74). So far, wheat breeding are focusing on gluten protein optimization, whereas

the non-gluten contribution to the flour baking quality were not addressed yet.

To investigate the functional properties of the ALPs in wheat flour, Chen and coworkers (88) designed

a heterologous expression system to obtain sufficient quantities of the protein, and a reduction/oxidation

protocol for incorporating the protein into flour in a reconstitution-type experiment. Two gram

Mixograph test results confirmed that incorporation of the heterologously expressed b-type ALPs into

flours resulted in significant increase in flour mixing properties, and this provided a preliminary result

regarding the relationships between b-type ALPs and functional properties of dough. When the b-type

ALPs (containing 18 cysteine residues) are overexpressed specifically in wheat grain, it is unclear

whether these proteins could improve the functional properties of wheat flour. Later, in order to confirm

the effects of increasing the in vivo levels of type b proteins on the functional properties of wheat flour,

the expression vector pLRPT-avel, expressing specifically in the endosperm, was successfully

23

constructed and transformed into an elite wheat variety (T. aestivum L. cv. Zhengmai 9023) by particle

bombardment (92, 104). The Mixograph analysis and sodium dodecyl sulfate sedimentation (SDSS) test

were performed to determine the functional properties of wheat flour using three transgenic wheat lines

overexpressing the type b ALPs. Ma and others proved (92) that type b ALPs, like other wheat storage

proteins, are present widely in Triticeae species, belong to a multigene family, and are specifically

expressed in seeds. SE-HPLC analysis indicates that they are incorporated into polymeric subunits by

intermolecular disulfide bonds. Both in vitro and in vivo experiments showed that they obviously

improved the dough functional properties (92).

1.6.3. Barley beer ALPs and soy sauce ALPs

In general, the brewing operation of barly seed, would enrich pathogenesis-related (PR) proteins, such

as proteases and/or amylases inhibtiors, among the barley endosperm components (105, 106). Although

they were newly discovered in beer, it is now established that a-type ALPs and related isoforms, which

share sequence homology with γ-hordeins, are to be counted among the major beer proteins (107).

Notably, in wheat beer, previously described as α-amylase/trypsin inhibitors and avenin like protein A1,

was detected at MW = 13−17 kDa using 2D electrophoresis (108). These proteins are rich in cysteine,

linked by disulfide bonds, and therefore resistant to thermal or proteolytic degradation.

Limure et al. 2015 (109) reported that the addition of barley dimeric α-amylase inhibitor-1 (BDAI-1)

significantly improves beer foam stability, while a-type ALP does not. More interestingly, Limure and

others (109) also found that this a-type ALP can be identified in a comparatively wider range of

molecular weights (12-19 kDa), confidently suggesting that beer ALP have undergone several post-

translational modifications (PTM), such as glycosylation, non-enzymatic glycation, acylation, disulfide

bond breakage, and partial digestion, during malting and brewing processes. The PTM of ALPs will be

further discussed in Chapter 3.

Gluten peptide markers, representing the gliadins and glutenins and ALPs were detected in the incurred

soy sauce, using LC-MS techniques (110). Besides, using LC-MS/MS, ALPs were identified among a

suite of hordeins, including B1-, B3-, d-, γ-hordeins, alongside protease inhibitors protease inhibitors

(α-amylase/trypsin inhibitors), lipid transfer proteins, serpins, peroxiredoxins, oleosins, hordoindolines

and various enzymes (e.g. dehydroascorbate reductase, protein disulfide isomerases) (111).

1.6.4. Brachypodium grain ALPs

In 2010, Larre et al. found proteins spots from Brachypodium prolamins similar to ALPs in wheat (112).

Brachypodium grain has minor storage proteins, as in Rice and oat, where only two types of prolamins

were identified, one is homologous to γ-gliadins and the other to the ALPs (113). Both proteins belong

to the AAI-LTSS superfamily, which emcompasses seed storage proteins presenting a common pattern

of eight cysteines that form four disulphide bridges (113). Though syntenic analysis revealed

Brachypodin loci for HMW-GS, S-poor HMW-GS were not found in the proteomic data, indicating that

24

such prolamin genes were not expressed (113). Meanwhile, the youngest genes among prolamins, the

alpha prolamins, which arose long after the split of the Poaceae family into three subfamilies (Pooideae,

Oryzoideae and Panicoideae), were absent as expressed proteins (113, 114). Their study of Wu et al. on

grain biochemistry supports the close relationships of Brachypodium with Pooideae subfamily members,

oat, wheat and barley (113).

1.6.5. Novel insights on ALPs related research

Avenin-like b precursors are minor storage proteins which are important to protect endosperm starch

reserves from degradation (115). It is reported that, a putative avenin-like b precursor that comprises a

cereal-type alpha-amylase inhibitor, as well as serpin-Z1C like defence proteins were increased by

elevated CO2 (115, 116). These storage proteins are thought to protect the starch reserves in the

endosperm from degradation (115). The CO2-induced impact on the avenin-like b precursor might

indicate changes of grain quality (115). Another novel study, indicated induction of one ALP and one

chitinase in winter wheat (cv. Bologna) grains, not only due to increased CO2, but might be linked to

the microbial populations (117), as in the case of accumulation of some multifunctional storage

globulins, which exhibit antimicrobial activity (118). An interesting discovery indicated that the full-

length globulins displayed a down-accumulation pattern, whereas up-accumulation of those forms

corresponding to endo-proteolytic events were also observed (117).

Gu et al. (119) found that, under water deficient environment, though with less grain weight and yield,

some storage proteins, such as HMW glutenin, globulins, and ALPs, still show upregulated expression,

which might benefit breadmaking quality. Using Mixolab-dough analysis systems, Wang et al. (120)

reported that the starch surface proteins (gliadins, b-type ALPs, LMW-GSs, and partial globulins), in

wheat flours with high and normal amylose content, exhibit different performance to mixing and thermal

treatment. In a recent study by Cao et al. (121), many storage proteins were identified in the endosperm

and embryo, including HMW-GS, gliadins, globulins, ALPs, triticins, and omega secalins. ALPs

displayed differential expression on the protein level between wheat species, suggesting that ALPs are

responsible partly for the quality differences (121). A recent proteomic study indicated that drought

stress affect wheat storage protein genes expression, such as gliadins, glutenins and ALPs as early as 3

days after pollination, moreover, drought stress misregulates genes associated with cytoskeleton

organization and grain quality proteins in developing seeds (122). Interestinly, chromosome substitution

wheat lines of 7A/7H from Hordeum chilense, indicate higher amounts of ALPs and triticin expression,

which may improve nutritional value and processing quality of flour (123).

Based on the study by Altenbach et al. (124), the farinins (ALPs) comprised from 2.6 to 3.1% of the

protein in the EPP polymers and 1.9–2.4% of the protein in the UPP polymers, yet they were influenced

by post-anthesis fertilizer. Due to proteome rebalancing, several high-sulfur non-gluten proteins, such

as farinins (ALPs) and purinins (avenin-3), beta-amylase, one globulin, alpha-amylase inhibitor WTAI

25

CM17, serpin Bu-7 and lipid transfer protein (LTP), showed decreased expression for a transgenic study

targeting omega-5 gliadins silencing (125). Fallahbaghery et al. (126) assessed different gluten

extraction protocols using LC-MS/MS analysis, notably, ALPs were not strictly classified as gluten,

even though they share significant homology with the γ-gliadins, they comprises 7.6% of the total

IPA/DTT protocol extracted proteins, compared with the enriched gluten proteins (54.5%).

Gao et al. found (127) a potential protein protein interaction between a stress-responsive transcription

factor, TaERFL1a and an avenin-like a precursor (3 clones) by yeast two hybrid library screening under

water deficiency conditions, though they did not further prove it. A total of 51 b-type farinin (ALPs)

genes were cloned and characterized, including 27 functional and 24 non-functional pseudogenes from

14 different Brachypodium distachyon L accessions (128). Most recently, Cao et al. (129) reported 13

avenin-like b alleles (TaALPb7D-A–M) in 108 Aegilops tauschii Coss. accessions.

1.6.6. ALPs as potential target antigens in celiac disease humoral response

In the field of celiac disease (CD), gluten is defined as storage protein from wheat (gliadins and

glutenins), barley (hordeins), rye (secalins), and oats (avenins). The toxic properties of gluten proteins

are believed to be largely due to P and Q rich peptides, which are target for celiac disease-related antigen

presenting cells and immunogloblulins, and are produced during incomplete degradation of the proteins

by human digestive enzymes (130). Recently, Huebener and others (94) have analysed the possible

involvement of non-gluten proteins as target antigens in celiac disease related humoral response, the

main antibody target proteins were identified as serpins, purinins (avenin-3), globulins, farinins (ALPs),

and α-amylase/protease inhibitors. Similarly, in another study, serpins, alpha-amylase inhibitors,

farinins (ALPs) and seed globulins have illustrated a significant immune response (131). As reported,

potential target proteins from wheat include one or more of the gluten proteins such as gliadins and

glutenins, as well as non-gluten proteins (132). Potentially antigenic proteins from these foods include

prolamin proteins, such as 2S albumins, non-specific lipid transfer proteins, bifunctional α-

amylase/protease inhibitors, soybean hydrophobic protein, indolines, gluten, serpins, purinins, alpha-

amylase/protease inhibitors, globulins, and farinins (132). Though ALPs have advantageous effect on

wheat quality improvement, the discovery of toxic epitopes in ALPs might be of malnutritional

properties. Thus breeding programs targeting improving of the functional properties and reduction of

the adverse health effects of the flour need also take into consideration the advantages and disadvantages.

1.7. Aims and objectives

Before the functional characterization experiments of ALPs in the following chapters, their differences

with typical gluten proteins, the major components of storage proteins, were reviewed. These proteins

confer the main flour processing quality. The similarities and differences in the promoters and CDS

regions of ALPs and the typical glutens were identified, which may indicate their major functional

properties. As reviewed in Chapter 1, the typical function of wheat glutens are their direct effects on the

26

rheological properties of wheat flour. Many studies have been conducted to optimize the wheat flour

end use quality by integrating the better alleles of HMW-GSs. As components of LMW-GSs are quite

complex, research on the disulphide bridging between HMW-GSs and LMW-GSs also highlighted the

importance of wheat glutenins. The wheat gliadins contributed to the wheat flour baking quality in

aspects different from wheat glutenins. Initially, the discovery of the novel wheat storage proteins, the

ALPs, which are characterized by high levels of cysteine residues, add further variables to the equation

of better bread making. ALPs are introduced as candidate for gluten branches, or key linkages in the

gluten matrix. Overexpression transgenic study and association study of allelic effects were

independently performed to support the dough improving effects of ALPs. Later, the phylogenetic

analysis of the major wheat prolamins with a gliadin domain and the alpha-amylase inhibitor domain

(PF13016 and PF00234), shared by ALPs, glutens, avenin-3, alpha-amylase inhibitors, grain softness

proteins, puroindolines, etc, were discussed in Chapter 2. ALPs with its extractability as the wheat

storage proteins are potential bi-functional storage proteins.

Previous work indicated that ALPs are highly expressed in wheat cultivars with good quality under

water-deficit conditions, but are moderately expressed in wheat cultivars with poor quality (119). In our

laboratory, we have already mapped the genes for type-b ALPs on chromosomes 7AS, 7DS and 4AL

(91). Our previous work also showed that there are several single-nucleotide polymorphisms (SNPs)

and deletions between different breadwheat cultivars. The existence of a stop codon on 7AS facilitated

that specific STS markers can be designed to screen wheat lines of interest (91).

The aim of this PhD is the genetic characterization of ALPs genes, meanwhile, we will analyse the

polymorphisms of both the b-type and a-type ALPs genes in a broad collection of wild emmer wheat

cultivars, to be used as a genetic resource in breeding for wheat quality. This special natural population

of progenitors for common wheat and pasta wheat harbors immense resources of genetic diversity,

which confer various properties, such as multiple disease resistance, good agronomic traits, resistance

to diverse ecological stresses, and variation in protein quantity and composition. For this project, wild

emmer wheat would serve as an optimal material for novel gene identification. The specific aims of this

study include:

1) Identify the polymorphisms of ALPs genes within Australia common wheat cultivars and a

suite of wild emmer wheat germplasms;

2) Establishe the correlation between the TdALP genes diversity and environmental factors in

wild emmer wheat populations;

3) Purify, isolate and identify the ALPs in common wheat flour using RP-HPLC, SDS-PAGE,

and MS/MS peptides sequencing;

4) Study the gene expression and protein level expression of ALPs in common wheat;

5) Characterize the functional traits of ALPs using molecular biology techniques.

27

2. Chapter 2. New insights into the evolution of wheat avenin-like proteins in wild emmer wheat,

Triticum dicoccoides

2.1. Abstract

Fifteen full length wheat grain avenin-like protein coding genes (TaALP) were identified on

chromosomes arms 7AS, 4AL and 7DS of bread wheat with each containing five genes. Beside the a-

and b-type ALPs, a c-type was identified in the current study. Both a- and b-type have two subunits,

named as x- and y-types. The five genes on each of the three chromosome arms consisted of two x-type,

two y-type, and one c-type genes. The a-type genes were typically of 520 bp in length, while the b-

types were of 850 bp and the c-types were of 470 bp. The ALP gene transcript levels were significantly

upregulated in Blumeria graminis f. sp. tritici (Bgt.)-infected wheat grain caryopsis at early grain filling.

Wild emmer wheat (WEW, Triticum dicoccoides) populations were focused on in our study to identify

allelic variations of ALP genes and to study the influence of natural selection on certain alleles.

Consequently, 25 alleles were identified for TdALP-bx-7AS, 13 alleles for TdALP-ax-7AS, 7 alleles for

TdALP-ay-7AS, and 4 alleles for TdALP-ax-4AL. Correlation studies on TdALP genes diversity and

ecological stresses suggested that environmental factors contribute to the ALP polymorphism formation

in WEW. Many allelic variants of ALPs in the endosperm of WEW are not present in bread wheat, and

therefore could be utilized in breeding bread wheat varieties for better quality and elite plant defence

characteristics.

2.2. Introduction

Prolamin superfamily proteins share a conserved pattern of cysteine residues, including the sulphur-

rich prolamins of the Triticeae, the cereal α-amylase/trypsin inhibitors, 2S storage albumins,

puroindolines, grain softness proteins, α-globulins, and a group of hydroxyproline-rich cell wall

proteins, which might all have originated from a small number of ancestral genes. According to Shewry

(18), the gliadins, members of the prolamin superfamily, include members with a large repetitive

domain and a conserved set of cysteine residues (α- and γ-gliadins), members with a repetitive domain

but no cysteine (ω-gliadins), and members with novel low molecular weight gliadins (LMWG) also

known as avenin-like proteins (ALPs) that contain a conserved cysteine pattern but with no repetitive

domains (89).

LMWG are proteo-lipid-like hydrophobic proteins, similar to albumin-like and globulin-like proteins

(133-135). Genes encoding LMWG are located in bread wheat on chromosomes 7A, 4A, and 7D

(136).This observation supports the 4A/7B chromosome interchange hypothesis because there is a

similar chromosomal distribution of peroxidase genes (133-135). In 2001, Anderson and others (8)

cloned five genes that shared complex relationships with the gliadins. One cloned gene, 11dc7,

28

corresponded to one group of LMWGs described by Salcedo and Prada (71). Rocher et al. (137)

reported two similar LMWGs proteins, rye-15 and rye-18 that showed weak immune-reactivity with

antibodies in serum from celiac patients. Clark described the identification of a functional class of genes

relevant to wheat grain end-use belonging to a novel glutenin/gliadin seed storage protein (138). Kan

et al. (139) identified two highly expressed transcripts encoding a and b type ALPs in wheat, but with

typically much higher expression in the Aegilops species. Over-expression of type b ALPs in transgenic

wheat improved dough mixing properties (92). ALP-coding genes were mapped to the short arms of

chromosomes 7A and 7D, and to the long arm of chromosome 4A in bread wheat (91). Importantly,

alleles on 7A have been found with differential effects on dough quality and its allele specific markers

have been developed to track the allelic effects (91). Recently, wheat ALP proteins were discovered

with significant Fusarium Head Blight resistant function, which highlighted the divergent functions of

this gliadin domain containing proteins families (140).

Emmer wheat, T. dicoccoides, is the progenitor of cultivated tetraploid and hexaploid wheats. It evolved

in the northern eco-geographical region of the upper Jordan River in the eastern Upper Galilee

Mountains and Golan Heights. Here we studied 21 populations of wild emmer wheat (WEW) from

across its natural range in Israel. These were screened for allelic variation of ALP genes with the aims

of identifying alleles useful for bread wheat improvement and determining the regional ecological

influences on allele formation. The 21 Israeli populations used in this study had previously been studied

by Nevo and colleagues (141-149). They identified local and regional ecological differences, genetic

differences, and allozymic polymorphisms. These early studies identified adaptive allozyme diversity

induced by abiotic and biotic stresses, highlighting the influence of selection on the adaptive nature of

allozymic variation, and thereby negating the neutral theory of evolution.

In history, there are mainly two controversial hypothesises of the natural variation for gene evolution,

the neutral/gene drift theory of gene evolution verses the neo-Darwinian natural selection theory. I drew

our initial hypothesis based on the previous researches on other storage protein coding genes, alpha-

amylase inhibitors, etc. As evidenced by our statistical analysis of ALPs polymorphism in WEW

populations, they are in most cases selected by adaptation to micro-environments rather than the neutral

theory of gene evolution.

2.3. Materials and Methods

2.3.1. Plant materials

Wild emmer wheat (WEW), tetraploid T. dicoccoides, the progenitor of most tetraploid and hexaploid

cultivated wheats, grows in lush and extensive stands in the catchment area of the upper Jordan Valley,

in the eastern upper Galilee Mountains and in the Golan Heights, where it originated. This resource is

rich in adaptive genetic diversity (142-146, 148-159). However, in some parts of central Israel, and in

29

part of the Fertile Crescent like Turkey, populations of wild emmer are semi-isolated or isolated. In

these places, wild emmer displays a patchy distribution pattern (142). The genotypes chosen for this

study were from 21 populations studied earlier for allozyme variation, spanning most of the ecological

range of emmer wheat in Israel (142). The central populations (Yehudiyya, Gamla, Rosh-Pinna and

Tabigha) were collected from the western Golan, eastern upper Galilee, and north of the Sea of Galilee,

which have warm and humid environments. The marginal steppic-populations (Mt. Hermon, Mt. Gilboa,

Mt. Gerizim, Gitit, Kokhav-Hashahar and J’aba) were collected across a wide geographic area on the

northern, eastern, and southern Israeli distribution borders, which have hot, cold and xeric peripheries.

In addition, the marginal mesic-populations (Amirim, Bet-Oren, Bat-Shelomo and Givat Koach) were

collected from the western border. The geographic distribution of 21 WEW populations is displayed in

supplementary Fig. S1. The exact locations (name, longitude, latitude, and altitude) of these 21

populations and the corresponding climatic data were listed in supplementary Table S7. Different

numbers of plants were sampled from each population. Seeds were obtained from the Gene Bank of the

Institute of Evolution, University of Haifa, Haifa, Israel. Seedling tissue was used for DNA isolation.

Doubled Haploid (DH) populations of Spitfire x Mace were developed at the Australia-China Joint

Centre for Wheat Improvement, Murdoch University. The two parental cultivars are both susceptible

to Fusarium Head Blight (FHB). A clear segregation of FHB disease level among the DH lines of

Spitfire x Mace was observed in our 2016 field trials. In a separate study (BioRxiv Doi:

10.1101/406694), we have found that ALP has FHB resistance function. Initially, for qRT-PCR analysis,

we attempted to choose DH lines with various FHB resistance but same ALP allele composition for all

15 loci and identical flowering and grain development timing and patterns to exclude the confounding

of allelic effects that need large line number to study so that the gene expression can be compared

among the same ALP alleles over exactly the same grain development stages. We found that the DH

line 241 was resistant to FHB while lines 130, 131, 187 were susceptible to FHB. These four lines had

the same ALP allele compositions for all 15 loci and had exactly the same flowering times and maturity

dates. Unfortunately, the three susceptible DH lines were heavily infected by the FHB pathogen F.

graminearum, making no grain can be harvested for gene expression study. We therefore chose to use

the naturally powdery mildew occurring lines for ALP expression to narrow down the loci inclusion.

Naturally occurring powdery mildew symptoms were observed for the Spitfire x Mace DH populations

in the field. Similar to the FHB disease, we also found that DH line 241 is highly resistance to powdery

mildew while lines 130, 131, and 187 were susceptible to powdery mildew. The healthy grains of DH

line 241 at 2 days after pollination (DAP), 7 and 10 DAP were sampled. The pathogen Blumeria

graminis f. sp. Tritici (Bgt.) affected DH line 131 were sampled at 2 and 10 DAP, meanwhile Bgt.

infected DH lines (130 and 187) were also sampled at 10 DAP in August 2016 with three biological

replicates. All samples were snap-frozen in liquid nitrogen and stored at -80C after sampling.

30

2.3.2. Sequence retrieval, orthologous gene identification and protein classification of ALPs

Previously characterized ALP protein sequences (91, 128, 160) were retrieved from uniprot database

(www.uniprot.org). The amino acid sequences of those characterized ALPs were used for tBlastn

queries against bread wheat genome database (TGACv1)

(https://plants.ensembl.org/Triticum_aestivum/Info/Index) with E-value threshold (1e-30). The

homologous genomic fragment hits at individual locus were merged and assembled as candidate ALP

encoding genes using Geneious Pro software (v10.2.2). The predicted ALP protein sequences were

verified for the presence of target peptides using the recommended protocol for TargetP 1.1 (161). The

integrity of each ALP genes was validated by Blastn query against the TGACv1 genome assembly for

its presence on a single TGAC scaffold with 100% sequence identity. Clustering of the identified ALP

homologues was performed in MEGA7 (162) using the UPGMA phylogeny method, based on sequence

alignment of the predicted amino acid sequences of ALPs. Alignment of ALPs was carried out using

the MUSCLE add-on tool in Geneious. Classification of ALP types was based on the phylogeny

grouping with previously classified ALPs. The classification of homoeologous genes also took into

account of the known 4AL/7BS wheat chromosome arms translocation, as previously been reported for

ALP genes (133-135). Each identified ALP was assigned with a unique name based on protein type

classification, subgenome location following the rules for gene symbolization in wheat

(http://wheat.pw.usda.gov/ggpages/wgc/98/Intro.htm).

2.3.3. Phylogeny and natural selection analyses

For homologous gene identification, previously characterized ALP protein sequences were used as

query for Blastp search against public databases with E-value threshold ae-30. For Brachypodium

distachyon and Hordeum vulgare, the Phytozome database

(https://phytozome.jgi.doe.gov/pz/portal.html) was used. For T. urartu, T. monococcum, Aegilops

speltoides, A. sharonesis, the MIPs database (http://pgsb.helmholtz-muenchen.de/plant/index.jsp) was

used. For T. turgidum ssp. dicoccoides and A. tauschii, the datasets from Zavitan WEWseq

(https://wheat.pw.usda.gov/GG3/wildemmer) and ATGSP (http://aegilops.wheat.ucdavis.edu/ATGSP/)

were searched, respectively. Codon-based CDS sequence alignments and amino acid sequence

alignments were performed using MUSCLE software with default settings. Neighbor joining (NJ) was

performed using MEGA7 software (162) with the p-distance substitution model. Branching support was

tested with interior branching tests (1000 times). Natural selection analyses were performed using

codeml program in PAML 4.7 package (163). Different branching models were specified using figtree

software ((http://tree.bio.ed.ac.uk/software/figtree/). For NJ phylogeny of homologous ALPs across

cereal crops, PF14368, PF00234, PF13016 domains for each protein sequence was identified by

hmmscan search against Pfam database and used for phylogeny development. For Maximum likelihood

(ML) phylogeny on the promalin superfamily protein in bread wheat and other species, the JTT + G (5

categories) amino acid substitution model was used with 500 times bootstrapping test.

http://www.uniprot.org/

https://plants.ensembl.org/Triticum_aestivum/Info/Index

http://wheat.pw.usda.gov/ggpages/wgc/98/Intro.htm

https://phytozome.jgi.doe.gov/pz/portal.html

http://pgsb.helmholtz-muenchen.de/plant/index.jsp

https://wheat.pw.usda.gov/GG3/wildemmer

http://tree.bio.ed.ac.uk/software/figtree/

31

2.3.4. Gene cloning and sequencing

Subgenome-specific PCR primers for each TaALP locus were designed using the respective TGAC

contig sequences with Primer Premier 5 software (164); the primer pairs were used to amplify fragments

from Chinese Spring genomic DNA. PCR amplification cycles consisted of 1 cycle =3 min 95°C; 35

cycles = 30 s 95 °C, 30 s 60–62 °C, 1 min 72 °C; 1 cycle = 5 min 72 °C. For the WEW lines, the TdALP-

bx/ay/ax-7AS and -ax-4AL genes were cloned using primer pairs listed in Table S2. The target PCR

products were separated by 1.5% (w/v) agarose gel electrophoresis, and the expected fragments were

purified from the gel using a Gel Extraction Kit (Promega, Madison, WI, USA). Subsequently, the

purified PCR products were amplified using BigDye@version 3.1 terminator mix (Applied Biosystems)

and submitted for Sanger sequencing.

2.3.5. WEW population data acquisition and analysis

POPGENE 1.32 was used to compute genetic indices, expected heterozygosity (Nei's gene diversity)

(He), and Shannon's information index (I) for 21 WEW population (165). Spearman rank correlation

coefficients were used to assess differences in genetic indices (He and I) and climatic variables in 15

WEW populations. The significant difference was calculated by SPSS one-way ANOVA followed by

Duncan’s multiple range test; values <0.05 were considered to be significant (Version 22.0; IBM

Corporation, Armonk, NY). Backward multiple regression (MR) analysis was conducted to test the best

predictors of He and I in the 15 populations using these genetic indices (He and I) as dependent variables

and the eco-geographic factors as independent variables from each population.

2.3.6. qRT-PCR

Quantitative reverse transcription PCR (qRT-PCR) analysis of TaALP gene RNA of Mace × Spitfire

DH lines (Lines 130, 131, 187 and 241) representing different developmental stages was undertaken as

previously been described (166). Seeds samples were frozen in liquid nitrogen, homogenized in a

mortar and pestle, and kept at −80°C until used. Total RNA was extracted as described by Wang et al.

(167). For qRT-PCR analysis, total RNA was treated with the DNase I (Qiagen). qRT-PCRs were

carried out in 10 μl volume in a Qiagen RotorGeneQ High Resolution Melt Instrument (Qiagen) using

a SensiFAST SYBR No-ROX One-Step Kit (Bioline, USA). The qRT-PCR profiles were as follows:

one cycle at 45°c for 10 min, followed by 95°c for 2 min, 40 Cycles at 95°c for 5 secs, 61°c for 10 secs,

72°c for 5 secs. A melting curve was performed to determine the specificity of each PCR primer by

incubating the reaction at 95°C for 20 s, cooling at 55°C for 10 s, and increasing to 95°C at a rate of

0.5°C/10 s. The geometric mean of the Taactin and TaGAPDH gene were used to normalize the

expression of the TaALP genes (166). The 2-ΔΔCt method (168) was used to calculate the relative

expression levels with three technical repeats. A one-way ANOVA followed by a Duncan’s test was

performed to identify significant differences. The linear correlations among the various relative TaALP

gene expression were also investigated using the SPSS (Version 22.0; IBM Corporation, Armonk, NY).

The TaALP gene specific primers were listed in Table S4A. The subgenome specificity of each primer

pair was verified using genomic DNA of wheat cultivar Chinese Spring (169). All the 15 pairs of

32

primers were tested using DNA from Wheat cv. Spitfire. The primer amplification efficiencies were

confirmed using four dilutions of each PCR product as template.

2.4. Results

2.4.1. Identification of ALP homologous genes from wheat genome phylogeny

We start the results section with an analysis of ALP homologs from wheat genomes in order to place

the TdALP analysis from WEW populations (Fig. S1) in a broader context of the Triticeae and other

plants.

In allohexaploid bread wheat, 15 unique full-length TaALP genes cDNA were mapped to chromosome

groups 4 and 7 (Fig. S2). Subsequently, besides ALP genes reported in published studies (91, 128, 160),

all other genes were cloned and sequenced (Table S1). Alignment of the translated amino acid

sequences encoded by the 15 full-length TaALP genes showed that ALPs vary in length from 150 to

285 amino acids (Fig. 1A). Their signal peptides were predicted and listed in Table S2. According to

the domain classification based on the pFam database, ALPs are characterized by possessing gliadin

domains (PF13016) as well as alpha-amylase inhibitors and seed storage (AAIs-SS) protein subfamily

domains (PF00234) (170). Based on alignment analysis and comparison with the reported a- and b-type

TaALP genes, a new type was found and named as c-type in this study (Fig. 1B, C, D). The homogeneity

of the TaALP genes within the same subgroup is based on their high sequence identities (>86.43%)

(Table S3).

To investigate the evolutionary relationships among ALP genes from the Triticeae, a Maximum

likelihood (ML) phylogenetic analysis was conducted based on the deduced amino acid sequences of

46 genes, including ALP-related sequences. As shown (Fig. 1B), besides the outgroup of puroindolines

and avenin-3 in the monophyletic group, three major ALP gene clades, type a (blue), type b (red), and

type c (green) for the 15 genes in bread wheat, as well as one gene copy of Brachypodium distachyon

were classified. Type a ALP, and type b ALP can be further divided into x and y subgroups. Type b

clade contains 10 ALPs; Type a clade contains 22 ALPs, and type c clade contains 11 ALPs. For the

type c clade, three TaALP genes on chromosomes 4A, 7A and 7D from bread wheat and one orthologous

barley gene, HvALP, on chromosome 7H, one from T. dicoccoides chromosome 7A, and genes from T.

monoccocum, T. urartu, Aegilops speltoides, A. sharonesis, A. tauchii, and B. distachyon were all

closely related. Three subunits from T. urartu are clustered, indicating three type c ALP genes in that

species. Within the type b clade y-type subgroup, one ortholog for T. monococcum and two

homoeologous genes on chromosomes 4A and 7A for T. dicoccoides were found. However, other

orthologs of type b ALPs were not identified in databases. For the x-type subgroup, one ortholog from

A. taucchii and three homeologous TaALP genes from bread wheat genomes were identified. For type

a clade y-type subgroups, 11 genes were identified – three from bread wheat, two from T. dicoccoides

33

(4A and 7A), one ortholog from barley (7H), and one each from T. monoccocum, T. urartu, A. speltoides,

A. sharonesis, and A. tauchii. The same patterns were found for the type a ALP clade, x-type subunits.

All the gene sequences used in this phylogenic analysis (Fig. 1C) contain a gliadin domain classified as

PF13016. An unrooted ML phylogenetic analysis identified a wheat ALP clade (grey), avenin-3 and

gliadin clade (purple), and a clade comprising millet, sorghum, maize prolamins that have a gliadin

domain (yellow). The TaALP clade separated into three subgroups comprising type a, type b, and type

c, while the rice prolamin, alpha-amylase inhibitor, grain softness protein and puroindolines diverged

from ALPs much earlier in the evolutionary history. This most recent common ancestor of the wheat

and barley ALP clade (grey) and avenin-3 and gliadin clade (purple) can be traced to much earlier in

the PF13016 domain evolutionary history (Fig. 1C). Much earlier are the common ancestor of the

members of the yellow clade for the millet, sorghum, maize prolamins with a gliadin domain. As a

result, Triticeae prolamins (ALPs, gliadins, and avenin-3) are more closely related to one another than

to Panicoideae prolamins. A Neighbor Joining (NJ) analysis was performed on gliadin domains, AAI-

LTSS domains and LTP2 domains of monocots and lower plants (Fig. S3).

34

A

y

y

x

x

bx by

ay ax

c

Ta_ALPc_4AL_289104 Ta_ALPc_7AS_571266 Ta_ALPc_7DS_642525

Ta-ALP-c-4AL Ta-ALP-c-7AS Ta-ALP-c-7DS

Ta_ALPa_4AL_642768_2 Ta_ALPa_7AS_569550_2 Ta_ALPa_7DS_621482_2 Ta_ALPa_4AL_642768_1 Ta_ALPa_7AS_569550_1 Ta_ALPa_7DS_621482_1

Ta-ALP-ax-4AL Ta-ALP-ax-7AS Ta-ALP-ax-7DS Ta-ALP-ay-4AL Ta-ALP-ay-7AS Ta-ALP-ay-7DS

Ta_ALPb_4AL_293148 Ta_ALPb_7AS_569550_4 Ta_ALPb_7DS_623321 Ta_ALPb_4AL_642768_3 Ta_ALPb_7AS_569550_3 Ta_ALPb_7DS_621482_3

Ta-ALP-bx-4AL Ta-ALP-bx-7AS Ta-ALP-bx-7DS Ta-ALP-by-4AL Ta-ALP-by-7AS Ta-ALP-by-7DS

B

D

C

x y

x y

35

Figure 1. Avenin-like protein sequence alignment and phylogenetic analysis. (A) Alignment of 15 deduced amino acid sequences of TaALP proteins from

bread wheat; (B) ML phylogenetic relationship of the bread wheat (T. aestivum) ALP amino acid sequences, ALP sequences of T. dicoccoides (wild emmer

wheat, WEW), T. urartu, T. monococcum, A. speltoides and A. sharonesis, A. tauschii, B. distachyon, and H. vulgare; (C) ML phylogenetic relationship of

bread wheat ALPs, Avenin-3 and gliadins, rice, sorghum, maize, and millet prolamins with a gliadin domain, alpha amylase inhibitors, grain softness protein,

and puroindolines; (D) Individual ALP gene names and the corresponding gene legends used for phylogenetic analysis.

36

2.4.2. Transcriptional analyses of TaALP genes in bread wheat under Bgt.-infection.

Gene expression dynamics of TaALP genes under biotic stress were studied to select gene loci for

detailed evolutionary study. The relative expression of TaALP genes in lemma and grain of 2 and 10

days after pollination (DAP) of Spitfire × Mace DH (doubled haploids) lines 130, 131, and 187 under

powdery mildew pathogen infection were studied (Fig. 2). Gene specific primers were designed for the

15 TaALP genes (Table S4A). The parent wheat cvs. Spitfire and Mace displayed allelic variations at 3

TaALP loci while the 4 DH lines were selected with consistent allelic compositions for the TaALP genes

(Table S4B). The healthy wheat lines (DH line 241) was chosen as the control and its ALP expressions

at 2, 7 and 10 DAP were shown in Table S4C. In the Bgt. infected 2 DAP lemma and grain, when

compared with the healthy control (DH line 241), gene c-7A exhibited 5-fold greater expression.

Similarly, bx-7A exhibited 6-fold up-regulation and by-7D 5-fold up-regulation. At 10 DAP, by-7D

showed 100-fold higher expression than the control (DH line 241). In DH line 131, bx-4A displayed the

highest up-regulation, >35-fold, whereas in DH line 130, all the type c genes were >8-fold up-regulated,

but they were not significantly different from the type b gene (bx-7D). For DH lines 130 and 131,

expression of the five a-type (ax-4A, ax-7A, ax-7D, ay-4A and ay-7D) genes was not significantly up-

regulated. In Line 187, ax-7A displayed nearly 40-fold up-regulation, which was significantly different

from the other four a-type genes. Due to the low transcriptional level of ay-7A gene, signals were

undetectable by RT-PCR. Relative expression of diverse types of TaALP genes showed significant

positive linear correlations under Bgt. infection (Table S5). Four a-type genes (ax-4A, ax-7A, ax-7D

and ay-7D) and three b-type genes (bx-4A, by-4A, by-7D) were observed with significant positive linear

correlations (r > 0.8, P < 0.05). Type c gene (c-7D) had a positive linear correlation with the three a-

type (ax-4A, ax-7A, and ax-7D) and 2 b type (by-4A and by-7D) genes, with coefficient r > 0.99 (P <

0.01). Insofar as bx-7A and ay-7A were not highly expressed, their expression in WEW should be further

examined. Meanwhile, ax-7A and ax-4A, exhibiting positive linear correlation with most of the other

ALP genes, should also be examined. Based on the transcriptional study above, we selected four TaALP

genes (bx/ay/ax-7AS and -ax-4AL) for allele screening and evolution study across the 21 WEW

populations.

37

0

1

2

3

4

5

6

7

8

9

10R

elat

ive

Ta

AL

P g

ene

exp

ress

ion

A

a

aa

a

a

aa a

aa

a

b

bb

0

20

40

60

80

100

120

140

Rel

ativ

e T

aA

LP

gen

e ex

pre

ssio

n

D

a a

a a

a a

a a

a

a

b b

bc

c

0

5

10

15

20

25

30

35

40

45

Rel

ativ

e T

aA

LP

gen

e ex

pre

ssio

n

C

a a ab abc abcd abcd

a

e

f

de cde

bcde bcde bcde

0

2

4

6

8

10

12

14

Rel

ativ

e T

aA

LP

gen

e ex

pre

ssio

n

B

a

a

a

a

a a

a a a a

b

b

b b

38

Fig. 2. Relative expression of 14 TaALP genes in the grain of 3 Spitfire x Mace DH lines (130, 131, and 187) under naturally occurring powdery mildew

pathogen infection at 2 and 10 DAP. The healthy 2 DAP and 10 DAP grain and lemma of DH line 241were used as control. (A) 2 DAP grain and lemma of

Spitfire x Mace DH line 131; (B) 10 DAP grain and lemma of Spitfire x Mace DH line 130; (C) 10 DAP grain and lemma of Spitfire x Mace DH line 131; (D)

10 DAP grain and lemma of Spitfire x Mace DH line 187. Units on the y-axis indicate relative expression of TaALP under powdery mildew pathogen infection.

Error bars indicate SEM of three technical replicates derived from one bulked biological replicate. Different letters indicate statistically significant differences

between genes for the infection at each time point. Values with different letters within the same row were significantly different (P < 0.05).

39

2.4.3. Gene cloning and sequencing analyses of 4 selected TdALP genes in WEW

Cloning and sequencing of the four selected TdALP genes in WEW (TdALP-bx/ay/ax-7AS and -ax-4AL)

revealed a surprisingly rich diversity. The 49 alleles identified were 25 bx-7AS genes, 13 ax-7AS genes,

7 ay-7AS genes, and 4 ax-4AL genes (Fig. S4). For the TdALP-bx-7AS gene, among the 25 haplotypes

(Fig. S4 A), 14 bx-7AS genes were assumed to be pseudogenes. Other alleles, bx-7AS-a*, -d, -g, -k, -m,

-r, -s, -t, -x, -y, and -z, were functional genes and the amino acid translations indicated continuous reads

from initiation to termination with no frameshift or premature termination. Amino acids A/T

replacement at position 12, a Q insertion at position 35, I/S and M/W replacements at position 58 and

60, occurred for genes bx-7AS-g, -s, -t, and -r. The Q/H replacement at position 205 also occurred in

several alleles (bx-7AS-m, -g, -s and -t). The Q insertion at position 35 occurred for alleles bx-7AS-d

and -k. For bx-7AS-k encoded ALPs type b proteins, G/C replacement at the N-terminal region occurred.

The coding sequences and deduced amino acids sequences of TdALP-ax/ay-7AS, and ax-4AL were

aligned, and the particular SNPs and indels are shown in Fig. S4 B, C, D. The amino acid alignments

of the 11 functional alleles of TdALP-bx-7AS are shown in Fig. S5A, while the type a alleles are shown

in Fig. S5B, C, and D.

2.4.4. Population genetics in relation to water and edaphic effects on TdALP gene diversity

The genetic diversity among different populations of WEW in Israel was assessed by comparing the

TdALP gene alleles identified from each population and the corresponding He and I indexes. As shown

in Table S6, 45 of 49 alleles were present in WEW populations in Israel. Overall, the four TdALP gene

loci were polymorphic in most populations. The mean number of alleles per locus ranged from 1 to 8

(Table S6). The genetic variation of TdALP genes displayed a clear region-specific pattern,

corresponding to a He index ranging from 0 to 0.64 and an I index from 0 to 1.26 (Fig. 3A).

40

Fig. 3. Population genetics of WEW based on TdALP diversity. (A) Genetic indices of 21 wild emmer

wheat populations; (B) Spearman rank correlations of genetic indices at each emmer wheat population

and climatic variables; (C) So and Rn are two environmental parameters which can best predict the

TdALP diversity in wild emmer wheat populations. Note: ** Correlation is significant at the 0.01 level

(1-tailed). * Correlation is significant at the 0.05 level (1-tailed). na = Observed number of alleles; ne

= Effective number of alleles (48); He = Nei's -1973 gene diversity; I = Shannon's Information index

(49).

To investigate the association of genetic diversity of TdALP genes in WEW with environmental

variables, firstly, one-tailed Spearman correlation analysis was performed to analyse the association of

He I

He 1

I 0.989** 1

Ln 0.079 0.093

Lt -0.285 -0.251

AI -0.467* -.490*

Tm 0.446* 0.435

Ta 0.514* 0.519*

Tj 0.435 0.449*

Td 0.113 0.093

Tdd 0.392 0.392

Rn -0.564* -.525*

Rd -0.368 -0.356

Hul4 -0.288 -0.316

Huan -0.139 -0.154

Dw 0.077 0.109

Sh -0.208 -0.253

Th -0.427 -0.427

Trd 0.264 0.3

Ev 0.497* 0.501*

Sz 0.142 0.174

Ma 0.245 0.273

So 0.559* 0.594**

Rv 0.495* 0.478*

Rr 0.256 0.265

SO

Rn I

SO

Rn He

A

B

C

na* ne* He I

Qazrin 2.00 1.87 0.46 0.66

Yehudiyya 5.00 2.57 0.60 1.12

Gamla 3.00 2.78 0.64 1.06

Rosh-Pinna 1.00 1.00 0.00 0.00

Ammiad-85 1.33 1.33 0.17 0.23

Tabigha 4.67 3.10 0.67 1.26

Mt. Gilboa 1.67 1.67 0.33 0.46

Mt. Gerizim 1.67 1.60 0.31 0.44

Gitit 2.00 1.73 0.42 0.61

Kokhav-Hashahar 2.67 2.67 0.61 0.96

Taiyiba 2.67 2.44 0.58 0.92

Sanhedriyya 2.00 2.00 0.50 0.69

Bet-Meir 2.00 2.00 0.50 0.69

J'aba 2.33 2.33 0.56 0.83

Amirim 2.00 2.00 0.50 0.69

Nesher 1.00 1.00 0.00 0.00

Beit-Oren 2.00 1.80 0.44 0.64

Daliyya 1.00 1.00 0.00 0.00

Bat-Shelomo 1.00 1.00 0.00 0.00

Kabara 2.00 2.00 0.50 0.69

Mt. Hermon 1.00 1.00 0.00 0.00

41

genetic diversity of TdALP (He and I) with various environmental variables (Fig. 3B, Table S7). The

results showed that eight variables, including climate, altitude, temperature (mean annual temperature,

mean August temperature, mean January temperature), available water (mean annual rainfall, mean

annual evaporation), and edaphic (soil type) variables, were significantly correlated with TdALP

genotype (Fig. 3B). Secondly, the eight variables listed above plus two further geographical parameters

were tested by backwards multiple linear regression (MR) analysis, for which 15 of the 21 WEW

populations were included (Table S8). When the three-variable model was used (Table S9), significant

regression equation was found: F (3, 11) = 8.99, p < 0.01, with an R2 of 0.710, t (15) = 5.62, p < 0.01.

Accordingly, latitude (Lt, 50%), mean annual rainfall (Rn, 99%) and soil type (So, 56%) were identified

as the variables that could explain the highest proportion of the TdALP genetic diversity (He) among

different populations. Noteworthy is the standardized coefficient for mean annual rainfall variable was

calculated as 99%, which suggests that mean annual rainfall dominates the other two variables in their

relevance to TdALP diversity. As such, a two-variable model was applied to the dataset (Table S10). A

significant regression equation was found: F (2, 12) =10.69, p < 0.01, with an R2 of 0.640, t (15) = 5.90,

p <0.001. The results showed that Rn and So could explain 65% and 35% of TdALP diversity (He),

respectively, which suggest that the two-variable model fits the dataset much better than the three-

variable model. To further validate that Rn and So are variables mostly-associated with the TdALP

genetic diversity, other backwards MR analyses were performed. Similarly, a significant regression

equation was found: F (2, 12) = 11.59, p < 0.01, with an R2 of 0.659, t (15) = 4.98, p < 0.001 (Table

S11). The results showed that Rn and So contribute 57% and 47%, respectively, to the genetic diversity

(I) (Fig. 3C). These results are comparable to the He index calculation (Fig. 3C).

2.4.5. TdALP-bx-7AS gene clustering analysis and correlation with environmental factors

A NJ analysis was done based on 25 TdALP-bx-7AS gene sequence alignments (Fig. 4A). Natural

selection pressure on bx-7AS gene in WEW was examined by measuring the ratio of non-synonymous

to synonymous substitutions (dN:dS = ω) (171). The silent alleles (-) and the functional alleles (+) are

listed in Table S6. The branch ω value of Haplo 4, 9, 12, and 14 is 0.45, for Haplo 15 and 25 is 0.0001,

for Haplo 1, 7, and 10 is 0.0001, for Haplo 2, 8, 17, and 23 is 2.37, for Haplo 18, 21, and 22 is 2.23, for

Haplo 3, 5, 6, 10, 11, 13, 16, and 19 is 1.93, and for Haplo 24 is 1, displaying a neutral selection. The

results indicated that all the functional alleles (ω <1 branches) are under purifying selection (except for

Haplo 11, clustered with other silent alleles), while all the silent allele (ω >1 branches) are under

positive selection. The T test results (one tailed, with equal variance) (Table S12) showed that the

environmental factors had a P value < 0.05, indicating significant correlations of TdALP-bx-7AS

functional allele/silent allele (+/-) with environmental factors. The micro environments selecting the

functional alleles (+) were significantly different from the micro environments favouring silent alleles

(-). The P values of Rd (mean number of rainy days), Dw (mean number of dew nights in summer), Ev

(mean annual evaporation) were > 0.05, indicating no significant correlations.

42

Fig. 4. Phylogenetic analysis of TdALP-bx-7AS gene in WEW populations. (A) Neighbour joining (NJ) phylogenetic analysis and natural selection tests of 25

haplotypes of TaALP-bx-7AS gene in WEW; (B) UPGMA phylogenetic analysis based on TaALP-bx-7AS gene variation in 21 WEW populations.

A B

43

2.4.6. UPGMA Phylogenetic analysis of TdALP-bx/ay/ax-7AS in WEW populations

Genetic variation of TdALP-bx-7AS among different WEW populations was analyzed. A UPGMA

(unweighted pair group method with arithmetic mean) tree was developed based on TdALP-bx/ax/ay-

7AS sequence alignments (Fig. 4B). In total, eight alleles (bx-7AS-f, -g, -h, -i, -j, -k, -l, and -m) were

identified in the Yehudiyya population. These alleles were distributed among different branches,

suggesting a significant degree of genetic variation. Some alleles are related to adaption to shade (-j and

-h), under tree canopies and sun (-k and -l) between trees (146-149). Some alleles collected from

different WEW populations clustered together. For example, alleles bx-7AS-g (Yehudiyya, Tabigha-

Terra Rossa and Mt. Gerizm), -s (Bet-Oren, Daliyya and Mt. Hermon), and -t (J’aba and Taiyiba) were

grouped together. The bx-7AS-m allele was found in Yehudiyya (both sun and shade), Mt. Gerizm, and

Amirim, while -n was present in Tabigha-Basalt and Ammiad-85. The bx-7AS-p from Nesher, Tabigha-

Terra Rossa, Mt. Gilboa, Kokhav-Hashahar, and Bet-Meir (mostly xeric populations) were grouped

together with -j from Yehudiyya-Shade, suggesting they were related populations from sites of similar

eco-geographic backgrounds with respect to rainfall and Terra-Rossa soil. The remaining 12 bx-7AS

genes were from populations of diverse eco-geographic backgrounds, and these were clustered together

in a separate group. Notably, bx-7AS-f dominates those populations from Yehudiyya (allele frequency

of 28.22%, Table S13) and also ranks the highest in Tabigha (with both TerraRossa and basalt soils).

Specifically, taking soil type into consideration, alleles bx-7AS-g, -p and –i were found in Tabigha-

Terra Rossa, not in the abutting basalt soil. In contrast, -n was found in Tabigha-basalt soil,

demonstrating adaption to this soil type. The results of the UPGMA analysis for TdALP-ax-7AS and

TdALP-ay-7AS genes are shown in Fig. S6. and Fig. S7, respectively.

2.4.7. Genetic distance analyses among different WEW populations

Pair-wise genetic distances (p-distance), based on the normalized gene sequence identity of TdALP-

bx/ay/ax-7AS in WEW populations, were calculated using MEGA 7.0 software (Table S14). Overall,

the target populations demonstrated a close distance with each other, ranging from 0.013 to 0.291 (Table

S14). The genetic distance between WEW populations was found for J’aba, > 0.195 with Bet-Meir,

Gamla, Gitit, Mt. Gilboa, Qazrin, Sanhedriyya, Tabigha1979, Taiyiba and Kokhav-Hashahar. The

maximum pair-wise genetic distance (p-distance = 0.291) among different populations was identified

between populations J’aba and Kokhav-Hashahar, indicating significant variation in closer but marginal

steppic-populations. However, one interesting phenomenon was observed, some physically distant

populations displayed relatively lower p-distances than some physically close populations. For example,

populations Gamla and Yehudiyya-Sun, which were separated by only 9.5 km (Fig. S1), have a p-

distance of 0.212. In contrast, the p-distance between Mt. Gerizim and Gamla (156 km, Fig. S1) is 0.155,

and, most significantly, Yehudiyya-Sun and J’aba (130 km, Fig. S1) has the lowest p-distance (0.013)

(Table S14). Noteworthy, the p-distance between Yehudiyya-Sun and Yehudiyya-Shade is 0.133, while

that of Tabigha Terra Rossa and basalt is 0.163 (Table S14), suggesting that soil type plays a more

significant role than temperature.

44

2.5. Discussion

2.5.1. Origin, mechanism, and phylogeny of ALP gene evolution

The ALPs anti-fungal functions revealed by Zhang et al (140) indicates a vital importance to identify

genetic diversity of ALPs for potential exploration in wheat breeding. Similar to most grain storage

protein genes, the current study revealed that abundant ALP alleles have accumulated during evolution.

The ALP coding genes of bread wheat were closely related to the gliadins and avenin-3 genes identified

in the present study from populations of WEW (Fig. 1). Previous studies have shown that unequal

crossover or gene slippage of insertions or deletions of blocks often happened during duplication events

for HMW-GS genes (172, 173), which might also help to explain the emergence, expansion, and the

allelic variations of the ALP genes. Domain replication observed for ALP genes (b-type), serves a

similar function to gene duplication, establishing gene variability driven by evolutionary forces. As for

many proteases inhibitor gene families, instead of complete gene duplication, including promoter and

terminator sequences and possible reintegration at a distinct locus, there is duplication of the inhibitory

domain sequence with the domains remaining fused (174-176). Fifteen full-length TaALP genes were

clustered into three major subgroups (type-a, -b and -c) in our phylogenetic analyses (Fig. 1B, C). In

addition, our results revealed the existence of intra- and inter-chromosomal ALP genes in WEW and

bread wheat. There are three copies of type c genes in T. urartu (Fig. 1B) while only one copy in each

chromosome of bread wheat and WEW, indicating that wheat-specific ALP gene

duplication/elimination events most likely occurred in a diploid wheat ancestor, leading to the loss of

these genes in WEW as well as in bread wheat. Similar wheat-specific gene duplication events and/or

chromosomal translocations are also likely to be responsible for origin of the multi ALP genes.

2.5.2. The importance of natural population in highlighting genetic adaptations

Experimental populations evolving under natural selection represent an important resource for studying

the genetic basis of adaptation. Our analysis of TdALP gene variation and evolution in WEW was based

on eco-genetic analyses of Israeli and Golan Heights populations, as was demonstrated previously in a

study of allozyme evolution in these populations (141-149). Our results demonstrated that

polymorphisms in ALP genes in WEW correlated with the eco-geographic distribution of the genotypes.

Observations were consistent with previous results on HMW-GS, LMW-GS, gliadins and α-/β-amylase

inhibitors (150, 152-154, 156, 157). Some geographically-close populations were very different in their

TdALP structures at the considered loci (Table S6). In Yehudiyya-Sun and -Shade abutting populations,

TdALP genes consist of bx-7AS-f, ay-7AS-d, ax-7AS-d, ax-4AL-d (Shade), or in some genotypes they

are composed of bx-7AS-f, ay-7AS-c, ax-7AS-b, ax-4AL-a (Shade). Another example can be found at

Tabigha, now designated Evolution Slope, where two divergent soil types – the calcareous Terra Rossa

soil and the volcanic basaltic soil (141, 177) – influenced the TdALP composition of WEW populations

occupying these different soils. Alleles bx-7AS-g, ay-7AS-b, ax-7AS-c occurred only in plants from

Terra Rossa soil, whereas bx-7AS-n, ay-7AS-c, ax-7AS-b occurred only in basaltic soil. In contrast,

45

TdALP alleles from some geographically-distant populations were very similar. An extreme example

was bx-7AS-s, which occurred in Mt. Hermon, Bet-Oren, and Daliyya populations. The silent allele, bx-

7AS-a was found in Gitit and Kabara of Israel, as well as wheat cultivar Chinese Spring, while the

functional allele (with a C → T SNP), bx-7AS-a*, was identified in marginal mesic-populations at Bat-

shelomo of Israel (Table S6).

The absence of a significant relationship between geographic separation and genetic distance attests to

a sharp local ecological differentiation rather than a gradual change in allele frequencies across the

range of WEW in Israel. Genetic diversity did not follow the simple isolation by distance model of

Wright (178). Quite often, a greater genetic difference occurred between physically close populations

than between distant populations. This was clearly demonstrated by the proximal populations located

at Tabigha (two soil types) (177) and Yehudiyya (Sun vs Shade) (146-149). Most of these peripheral

populations are isolated marginal populations with unique eco-geographical conditions. For example,

ay-7AS-g was only identified from xeric Gitit, ay-7AS-e was only identified from J’aba, a population

near the southern border of WEW in Israel, while bx-7AS-v was only identified from the small

peripheral Bet-Oren population on Mount Carmel. Some alleles were rare (never occurring with a

frequency ≥ 1%) and unique to specific populations, like alleles bx-7AS-i and -h (Yehudiyya-Shade).

On the other hand, some common alleles were widespread across the populations. For example, ay-

7AS-b was found in Tabigha (Terra Rossa and basalt soils), Yehudiyya (Sun and Shade), Gamla, J’aba,

Bet-Meir, Sanhedriyya, and Taiyiba, Mt. Gerizim, Mt. Gilboa, Kokhav-Hashahar, and Qazrin, where

environments are either hot, cold or xeric, suggesting that ay-7AS-b could be a valuable allele for plant

survival under variable harsh environments. Finally, at the bx-7AS locus, some alleles occurred

sporadically (in three or more populations) at physically distant sites such as -g (Yehudiyya, Tabigha-

Terra Rossa, and Mt. Gerizm), -m (Yehudiyya-Sun and -Shade, Mt. Gerizm and Amirim) and -p (Nesher,

Tabigha-Terra Rossa, Mt. Gilboa, Kokhav-Hashahar, and Bet-Meir). Thus, the genetic structure of

WEW populations in Israel is mosaic. This patchy genetic distribution appears to reflect the underlying

ecological, climatic, edaphic, and biotic heterogeneity at both micro- and macro-scales (142, 144, 155).

The high levels of polymorphism and genetic diversity found within and between populations could be

explained by spatio-temporal selection. Micro-environmental variation coupled with a limited

migration of T. dicoccoides, may explain the dramatic genetic divergence of the two populations at the

Tabigha site (141, 177). Specific SNP positions detected in TdALP genes were found to be highly

effective in distinguishing genotypes and populations of WEW originating from diverse eco-geographic

sites. These results suggest that genetic variation at these SNP positions in the TdALP were at least

partly ecologically determined.

46

2.5.3. Natural Selection of TdALP-bx-7AS genes in WEW

Significant diversities at the TdALP-bx-7AS gene locus were detected both between and within WEW

populations. The bx-7AS genes were naturally selected across populations supported by a different ratio

of dN:dS (ω) (171). Environmental factors significantly correlate with the functional and silent alleles

for bx-7AS locus (Fig. S12). A sharp genetic divergence over short geographic distances compared to a

small genetic divergence between large geographic distances also suggested that the SNPs were

subjected to natural selection, and ecological factors had an important evolutionary role in gene

polymorphism formation (141-149). Natural selection of orthologous genes can be assessed by

comparing the ratio of ω in protein coding sequences (179). Natural selection of orthologous genes can

be assessed by comparing the ratio of ω in protein coding sequences (42). Ecological stresses have often

been proposed as inducing active and rapid evolutionary changes. Compared to positive natural

selection, purifying selection acts against mutations that have deleterious effects on protein structure.

The ω value of Haplo 24 equals 1, displaying neutral selection (Fig. 4A). The results indicated that all

the functional alleles are smaller than 1, suggesting that natural selection may have eliminated most of

the deleterious effects caused by purifying selection (Fig. 4A). On the other hand, all the silent alleles

and one functional allele, Haplo 11, are greater than 1, suggesting that positive selection give rise to

dominant alleles in several WEW populations (Fig. 4A). Genes under positive selection give rise to

new advantageous genetic variants that become more common in populations.

Altitude plays a significant role in population TdALP divergence as evidenced by the populations of Mt.

Hermon, Rosh Pinna, Gamla, Bat-Shelomo and Tabigha, located at altitudes of 1300, 700, 200, 75 and

0 m, respectively (Table S7). In addition, the genetic variation was also estimated for populations

collected from different altitudes. The results showed that the populations located below 700 m

(Tagbiha, 0 m) tends to have a higher level of genetic diversity with the He and I being 0.67 and 1.26,

respectively (Fig. 3B). This is followed by the populations collected from Yehudiyya and Gamla (200

m), with slightly lower He and I of 0.6 and 1.12 for Yehudiyya, and 0.64 and 1.06 for Gamla (Fig. 3B).

In contrast, populations collected above 900 m, such as Mt. Hermon, were not polymorphic at all;

meanwhile, for Mt. Gerizim (800 m), the He and I were of 0.31 and 0.44, respectively, also with less

diversity (Fig. 3B). Along with altitude, several other environmental factors differed among these

populations, such as abiotic climatic conditions, water availability, soil type, and biotic factors including

parasites, pathogens and competitors (Table S7) (180, 181). The association of altitude with genotype

diversity could be explained by the sharp gradient of climatic conditions down the mountain slopes,

with increasing temperatures and water availability downslope towards the Jordan valley. It is worth

noting that the climatic factors included in our analysis does not represent all the possible components

involved in determination of the real climate, nor does it contain any biotic factors. Thus, altitude

influences could only account for some climate components, but do not represent a host of changing

soil and biotic factors.

47

2.5.4. Genetic distance and evolution of TdALP in WEW

The relationship between TdALP genetic distance and geographical distance indicated that the estimates

of genetic distance (p-distance) were geographically independent. Sharp genetic divergence (large p-

distance) over very short geographic distances against small genetic divergence (small p-distance)

between large physical distances were observed. For example, the genetic distance between populations

of Tabigha (Terra Rossa and basalt) and Gamla located only about 9.5 km apart with p-distance = 0.212,

was 1.4 times higher than the genetic distance between populations Mt. Gerizim and Gamla (156 km,

Fig. S1), and most significantly, 16 times higher than that between Yehudiyya-Sun and J’aba (130 km,

Fig. S1). Environmental stress can greatly influence plant susceptibility to herbivores and pathogens,

and drought stress can promote outbreaks of fungal diseases and plant-eating insects (182). Different

herbivore-related and pathogen related selection pressures at these ecological locations may influence

polymorphism of insect-resistant and pathogen-resistant loci in WEW (156). Interestingly, in the

transcriptional analysis, ALP genes were found to be significantly upregulated by pathogen infection

(Fig. 2). Different environmental pressures at each WEW population relate directly to the climate, but

ALP gene expression may respond indirectly to environmental factors. It is possible that several

evolutionary mechanisms underlie the differences in ALP diversity. It can be concluded that the

variation in ALP genetic diversity between populations is due to selective forces. The genetic structure

of WEW populations in Israel is a mosaic (142, 143, 145, 150, 151, 153, 183). Thus, higher levels of

polymorphisms and genetic variations of TdALP within and between populations can be explained as

adaptive complexes generated by natural selection and co-evolution with biotic or abiotic pressure.

2.5.5. Conclusions and prospects

Our molecular characterization of the TdALP gene family in WEW allows several conclusions to be

made about the origin of ALP genes. Future challenges of crop improvement can be overcome by

effectively utilizing the immense resources of genetic diversity unravelled by the evolution and allele

analysis in natural populations of the wheat progenitors. The drivers of ALPs allelic variations in WEW

populations appear to be intimately linked to the environment in which the populations originated.

These results suggest: (I) during the evolutionary history of WEW, diversifying natural selection

through climatic (e,g. annual rain fall and temperature) and edaphic factors (soil type) was a major agent

of genetic structure and differentiation at TdALP loci; and (II) WEW populations harbor large amounts

of genetic diversity exploitable for wheat improvement. Further, in the transcriptional level, we found

that most members of this multi-function large gene family are transcriptionally active at multiple stages

of bread wheat development as well as under conditions of pathogen infection (powdery mildew). The

allelic diversity associated with the germplasm-originating environmental conditions may provide a

solution to fight the negative impact of the global warming complexities on modern wheat production.

These genetic resources provide potential values for improving wheat cultivars under uncertain

environmental conditions in the future.

48

Figure S1. Geographic distribution of the 21 tested populations of wild emmer wheat, T.

dicoccoides, in Israel, as indicated by yellow stars (142).

52

Figure S2. 15 TaALP genes annotated on bread wheat chromosomes arms 4AL, 7AS, and 7DS.

Distribution of the genes across two chromosome groups A (7A and 4A) and D (7D) of bread wheat. Gene names were based on the identified TGACv1

scaffold name, and an additional number was added to the gene name when more than one TaALP gene was located on the same chromosome.

53

Figure S3. Neighbour joining (NJ) phylogeny on ALP homologous genes (gliadin, AAI-LTSS and LTP2) in

monocots plant. The 1000 times interior branching support was labelled above each branch. The identified Pfam

domains for each protein were added to the taxa ID. Bread wheat ALPs were highlighted in red color.

ALPs are characterized by gliadin domains (PF13016, http://pfam.xfam.org/family/Gliadin), as well as

alpha-amylase inhibitors (AAIs) and seed storage (SS) protein subfamily domains (PF00234,

http://pfam.xfam.org/family/Tryp_alpha_amyl), according to the domain classification (33). PF13016

is characterized by a cysteine-rich N-terminal domain of gliadins and avenins. The function of this

domain is unknown. Another group of proteins contains PF00234, which is a domain characteristic of

α-amylase inhibitors/grain softness proteins. Further, a group of proteins containing PF14368 is

characteristic of LTP-2. Homologous gene sequences of PF13016, PF00234 and PF14368 from lower

plants and several monocot species (Physcomitrella patens, B. distachyon, Oryza sativa, Panicum hallii,

Setaria italica, H. vulgare, Sorghum bicolor, and Zea mays) were obtained from the Phytozome

database. Corresponding domain sequences were identified by hmm search which were used for NJ

http://pfam.xfam.org/family/Gliadin

http://pfam.xfam.org/family/Tryp_alpha_amyl

54

phylogenetic analysis. Likwise, the closest relatives of ALP genes were located on chromosome groups

1 and 6 (avenin-3, gamma-gliadins, LMW-glutenins, and alpha-gliadins); group 3 & 4 (alpha-amylase

inhibitors) and group 5 (puroindolins and grain softness protein). Several sets of homoeologous TaALP

genes were identified on bread wheat chromosome groups 4 and 7. Among the subfamilies of TaALP,

the ALP subfamily has the gliadin domain and the AAI-SS domain. The type c and type a ALP subfamily

possesses one gliadin domain and one AAI-SS domain while the b type ALP subfamily possesses two

repeated domains.

55

Figure S4. Haplotypes identified in wild emmer wheat (WEW) T. dicoccoides.

(A) Alignment of 25 TdALP-bx-7AS. InDels is shown. Despite the start and stop codon coding ATG and TAG, all the polymorphisms loci are highlighted.

Dashed (-) and Tilded (~), respectively indicate identical and deletion nucleotides. Position 34 (A→G), 45 (C→G), 70 (T→G), 75 (C→T), 94 (CAA insertion),

102 (T→A), 114 (G→T), 132 (T→C), 145 (T→C), 152 (T→C), 153 (A→G) 173 (G→T), 178 (G→A), 261 (A→G), 270 (G→A), 271 (G→A), 300 (G→C),

301 (G→A), 313 (A→G), 318 (G→T), 328 (C→T), 336 (A deletion), 343 (C→T), 353 (A→G), 419 (CCGTCCCGGTACAA, 14 nucleotides deletion), 425

(C→T), 441 (A→G), 456 (C→G), 471 (ACA deletion), 472 (C→T), 473 (A→T), 481 (GAGCA insertion), 511 (T→C), 532 (C→T), 540

56

(GTGCCATTCCCCCAGACA, 18 nucleotides deletion), 541 (T→C), 545 (A→G), 557 (A→T), 559 (C→T), 588 (G→A), 607 (G→T), 620 (T→G), 624

(C→T), 639 (T→A), 662 (T→G), 672 (A→G), 681 (C→T), 696 (T→C), 713 (G→A), 716 (C→G or C deletion), 726 (G→T), 728 (C→G), 756 (C→G), 761

(C→T), 770 (G→A), 802 (C→A), 807 (C→T or C deletion). (B) 13 TaALP-ax-7AS, Position 41 (G → A), 67 (A → G), 87 (C → T), 102 (G → C), 145 (C →

T), 150(G → A), 163 (Deletion ACACCATATGTCCAG), 172 (G → A), 199 (G → A), 233 (C → T), 426 (C → T), 489 (G → A), 494 (C → G). (C) 7 TdALP-

ay-7AS, Position 33 (C → A), 36 (C → T), 39 (GG → AA), 208 (C → T), 352 (C → G), 413 (T → C). (D) 4 TdALP-ax-4AL, Position 126 (G → A), 285(G →

A), 287 (C → T), 493 (C → G).

A comparison of all the alignments indicated that one in-frame stop codon was involved in gene alleles bx-7AS-a, -h, -l, -n. Moreover, for alleles -j, -p, which

contained two in-frame stop codons, at position 716, a C deletion occurred, which resulted in a frameshift. For bx-7AS-u, at position 419, a deletion of 14

nucleotides (CCGTCCCGGTACAA) occurred, which resulted in a frameshift and premature termination of protein translation. As for bx-7AS-f and -o, a

deletion at position 336, an insertion of five nucleotides (GAGCA) at position 481 occurred, which resulted in a frameshift and premature termination of protein

translation. At bx-7AS-e, -i, -q, -v, and -w, an insertion of 5 nucleotides (GAGCA) occurred, which resulted in a frameshift and premature termination of protein

translation. Similar to the gliadin family genes, TdALP genes contained a moderate proportion of glutamine (Q) codons, which can mutate to become premature

termination codons through C → T transitions (bx-7AS-a, -h, -l, -n, -j, -p, -u).

58

Figure S5. Alignment of the deduced amino acid sequences. (A) 11 functional TdALP-bx-7AS, (B) 13 TaALP-ax-7AS, (C) 7 TdALP-ay-7AS, (D) 4

TdALP-ax-4AL.

59

Figure S6. UPGMA phylogenetic analysis based on TaALP-ax-7AS gene variation in wild emmer wheat

(WEW) populations.

The evolutionary history was inferred using UPGMA (184). The evolutionary distances were computed

using the p-distance method (185) and are in the units of the number of base differences per site. The

rate variation among sites was modeled with a gamma distribution (shape parameter = 3). The analysis

involved 137 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All

positions containing gaps and missing data were eliminated. There were 478 positions in the final

dataset. Evolutionary analyses were conducted in MEGA7 (186).

Notably, the ax-7AS-a allele identified from Qazrin, Kokhav-hashahar, and Gamla was closely related

to -h from Sanhedriyaa, also suggesting allelic adaption to ecological constraints (approximate rain fall)

despite geographic distance. The ax-7AS-j allele was unique to the WEW collected from the xeric Mt.

Gilboa population, Sanhedriyaa and Tabigha-Terra Rossa population, while -k was specific to J’aba,

the southern-most WEW population in Israel. In addition, ax-7AS-i and -e were unique to xeric Gitit

60

and Ammiad-85, respectively, while the -m was only found in Yehudiyya. Others, such as ax-7AS-g

were found in multiple locations, including Mt. Gerizim, Kokhav-Hashahar and Bet-Meir, which shared

some ecological factors, such as the terra rossa soil. Allele ax-7AS-l was present in Gamla and J’aba,

which share similar annual temperatures, while -c was found in both Tabigha-Terra Rossa and

Yehudiyya, where water availability was comparable. Two alleles, ax-7AS-b (51.04%) and -d (22.92%)

(Table S13), were widely distributed among various populations and did not show strong ecological

constraints.

Figure S7. UPGMA phylogenetic analysis based on TaALP-ay-7AS gene variation in wild emmer wheat

(WEW) populations.

61

The evolutionary history was inferred using UPGMA (184). The evolutionary distances were computed

using the p-distance method (185) and are in the units of the number of base differences per site. The

rate variation among sites was modeled with a gamma distribution (shape parameter = 3). The analysis

involved 137 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All

positions containing gaps and missing data were eliminated. There were 478 positions in the final

dataset. Evolutionary analyses were conducted in MEGA7 (186).

The UPGMA analysis of TdALP-ay-7AS genes showed that ay-7AS-a was present in Qazrin, Kokhav-

hashahar, Gamla and Sanhedriyaa, which were closely related to -g identified from Gitit. The ay-7AS-f

was found only in Ammiad-85. The ay-7AS-b (38.54%) -c (34.38%) and -d (16.67%) alleles (Table

S13) were the most common alleles present across several locations. These alleles (-b, -c, -d) were

grouped together and display a close relationship with -e identified from J’aba.

62

Table S1. Identification of 15 TaALP genes in bread wheat.

The sequences of oligonucleotides used to amplify each gene from genomic DNA, the CDS length, as well as the expected PCR product sizes (bp) were listed.

Chromosome

arms location Gene name Forward primer sequence 5' to 3' Reverse primer sequence 5' to 3'

CDS

length

(bp)

Product

size

(bp)

4AL TaALP-c-4AL GGATCCTTAGACATCATGAAGACCTTG AAGCTTAGAGTCATCAACCGTCAATTC 474 515

7AS TaALP-c-7AS GGATCCTTAGACATCATGAAGACCTTG AAGCTTACATTGACTCACAGACCCATC 474 497

7DS TaALP-c-7DS GGATCCTTAGACATCATGAAGACCTTG AAGCTTAGACTCATACACCGCTACACCT 453 488

4AL TaALP-ax-4AL GATTGTATCCAGCCACTATGAAGAA * ACGGTGATCGATCTAGCTAGC * 546 596

7AS TaALP-ax-7AS CTAGCCACTATGAAGACCATGTTCA * ACGGTGATCGATCTAGCTAGC * 528 554

7DS TaALP-ax-7DS GGATCCATGAAGACCATGTTCCTC AAGCTTCATCACAGATCTTAGCAGGC 507 530

4AL TaALP-ay-4AL TCTAAACCATGGTTGCGCAGCTGGACAC TCTAAAGGATCCTTAGCAGGTACCACCAAC 516 491

7AS TaALP-ay-7AS CTAGCCACTATGAAGACCATGTTCA * CTACTCAACAACGATTTTAGCAGGT * 522 547

7DS TaALP-ay-7DS CTAGCCACTATGAAGACCATGTTGA AGCAGATACCACCCACACAGTTAGT 522 529

4AL TaALP-bx-4AL AGGTCTTCATCCTGGCTCTCC GACCATCTACCATTCACCACT 858 860

7AS TaALP-bx-7AS ATGAAGGTCTTCATCCTGGCT * CTACTACGCACCAACAGGCTAA * 852 852

7DS TaALP-bx-7DS ATGAAGGTCTTCATCCTGGCT CATTTTTATCTTGCCACCGCTA 855 887

4AL TaALP-by-4AL - - 843 -

7AS TaALP-by-7AS GGATCCCTAGCAACCATGAAGACA AAGCTTATTGATCAACTAGCAGGTACCAC 843 885

7DS TaALP-by-7DS - - 843 -

The primers with an asterisk * are used for wild emmer wheat population screening.

Each TaALP gene was assigned with a unique name based on homoeologous grouping and subgenome A and D and the phylogenetic analysis.

63

Table S2. Prediction of subcellular localization peptides for TaALP proteins. For each TaALP gene,

measures are given for protein length (Len), scores for chloroplast transit peptide (cTP), mitochondrial

targeting peptide (mTP), secretory pathway signal peptide (SP) and other subcellular localization

including cytoplasmic, nuclear and peroxisomal peptides (Other) using the recommended protocol for

TargetP 1.1 as described by Emanuelsson et al. (21). Significant scores are summarized in the predicted

localization (Loc) column for proteins containing mitochondrial targeting (M), chloroplast transit (C)

or secretory pathway signal (S) peptides. The TargetP1.1 prediction scores (RC) for reliability and

confidence are also provided.

Gene name Len cTP mTP SP Other Loc RC TPlen

TaALP-c-4AL 174 0.032 0.09 0.398 0.266 S 5 19

TaALP-c-7AS 174 0.032 0.08 0.459 0.261 S 5 19

TaALP-c-7DS 160 0.067 0.057 0.374 0.363 S 5 19

TaALP-ax-4AL 181 0.009 0.11 0.778 0.05 S 2 19

TaALP-ax-7AS 175 0.012 0.079 0.718 0.07 S 2 19

TaALP-ax-7DS 168 0.008 0.139 0.681 0.049 S 3 19

TaALP-ay-4AL 171 0.064 0.018 0.734 0.126 S 2 18

TaALP-ay-7AS 173 0.033 0.014 0.787 0.188 S 3 19

TaALP-ay-7DS 173 0.03 0.014 0.869 0.142 S 2 19

TaALP-bx-4AL 285 0.022 0.058 0.525 0.212 S 4 18

TaALP-bx-7AS 282 0.018 0.041 0.618 0.177 S 3 18

TaALP-bx-7DS 284 0.02 0.073 0.555 0.154 S 3 18

TaALP-by-4AL 280 0.013 0.022 0.909 0.087 S 1 19

TaALP-by-7AS 280 0.027 0.019 0.896 0.064 S 1 19

TaALP-by-7DS 280 0.014 0.02 0.933 0.068 S 1 19

64

Table S3. Percentage (%) nucleic acid identity between 15 full-length TaALP genes.

ay-4AL ay-7AS ay-7DS ax-4AL ax-7AS ax-7DS by-4AL by-7AS by-7DS bx-4AL bx-7AS bx-7DS c-4AL c-7AS

ay-7AS 93.46

ay-7DS 93.49 92.09

ax-4AL 89.79 90.05 88.67

ax-7AS 89.51 89.76 88.67 97.20

ax-7DS 88.92 89.17 88.07 96.93 96.67

by-4AL 55.17 55.17 55.08 56.12 57.37 57.53

by-7AS 55.75 55.75 55.66 55.84 57.09 56.37 94.05

by-7DS 56.56 56.56 57.13 56.44 57.69 56.97 96.68 95.37

bx-4AL 58.71 58.67 59.25 58.60 58.56 59.54 82.04 82.97 83.60

bx-7AS 58.27 59.81 60.38 59.89 59.85 60.03 81.15 81.77 82.04 94.82

bx-7DS 59.85 59.81 61.16 57.21 57.17 58.16 83.27 82.98 83.61 95.09 93.75

c-4AL 62.80 64.71 61.74 64.31 64.25 63.06 61.79 61.34 62.59 66.61 66.69 65.69

c-7AS 63.32 65.63 63.29 66.01 66.35 65.17 59.11 58.83 60.30 64.96 65.23 63.81 83.51

c-7DS 64.99 66.49 63.56 66.84 66.78 65.61 64.75 63.54 65.12 68.64 68.71 67.73 95.39 84.32

65

Table S4A. Gene specific primers for 15 TaALP genes.

Gene name Forward primer sequence 5' to 3' Reverse primer sequence 5' to 3' PCR product size (bp)

TaALP-c-4AL GGATCCTTAGACATCATGAAGACCTTG AAGCTTAGAGTCATCAACCGTCAATTC 509

TaALP-c-7AS GGATCCTTAGACATCATGAAGACCTTG AAGCTTACATTGACTCACAGACCCATC 493

TaALP-c-7DS GGATCCTTAGACATCATGAAGACCTTG AAGCTTAGACTCATACACCGCTACACCT 488

TaALP-ax-4AL GATTGTATCCAGCCACTATGAAGAA GATTTATGCCACGCTACAGACC 326

TaALP-ax-7AS CTAGCCACTATGAAGACCATGTTCA TGACTGGACTTATGGTGTCTGGA * 189

TaALP-ax-7DS CTAGCCACTATGAAGACCATGTTCC GAAGCACCATCCTCATTATCTCG * 382

TaALP-ay-4AL CATATTTGCAGTCTCAGATGTGGCG GTTGTAGGGGGTCTGAGTGATGGTC 320

TaALP-ay-7AS CTAGCCACTATGAAGACCATGTTCA CTACTCAACAACGATTTTAGCAGGT 547

TaALP-ay-7DS CTCGCGGCGACTAGCGTC * ATGACCTGGGCCACACCG * 254

TaALP-bx-4AL AACGACAGTTGGTGGAGGAGATAAG ATTGTTGTTGCTGCTGGCATTGTAT 336

TaALP-bx-7AS TGCAGCAGCTTAGCAGCTGCCAT * GCTGGTAGGCTGATCCACCGGA * 368

TaALP-bx-7DS CATTTAGCCAGTGCTTTGGACAGTC TGTTGAATGATAGCCTCTACCACGA 256

TaALP-by-4AL TGTAGCCCAGTCGTAACACCATTCT ATTCTTGTTGGGGCTGTTGTTGAC 172

TaALP-by-7AS GCTCAATTGGAAACCATTTGTAACA ATTGTCTTGCACCGGGTTTGATT 242

TaALP-by-7DS AGAACAAGTCCTGTGCAAAGCCATA TGCCTGATAGACTCTACCACATTACGA 402

The oligonucleotides with an asterisk * are from published studies (91, 160). The reaction efficiency of each gene specific primer was testified.

66

Table S4B. Allelic variation of wheat cvs. Spitfire, Mace, DH lines 187, 130, 131, and 241.

Genes Mace Line 187 Line130 Line 131 Line 241 Spitfire

TaALP-c-4AL C C C C C C

TaALP-c-7AS C C C C C C

TaALP-c-7DS C C C C C C

TaALP-ax-4AL M C C C C C

TaALP-ax-7AS C C C C C C

TaALP-ax-7DS C C C C C C

TaALP-ay-4AL C C C C C C

TaALP-ay-7AS C C C C C C

TaALP-ay-7DS C C C C C C

TaALP-bx-4AL C C C C C C

TaALP-bx-7AS M + + + + +

TaALP-bx-7DS C C C C C C

TaALP-by-4AL M C C C C C

TaALP-by-7AS C C C C C C

TaALP-by-7DS C C C C C C

Allelic variations were identified for gene TaALP-ax-4AL, bx-7AS, and by-4AL in parent wheat cvs.

Spitfire and Mace. Gene specific primers were designed based on TGAC contig sequences. Allele C

stands for the allele in wheat cv. Chinese Spring. In wheat cv. Mace, none of the expected PCR product

can be amplified. In DH line 187, 130, 131, 241, all the expected PCR product can be identified. For

the TaALP-bx-7AS gene, the gene specific primers were for the functional alleles, represented by “+”,

as reported by Chen et al. at 7A locus for type b genes (91).

Table S4C. Relative TaALP genes expression in DH line 241.

Genes Relative TaALP gene expression

2DPA 7DPA 10DPA

TaALP-c-4AL 1a 20.27b 7.37a

TaALP-c-7AS 1a 10.82b 14.34b

TaALP-c-7DS 1a 6.28b 2.03a

TaALP-ax-4AL 1a 3.45b 4.55b

TaALP-ax-7AS 1a 6.49a 431.78b

TaALP-ax-7DS 1a 2.55a 48.53b

TaALP-ay-4AL 1a 0.98a 1.70a

TaALP-ay-7DS 1a 8.22a 48.30b

67

TaALP-bx-4AL 1a 1.02a 3.00b

TaALP-bx-7AS 1a 78.78b 4.81a

TaALP-bx-7DS 1b 0.91b 0.07a

TaALP-by-4AL 1a 1.21a 0.79a

TaALP-by-7AS 1a 0.72a 0.99a

TaALP-by-7DS 1a 10.70a 44.36b

DH line 241 samples were used as the healthy control. None of the powdery mildew symptoms were

observed in the field. Values with different letters (a, b) within the same row were significantly different

(P < 0.05). The results indicated that 6 TaALP genes, c-7AS, ax-4AL7AS/7DS, ay-7DS, bx-4AL and by-

7DS demonstrated the highest relative expression at 10 DAP. Four genes, c-4AL/7DS and ax/4AL

exhibited high expression at 7 DAP. Specially, bx-7AS showed highest expression at 7 DAP, followed

by 10 DAP. The other 3 genes, ay-4AL. by-4AL/7AS were moderately expressed at 2, 7, and 10 DAP.

The expression of TaALP-ay-7AS was much lower at the sampling stages, the results were not analyzed.

DH lines 130, 131, and 187 all showed severe powdery mildew symptoms at each sampling stage. In

the following analysis, relative TaALP gene expression in DH lines 130, 131, 187 were compared with

the control DH line 241 at 2 and 10 DPA.

68

Table S5. Correlation matrix of TaALP genes relative expression under powdery mildew condition.

c-4AL c-7AS c-7DS ax-4AL ax-7AS ax-7DS ay-4AL ay-7DS bx-4AL bx-7AS bx-7DS by-4AL by-7AS by-7DS

c-4AL 1

c-7AS 0.579 1

c-7DS -0.131 -0.197 1

ax-4AL -0.213 -0.259 0.986** 1

ax-7AS -0.191 -0.244 0.971** 0.994** 1

ax-7DS -0.175 -0.179 0.990** 0.996** 0.986** 1

ay-4AL -0.101 0.178 0.577 0.562 0.528 0.606 1

ay-7DS -0.402 -0.141 0.733 0.810* 0.852* 0.795* 0.4 1

bx-4AL -0.428 -0.393 0.753 0.840* 0.880** 0.803* 0.33 0.956** 1

bx-7AS -0.298 -0.458 -0.191 -0.23 -0.267 -0.263 0.076 -0.341 -0.215 1

bx-7DS -0.03 0.266 -0.276 -0.26 -0.255 -0.242 -0.576 -0.092 -0.21 -0.66 1

by-4AL -0.219 -0.237 0.989** 0.997** .984** 0.998** 0.59 0.784* 0.806* -0.234 -0.241 1

by-7AS -0.193 0.386 -0.431 -0.492 -0.558 -0.437 0.01 -0.49 -0.654 0.109 0.409 -0.43 1

by-7DS -0.187 -0.224 0.995** 0.988** 0.967** 0.992** 0.622 0.731 0.754 -0.17 -0.293 0.994** -0.397 1

*Correlation is significant at the 0.05 level; **Correlation is significant at the 0.01 level.

69

Table S6. TdALP gene allelic variations in wild emmer wheat, T. dicoccoides

Genotype

code

Country of

origin region

TdALP-bx-7AS

TdALP-ay-7AS TdALP-ax-7AS TdALP-ax-4AL

TD4 Israel Qazrin TdALP-ay-7AS-a TdALP-ax-7AS-a

TD7 Israel Qazrin - Haplo16 TdALP-bx-7AS-e TdALP-ay-7AS-a TdALP-ax-7AS-a

TD9 Israel Qazrin + Haplo25 TdALP-bx-7AS-d TdALP-ay-7AS-b TdALP-ax-7AS-b

TD13 Israel Yehudiyya + Haplo4 TdALP-bx-7AS-g TdALP-ay-7AS-b TdALP-ax-7AS-b

TD15 Israel Yehudiyya TdALP-ay-7AS-b TdALP-ax-7AS-c

TD16 Israel Yehudiyya - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-c TdALP-ax-7AS-b

TD17 Israel Yehudiyya TdALP-ay-7AS-c TdALP-ax-7AS-b

TD19 Israel Yehudiyya TdALP-ay-7AS-d TdALP-ax-7AS-d

TD20 Israel Yehudiyya TdALP-ay-7AS-c TdALP-ax-7AS-b TdALP-ax-4AL-c

TD21 Israel Yehudiyya-Shade TdALP-ay-7AS-d TdALP-ax-7AS-d TdALP-ax-4AL-a

TD24 Israel Yehudiyya-Shade TdALP-ay-7AS-b TdALP-ax-7AS-b TdALP-ax-4AL-d



TD30 Israel Yehudiyya-Shade - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-d TdALP-ax-7AS-d TdALP-ax-4AL-d

TD31 Israel Yehudiyya-Shade TdALP-ay-7AS-d TdALP-ax-7AS-b TdALP-ax-4AL-a

TD32 Israel Yehudiyya-Shade TdALP-ay-7AS-c TdALP-ax-7AS-b TdALP-ax-4AL-d


TD34 Israel Yehudiyya-Shade - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-c TdALP-ax-7AS-b TdALP-ax-4AL-a

TD35 Israel Yehudiyya-Shade - Haplo3 TdALP-bx-7AS-j TdALP-ay-7AS-d TdALP-ax-7AS-d TdALP-ax-4AL-d


TD38 Israel Yehudiyya-Shade TdALP-ay-7AS-c TdALP-ax-7AS-b TdALP-ax-4AL-a

TD40 Israel Yehudiyya-Shade + Haplo24 TdALP-bx-7AS-m

TD41 Israel Yehudiyya-Shade TdALP-ay-7AS-c TdALP-ax-7AS-b TdALP-ax-4AL-a

TD42 Israel Yehudiyya-Shade - Haplo21 TdALP-bx-7AS-i TdALP-ay-7AS-b TdALP-ax-7AS-b TdALP-ax-4AL-a

TD44 Israel Yehudiyya-Shade TdALP-ay-7AS-b TdALP-ax-7AS-b TdALP-ax-4AL-b

TD46 Israel Yehudiyya-Shade - Haplo2 TdALP-bx-7AS-f TdALP-ax-4AL-d

TD47 Israel Yehudiyya-Shade - Haplo21 TdALP-bx-7AS-i TdALP-ax-4AL-d

TD48 Israel Yehudiyya-Shade - Haplo21 TdALP-bx-7AS-i TdALP-ax-4AL-d

TD51 Israel Yehudiyya-Shade - Haplo23 TdALP-bx-7AS-h TdALP-ax-4AL-d

TD53 Israel Yehudiyya-Shade - Haplo2 TdALP-bx-7AS-f TdALP-ax-4AL-d

TD55 Israel Yehudiyya-Shade + Haplo4 TdALP-bx-7AS-g TdALP-ax-4AL-d

TD56 Israel Yehudiyya-Shade + Haplo4 TdALP-bx-7AS-g TdALP-ax-4AL-d

TD57 Israel Yehudiyya-Shade + Haplo4 TdALP-bx-7AS-g TdALP-ay-7AS-b TdALP-ax-7AS-b

TD58 Israel Yehudiyya-Shade - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-b TdALP-ax-7AS-b

TD59 Israel Yehudiyya-Shade - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-c TdALP-ax-7AS-b




TD70 Israel Yehudiyya-Shade - Haplo21 TdALP-bx-7AS-i TdALP-ay-7AS-c TdALP-ax-7AS-b

TD71 Israel Yehudiyya-Shade - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-d TdALP-ax-7AS-d

TD72 Israel Yehudiyya-Shade - Haplo2 TdALP-bx-7AS-f

TD74 Israel Yehudiyya-Sun - Haplo2 TdALP-bx-7AS-f

70

TD75 Israel Yehudiyya-Sun + Haplo15 TdALP-bx-7AS-k


TD77 Israel Yehudiyya-Sun + Haplo24 TdALP-bx-7AS-m


TD79 Israel Yehudiyya-Sun - Haplo13 TdALP-bx-7AS-l



TD85 Israel Yehudiyya-Sun TdALP-ay-7AS-b TdALP-ax-7AS-b

TD87 Israel Yehudiyya-Sun - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-b TdALP-ax-7AS-b

TD89 Israel Yehudiyya-Sun - Haplo21 TdALP-bx-7AS-i TdALP-ay-7AS-d TdALP-ax-7AS-d

TD90 Israel Yehudiyya-Sun - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-b TdALP-ax-7AS-b

TD94 Israel Yehudiyya-Sun - Haplo21 TdALP-bx-7AS-i TdALP-ay-7AS-b TdALP-ax-7AS-d



TD102 Israel Yehudiyya-Sun - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-c TdALP-ax-7AS-b


TD112 Israel Yehudiyya-Sun + Haplo4 TdALP-bx-7AS-g TdALP-ay-7AS-b TdALP-ax-7AS-b



TD120 Israel Yehudiyya-Sun + Haplo24 TdALP-bx-7AS-m TdALP-ay-7AS-b TdALP-ax-7AS-m

TD121 Israel Yehudiyya-Sun + Haplo24 TdALP-bx-7AS-m TdALP-ay-7AS-b TdALP-ax-7AS-m



TD125 Israel Yehudiyya-Sun - Haplo21 TdALP-bx-7AS-i TdALP-ay-7AS-c TdALP-ax-7AS-b

TD126 Israel Yehudiyya-Sun - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-d TdALP-ax-7AS-d

TD127 Israel Yehudiyya-Sun + Haplo15 TdALP-bx-7AS-k TdALP-ay-7AS-c TdALP-ax-7AS-b

TD129 Israel Gamla TdALP-ay-7AS-b TdALP-ax-7AS-b

TD130 Israel Gamla - Haplo19 TdALP-bx-7AS-q TdALP-ay-7AS-c TdALP-ax-7AS-b

TD131 Israel Gamla + Haplo15 TdALP-bx-7AS-k TdALP-ay-7AS-b TdALP-ax-7AS-l

TD136 Israel Gamla + Haplo15 TdALP-bx-7AS-k TdALP-ay-7AS-a TdALP-ax-7AS-a

TD141 Israel Rosh-Pinna + Haplo22 TdALP-bx-7AS-v

TD142 Israel Rosh-Pinna Haplo21 TdALP-bx-7AS-i

TD148 Israel Ammiad-85 - TdALP-ay-7AS-f TdALP-ax-7AS-e

TD150 Israel Ammiad-85 TdALP-ay-7AS-f TdALP-ax-7AS-e

TD153 Israel Ammiad-85 - Haplo10 TdALP-bx-7AS-n

TD158 Israel Tabigha 1979 - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-b TdALP-ax-7AS-c

TD159 Israel Tabigha 1979 - Haplo10 TdALP-bx-7AS-n TdALP-ay-7AS-d TdALP-ax-7AS-d

TD161 Israel Tabigha 1979 - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-b TdALP-ax-7AS-c

TD163 Israel Tabigha 1979 - Haplo10 TdALP-bx-7AS-n TdALP-ay-7AS-c TdALP-ax-7AS-b

TD164 Israel Tabigha 1979 - Haplo21 TdALP-bx-7AS-i TdALP-ay-7AS-b TdALP-ax-7AS-d

TD166 Israel Tabigha 1979 - TdALP-ay-7AS-c TdALP-ax-7AS-b

TD167 Israel Tabigha 1979 - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-b TdALP-ax-7AS-d

TD168 Israel Tabigha-Basalt - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-d TdALP-ax-7AS-d

TD169 Israel Tabigha-Basalt - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-c TdALP-ax-7AS-b

TD170 Israel Tabigha-Basalt - Haplo10 TdALP-bx-7AS-n TdALP-ay-7AS-c TdALP-ax-7AS-b

TD171 Israel Tabigha-Basalt - Haplo10 TdALP-bx-7AS-n TdALP-ay-7AS-c TdALP-ax-7AS-b

71

TD173 Israel Tabigha-Basalt - Haplo17 TdALP-bx-7AS-o TdALP-ay-7AS-b TdALP-ax-7AS-d

TD176 Israel Tabigha-Basalt - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-b TdALP-ax-7AS-d

TD179 Israel Tabigha-Terra Rossa - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-b TdALP-ax-7AS-j

TD181 Israel Tabigha-Terra Rossa - Haplo2 TdALP-bx-7AS-f

TD182 Israel Tabigha-Terra Rossa - Haplo21 TdALP-bx-7AS-i TdALP-ay-7AS-c TdALP-ax-7AS-b

TD183 Israel Tabigha-Terra Rossa - Haplo5 TdALP-bx-7AS-p TdALP-ay-7AS-c TdALP-ax-7AS-b

TD185 Israel Tabigha-Terra Rossa - Haplo21 TdALP-bx-7AS-i TdALP-ay-7AS-c TdALP-ax-7AS-b

TD186 Israel Tabigha-Terra Rossa - Haplo17 TdALP-bx-7AS-o

TD187 Israel Tabigha-Terra Rossa + Haplo4 TdALP-bx-7AS-g TdALP-ay-7AS-b TdALP-ax-7AS-c

TD188 Israel Mt. Gilboa - Haplo5 TdALP-bx-7AS-p TdALP-ay-7AS-d TdALP-ax-7AS-d

TD196 Israel Mt. Gilboa - Haplo5 TdALP-bx-7AS-p TdALP-ay-7AS-b TdALP-ax-7AS-j

TD198 Israel Mt. Gerizim + Haplo24 TdALP-bx-7AS-m

TD203 Israel Mt. Gerizim + Haplo4 TdALP-bx-7AS-g

TD204 Israel Mt. Gerizim TdALP-ay-7AS-b TdALP-ax-7AS-b

TD205 Israel Mt. Gerizim TdALP-ay-7AS-b TdALP-ax-7AS-g

TD206 Israel Mt. Gerizim TdALP-ay-7AS-b TdALP-ax-7AS-g

TD210 Israel Gitit + Haplo18 TdALP-bx-7AS-w TdALP-ay-7AS-g TdALP-ax-7AS-b

TD211 Israel Gitit + Haplo18 TdALP-bx-7AS-w TdALP-ay-7AS-g TdALP-ax-7AS-b

TD215 Israel Gitit - Haplo8 TdALP-bx-7AS-a TdALP-ay-7AS-c TdALP-ax-7AS-i

TD216 Israel Gitit + Haplo18 TdALP-bx-7AS-w

TD219 Israel Kokhav-Hashahar TdALP-ay-7AS-c TdALP-ax-7AS-b

TD220 Israel Kokhav-Hashahar - Haplo5 TdALP-bx-7AS-p TdALP-ay-7AS-b TdALP-ax-7AS-g

TD222 Israel Kokhav-Hashahar + Haplo15 TdALP-bx-7AS-k TdALP-ay-7AS-a TdALP-ax-7AS-a

TD228 Israel Taiyiba TdALP-ay-7AS-d TdALP-ax-7AS-d

TD230 Israel Taiyiba TdALP-ay-7AS-c TdALP-ax-7AS-b

TD232 Israel Taiyiba + Haplo15 TdALP-bx-7AS-k TdALP-ay-7AS-b TdALP-ax-7AS-b

TD237 Israel Taiyiba + Haplo12 TdALP-bx-7AS-t TdALP-ay-7AS-b TdALP-ax-7AS-f

TD243 Israel Sanhedriyya TdALP-ay-7AS-b TdALP-ax-7AS-j

TD244 Israel Sanhedriyya + Haplo25 TdALP-bx-7AS-d TdALP-ay-7AS-a TdALP-ax-7AS-h

TD246 Israel Sanhedriyya + Haplo22 TdALP-bx-7AS-v

TD252 Israel Bet-Meir - Haplo5 TdALP-bx-7AS-p TdALP-ay-7AS-b TdALP-ax-7AS-g

TD253 Israel Bet-Meir - Haplo2 TdALP-bx-7AS-f TdALP-ay-7AS-c TdALP-ax-7AS-b

TD260 Israel J'aba + Haplo22 TdALP-bx-7AS-v

TD262 Israel J'aba + Haplo12 TdALP-bx-7AS-t TdALP-ay-7AS-e TdALP-ax-7AS-k

TD263 Israel J'aba + Haplo15 TdALP-bx-7AS-k TdALP-ay-7AS-b TdALP-ax-7AS-l

TD268 Israel Amirim + Haplo15 TdALP-bx-7AS-k

TD269 Israel Amirim + Haplo24 TdALP-bx-7AS-m

TD292 Israel Nesher - Haplo5 TdALP-bx-7AS-p

TD298 Israel Bet-Oren + Haplo14 TdALP-bx-7AS-s

TD303 Israel Bet-Oren + Haplo22 TdALP-bx-7AS-v

TD304 Israel Bet-Oren + Haplo22 TdALP-bx-7AS-v

TD310 Israel Daliyya + Haplo14 TdALP-bx-7AS-s

TD311 Israel Daliyya + Haplo14 TdALP-bx-7AS-s

TD318 Israel Bat-Shelomo + Haplo1 TdALP-bx-7AS-a*

TD330 Israel Kabara - Haplo8 TdALP-bx-7AS-a

TD333 Israel Kabara - Haplo19 TdALP-bx-7AS-q

72

TD392 Israel Mt. Hermon + Haplo14 TdALP-bx-7AS-s

TD398 Israel - Haplo2 TdALP-bx-7AS-f

TD403 Israel - Haplo21 TdALP-bx-7AS-i


TD410 Israel - Haplo21 TdALP-bx-7AS-i


TD419 Israel + Haplo4 TdALP-bx-7AS-g





TD426 Israel + Haplo15 TdALP-bx-7AS-k

TD427 Israel - Haplo13 TdALP-bx-7AS-l


TD435 Israel - Haplo5 TdALP-bx-7AS-p

TD440 Israel - Haplo5 TdALP-bx-7AS-p

TD450 Israel + Haplo15 TdALP-bx-7AS-k

TD463 Israel + Haplo9 TdALP-bx-7AS-r

TD516 Lebanon - Haplo6 TdALP-bx-7AS-u

TD518 Lebanon + Haplo20 TdALP-bx-7AS-z




TD532 Lebanon + Haplo15 TdALP-bx-7AS-k

TD533 Turkey + Haplo7 TdALP-bx-7AS-y

TD534 Turkey + Haplo24 TdALP-bx-7AS-m

TD535 Turkey + Haplo24 TdALP-bx-7AS-m

TD538 Syria + Haplo20 TdALP-bx-7AS-z

TD544 Syria - Haplo8 TdALP-bx-7AS-a

TD550 Syria + Haplo25 TdALP-bx-7AS-d


TD561 Syria + Haplo15 TdALP-bx-7AS-k

TD570 Syria - Haplo13 TdALP-bx-7AS-l




TD709 Turkey + Haplo4 TdALP-bx-7AS-g

TD710 Turkey + Haplo15 TdALP-bx-7AS-k


TD726 Lebanon + Haplo15 TdALP-bx-7AS-k

TD728 Lebanon + Haplo4 TdALP-bx-7AS-g


TD733 Turkey + Haplo1 TdALP-bx-7AS-a*



TD748 Turkey + Haplo1 TdALP-bx-7AS-a*

73

TD756 Turkey + Haplo11 TdALP-bx-7AS-x




TD768 Israel - Haplo10 TdALP-bx-7AS-n





The silent alleles (-) and the functional alleles (+) of TdALP-bx-7AS

74

Table S7. The ecogeographical background of 21 wild emmer wheat populations (142).

Qazrin Yehudiyya Gamla Rosh-Pinna Ammiad-85 Tabigha Mt. Gilboa Mt. Gerizim Gitit Kokhav-Hashahar Taiyiba Sanhedriyya Bet-Meir J'aba Mt. Hermon

Ln 35.67 35.7 35.74 35.52 35.3 35.53 35.42 35.28 35.4 35.34 35.3 35.22 35.03 35.08 35.73

Lt 32.99 32.93 32.88 32.95 32.54 32.9 32.5 32.2 32.1 31.95 31.95 31.8 31.8 31.67 33.3

AI 350 200 200 700 270 0 150 800 300 600 450 800 500 660 1300

Tm 18 19 19 18 19 24 21 17 21 20 19 17 19 17 11

Ta 26 27 26 25 26 32 28 23 29 28 26 24 26 25 21

Tj 10 11 9 9 10 15 12 8 13 12 10 9 11 9 3

Td 16 16 17 16 16 17 16 15 16 16 16 15 15 15 18

Tdd 12 12 12 10 10 10 12 9 12 12 12 9 9 9 6

Rn 530 550 470 697 700 436 400 700 360 400 400 548 582 500 1400

Rd 50 47 50 50 48 45 44 47 39 40 40 44 44 41 66

Hul4 43 42 43 48 48 45 43 45 39 45 44 51 47 49 48

Huan 58 58 58 58 58 57 58 60 55 59 58 62 60 62 60

Dw 58 58 58 50 50 58 40 42 25 30 30 44 61 57 60

Sh 50 50 50 75 70 60 60 80 80 102 70 90 80

Th -10 -10 -30 -30 10 -25 -20 -10 -10 -10 -20

Trd 60 100 60 35 50 120 160 0 100 25 25 0 100 30 0

Ev 155 160 155 150 150 160 165 155 170 165 165 155 160 155 150

Sz 3 3 3 3 3 3 2 2 2 2 2 2 2 2 2

Ma 5 5 5 5 5 5 3 3 3 3 3 3 3 3 1

So 5 5 5 1 1 5 1 1 1 1 1 1 1 1 1

Rv 39 38 39 35 38 39 34 38 38 38 38 30 33 35 30

Rr 26 25 26 22 25 25 24 25 24 22 22 21 25 21 20

Symbols of variables: Geographical: Ln = longitude (decimals); Lt = latitude (decimals); AI = Altitude (m); Temperature: Tm = mean annual temperature;

Ta = mean August temperature; Tj = mean January temperature; Td = seasonal temperature difference; Tdd = day-night temperature difference; Trd = mean

number of tropical days; Sh = mean number of Sharav days, i.e., hot and dry days; Water availability: Rn = mean annual rainfall (mm); Rd = mean number of

75

rainy days; Huan = mean annual humidity; Hu14-mean humidity at 14:00; Dw = mean number of dew nights in summer; Th = Thornthwaite's moisture index;

Ev = mean annual evaporation; Rv = mean interannual variability of rainfall; Rr = mean relative variability of rainfall; Edaphic: So = soil type: 1 = terra rossa

( = t.r.); 2 = rendzina; 5 = basalt Biotic; Ma = marginality: 1= north margin; 2 = west margin; 3 = south-east margin; 4 = Turkey; 5 = central population; Sz =

estimate of population size: 1 = small, (from a dozen to few hundred plants); 2 = intermediate, 3 = large; The difference of the shade and the sun in Yehudiyya

(1) in shade, under the canopies of the oak trees (trees 10–20 m in height, with canopy diameters up to 20 m); (2) in sun, in the circumference around each tree

and between trees. The sun-shade niches are abutting, and the difference of the samples tested is 2–4 m apart. While (1) is largely shaded during the day, (2) is

exposed in daytime to continuous sun radiation and drying. Hence, the soil temperature in the sun niche was almost 10°C higher than in the shade niche.

76

Table S8. Nei’s gene diversity (He) and Shannon’s information index (I) and 10 environmental factors from 15 wild emmer wheat (WEW) populations

for multi regression analysis

He I Ln Lt AI Tm Ta Tj Rn Ev So Rv

Qazrin 0.46 0.66 35.67 32.99 350 18 26 10 530 155 5 39

Yehudiyya 0.6 1.12 35.7 32.93 200 19 27 11 550 160 5 38

Gamla 0.64 1.06 35.74 32.88 200 19 26 9 470 155 5 39

Rosh-Pinna 0 0 35.52 32.95 700 18 25 9 697 150 1 35

Ammiad-85 0.17 0.23 35.3 32.54 270 19 26 10 700 150 1 38

Tabigha 0.67 1.26 35.53 32.9 0 24 32 15 436 160 5 39

Mt. Gilboa 0.33 0.46 35.42 32.5 150 21 28 12 400 165 1 34

Mt. Gerizim 0.31 0.44 35.28 32.2 800 17 23 8 700 155 1 38

Gitit 0.42 0.61 35.4 32.1 300 21 29 13 360 170 1 38

Kokhav-Hashahar 0.61 0.96 35.34 31.95 600 20 28 12 400 165 1 38

Taiyiba 0.58 0.92 35.3 31.95 450 19 26 10 400 165 1 38

Sanhedriyya 0.5 0.69 35.22 31.8 800 17 24 9 548 155 1 30

Bet-Meir 0.5 0.69 35.03 31.8 500 19 26 11 582 160 1 33

J'aba 0.56 0.83 35.08 31.67 660 17 25 9 500 155 1 35

Mt. Hermon 0 0 35.73 33.3 1300 11 21 3 1400 150 1 30

He = Nei's -1973 gene diversity; I = Shannon's Information index (187).

Symbols of variables: Geographical: Ln = longitude (decimals); Lt = latitude (decimals); AI = Altitude (m); Temperature: Tm = mean annual temperature;

Ta = mean August temperature; Tj = mean January temperature; Water availability: Rn = mean annual rainfall (mm); Ev = mean annual evaporation; Rv =

mean inter-annual variability of rainfall; Edaphic: So = soil type: 1 = terra rossa ( = t.r.); 5 = basaltic.

77

Table S9. Model 1 coefficients of He (Nei’s gene diversity) and environmental variables in 15 wild emmer wheat populations.

Unstandardized

Coefficients

Standardized

Coefficients t Sig.

95.0%

Confidence

Interval for B

Correlations Collinearity

Statistics

B Std.

Error Beta

Lower

Bound

Upper

Bound Zero-order Partial Part Tolerance VIF

(Constant) 0.615 0.109 5.627 0.000 0.374 0.855

Lt 0.000 0.000 0.505 1.628 0.132 0.000 0.001 -0.542 0.441 0.264 0.274 3.655

Rn -0.001 0.000 -0.986 -

3.747 0.003 -0.001 0.000 -0.723 -0.749

-

0.608 0.380 2.629

So 0.068 0.025 0.564 2.668 0.022 0.012 0.123 0.481 0.627 0.433 0.588 1.700

Symbols of variables: Geographical: Lt = latitude (decimals); Water availability: Rn = mean annual rainfall (mm); Edaphic: So = soil type

Based on backwards linear multi-regression analysis (using SPSS software), the environmental factors listed in Table S8 were used as independent variables

to predict the He (Nei’s gene diversity) variances observed for TdALP genes in wild emmer wheat populations. He was calculated using POPGENE 1.32.

78

Table S10. Model 2 coefficients of He (Nei’s gene diversity) and environmental variables in 15 wild emmer wheat populations.

Unstandardized

Coefficients

Standardized

Coefficients t Sig.

95.0%

Confidence

Interval for B


Statistics

B Std.

Error Beta

Lower

Bound

Upper

Bound

Zero-

order Partial Part Tolerance VIF

(Constant) 0.663 0.112 5.905 0.000 0.418 0.907

Rn -0.001 0.000 -0.653 -

3.696 0.003 -0.001 0.000 -0.723 -0.730

-

0.640 0.960 1.042

So 0.042 0.021 0.350 1.982 0.071 -0.004 0.088 0.481 0.497 0.343 0.960 1.042

Symbols of variables: Water availability: Rn = mean annual rainfall (mm); Edaphic: So = soil type.


to predict the He (Nei’s gene diversity) variances observed for TdALP genes in wild emmer wheat populations. He was calculated using POPGENE 1.32.

79

Table S11. Model Coefficients of I (Shannon’s information index) and environmental variables in 15 wild emmer wheat populations.

Unstandardized

Coefficients

Standardized

Coefficients t Sig.

95.0%

Confidence

Interval for B


Statistics

B Std.

Error Beta

Lower

Bound

Upper

Bound

Zero-

order Partial Part Tolerance VIF

(Constant) 0.954 0.191 4.983 0.000 0.537 1.371

Rn -0.001 0.000 -0.569 -

3.309 0.006 -0.001 0.000

-

0.665 -0.691

-

0.558 0.960 1.042

So 0.100 0.036 0.475 2.763 0.017 0.021 0.178 0.590 0.624 0.466 0.960 1.042

Symbols of variables: Water availability: Rn = mean annual rainfall (mm); Edaphic: So = soil type.


to predict the I (Shannon’s information index) variances observed for TdALP genes in wild emmer wheat populations. I was calculated using POPGENE 1.32.

80

Table S12. Statistical analysis of TdALP-bx-7AS functional/silent (+/-) alleles with environmental

factors.

P value

Ln 0.00

Lt 0.00

AI 0.00

Tm 0.00

Ta 0.00

Tj 0.00

Td 0.01

Tdd 0.01

Rn 0.03

Rd 0.10

Hul4 0.00

Huan 0.00

Dw 0.15

Sh 0.00

Th 0.00

Trd 0.00

Ev 0.07

Sz 0.00

Ma 0.00

So 0.00

Rv 0.00

Rr 0.00

Symbols of variables: Geographical: Ln = longitude (decimals); Lt = latitude (decimals); AI = Altitude

(m); Temperature: Tm = mean annual temperature; Ta = mean August temperature; Tj = mean January

temperature; Td = seasonal temperature difference; Tdd = day-night temperature difference; Trd = mean

number of tropical days; Sh = mean number of Sharav days, i.e., hot and dry days; Water availability:

Rn = mean annual rainfall (mm); Rd = mean number of rainy days; Huan = mean annual humidity;

Hu14-mean humidity at 14:00; Dw = mean number of dew nights in summer; Th = Thornthwaite's

moisture index; Ev = mean annual evaporation; Rv = mean interannual variability of rainfall; Rr = mean

relative variability of rainfall; Edaphic: So = soil type: 1 = terra rossa ( = t.r.); 2 = rendzina; 5 = basalt

Biotic; Ma = marginality: 1= north margin; 2 = west margin; 3 = south-east margin; 4 = Turkey; 5 =

81

central population; Sz = estimate of population size: 1 = small, (from a dozen to few hundred plants);

2 = intermediate, 3 = large.

Based on the T test results (one tailed, with equal variance), the environmental factors with P value < 0.05, indicate significant

correlations of TdALP-bx-7AS functional allele/silent allele (+/-) with environmental factors.

82

Table S13. Allele occurrence frequency (%) of 4 TdALP genes in wild emmer wheat.

Haplo8 TdALP-bx-7AS-a 1.84 TdALP-ax-7AS-a 4.17 TdALP-ay-7AS-a 5.21 TdALP-ax-4AL-a 32.26

Haplo1 TdALP-bx-7AS-a* 1.84 TdALP-ax-7AS-b 51.04 TdALP-ay-7AS-b 38.54 TdALP-ax-4AL-b 9.68

Haplo25 TdALP-bx-7AS-d 1.84 TdALP-ax-7AS-c 4.17 TdALP-ay-7AS-c 34.38 TdALP-ax-4AL-c 9.68

Haplo16 TdALP-bx-7AS-e 0.61 TdALP-ax-7AS-d 22.92 TdALP-ay-7AS-d 16.67 TdALP-ax-4AL-d 48.39

Haplo2 TdALP-bx-7AS-f 28.22 TdALP-ax-7AS-e 2.08 TdALP-ay-7AS-e 1.04

23 lines

Haplo4 TdALP-bx-7AS-g 7.98 TdALP-ax-7AS-f 1.04 TdALP-ay-7AS-f 2.08

Haplo23 TdALP-bx-7AS-h 0.61 TdALP-ax-7AS-g 4.17 TdALP-ay-7AS-g 2.08

Haplo21 TdALP-bx-7AS-i 9.20 TdALP-ax-7AS-h 1.04

96 lines

Haplo3 TdALP-bx-7AS-j 0.61 TdALP-ax-7AS-i 1.04

Haplo15 TdALP-bx-7AS-k 9.82 TdALP-ax-7AS-j 3.12

Haplo13 TdALP-bx-7AS-l 4.29 TdALP-ax-7AS-k 1.04

Haplo24 TdALP-bx-7AS-m 4.91 TdALP-ax-7AS-l 2.08

Haplo10 TdALP-bx-7AS-n 4.91 TdALP-ax-7AS-m 2.08

Haplo17 TdALP-bx-7AS-o 1.23

96 lines

Haplo5 TdALP-bx-7AS-p 4.91

Haplo19 TdALP-bx-7AS-q 1.23

Haplo9 TdALP-bx-7AS-r 0.61

Haplo14 TdALP-bx-7AS-s 2.45

Haplo12 TdALP-bx-7AS-t 1.23

Haplo6 TdALP-bx-7AS-u 3.07

Haplo22 TdALP-bx-7AS-v 3.07

Haplo18 TdALP-bx-7AS-w 1.84

Haplo11 TdALP-bx-7AS-x 0.61

Haplo7 TdALP-bx-7AS-y 0.61

Haplo20 TdALP-bx-7AS-z 2.45

163 lines

In the current datasets listed in Table S6, 163 wild emmer wheat lines were sequenced for TdALP-bx-

7AS, 25 alleles were identified; 96 wild emmer wheat lines were sequenced for TdALP-ax-7AS, 13

alleles were identified. 96 wild emmer wheat lines were sequenced for TdALP-ay-7AS, 8 alleles were

identified. 96 wild emmer wheat lines were sequenced for TdALP-ax-4AL, 31 have been amplified using

primers listed in Table S1, and the rest 65 lines cannot be amplified using the above primers. Only 4

alleles were identified for TdALP-ax-4AL. For each allele, occurrence frequency were calculated and

represented as percentage.

83

Table S14. Estimates of evolutionary divergence (p-distance) over sequence pairs between populations.

Ammiad-

85

Bet-

Meir Gamla Gitit J’aba

Kokhav-

Hashahar Mt.Gerizim Mt.Gilboa Qazrin Sanhedriyya Tabigha1979

Tabigha-

Basalt

Tabigha-

Terra

Rossa Taiyiba

Yehudiyya-

Shade Yehudiyya

Bet-Meir 0.165

Gamla 0.165 0.142

Gitit 0.163 0.150 0.147

J’aba 0.152 0.209 0.218 0.196

Kokhav-

Hashahar 0.174 0.131 0.114 0.133 0.291

Mt.Gerizim 0.163 0.155 0.155 0.158 0.176 0.161

Mt.Gilboa 0.168 0.140 0.135 0.145 0.235 0.104 0.156

Qazrin 0.163 0.149 0.146 0.152 0.195 0.134 0.157 0.145

Sanhedriyya 0.163 0.150 0.146 0.151 0.195 0.133 0.157 0.145 0.151

Tabigha1979 0.163 0.150 0.147 0.153 0.197 0.134 0.158 0.146 0.152 0.152

Tabigha-Basalt 0.163 0.155 0.152 0.156 0.186 0.138 0.161 0.152 0.155 0.155 0.156

Tabigha-Terra

Rossa 0.160 0.163 0.164 0.163 0.150 0.179 0.161 0.167 0.162 0.162 0.163 0.163

Taiyiba 0.166 0.148 0.142 0.150 0.208 0.114 0.158 0.140 0.149 0.149 0.150 0.154 0.166

Yehudiyya-

Shade 0.160 0.169 0.170 0.166 0.139 0.180 0.165 0.174 0.166 0.166 0.167 0.165 0.160 0.169

Yehudiyya 0.162 0.161 0.160 0.161 0.163 0.163 0.161 0.162 0.160 0.160 0.161 0.161 0.161 0.161 0.162

Yehudiyya-Sun 0.144 0.202 0.212 0.189 0.013 0.287 0.172 0.228 0.189 0.188 0.189 0.179 0.144 0.205 0.133 0.158

The number of base differences per site from averaging over all sequence pairs between groups are shown. The rate variation among sites was modeled with a

gamma distribution (shape parameter = 3). 16 wild emmer wheat populations were compared. The analysis involved 109 nucleotide sequences, including alleles

from 3 genes, TdALP-bx/ay/ax-7AS. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated.

There were a total of 478 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (187).

84

3. Chapter 3 Charaterization of avenin-like proteins (ALPs) derived from wheat grain

albumin/globulin fraction by RP-HPLC, SDS-PAGE, and MS/MS peptides sequencing

3.1. Abstract:

Thirteen avenin-like proteins were isolated and characterized from albumin and globulin fractions of

wheat storage proteins. Some of the ALPs were isolated from wheat flour for the first time. Thirteen

water and salt soluble ALPs encoded by TaALP4A and TaALP7A/TaALP7D genes on chromosomes 4

and 7 were isolated using SDS-PAGE. Our results highlighted the potential defense properties of

albumin and globulin fractions of storage proteins, such as wheat protein disulfide-isomerase, GSP,

alpha-amylase inhibitors, endogenous alpha-amylase/subtilisin inhibitor, and avenin-3, as well as alpha-

gliadins, gamma-gliadins, and LMW-GS. We found the range of MW of avenin-like proteins, their

electrophoresis properties, distribution within the SDS-PAGE gel and segregation properties with

relative proteins, where most of the segregated proteins belong to an AMI_LTSS superfamily and confer

certain property in plant immunity. Protein composition of wheat flour, give dough their rheological

property, and finetune of flour protein composition would help wheat breeders to meet different

processing needs. To better understand the composition of storage proteins would contribute to the

overall knowledge of how to make better use.

Keywords: Separation, avenin-like proteins, HPLC, MALDI-TOF, Albumins, Globulins.

3.2. Introduction

Wheat (Triticum spp.) is a self-pollinating annual plant, belonging to the family Poaceae (grasses), tribe

Triticeae, genus Triticum (1). The major flour protein types are the water-soluble albumins, the salt-

soluble globulins, the alcohol-soluble gliadin monomers, and the high and low molecular weight

glutenin subunits (HMW-GS and LMW-GS). The HMW-GS and LMW-GS are soluble in alcohol

solutions as monomers, dimers, or small polymers but are mainly present in flour as large, insoluble

polymeric polymers. They have the largest effect on bread making quality, but other storage proteins

also contribute to the unique functional characteristics of flour (101, 188-190). Albumins and globulins

are non-gluten proteins in wheat, which are water-soluble and salt-soluble, respectively. The albumins

and globulins are considered nutritionally better than the gluten proteins because they have higher

contents of the essential amino acids lysine and methionine (191). One estimate of composition is 13%

albumins, 2% globulins, 29% gliadins, 57% glutenins (192), and 13-22% for albumins (190). Triboi et

al. (193) obtained estimates of approximately 25% albumins and globulins, 25% gliadins, 40% glutenins,

and 10% amphiphilic proteins for total grain protein. In particular, when plants are grown under

conditions where availability of N varies in soil, the proportion of albumins plus globulins varies in

inverse proportions to the grain or flour protein content (193, 194). Recent advances in proteomic

techniques lend increasing precision to identification of these individual flour protein components in 2D

maps (195-197). Albumins are known to have many different functions and are thus of different types

85

e.g. glycoprotein, amylase inhibitors, serpins and purotionins. Many albumins function as enzymes such

as carbohydrases like α- and β-amylases, or proteolytic enzymes (198). Albumins such as α-

amylase/trypsin inhibitors (199, 200), serpins (201) and purothionins (202) are considered to have a

function of nutrient storage and inhibitors of insect and pathogen attack on the germinating seed.

Puroindolines influence grain hardness (203). The globulins are divided into two groups on the basis of

sulphur containing amino acids, these are the 7S and 11S globulins (204). Back in 2001, Singh et al.

characterized water- and salt-soluble proteins of wheat flour using a range of protein analytical methods,

including SDS-PAGE, reverse-phase HPLC (205, 206). Dupont et al. (75) optimized the method of Fu

and Kovacs (207), and improved separation of albumins and gliadins from glutenins, and differential

precipitation by NH4Ac-MeOH followed by acetone enabled separation of the most abundant albumins

from the gliadins. Purothionins, grain softness proteins, and several α-amylase inhibitor proteins, as well

as several CM3-type α-amylase trypsin inhibitors and one protein related to the avenin storage proteins

from oats were identified in the albumin/globulin fraction (75).

With the identification of more protein components, the overall dough quality can be defined. The

hydrophobic-seed domain-containing proteins include cortical cell delineating (208), hydrophobic-seed

domain-containing protein (209-213), glycine-rich protein (214-216) and proline-rich protein (217, 218),

which are part of the plant defence system and have antifungal properties. Egg-cell secreted protein (219)

has a prolamin-like domain. Lipid transfer protein (220-224) and Non-specific lipid transfer protein

(225) have a LTP-2 domain. Alpha-amylase/trypsin inhibitor (226, 227), Grain softness protein (228),

Puroindoline (229, 230), Alpha gliadin (231) all contain a Tryp-alpha-amyl domain. Meanwhile,

Puroindoline, Alpha gliadin, LMW glutenin, Gamma gliadin and Avenin-like protein have a Gliadin

domain. The 19KDa Globulin (232, 233), Small cysteine-rich protein (234-236) belongs to the

Domainless Cys-rich proteins. By contrast, Omega gliadin and HMW-GS are Domainless Cys-poor

proteins. With the identification of all these different grain protein families, and characterization of their

individual function, content and contribution to the dough structure, it should be possible to breed wheat

to produce flour to meet different processing needs. Yet the complexity of flour proteins and difficulty

of separating and quantifying them make it challenging to evaluate their roles in flour quality and to

compare different flour samples.

In particular, the function of the recently identified ALPs wheat storage proteins is unknown. It has been

hypothesised that they may contribute to the functional properties of wheat flour due to their high

cysteine residue content. Kan et al. (74) characterized two classes of cDNAs encoding avenin-like a and

b proteins, based on their nearest relatives identified in databases. The identification of avenin-like b

proteins was supported by acquiring the sequences of a reasonable number of tryptic peptides and the

matches between measured and expected MW and pI (85). The first 18 amino acid residues of each

86

avenin-like b protein are signal peptides; the mature proteins contained 266 amino acid residues having

an average molecular mass of 30 kDa (86). The μLC-MS/MS (liquid chromatography-tandem mass

spectrometry) analysis conducted by De Caro and coworkers (86) indicated that cleavage of the signal

peptide occurred at position 19, before the glutamine residue. Ma and others (73) proved that avenin-

like b proteins, like other wheat storage proteins, occur widely in Triticeae species, and belong to a

multigene family that is specifically expressed in seeds. SE-HPLC analysis indicated that avenin-like b

protein was incorporated into polymeric subunits by intermolecular disulfide bonds. Both in vitro and

in vivo experiments showed that avenin-like b proteins improved dough functional properties (92). In

this study, we characterize avenin-like proteins and their electrophoretic mobilities, composition and

extraction properties using the separation techniques RP-HPLC and SDS-PAGE, and the peptide and

protein mass identification methods MALDI-TOF and MS/MS, to distinguish different subunits of

ALPs.

3.3. Materials and methods

3.3.1. Reagents and chemicals

All solvents and chemicals used for sample preparation were either HPLC grade or analytical quality,

unless stated otherwise. Dithiothreitol (DTT), trifluoracetic acid and acetonitrile, Sinapinic acid (SA)

were purchased from Sigma Chemical Co., St. Louis, MO, USA.

3.3.2. Protein extraction

Australia spring bread wheat varieties Mace and Spitfire were used in this study. The albumin/globulin

proteins were extracted from 100 mg of flour according to the procedure of Dupont et al. (75). Briefly,

100 mg of flour was extracted with 1 mL of 0.3 M NaI, 7.5% 1-propanol (NaI-propanol), and centrifuged

at 4500 g for 10 min. After two extractions, the supernatant fractions were pooled in 15 ml tubes,

precipitated with four volumes of ice-cold (-20°C) NH4Ac-MeOH (0.1 M ammonium acetate in 100%

methanol), stored at -20 °C for at least 48 h, and centrifuged as above. The supernatant fluid was

transferred into 50 ml tubes and precipitated with four volumes of ice-cold acetone and incubated at -

20 °C overnight. Following incubation, the fluid was centrifuged as above to yield albumin/globulin

fraction pellets.

3.3.3. RP-HPLC

Freeze-dried protein pellets were dissolved in 500 µL 6 M guanidine HCl (with a concentration of 1 mg

mL-1) adjusted to pH 8.0 with TRIS, plus 50 mM DTT, and then alkylated with 4-vinylpyridine (4VP),

prior to HPLC analysis (76). Albumin and globulin proteins extracted from Spitfire and Mace seeds

were analyzed by RP-HPLC. HPLC was performed on a 1200 Series Quaternary HPLC-System (Agilent

Technologies, Palo Alto, CA, USA), using a SB-C8 reversed-phase analytical column (5 μm, 4.6×250

mm, Agilent Technologies, Palo Alto, CA, USA), with a diode array UV-Vis detector. The column

temperature was set at 40 °C. A linear elution gradient was performed using two mobile solvents: the

polar solvent A consisting of 0.1% trifluoroacetic acid (TFA), (v/v) in type I ultrapure water (18 MΩ·cm

87

specific resistance) and the non-polar solvent B consisting of 0.1% TFA (v/v) in acetonitrile (ACN).

Absorbance was monitored at a detection wavelength of 210 nm, and the flow rate was kept at 0.6 mL

min−1. The elution gradient conditions were set as follows: from 0 to 51 min, eluent B was increased

from 20% to 60%; from 51 to 53 min, eluent B was increased from 60% to 80% and then maintained at

80% for 5 min for washing the column, then decreased to the starting B concentration in 1 min and

maintained for 10 min for the next run. The injection volume was 100 µL. The proteins eluted from

individual peaks were collected with reference to the chromatographic profile captured in real time and

pooled from three runs. RP-HPLC chromatographic finger print profiles showed no variation between

runs, thus the elution of each run could be combined to increase the amount of protein in the final sample

for later analysis. Samples were immediately frozen at −80 °C for 24 h and lyophilized. Lyophilized

samples were stored at room temperature before MALDI-TOF and SDS-PAGE analyses.

3.3.4. MALDI-TOF

MALDI-TOF-MS was used to obtain the mass spectra profile of albumin/globulin fractions obtained

from individual HPLC peaks (fractions) with and without 4VP alkylation. The albumin/globulin fraction

protein extracts were prepared for MALDI-TOF-MS test, whereas the pelleted RP-HPLC eluted protein

samples were diluted 20 times for MALDI-TOF-MS test. Each individual RP-HPLC eluates were

lyophilized, the freeze-dried eluates were dissolved with 10 µL ultrapure water, 1 µL was used for

MALDI-TOF-MS, and the residues were saved for SDS-PAGE running. Sample preparation was carried

out according to the dried droplet method (237), using sinapinic acid (SA) as matrix. The matrix solution

was prepared by dissolving SA in ACN/H2O/MeOH (60:8:32 v/v) at a concentration of 20 mg mL-1. All

samples, including the RP-HPLC eluates, the raw albumin/globulin extracts and the alkylated

albumin/globulins extracts were mixed with SA at the ratio of 1:9 (v/v) individually, and firstly, 1 µL

of this protein-SA mixture was deposited onto a 100-sample MALDI probe tip. After drying, another 1

µL of this protein-SA mixture was added, then dried at room temperature. The mass spectra for each

sample was recorded on a Voyager DE-PRO TOF mass spectrometer (Applied Biosystems, Foster City,

CA, USA) using a positive linear ion mode at an accelerating voltage of 25 kV and a delay time of 700

ns by capturing 1000 spectra of a single laser shot with a mass range of 15000-45000 m/z.

3.3.5. SDS-PAGE

To identify the ALPs from RP-HPLC eluates, SDS-PAGE was used to separate the protein mixtures of

each RP-HPLC eluate, and SDS-PAGE bands of interest were cut for protein peptides sequencing. Then.

12% SDS-PAGE was prepared following Fling and Gregerson’s method (238). Briefly, the gel

comprises two layers: the separating layer and the stacking layer. The separating gel was prepared by

mixed 4.2 mL of acrylamide stock solution (30% acrylamide: 0.8% bis acrylamide; Cat #161-0154, Bio-

Rad Laboratories, Hercules, CA, USA) with 4.2 mL of water, 3 mL of 3 M Tris-HCl (pH 8.8), 120 μL

of 10% SDS, 120 μL of 10% ammonium persulfate (APS) and 6 μL of tetramethylethylenediamine

(TEMED). After polymerization, the separating gel was layered with the stacking gel prepared using 1

88

mL of acrylamide solution, 750 μL 1 M Tris-HCl (pH 6.8), 4.25 mL of water, 60 μL of 10% SDS, 60

μL 10% APS, and 4 μL of TEMED. Pelleted samples of HPLC eluates described above were mixed

with 10 μL 2×laemmli sample buffer SDS loading buffer (Bio Rad). Electrophoresis was carried out in

a modified Laemmli system (239). Runs were performed with running buffer of 25 mM Tris-HCL, 192

mM glycine and 0.1% SDS at 120 volts for 2 h. The gels were stained in Coomassie Brilliant Blue (CBB)

solution (R-250). Protein standards (Bio-Rad) were used to estimate the molecular size of the proteins.

The gels were scanned by a gel Proteomic Imaging System, “Image lab 5.0” (Bio-Rad).

3.3.6. Protein identification by MS/MS

Protein bands of interest were manually excised from gels and analysed further by mass spectrometric

peptide sequencing. The spots were analysed by Proteomics International Ltd. Pty, Perth, Australia.

Protein samples were trypsin digested and the resulting peptides were extracted according to standard

techniques (240). Tryptic peptides were loaded onto a C18 PepMap100, 3 μl (LC Packings) and

separated with a linear gradient of water/acetonitrile/0.1% formic acid (v/v), using an Ultimate 3000

nano HPLC system. The HPLC system was coupled to a 4000Q TRAP mass spectrometer (Applied

Biosystems). Spectra were analysed to identify the proteins of interest using Mascot sequence matching

software (Matrix Science) with taxonomy set to Viridiplantae (Green Plants). All searches used the

Ludwig NR. The software was set to allow 1 missed cleavage, a mass tolerance of ± 0.2 Da for peptides

and ± 0.2 for fragment ions. The peptide charges were set at 2+, 3+ and 4+, and the significance threshold

at P < 0.05. Generally, a match was accepted where two or more peptides from the same protein were

present in a protein entry in the Viridiplantae database.

3.4. Results

3.4.1. ALP identification by RP-HPLC fractionation

Twenty-three peaks were chosen for analysis following separation by RP-HPLC of reduced

albumin/globulin proteins (Figure 1). Individual peaks were collected separately, vacuum dried,

reduced, and pyridyl ethylated. None of the albumin/globulin protein peaks gave baseline separations.

Figure S1 shows one-dimensional SDS-PAGE patterns of each peak in Figure 1. Peaks appear to have

a single major band in SDS-PAGE, although subsequent sequencing indicated that most of these

fractions were mixtures, as will be discussed later. Minor amounts of higher molecular weight bands

appeared in the SDS-PAGE patterns of some fractions. These bands, which were noticeable only when

the samples were heavily loaded, probably correspond to oligomers of the main monomeric component

that are cross-linked in some way other than by disulfide cross-linking, as the samples had been reduced

and alkylated, and, in addition, 5% mercaptoethanol had been included in the electrophoresis sample

buffer.

89

Figure 1. RP-HPLC elution profiles for of albumin/globulin extracts from wheat cultivar Mace.

Twenty-three numbered peaks of Albumin/Globulins fractions of Mace flour samples were collected

and freeze-dried for later SDS-PAGE, protein sequencing and MALDI-TOF analysis, respectively.

90

Figure S1. SDS-PAGE gel results of collection peaks from HPLC for for wheat cultivar Mace.

The horizontal axis gives the collection peak number, and the numbers on the bands are the bands of

interest for sequencing. The identified ALPs were labeled on the corresponding bands according to the

sequencing results.

3.4.2. Peptide sequencing showed ALPs were cleaved in mature wheat grain

To investigate the content of ALPs in mature wheat grain, total albumin and globulin proteins were

extracted from two wheat cvs.: Mace and Spitfire. The presence of ALPs was identified by reverse-

phase HPLC (RP-HPLC), SDS-PAGE and Maldi-tof methods. Firstly, the extracted protein samples

were separated by RP-HPLC. A total of 36 and 33 elution peaks were identified for Mace and Spitfire,

respectively (Figure S2). Then, the protein fractions for each HPLC peaks were collected and loaded

on SDS-PAGE gel for further separation. As shown in Figure 2, most of the collected HPLC fraction

contains a mixture of proteins with different molecular weights. The major bands in each fraction were

cut out and sent for peptide sequencing. Only those target proteins with molecular size close to or lower

91

than the maximum predicted molecular weight of ALPs (~ 33 kDa) were analysed. A total of 55 SDS-

PAGE bands were sequenced (Figure 2; Table S1). Results (Figure 2) showed that 20 and 15 fractions

from Mace and Spitfire, respectively, were found to contain ALPs.

For Mace, 5 (ay-7DS/4AL, ax-4AL/7AS/7DS) out of the 15 ALPs, belonging to type a, could be

identified, occurring in fractions 8-11, 17-18, 20, 24-30. These type a ALPs displayed molecular weight

similar to the full length ALPs, suggesting an intact form of type a ALPs. In addition, 12 protein bands

(2, 4, 8-13, 15, 17, 20-21) were identified as type b ALPs (bx and by) which, however, could not be

assigned to specific ALP orthologues. Notably, some identified type “by” ALPs, corresponding to bands

1, 3 and 5, displayed molecular weight at around 18.34 kDa (Figure S3A-F), suggesting an inter-domain

cleavage for these ALPs. Other type “by” ALPs, corresponding to bands 2, 4, 8 and 9, contained multiple

proteins at ~ 32.32 kDa and ~ 28.19 kDa, which were validated by Malti-tof analyses (Figure S3A, C).

These results suggest the presence of both full length and another kind of partial type “by” ALPs, which

may result from the cleavage at the predicted myristoylation sites. This hypothesis is consistent with the

predicted molecular weight for myristoylation cleavage and is supported by the peptide sequencing

results, which revealed no peptide covering the myristoylation sites. In contrast to the type “by” ALPs,

the identified type “bx” ALPs, corresponding to bands 10-13, 15, 17, 20-21, were all characterised as

full length ALPs, suggesting that the type “bx” ALP that do not contain myristoylation sites had no

cleavage occurred.

Similar observations were made with Spitfire. 5 type a ALPs (ay-7DS/4AL, ax-4AL/7AS/7DS) could

be identified, occurring in the predicted full length form, with molecular weight ranging from 17.90 kDa

to 19.20 kDa (Figure S4A-F). Bands 31, 35, 37-42 were identified as type b ALPs, containing both

types “by” and “bx”. No type b ALP orthologue could be assigned. For type “by”, molecular weight at

32.43 kDa, 28.28 kDa and 18.41 kDa was observed (Figure S4A, C), suggesting the presence of the

intact form and two differently cleaved forms. For type “bx”, molecular weight at 33.01 kDa, 32.92 kDa,

32.67 kDa, 27.61 kDa were identified (Figure S5), indicating the occurrence in the intact form and the

predicted myristoylation cleaved form, but not the inter-domain cleavage form. Notable, for both Mace

and Spitfire, no type c ALP could be identified in the present study.

92

Figure S2. RP-HPLC analyses of albumin and globulin proteins in wheat. A: Mace; B: Spitfire.

Figure 2. SDS-PAGE gel separation of albumin and globulin proteins. A: Mace; B: Spitfire.

93

Figure S3A-F. Maldi-tof analyses of ALP proteins present in wheat grain of Mace

A. Peak 8 from RP-HPLC separation of albumin and globulin fraction of wheat cv. Mace; B. Peak 11

from RP-HPLC separation of albumin and globulin fraction of wheat cv. Mace; C. Peak 17 from RP-

HPLC separation of albumin and globulin fraction of wheat cv. Mace; D. Peak 20 from RP-HPLC

separation of albumin and globulin fraction of wheat cv. Mace; E. Peak 26 from RP-HPLC separation

of albumin and globulin fraction of wheat cv. Mace; F. Peak 29 from RP-HPLC separation of albumin

and globulin fraction of wheat cv. Mace.

94

Figure S4A-F. Maldi-tof analyses of ALP proteins present in wheat grain of Spitfire.

A. Peak 8 from RP-HPLC separation of albumin and globulin fraction of wheat cv. Spitfire; B. Peak 11

from RP-HPLC separation of albumin and globulin fraction of wheat cv. Spitfire; C. Peak 15 from RP-

HPLC separation of albumin and globulin fraction of wheat cv. Spitfire; D. Peak 21 from RP-HPLC

separation of albumin and globulin fraction of wheat cv. Spitfire; E. Peak 23 from RP-HPLC separation

of albumin and globulin fraction of wheat cv. Spitfire; F. Peak 25 from RP-HPLC separation of albumin

and globulin fraction of wheat cv. Spitfire.

95

Figure S5. Maldi-tof analyses of ALP proteins present in wheat grain of Spitfire Peak 19 of RP-

HPLC separation.

Table S1. Peptide sequencing results of wheat ALPs.

SDS-PAGE bands HPLC Peak Retention Time Sequencing Results MW of MAILDI-TOF

1 Mace-8 17.035 C-terminal by-7DS/4AL 18335.99

2 Mace-8 17.035 by-7DS/4AL/7AS 28185.92


4 Mace-9 18.325 by-7DS/4AL/7AS 28185.92


6 Mace-10 19.445 ay-7DS 18451.18

7 Mace-11 20.247 ay-7DS 18456.80

8 Mace-11 20.247 by-7DS/4AL/7AS

9 Mace-12 21.017 by-7DS/4AL/7AS

10 Mace-13 21.612 bx-7DS/4AL 28736.77

11 Mace-14 21.967 bx-7DS/4AL 28776.56

12 Mace-15 22.414 bx-7DS/4AL 28617.72

96

13 Mace-16 22.659 bx-7DS/4AL 28774.42

14 Mace-17 22.941 ay-4AL 18416.56

15 Mace-17 22.941 bx-7DS/4AL 28619.52

16 Mace-18 23.375 ay-4AL 18428.36

17 Mace-18 23.375 bx-7DS/4AL 28586.6

18 Mace-19 24.414 ax-4AL 19515.57

19 Mace-20 24.725 ax-4AL 19512.37

20 Mace-20 24.725 bx-7DS/4AL

21 Mace-21 25.529 bx-7DS/4AL

22 Mace-24 27.387 ax-7AS 18845.22

23 Mace-25 27.798 ax-7AS 18681.39

24 Mace-26 28.754 ax-7AS 18773.17

25 Mace-27 29.614 ax-7AS 18789.94

26 Mace-28 30.178 ax-7DS 17990

27 Mace-28 30.178 ax-7AS 18805.21

28 Mace-29 30.914 ax-7DS 17925.30

29 Mace-30 31.864 ax-7DS 18058.39

30 Spitfire-8 17.467 C-terminal by-7DS/4AL 18408.36

31 Spitfire-8 17.467 by-7DS/4AL/7AS 28236.77

32 Spitfire-11 20.266 ay-7DS 18423.39

33 Spitfire-12 21.406 ay-7DS 18447.6

34 Spitfire-14 22.796 ay-4AL 18472.54

35 Spitfire-14 22.796 bx-7DS/4AL/7AS 28759.24

36 Spitfire-15 23.147 ay-4AL 18418.48

37 Spitfire-15 23.147 bx-7DS/4AL/7AS



97


41 Spitfire-18 26.15 -


43 Spitfire-20 27.305 ax-4AL 18812.35

44 Spitfire-21 27.676 ax-7AS peptide 1

45 Spitfire-21 27.676 ??

46 Spitfire-21 27.676 ax-4AL 19269.88

47 Spitfire-22 28.743 ax-7AS 18787.16

48 Spitfire-22 28.743 ax-4AL 19249.09

49 Spitfire-23 29.378 ax-7AS 18780.63

50 Spitfire-24 30.058 ax-7AS peptide 2

51 Spitfire-24 30.058 ax-7DS

52 Spitfire-24 30.058 ax-7AS 18786.6

53 Spitfire-25 31.115 ax-7DS 17959.72

54 Spitfire-25 31.115 ax-7DS 18036.36

55 Spitfire-26 32.004 ax-7DS 18188.99

Table S2. Sumary of the detected ALPs of with HPLC and MALDI-TOF.

ALPs AAs Cysteine

residues

Main Peak of

HPLC

Retention

time (Min) MW1 a (kDa) MW2 b (kDa) MW3 c (Da) MW3 d (Da)

C-terminal by-

7DS/4AL 152 11 Mace-8 17.03 17.39/17.44 18.54/18.60 17291.16 18335.99

ay-7DS 154 14 Mace-11 20.24 16.96 18.42 16961.22 18456.8

ay-4AL 153 14 Mace-17 22.94 17.01 18.47 16961.22 18416.56

ax-4AL 162 14 Mace-20 24.72 17.747 19.20 17626.66 19474.94

ax-7AS 156 14 Mace-26 28.75 17.29 18.75 17291.16 18773.17

ax-7DS 149 14 Mace-29 30.94 16.44 17.90 16446.66 17925.3

by-7DS/4AL/7AS 261 19 Mace-8-12 17.03-21.01 29.98/29.87/29.69 31.95/31.84/31.67

98

bx-4AL/7DS 266/267 18/19 Mace-13-23 21.61-26.33 30.59/30.88 32.46/32.86

C-terminal by-

7DS/4AL 152 11 Spitfire-8 17.46 17.39/17.44 18.54/18.60 17269.85 18408.36

ay-7DS 154 14 Spitfire-11 20.26 16.96 18.42 16951.81 18423.39

ay-4AL 153 14 Spitfire-15 23.14 17.01 18.47 16951.81 18418.48

ax-4AL 162 14 Spitfire-21 27.67 17.74 19.20 17757.01 19269.88

ax-7AS 156 14 Spitfire-23 29.37 17.29 18.75 17269.85 18780.63

ax-7DS 149 14 Spitfire-25 31.11 16.44 17.90 16431.19 17959.72

by-7DS/4AL/7AS 261 19 Spitfire-8 17.46 29.97/29.87/29.69 31.95/31.84/31.67

bx-7DS/4AL/7AS 266/267/265 18/19/18 Spitfire-13-19 21.97-26.60 30.59/30.88/30.40 32.46/32.86/32.27

a Calculated molecular weight of ALPs; b Calculated molecular weight of ALPs after molecule

alkylation; c The molecular weight as deduced by MALDI TOF MS for ALPs without molecule

alkylation; d Molecular weight as deduced by MALDI TOF MS for ALPs after molecule alkylation; e

Calculated delta molecular weight of ALPs after molecule alkylation; f Delta molecular weight between

the molecular weight as deduced by MALDI TOF MS for ALPs with molecule alkylation and without

molecule alkylation. Note: The theory was that each cysteine residue would combine with one 4-vp

molecule and the molecular mass would increase 104.14 Da (the 4-vp molecular mass minus the mass

of one hydrogen ion).

3.5. Discussion

Procedures for sequentially extracting and recovering protein fractions from small flour samples were

described as reported previously (75). The NaI-propanol solution solubilized almost all the gliadins,

albumins, and globulins, along with traces of glutenin (75). The present investigation has identified

water and salt soluble proteins using three different approaches (RP-HPLC, SDS-PAGE, and MALFI-

TOF) (Figure S2, Figure 2, FigureS3A-F, Figure S4A-F, Table S1, and Table S2). Analysis of the

protein fractions by a combination of RP-HPLC followed by SDS-PAGE analysis along with protein

reference maps developed by use of protein peptide sequencing or mass spectrometry, makes it possible

to separate and identify most of the abundant proteins. These proteins include alpha-amylase and

protease inhibitors (241), high molecular weight albumins (242) and other non-storage groups and

enzymes which have specific synthetic, metabolic, regulatory, or protective roles in the plant (190, 206).

Apart from this, some high molecular weight albumins and certain globulins (triticins) are considered

to have a storage function (243).

RP-HPLC followed by SDS-PAGE of the albumin/globulin fraction demonstrated that it was highly

enriched in ALPs. Identification of the ALPs was done by molecular mass based on MALDI-TOF

99

analysis. In our analysis, when taken into all the obtained fragmentation patterns and aligned with the

respective ALP amino acids sequences, most of the bands can be resolved. On the contrary,

identification of α-/β- and γ-gliadins and LMW-GS by mass spectrometry tends to give low expectation

score, due to the repetitive motifs in the N-terminal regions and proline-rich pattern, which are hard to

digest with trypsin (75). In the case of ALPs identification, the only problem is the accurate

determination of the homeologous proteins from 7A, 4A, and 7D, due to their highly similar amino acid

sequences (> 93%). We did not attempt to resolve completely the individual subunits of this highly

complex mixture. Likely, the many individual proteins in the region with apparent molecular masses

from 33000 to 48000 Da (mainly gliadins and LMW-GSs) were not resolved by SDS-PAGE, may be

due to overlapping of fractions because baseline separations were not achieved by RP-HPLC (Figure

S2). Some of the individual ALPs are clearly resolved at apparent molecular masses of 17000 to 32000

Da, and consist of chromosomes 7A/4A/7D (Figure 2, Table S1 and Table S2). Protein bands below

16000 Da included LMW-albumins, such as members of the complex α-amylase inhibitor and α-

amylase-trypsin inhibitor families that range in mass from 13000 to18000 Da. Protein bands of the

molecular mass range of 30000 to 32000 Da include the homologous chromosome 7A/7D/4A-encoded

type b ALPs. Protein bands in this size range also include the α-/β- and γ-gliadins, grain softness proteins,

and the LMW-GS. It is unclear whether the homeologous chromosome 4A-encoded by-4AL and C-

terminal by-4AL resolved in the same bands as by-7DS and C-terminal by-7DS. A distinct band of

chromosome 7D-encoded ay-7DS and chromosome 4A-encoded ay-4AL, both with a molecular mass

of approximately 18000 Da, were identified, respectively. The protein identification indicated that our

method gave considerable overlap of protein types. For example, the ay-7AS proteins were eluted in

peaks 5-7. The ay-4AL proteins were eluted in peaks 8-10 of wheat cv. Mace. The type b ALPs (bx-

4AL/7DS) were detected in peaks 8, 9, 10, 11, 12, 13, 15, 17, 20, 21 of wheat cv. Mace. This was

typical of most fractions in our study, which consisted of analysis of overlapping fractions corresponding

to almost the entire area of the chromatogram (ALPs region). The different ALPs subunits have variant

physio-chemical properties, ALPs ay, by, and bx subunits are similar to protease inhibitors like α-, β-

amylase/subtilisin-inhibitors and serpins, triticins, while ALPs ax subunits are more similar physio-

chemical properties as avenin-3, gliadins and LMW-GSs.

The identities of individual proteins separated by RP-HPLC here were also correlated with those of

proteins resolved by others work. Shewry et al. (244) characterized certain seed albumins from different

wheat species by N-terminal sequencing and found that several belonged to the trypsin/alpha-amylase

inhibitor family. By using wheat null genetic lines, Singh and Skerritt (205) has established the location

of several of their genes on individual chromosomes for albumin and globulin proteins. SDS-PAGE

analysis of water-soluble proteins indicated the chromosomal location of polypeptides and proteins of

different molecular weight were assigned on and 1D, 2A, 2B, 2D, 3AL, 3BS, 3DS, 4AL, 4BS, 4DS,

4DL, 5DL, 6DS, 7BS or 7DL (205). In our study, besides the identification of ALPs on 7DS, 4AL, and

100

7AS, it is also displayed in our analysis that other water- and salt-soluble proteins were located to

chromosomes 1A/1B/1D (Avenin-3, Gamma-gliadin B, γ-gliadins and LMW-GS), 2A/2B/2D (alpha-

amylase/subtilisin inhibitor), 3A/3B/3D (Alpha-amylase inhibitor), 4A/4B/4D (Alpha-amylase/trypsin

inhibitor CM3), 5A/5B/5D (Grain softness protein), 6A/6B/6D (α-/β- gliadins), 7A/7B/7D (60S acidic

ribosomal protein, Alpha-amylase/trypsin inhibitor CM2). Immunological and N-terminal sequencing

characterisation identified most of the water-soluble proteins belonged to a family of alpha -amylase

inhibitors, serine carboxypeptidase III homologous protein (206). Salt-soluble proteins matched with

barley embryo globulins, other proteins include, lipid transfer protein (LTP), peroxidase BP-1 precursor

and histone H4 proteins (206). The protein sequences could also potentially be used for making antibody

or DNA probes for use in selection in breeding programmes. Information on the genetics and regulation

of this fraction of proteins is necessary to understand their role and function in the grain. It is likely that

proteins with similar physio-chemical properties are accumulated in the same fraction. The ALPs

identified together with other antifungal proteins in albumin and globulin fraction might indicate similar

antifungal functions.

3.6. Conclusions

Thirteen water and salt soluble ALPs encoded by TaALP-4A/7A/7D on chromosomes 4 and 7 were

isolated using SDS-PAGE coupled with RP-HPLC. A significant finding of this study was the

identification of multiple forms of proteins in these abundant families (by/7DS/4AL and C-terminal by-

7DS/4AL, and short peptides obtained for ax-7AS). These multiple forms may be attributed at least in

part to post-translational modifications (PTM), although the hexaploidy nature of common wheats

increases the complexity of the situation. As is common in gluten and gliadin protein extraction,

overlapping in different solvent extracts were normal. With the availability of more protein gene

sequences in public databases, and improved methods to identify proteins, it is much easier to identify

new proteins and compliment the previous accumulated information. Therefore, flour protein types now

are based on sequence similarity rather than solubility, even though cross-contamination between types

is both evident and a significant problem. Our study provides a clear identification of the proteins

extracted from albumin/globulin fractions, and with the RP-HPLC separation coupled with one

dimensional SDS-PAGE, the identification and characterization of single protein becoming possible.

RP-HPLC, SDS-PAGE, and MALDI-TOF are techniques utilized to separate and identify single protein

of importance. Each of the technique alone cannot lead to the elucidation of proteins, but combined

together, accurate identification of individual proteins will be gained.

101

4. Chapter 4 Functional characterization of wheat avenin-like proteins reveals a novel function

in fungal resistance

4.1. Abstract:

Wheat Avenin-like proteins (TaALP) are atypical storage proteins belonging to the Prolamin

superfamily. Previous studies on ALPs have focused on the proteins’ positive effects on dough strength,

whilst no correlation has been made between TaALPs and the plant immune system. Here, we performed

genome-wide characterization of ALP encoding genes in bread wheat. In silico analyses indicated the

presence of critical peptides in TaALPs that are active in the plant immune system. Pathogenesis-related

nucleotide motifs were also identified in the putative promoter regions of TaALP encoding genes. RT-

PCR was performed on TaALP and previously characterised pathogenesis resistance genes in

developing wheat caryopses under control and Fusarium graminearum infection conditions,

respectively. The results showed that TaALP and N-myristoyltransferase-1 (TaNMT) genes were

upregulated upon F. graminearum inoculation. mRNA insitu hybridization showed that TaALP genes

were expressed in the embryo, aleurone and sub-aleurone layer cells. Seven TaALP genes were cloned

for the expression of recombinant proteins in Escherichia coli, which displayed significant inhibitory

function on F. graminearum under anti-fungal tests. In addition, FHB index association analyses showed

that allelic variations of two ALP genes on chromosome 7A were significantly correlated with FHB

symptoms. Over-expression of an ALP gene on chromosome 7A showed an enhanced resistance to FHB.

Yeast two Hybridization results revealed that ALPs have potential proteases inhibiting effect on

metacaspases and beta-glucosidases. A vital infection process related pathogen protein, F. graminearum

Beta-glucosidase was found to interact with ALPs. Our study is the first to report a novel function for

wheat storage protein in fungal resistance, which greatly advances our understanding of the biological

roles of this protein class. The findings in this study is of great significance for future wheat breeding

and production.

Keywords: Avenin-like proteins, Pathogenesis related DNA motifs, N-myristoylation sites, Protein

cleavage, PTM, Triticum aestivum, FHB, antifungal function

4.2. Introduction

Plants have evolved an immune system to recognize and respond to pathogen attack (245). Initially,

transmembrane receptors on the cell surface detect and recognize the pathogen via pathogen-associated

molecular patterns (PAMPs). Adapted pathogens can suppress the PAMP-triggered immunity (PTI) by

releasing effector molecules into host plant cells. Plants, in turn, activate a second line of defence, the

effector-triggered immunity (ETI) that represses action of the effector molecules (245). Pathogen-

infected tissues generate a mobile immune signal consisting of multiple proteins as well as lipid-derived

and hormone-like molecules, which are transported to systemic tissues, where they induce systemic

acquired resistance (SAR) (246). SAR is associated with the systemic reprogramming of thousands of

https://pubs.acs.org/action/doSearch?action=search&AllField=Triticum+Aestivum&qsSearchArea=AllField

102

genes to prioritize immune responses over routine cellular requirements (247). Diverse hormones, such

as salicylic acid (SA), jasmonic acid (JA), ethylene (ET), and abscisic acid (ABA) as well as other small

phytohormones, play pivotal roles in regulation of this defence network (248-251). The signalling

pathways cross-communicate in an antagonistic or synergistic manner, providing the plant with a

powerful capacity to finely regulate its immune response (249, 250). Resistance in plants against

pathogen attack can be acquired by resistance genes that biosynthesize metabolites and proteins that

directly suppress and/or contain the pathogen to initial infection through their antimicrobial and/or cell

wall reinforcement properties. Resistance is achieved specifically by the recognition of pathogen

elicitors with plant host receptors, resulting in the induction of signalling events that include changes in

ion fluxes, phosphorylation and production of proteins and reactive oxygen species (252, 253).

Bread wheat (Triticum aestivum) is the third most cultivated crop worldwide, and a major source of

daily calories for the human population (254). Fusarium graminearum is a “hemibiotrophic” pathogen

capable of causing wheat head and seedling blight, resulting in yield loss and trichothecene mycotoxin

contamination, which is toxic to humans and animals (255, 256). In many Asia countries including

China, the FHB is referred as wheat cancer in recent years. Several historical wheat growing zones have

ceased wheat production due to severe FHB disease. The disease is now fast expanding to wheat growing

zones that no FHB disease was occurred in the past. Breeding wheat varieties resistant to FHB has

become one of the most important tasks. Better knowledge of the defence mechanisms and genetic

engineering provides an effective approach to improve wheat resistance to the disease during breeding.

Breeding wheat varieties resistant to FHB is the best strategy to minimize losses due to the disease.

Effective control of FHB requires better knowledge of the defence mechanisms and genetic engineering

provides an alternative approach to improve wheat resistance to the disease. Proteomics approaches

have revealed that F. graminearum produces extracellular enzymes, such as lipases, xylanases,

pectinases, cellulases and proteases (257-259), and other proteins, such as hydrophobins, small cysteine

rich proteins which may act as pathogenicity factors in plant–microbe interactions (257). Proteome

studies done on F. graminearum infected wheat spikes revealed that proteins could be involved in

antioxidant, JA, and ethylene (C2H2-type) signalling pathways, phenylpropanoid biosynthesis,

antimicrobial compound synthesis, detoxification, cell wall fortification, defence-related responses,

amino acid synthesis, and nitrogen metabolism (260, 261). While various transcriptome studies have

identified differentially expressed genes of resistant and susceptible wheat spikes infected with F.

graminearum, suggesting that FHB resistance is conferred by multiple genes (262-265). Further, the

defence related genes were functionally catalogued to different classes based on previous patho-

transcriptomic studies, such as transcription and signalling related genes and hormone (auxins,

gibberellins, ABA and SA) metabolism related genes (264, 266-269); cysteine-rich antimicrobial

peptides (AMPs) (270-272); GDSL-lipases (273); proteolysis including serine proteases (274);

peroxidases (POD) (275); genes related to cell wall defence (276-279), secondary metabolism and

103

detoxification involved genes; Toll-IL-IR homology region (280), and miscellaneous defence-related

genes, for example disease resistance-responsive family protein (281), NBSLRR disease resistance

protein (282).

Protein classification according to their conserved domains give insights into sequence and structural

and functional correlations. According to the Pfam analysis, many wheat grain specific proteins belong

to the prolamin superfamily (http://pfam.xfam.org/). Among them, proteins with LTP-2 (222, 223),

Tryp-alpha-amyl domain (283, 284) and Hydrophobic-seed domain (285) were reported to be involved

in the plant immunity system and have protease inhibition and antifungal activities. Proteins with a

gliadin domain, including the gamma gliadin, LMW glutenin, alpha gliadin, puroindoline, and avenin-

like protein (ALP), have been considered as typical storage proteins and have not previously identified

with biochemical functions. Their known biological role is as nutrient reservoirs for seed germination.

As most storage proteins, the ALPs also have positive effects on wheat flour and dough quality (92, 138,

160, 286). The current study reports for the first time the molecular characterisation and functional study

of TaALP in the aspects of anti-fungal activities. Results clearly demonstrated that the ALPs belong to

a pathogen-induced prolamin superfamily member gene family. It possesses significant function in

resistant to the infection of the FHB pathogen F. graminearum. It is expected that the ALPs’ FHB

resistant function can be efficiently utilised in controlling FHB. Identifying the potential linkage

between ALPs and the underlying mechanisms of a range of the newly identified FHB resistant gene

and QTLs may further enable successful control of FHB.

4.3. Materials and methods

4.3.1. Plant Materials

A natural population comprised of 240 wheat cvs. or accessions was used to evaluate the allelic effects

on FHB resistance. Eleven lines were sourced from CIMMYT (Centro Internacional de Mejoramiento

de Maíz y Trigo). The other 229 lines were from different provinces of China. A double haploid (DH)

population Yangmai-16 × Zhongmai-895 consisting of 198 lines were also used for field inoculation

assays. Australia premium bread wheat cultivar Mace and Spitfire, and Mace × Spitfire DH line 241

were used for a glasshouse inoculation study in Murdoch University.

4.3.2. Disease screening

A combination of Type I and Type II FHB resistances was assessed in field nurseries at the Nanhu

Experiment Station, Food Crops Institute, Hubei Academy of Agricultural Sciences, (Wuhan, Hubei

Province, China) during 2013-2014, 2015-2016, and 2016-2017 crop seasons. The materials used for

the 2013-2014 and 2015-2016 crop seasons were 240 wheat lines collected nation-wide in China, while

the materials used for the 2016-2017 crop season were the 198 DH lines of Zhongmai 985 x Yangmai

16. The experiments were carried out in randomized complete block designs with two replications. Each

plot comprised double 1 m rows with 25 cm between rows. An overhead misting system was applied to

http://pfam.xfam.org/

104

favour Fusarium infection and development. Plots were spray-inoculated at a concentration of 50,000

spores/ml at anthesis, when 50% of the spikes in the plot were flowering. Conidial inoculum comprised

a mix of two highly aggressive isolates of F. graminearum isolated from Huanggang and Wuhan, Hubei

Province. Ten spikes from different plants in each plot were labeled with blue tape to facilitate scoring.

These spikes were assessed 21 DAP for incidence (percentage of diseased spikes) and severity

(percentage of diseased spikelet on infected spikes). The FHB index was calculated using the formula

FHB index (%) = (Severity × Incidence)/100 (287). Naturally occurring FHB was assessed during the

2016-2017 crop season, and the plots were assessed 20, 24, and 28 DAP based on evaluation of FHB

index of the plots.

4.3.3. Promoter analysis

Biotic defense related transcription factor binding sites (ATCAT, TGACG, TTGAC, CANNTG) and

TF specific binding sites related to biotic defense were collected from public promoter motif and TF

databases (Plant TFDB - http://planttfdb.cbi.pku.edu.cn; plantCARE -

(http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) and PLACE - https://sogo.dna.affrc.go.jp)

and used for transcription factor binding site prediction on 1100 bp nucleotide sequences including 1000

bp promoter region upstream from the start codon of the avenin-like protein coding genes. Promoter

sequences were retrieved from the Triticum aestivum cv. Chinese Spring (CS42) whole genome

assembly (Triticum_aestivum_CS42_TGAC_v1, Earlham Institute, UK). The TF binding motifs were

annotated according to their hormone and TF family specificity. Promoter motifs were mapped using

the CLC Genomics Workbench v. 11 (CLCBIO Aarhus, Denmark) both onto sense and anti-sense

strands with 100% sequence identity. TFBSs belonging to the same annotation group were marked with

the same colour.

4.3.4. Point inoculation on wheat spikelets

Glasshouse based experiments were carried out at Murdoch University, glasshouse 2. The F.

graminearum strain was sourced from Curtin University. The F. graminearum isolates were grown on

mung bean agar plates (MBA) for four weeks to produce spores. Spores were collected via flooding of

the cultures with sterile water, and the spore concentration in the suspension was adjusted to 5×105

conidia/mL before point inoculation. Point inoculation of wheat spikelets was performed as follows:

inoculation of 10 μL spore suspension/deionized water into the two-central opposite wheat flowering

spikelets, which were then covered in a polythene bag for 48-72h to maintain a high humidity. Infected

spikelets were counted after two weeks. Mock inoculation was done by replacing spore solutions with

sterile deionised water and treating spikelets in the same way. Inoculation experiments were repeated

three times independently. Infected and mock spike samples were collected 7, 13, and 42 DAP. After

sampling, plant material was immediately frozen in liquid nitrogen and stored at -80°C until use. For

each biological replicate, two inoculated spikes per time point were collected and for each biological

replicate, three technical replicates were conducted.

http://planttfdb.cbi.pku.edu.cn/

http://bioinformatics.psb.ugent.be/webtools/plantcare/html/)

https://sogo.dna.affrc.go.jp)/

105

4.3.5. Overexpression of TaALP-bx-7AS gene in transgenic wheat lines

An agrobacterium mediated gene transformation procedure was followed to overexpress a TaALP gene

on chromosome 7A (TaALP-bx-7AS) in wheat cv. Fielder. The TaALP-bx-7AS gene was cloned into

pMD vector driven by CaMV 35S promoter. Transformed Fielder wheat seeds were selected on MS

medium containing 50 mg/mL kanamycin. The T2 plants were screened for FHB symptoms under

combined Type I and Type II FHB inoculation in glasshouse. The symptom scoring procedure was the

same as that used in the field nursery.

4.3.6. RNA isolation

Total RNA was extracted using TRIzol reagent (Invitrogen Canada, Inc., Burlington, Ont., Canada,

catalogue No. 15596026) according to the manufacturer’s protocols. cDNA was synthesized using an

RNA reverse transcription kit (Bioline, London, UK, Catalogue No. BIO-65053). qRT-PCR was

performed on a Rotor-Gene RG3000A detection system (Corbett Research) using SensiFAST SYBR

No-ROX Kit (Bioline, London, UK, Catalogue No. BIO-98005) as follows: hold at 95°C for 2min,

followed by 45 cycles of 95°C for 10s, 60°C for 15s, 72°C for 30s. A melting curve was performed to

determine the specificity of each PCR primer by incubating the reaction at 95°C for 20 s, cooling at

55°C for 10 s, and increasing to 95°C at a rate of 0.5°C/10 s. The reference gene β-actin was used for

the normalization of all qRT-PCR data. The 2-ΔΔCt method (168) was used to calculate the relative

expression levels with three technical repeats.

4.3.7. In situ hybridization

To generate gene-specific anti-sense probes, a 750-bp and a 500-bp TaALP cDNA clone, pspt19

(RGRC-NIAS; http://www.rgrc.dna.affrc.go.jp/stock.html), was digested with BamHI and SacI,

respectively, and transcribed in vitro under the T7 and SP6 promoters with RNA polymerase using the

DIG RNA labeling kit (Sigma Aldrich). In situ hybridization was performed according to the protocol

of Kouchi and Hata (288) (Appendix Table 3).

4.3.8. Recombinant TaALP production

Full-length TaALP cDNA was inserted into the bacterial expression vector pET28a (+) (Novagen), and

the constructs were then introduced into Escherichia coli BL21(DE3) codon plus. Bacteria contain the

plasmids were grown in Luria-Bertani (LB) medium containing 50μg/ml kanamycin at 37°C to

OD600=0.6. Expression of the fusion protein His-ALP was induced by addition of 1 mM isopropyl β-D-

1-thiogalactopyranoside (IPTG) and incubation at 25°C for 16 hr. Bound proteins were eluted with

sodium phosphate buffer containing increasing concentrations of imidazole and detected by 12% SDS-

PAGE. Nonspecific proteins purified from the bacteria with the pET28a (+) vector were used as control

(Appendix Table 3).

4.3.9. In vitro antifungal activity of recombinant ALPs

An agar-gel diffusion inhibition assay was carried out in order to determine the in vitro anti-fungal

activity for inhibition of mycelial growth of F. graminearum. Three 5-mm diameter mycelial disks (3-

day-old culture) of the strain was placed in the PDA plate with 100 μl of the recombinant protein sample

106

and incubated at 23 °C for 3 days. Inhibitory zones from different recombinant samples were visually

compared with those from the control bacterial extracts. Antifungal activity of ALPs proteins against

fungi was assayed by micro spectrophotometry of liquid cultures grown in microtitre plates as described

previously (289, 290). Briefly, in a well of a 96-well microplate, 10 µl of the protein sample (purification

buffer as control) was mixed with 90 µl minimal medium (MM) containing fungal spores at a

concentration of 1×105 conidia ml−1. Growth was recorded after 24 h incubation at 22°C daily. EC50

values (the concentration of the antifungal protein required to inhibit 50% of the fungal growth) were

calculated from dose–response curves with two-fold dilution steps (290). The absorbance was recorded

at 595 nm in a 96-well plate reader (Biorad).

4.3.10. GAL4-based yeast two-hybrid assay

TaALP protein interactions were studied using GAL4-based yeast two-hybrid assay, including protein

to protein interactions within the wheat host and these between host and pathogen. A F. graminearum

cDNA library was screened for potential interactions. The TaALP gene were amplified using the forward

primer TaALP-NdeI-F and the reverse primer TaALP-BamHI-R (Appendix Table 3). The PCR product

and plasmid pGBKT7 (CLONTECH Co., United States) were treated with NdeI and BamHI enzymes

(Neb, England), respectively, followed by ligation to construct the recombinant vector pGBKT7:TaALP.

The recombinant vector and the negative control pGBKT7 were transformed into the wild yeast cells

Y187 (CLONTECH Co., United States), respectively, and cultured in Trp lacking media. While prey

proteins are expressed as fusions to the Gal4 activation domain (AD) (291, 292). The Ta-MCA gene and

Ta-NMT gene were amplified using primers listed in Appendix Table 3. The PCR products and plasmid

pGADT7 (CLONTECH Co., United States) were treated with NdeI and BamHI enzymes (Neb, England),

respectively, followed by ligation to construct the recombinant vector pGADT7:TaMCA and

pGADT7:TaNMT. The recombinant vectors were transformed into the wild yeast cells Y2HGold

(CLONTECH Co., United States), respectively, and cultured in Leu lacking medium. The clones grown

in the Leu lacking medium were mated with the previous Trp lacking medium colonies with overnight

shaking and then transferred to the Trp and Leu lacking medium with X-α-gal, to allow bait and prey

fusion proteins to interact. The DNA-BD and AD are brought into proximity to activate transcription

of MEL1 to test the transcriptional activation activity. Sequences coding for one anti-fungal proteins,

ALP gene (encoded by 7dyb, Appendix >YJ7dyb), were chemically synthesized according to their

amino acid sequences. A metacaspase gene and N-myristoyltransferase-1 (NMT) gene were cloned from

a common Australia wheat cv. Lincoln.

4.3.11. Statistical analysis for the allelic effect

For the allelic effect study, marginal F tests were used to determine the significance of allelic effects on

FHB indexes of the 240 wheat varieties (293). Markers were nested within the population. The statistical

significance of the FHB index was assessed performing T-tests using the SAS/STAT System software,

Version 8.0 (SAS Institute Inc. Cary, NG) for the DH population of Yangmai16 x Zhongmai 985. All

measurements were carried out in triplicate, and the results presented as mean values ± SD (standard

107

deviation). Statistical analysis was performed via one-way analysis of variance (ANOVA) followed by

Duncan’s test. P < 0.05 were considered significant. Data were analyzed using SPSS 19.0 (SPSS Inc.,

Chicago, IL, USA).

4.4. Results

4.4.1. In silico analyses revealed pathogenesis-related features on ALP encoding genes

To investigate the potential relationship of ALP genes with pathogenesis, the previously characterised

pathogenesis-related motifs were retrieved from public database (Table S1). A total of 11 motifs, related

to different hormones and transcription factor families, were identified. The putative promoter binding

regions (1000 bp region upstream the translation starting sites) of 15 ALP encoding genes (63) in bread

wheat were surveyed for the presence of those motifs (Figure 1A). Overall, multiple pathogenesis-

related motifs, ranging from 11 to 28, were identified in the promoter binding regions of all ALP genes.

The 15 wheat ALP genes could be divided into 5 orthologous groups: 2 groups of type a (ax, ay), 2

groups of type b (bx, by), and 1 group of type c (c). Interestingly, the highest number (26-28) of

pathogenesis-related motifs was observed for bx genes, while the lowest was found for ay genes, ranging

from 11 to 17. When different types of ALPs were compared, the highest number of pathogenesis-related

motif was observed for type b (146) followed by type a (103), with type c being the lowest (55).

In addition, when different chromosomes were compared, the ALP genes on 7D have the highest number

(108) of pathogenesis related motif, which is higher than these of 7A and 4A (both at 98). In addition to

pathogenesis-related motif analyses in the promoter regions, the predicted amino acid sequences for the

15 ALP encoding genes were analysed for the presence of N-myristoylation sites, which have been

shown to be related to pathogenesis. In particular, candidate proteins could be cleaved at the

myristoylation sites, followed by myristoylation reaction catalysed by N-myristoyltransferse. This

process leads to programmed cell death, which confers systemic acquired resistance (SAR). Results

showed that 13 out of the 15 ALP proteins contained one or two myristoylation sites (Figure 1B),

suggesting a potential biological role in pathogenesis resistance.

Table S1. The list of the retrieved motif related to pathogenesis.

Stress Hormone TF family

CANNTG pathogen JA bHLH MYC

TGACG pathogen SA TGA bZIP

TTGAC pathogen SA WRKY

AAAGATA pathogen GATA zinc finger

AACGTG pathogen JA MYC

108

ACGT Light, elicitor,

pathogen

ethylene bZIP

ATCAT pathogen JA ATB bZIP

AGCCGCC pathogen Ethylene, JA AP2/ERF

CTCTT pathogen

GCCGCC pathogen Ethylene, JA AP2/ERF

GTAC Biotic, abiotic

stress

ethylene SBP

Motifs were collected from PLACE and PlantCARE databases. Hormone and TF family specific

information was retrieved from the annotation.

110

Figure 1. In silico analyses on ALP genes. A. Prediction of pathogenesis-related motif in the promoter regions of ALP genes. B. Prediction of the presence of

signal peptides, phosphorylation sites, myristoylation sites, polyQ groups in ALP proteins

111

4.4.2. ALP genes were upregulated upon F. graminearum inoculation in developing wheat

caryopses

To investigate the potential interactions between ALP genes and pathogen resistance, the transcriptional

profiles of 7 ALP genes (ax-7AS/7DS, ay-7DS, by-7AS/7DS, bx-7AS/7DS), 2 previously characterised

anti-virulence gene candidates (xylanase inhibitor encoding gene Taxi III, pathogenesis-related protein

1encoding gene PR.1.1), and 2 Programmed cell death (PCD) related wheat meta-caspase 4 gene

(TaMCA) and N-myristoyl Transferase gene (TaNMT) were studied by RT-PCR under control and F.

graminearum inoculation conditions in developing wheat caryopses. A total of 3 wheat lines (Mace,

Spitfire, 241) at 3 developmental stages (7 DPA, 13 DPA, 42 DPA) were investigated (Table 1). Overall,

for the 7 ALP genes, the highest expression was observed at 13 DPA with the exception of 7axb, which

was barely expressed at all stages under the control conditions. At 13 DPA, a clear upregulation of ax-

7AS, ax-7DS, ay-7DS, by-7AS, bx-7DS and by-7DS upon F. graminearum inoculation could be

detected in all or some of the three wheat lines studied. Similar observations could also be made at 42

DPA, when the transcription of ax-7AS, 7axb and 7ayb were significantly upregulated in some wheat

lines. Noteworthy, although 7axb is barely expressed in all wheat lines throughout seed development

under control condition, significant upregulation of the transcription of this gene was detected at 7 DPA

and 42 DPA in wheat line 241. In contrast to ALP genes, transcription of RP.1 and Taxi III genes were

mainly found at 7 DPA and 42 DPA but not at 13 DPA. At 7 DPA and 42 DPA, clear up-regulation of

RP.1 and taxi was observed after F. graminearum inoculation, suggesting a positive role for these genes

in pathogenesis activities. For MCA and NMT genes, the highest expression occurred at 13 DPA, with

very low or no expression at 7 DPA and 42 DPA. At 13 DPA, in contrast to MCA, which displayed

variable transcriptional changes among different wheat lines upon F. graminearum inoculation,

significant up-regulation of NMT was detected in all wheat lines studied.

112

Table 1. RT-PCR of ALP genes in developing wheat seeds under control and pathogen infection conditions.

The control row represented the non-infected gene expression of wheat cultivar Mace, Spitfire, and DH line 241. The row of Mace, Spitfire and 241 represented

the infected gene expression of wheat cultivar Mace, Spitfire and DH line 241.

Cultivars Relative expression (%) at 13 DPA

ay-7DS ax-7AS ax-7DS by-7AS by-7DS bx-7AS bx-7DS TaMCA4 TaNMT Taxi III PR.1

control 1a 1a 1a 1a 1b 1a 1a 1c 1a 1a 1a

Mace 1.10b 1.58b 1.28b 1.54a 1.34c - 1.26b 0.77a 1.22a 2.07a 3.67d

Spitfire 1.69b 1.48c 1.58c 2.79b 0.44a 1.65b 0.96a 1.28d 2.86b 3.55b 2.06c

241 2.78c 2.53d 3.03d 5.60c 2.10d 3.59c 2.85c 0.96b 2.68b 1.80a 1.79b

Relative expression (%) at 7 DPA

control 1a 1a 1a 1b 1a 1a 1a 1b 1b 1a 1a

Mace 0.50a 0.58a 0.63a 0.26a 0.23a - 0.30a 0.58a 0.50a 0.67a 1.44a

Spitfire 13.82b 10.73b 9.24b 3.37c 2.59b 2.59a 6.10b 0.88b 0.51a 1.35a 3.12b

241 18.50c 19.09c 11.68c 3.81c 10.10c 30.24b 20.75c 1.08c 0.99b 4.07b 2.99b

Relative expression (%) at 42 DPA

control 1a 1a 1a 1a 1a 1a 1a - 1a 1a 1a

Mace 4.59b 24.23b 48.28b 12.25a 544.24b - 71.47a - 2.02a 22.88b 6.87a

241 0.03a 0.05a 22.57a 33.09b 0.05a 32.94b 0.07a - 32.70b 5.45a 161.89b

113

4.4.3. ALP genes were expressed in the embryo, aleurone, sub-aleurone and transfer cells

To determine the transcriptional domain of ALP genes, mRNA insitu hybridization was performed for

two ALP genes: ay-7DS and by-7AS, representing type a and b, respectively. The developing wheat

caryopses of Mace at 15 DPA was used. As shown in Figure 4, clear signals of type a ALP gene ay-7DS

expression were detected in the embryo (Figure 2A), aleurone cells (Figure 2A), sub-aleurone and

transfer cells (Figure 2A). The highest intensity was observed in the aleurone and subaleurone cells,

followed by embryo, whilst the signal in the transfer cells is relatively weaker. No signal or very weak

signal could be detected in other part of the endosperm, pericarp and husk tissues. Similar results were

obtained for type b ALP gene by-7AS. The transcription of by-7AS was observed in embryo (Figure 2B),

aleurone (Figure 2B), sub-aleurone (Figure 2B) and transfer cells (Figure 2B), with the highest

expression in embryo, aleurone and sub-aleruone cells, whilst relative weaker in transfer cells.

114

Figure 2. mRNA insitu hybridization on ALP genes in developing wheat caryopses. A. type a ALP;

B. type b ALP.

4.4.4. ALPs displayed significant anti-fungal function on F. graminearum

To determine whether ALP proteins have anti-fungal function, 7 ALP genes (ay-4AL, ay-7AS, C-

terminal by-7DS, c-7AS, by-7AS, bx-4AL and by-7DS) were cloned into pET28a (+) vector and induced

115

for recombinant protein production in E. coli system. After protein induction, E. coli cells were

harvested and lysised, followed by centrifugation. The expression of the target ALP proteins in the

supernatant solution were confirmed by SDS-PAGE gel (Figure 3A-C). The fungal growths were

compared between the unclarified whole cell protein extract with and without recombinant ALP from

E. coli BL21 (DE3), and found that protein extract containing the recombinant ALPs can significantly

inhibit the hyphae growth, both in the petri-dish experiment and the spores’ germination experiment.

Preliminary anti-fungal tests were performed by studying the inhibitory effects of F. graminearum on

PDA plates. As shown in Figure 3D, compared to the control tests, the growth of F. graminearum

colonies were clearly inhibited by the recombinant ALP protein solutions, indicating all selected ALPs

have anti-F. graminearum function. Noteworthy, variable degrees of anti-funtal activity were observed,

with ay-4AL, ay-7AS, C-terminal by-7DS displayed the highest and comparable anti-fungal activities,

followed by by-7AS. The lowest anti-fungal activities were observed for c-7AS, bx-4AL and by-7DS.

Further anti-fungal tests were performed by studying the inhibition effects on F. graminearum in

minimal medium (MM) media. The E. coli strain harbouring the pET28a (+) vector with no gene insert

was used as control. The growth rate of F. graminearum was plotted in Figure 3E for the 7 selected

ALP proteins. The inhibitory activity of each candidate protein was assessed by calculating the EC50

value. Overall, the results are consistent with that obtained from the PDA plate tests. As shown in Figure

3E, ALP, ay-4AL, ay-7AS, and C-terminal by-7DS displayed the lowest EC50 values (0.11 – 0.15),

suggesting the highest anti-fungal activities for these proteins. This is followed by ALP by-7AS, which

has an EC50 of 0.42 and demonstrated moderate anti-fungal activities. The lowest EC50 values were

observed for ALPs c-7AS, bx-4AL and by-7DS, suggesting these ALPs have relative lower ant-fungal

activities toward F. graminearum.

116

Figure 3A-C The production of recombinant ALP protein validated by SDS-PAGE gel; A.

Recombinant protein identified as ay-4AL, ay-7DS, C-terminal by-7DS and c-7AS, indicated by

the black arrow starting from the right side; B Recombinant protein identified as by-7AS and bx-

4AL, indicated by the black arrow starting from the right side; C Recombinant protein identified

as by-7DS indicated by the black arrow; D Anti-fungal tests of ALPs on F. graminearum on PDA

plates; E. Anti-fungal tests of recombinant ALPs on F. graminearum. growth rate plot and EC50

value calculation.

4.4.5. ALPs have potential proteases inhibiting effect on metacaspases and beta-glucosidases

In silico, peptide sequencing and gene transcriptional analyses in the present study suggested a positive

interaction between ALP genes and pathogenesis-related genes TaMCA4 and TaNMT. To validate the

predicted interactions between these proteins, yeast two hybridization experiments were performed.

Three ALP proteins (ay-4AL, ay-7AS, C-terminal by-7DS) were selected to study their potential

interactions with TaMCA4 and TaNMT proteins. Each gene fragment encoding these corresponding

proteins were cloned into both PGADT7 and PGDBKT7 vectors to allow forward and reverse double

validations. For each experiment, both vectors, containing one ALP insert and one target pathogenesis-

117

related gene insert, were transformed into yeast strainsY187 and Y2HGold, respectively. The potential

protein interactions were assessed by colour reaction on X-alpha-Gal media plate. As shown in Figure

4, all of the three selected ALPs were found to interact with TaMCA4 in both forward and reverse tests.

However, those ALPs displayed weaker interactions with TaNMT, which was also confirmed by both

forward and reverse interaction tests.

To further identify the other fungal proteins which may interact with ALP proteins, the above three ALP

gene constructs were used to screen the cDNA library constructed from F. graminearum strain. Beta-

glucosidase which is encoded by a candidate gene (id FG05_01351) was found to interact with all of

the three target ALPs. Beta-glucosidase has been shown to be able to hydrolyse the chitin in wheat seed

pericarp, which plays an important role during the pathogen infection process. This may explain the

molecular basis underlying the anti-fungal function of ALP toward F. graminearum.

The biochemical analysis and protein-protein interaction study were performed for several ALPs to

confirm and compare the antifungal activity and interacting potential of the homeologous ALP proteins.

The homeologous ALPs are likely to have similar biological functions. We have sequenced through

more than 20 Australian common wheats for polymorphisms of ALP gene, polymorphisms were

identified for bx-7AS, ax-4AL, and by-7AS loci. Based on this, FHB index association analysis study and

OE transgenic study were performed only for bx-7AS gene. FHB resistance are the results of multiple

genes, and it is also suggested that single gene contribution to the overall FHB resistance is not quite

significant. It is estimated that the homeologous ALPs are of similar functional properties.

Figure 4. Yeast two hybridization tests of ALPs and pathogenesis-related proteins TaMCA4 and

TaNMT. The symbols of 2/13, 3/13, 4/13 indicate the positive interations of ALPs and N-

myristyoltransferases, that is, PGADT7-ay-4AL/TaNMT, PGADT7-ay-7DS/ TaNMT, PGADT7-C-

terminal by-7DS/TaNMT, respectively. The symbols of 6/9, 6/10, and 6/11 indicate the positive

interations of ALPs and N-myristyoltransferases, that is, PGADT7-TaNMT/PGBKT7-ay-4AL,

PGADT7-TaNMT/PGBKT7-ay-7DS, and PGADT7-TaNMT/PGBKT7-C-terminal, respectively. The

118

symbols of 5/9, 5/10, 5/11 indicate the positive interations of ALPs and metacaspases, that is, PGADT7-

TaMCA/PGBKT7-ay-4AL, PGADT7-TaMCA/PGBKT7-ay-7DS, and PGADT7-TaMCA/PGBKT7-C-

terminal, respectively. The symbols of 2/12, 3/12, 4/12 indicate the positive interations of ALPs and

metacaspases, that is, PGADT7-ay-4AL/TaMCA, PGADT7-ay-7DS/ TaMCA, PGADT7-C-terminal

by-7DS/TaMCA, respectively.

4.4.6. Functional ALPs alleles are significantly associated with lower FHB index

To further characterise the potential anti-fungal role of ALPs in wheat, FHB index association analyses

were performed to study the ALP allelic effects on 240 wheat cvs. (collected across different regions in

China) using one SNP marker (marker ID bx-7AS). Functional bx-7AS allele was identified in ALP gene

bx-7AS, while the other allele resulting in a dysfunctional per-mature termination. The FHB index data

were collected from two continuous years for the 240 wheat cvs. grown in two different locations.

Results showed that, for the SNP marker, the functional alleles were significantly (P < 0.05) associated

with a lower FHB index, indicating a positive effect on F. graminearum resistance (Table 2).

The effects of bx-7AS (functional allele) on FHB resistance was further investigated using a double

haploid (DH) population (198 lines) derived from Yangmai 16 (dysfunctional allele) and Zhongmai 895

(Table 2). FHB index was calculated in both field and glasshouse conditions. Under the field growing

condition, three developmental stages (20 DPA, 24 DPA, 28 DPA) were analysed. Similar to the above

association analyses, results on the DH population also revealed a significant association (P < 0.009) of

the functional bx-7AS allele with a lower FHB index, which decreased by 23.15%, 21.32% and 19.35 %

for 20 DPA, 24 DPA and 28 DPA, respectively. For the glasshouse growing condition at 21 DPA,

significant association (P = 0.043) of the functional bx-7AS allele with a lower FHB index was also

observed, although leading to a relatively milder decrease (12.57%) on the FHB index. Taken together,

association analyses showed that the functional alleles of ALP genes bx-7AS were significantly

associated with FHB resistance.

Table 2. Statistical analysis of bx-7AS gene on FHB index

Average

FHB index

2013-2014 2015-2016 2016-2017

21DPA 21DPA 21DPA 21DPA 21DAP 20DAP 24DAP 28DAP

Allele 0 77.59 80.29 73.12 75.5 57.3 29.8 44.1 55.8

Allele 1 71.77 74.75 63.89 65.82 50.1 22.9 34.7 45

Increased

Rate (%) -7.5 -6.91 -12.62 -12.83 -12.57 -23.15 -21.32 -19.35

P value 0.038 0.046 0.015 0.01 0.043 0.009 0.006 0.004

119

4.4.7. Overexpression of TaALP-bx-7AS gene in transgenic wheat lines revealed decreases in

FHB symptoms

In order to further assess the involvement of the ALPs gene in wheat resistance to FHB, we generated

transgenic wheat plants that either had the ALPs gene overexpressed.

We generated two ALPs overexpression (ALPsox) lines in the wheat cv. Fielder background. We

inoculated ALPsox #1 and #2 lines together with wheat cv. Fielder and found elevated resistance to FHB.

As shown in the Table 3, from 7 to 14 DPA, relative increasing rate of infected spikelet number

decreased in the ALPsox lines compared with the control, suggesting slower FHB symptoms

development. Similar patterns were found from 14 to 21 DPA in the ALPsox Lines. These two ALPsox

lines FHB spreading are reduced when compared with the control. Thus, results of the overexpression

experiments strongly suggest that the ALPs gene functions as a disease resistant components to FHB

resistance.

Table 3. Relative increasing rate of infected spikelet number in transgenic and control wheat

Wheat Lines Relative increasing rate of infected spikelet (%)

7~14 DPA 14~21 DPA

Control 62.02 a 44.50 a

7A1-1 21.11 bc 36.61 ab

7A1-2 49.49 ab 28.06 abc

7A2-2 16.67 c 21.18 bc

7A2-4 21.42 bc 7.87 c

4.5. Discussion

4.5.1. Promoter significance of TaALP genes

FHB-responsive JA signalling regulated gene expression is immediate and conforming in resistance of

wheat cvs. (264, 294). Many cysteine-rich antimicrobial peptides (AMPs) were found to be up-regulated

by JA signalling, and were reported to be synthesized in healthy plants to maintain normal plant

development (295) as well as functioning as a primary protection against diseases and pests(296).

Meanwhile, an increased ethylene production contributes to wheat FHB resistance (262). Indeed,

indications for an active ET signalling were found in the FHB-attacked resistant wheat transcriptome

(264). In addition to the presence of JA- and ET-mediated general antifungal defences, a second line of

defence was found to be based on a FHB-responsive and targeted suppression of relevant Fusarium

virulence factors, such as proteases and mycotoxins (264). Fusarium subtilisin-like and trypsin-like

proteases are released in infected wheat kernels mainly to disrupt host cell membranes during

necrotrophic intracellular nutrition, both the plant protease inhibitor proteins and subtilisin-like and

trypsin-like proteases of F. graminearum and F. culmorum have already been proven in the cereal grains

(264, 297).

120

Previous studies showed that downstream PR genes are usually regulated by different signalling

hormones, ChiI and GluD was located downstream of the ET pathway, PR.10 was allocated downstream

of the JA pathway, and PR.1 was allocated downstream of the SA pathway (298, 299). Moreover, in

vitro antifungal assays confirmed that the purified wheat ChiI and GluD proteins could inhibit the hyphal

growth of F. graminearum (300). Base on promoter analysis, promoter regions of TaALP genes, were

pathogen inducible, can be induced by disease related transcriptional factors (TFs), such as TGAC-

bZIP/ATB-bZIP (Figure 1A). For example, at ALP gene loci on chromosome 7A, 31 and 4 motifs were

identified for ATB_bZIP and TGA1_bZIP, respectively (Figure 1A). Further, promoter region motif

annotation illustrated that TaALP genes have motifs related to SA and JA, ET signalling regulation

(Figure 1A). A few ET/JA related motifs were compounded by pathogen responsive motifs, indicating

that TaALP genes are likely to be regulated by ET/JA and located downstream of ET/JA signal pathway

(Figure 1A). For example, at ALP gene loci on chromosome 7A, 137 pathogen related motifs were

identified, 75 and 100 motifs were identified for ET and JA, respectively, yet with only 23 motifs

identified for SA signal (Figure 1A). This results suggest that TaALP genes are likely to be induced by

a JA or ET signal, and ET/JA signal pathway might act in a synergistic or opposite manner with SA

signal pathway to confer FHB resistance. Transcript profile analysis by q-RT-PCR indicated that the

transcripts of TaALP genes in wheat are induced by pathogen infection. Further, we have seen that the

expression pattern of TaALP genes is similar to some PR genes (Taxi III and PR.1) under F.

graminearum infection conditions. As shown in RT-PCR analysis above, the expression of TaALP was

induced rapidly and dramatically by exogenous F. graminearum at 7 DAP for wheat cv. Spitfire and

DH line 241, declined later on, whereas the expression of TaALP genes was dramatically induced at 13

DPA and the maturity stage for wheat cv. Mace. The transcriptional differences might be a direct results

of differences in the ET/JA signalling. The dual peak, indicated by 13 DPA and maturity upregulation,

might be caused by regulation of the expression of TaALP genes by other TFs regulated by ET/JA, or

interactively regulated by other hormones, such as SA. Cross-talking between different signalling

pathways might either activate or suppress the PR genes transcription (301-303). Taking these results

together, TaALP is potentially involved in wheat defense response to F. graminearum through the ET/JA

pathways.

In summary, the results of q-RT-PCR analyses showed that under F. graminearum infection, wheat

grain dramatically increased the transcript levels of TaALP genes. And in addition, in the protein level,

in vitro antifungal assays of recombinant protein products of TaALP genes gave evidence to their

toxicity against hyphae growth of F. graminearum (Figure 2D, E). Most importantly, our results

demonstrate that ALPs are directly involved in resistance to F. graminearum in wheat. ALPs, as a so

far unknown family of antifungal proteins, can be used to breed wheat lines with increased disease

resistance. Other researches were done on transformation of bread wheat by the transfer of cDNAs

encoding differently acting antifungal proteins (298, 304-307). According to Ferreira et al. (295),

121

overexpression of defense protein genes in the living host cells form a zone surrounding the most

advancing hyphae as they allow a continuous supply with antifungals onto the intercellular hyphal tips.

TaALP could be used as a candidate to improve crop resistance to F. graminearum. To our knowledge,

this is the first time that ALPs, belonging to the seed prolamin superfamily with a gliadin domain, are

reported to act as defense proteins against pathogens.

4.5.2. Gliadin domain components display antifungal effects

ALPs contain either one or two gliadins domains (PF13016). Such a domain was also found to be

characteristic of puroindolines, gamma and alpha gliadins and LMW glutenins. Similar to the pFam

classification, ALPs has bifunctional inhibitor/plant lipid transfer protein/seed storage helical domain

(Bifun_inhib/LTP/seed_sf), based on the InterPro classification. This represents a homologous

superfamily of structural domains consisting of 4 helices with a folded leaf topology and forming a

right-handed superhelix. Prolamin superfamily protein’s function may relate to protease inhibition or

involvement in plant defence. As discussed in Juhasz, et al. 2018 (308), the hydrophobic-seed domain

containing proteins include, cortical cell delineating (208), hydropho-seed domain containing protein

(209-213), glycine-rich protein (214-216) and proline-rich protein (217, 218), which are found to be

included in the plant defence system and have antifungal properties. Lipid transfer protein (220-224)

and non-specific lipid transfer protein (225) have a LTP-2 domain, and have antifungal properties.

Alpha-amylase/trypsin inhibitor (226, 227), Grain softness protein (228), Puroindoline (229, 230),

Alpha gliadin (231) all contain a Tryp-alpha-amyl domain, and are known antifungal proteins.

Meanwhile, Puroindoline, Alpha gliadin, LMW glutenin, Gamma gliadin, ALPs have a Gliadin domain,

yet till now, the exact function is unclear. 19KDa Globulin (232, 233), Small cysteine-rich protein (234-

236) belongs to the Domainless Cys-rich proteins, are involved in plant defence. While Omega gliadin

and HMW-GS are Domainless Cys-poor proteins, were not reported to have disease resistance

properties. Our study is the first-time proteins with gliadin domains that are also characteristic in gamma

and alpha gliadins and LMW glutenins are described with a defense related function and this highlights

the possible involvement of the gliadin domain in plant immunity and biotic stress mechanisms.

4.5.3. Temporal and spatial expression of TaALP gene under fungal infection

Plants induce defense responses against pathogen invasion which include activation of the SA-, JA- ,

ET- mediated defense pathways, which in turn increase reactive oxygen species (ROS) production,

phytoalexin accumulation, Hypersensitive Response (HR), and/or upregulation of pathogenesis-related

(PR) protein expression (309). Phyto-oxylipins comprising antimicrobial peptides and defence-

signalling molecules such as JA, together with cysteine-rich PR genes indicate an induced antifungal

defence mechanism (264). There is increasing evidence that members of the prolamin superfamily may

play important roles in responding to biotic and abiotic stresses (310-312).

To understand the defense mechanisms of wheat grain ALPs, it is necessary to identify wheat TaALP

genes and study their functions in the defense response to pathogens. In this study, we isolated and

122

characterized pathogen induced TaALP genes in wheat, TaALP, whose transcript peak showed more

rapid and stronger response to challenge with F. graminearum in the wheat cv. Spitfire and DH line 241

than in that of the wheat cv. Mace (Table 1). Our observation showed that disease symptoms in wheat

cv. Mace were more severe than wheat cv. Spitfire and DH line 241 under F. graminearum infection.

Meanwhile, TaALP genes induction, as well as the two PR genes (Taxi III and PR.1) showed earlier

induction in Spitfire wheat and DH line 241 than in wheat cv. Mace. However, even the lower induction

ratio at 7 DAP for wheat cv. Mace was considered relevant due to the strictly suppressed expression in

the susceptible genotype. The significant >80-fold inductions at maturity stages for Mace wheat in the

infected spike tissues was observed and may be an indication of delayed hormone regulation of the

susceptible wheat cv. No gene expression was verifiable in spike samples of wheat cv. Spitfire and Line

241 for some TaALP genes at maturity stages. In the first instance, the relative induction peak at 7 DAP

for wheat cv. Spitfire and Line 241 are an indication of earlier response of fungal infection and was

consistent with less infected spikelets observations for wheat cv. Spitfire and Line 241 (20-30% infected

spikelets) than wheat cv. Mace (50% infected spikelets). Given that TaALP with distinct transcript

kinetics following pathogen challenge play unique roles in the defense response, it is necessary to

identify wheat TaALP genes with stronger and faster induction by the pathogen. Wheat cvs. Spitfire and

Mace may have developed a strategy to increase induction of TaALP expression, as well as other PR

genes to counter infection by F. graminearum.

TaALP genes were specifically highly expressed in developing wheat caryopsis with a peak around 10-

18 DAP. And in our study, we found enriched transcripts in fungal infected grains. TaALP genes

transcripts can be localized in transfer cells as well as aleurone cells in the infected caryopses (Figure

2). It is likely that expression of TaALP are greatly induced in the wheat endosperm, sub aleurone cells

and embryos, transfer cells, as well as the pericarps (Figure 2), which confirms that it acts directly on

reduction of pathogen spread, and most likely has a role in plant immunity. The transcripts, however,

were not restricted to the basal transfer cells; they were transcribed in the upper halves of immature

kernels like aleurone cells, as well as the seed endosperm itself, and embryo, as was evidenced by

mRNA in situ hybridization of TaALP genes (Figure 2). These up-regulated transcripts are most likely

to represent defences, such as trigger mechanisms or direct antimicrobial activities (305).

Developing seeds are strong sinks for nutrients produced in the maternal plant (313). In wheat and barley,

transfer cells are a vascular bundle running along the length of the grain, through modified maternal

cells in the nucellar projection, to the endosperm cavity that extends along the seed, in parallel to the

vascular bundle (314). The expression of TaALP in the transfer cells as well as aleurone cells under

pathogen infection is consistent with the evidence that endosperm transfer cells maintain a delicate

balance between nutrients transportation and the need to impede the ingress of pathogens into the

developing seed (315). Transfer cells are involved in delivery of nutrients between generations and in

123

the development of reproductive organs and also facilitate the exchange of nutrients that characterize

symbiotic associations (314). Since transfer cells play important roles in plant development and

productivity, the latter being relevant to crop yield, understanding the molecular and cellular events

leading to wall ingrowth deposition holds exciting promise to develop new strategies to improve plant

performance (314).

Enriched TaALP genes transcripts can also be localized in developing embryo around 15-18 DAP, which

also indicate another category that might be of great interests. Proteomic study have indicated that

proteins induced in response to infection are proteins involved in protein synthesis, folding and

stabilization, as well as proteins involved in oxidative stress tolerance, and PR proteins in tissues of the

fungal-infected germinating embryo (316). Lectin are known to have antifungal properties and are

actively involved in plant defense, are expressed at low levels in the developing embryo together with

the more abundant seed storage proteins (317).

4.5.4. In vitro antifungal function of ALPs and allelic effect of ALPs on field FHB index

Further heterologous bacterial expression confirmed that TaALP could significantly reduce fungal

hyphae growth in vitro (Figure 3D). As was illustrated in our in vitro antifungal activity test against F.

graminearum fungal growth, EC50 values suggested that different paralogs of ALPs might differ in their

toxicity (Figure 3E). In the transcriptional study under F. graminearum infection, TaALP encoded

proteins belonging to the type a subgroup (ax-7AS/7DS and ay-7AS/7DS) can be induced at earlier

stages, while most of the type b subgroup (bx-7AS/7DS and by-7AS/7DS) of the TaALP family can be

induced at late grain filling stages under pathogen infection. These findings support the hypothesis that

ALPs, might reduce certain protease activity of virulent pathogens as shown in the inhibited pathogen

growth and spreading with much earlier induction in wheat cv. Spitfire and DH line 241. Therefore, as

new members of the PR families and one of the many antifungal components, ALPs, are likely to play

an important role in SAR and defense responses to F. graminearum infection initially, and some ALPs

members induced at late grain filling stage could protect seed against this pathogen during germination.

TaALP genes encode prolamin superfamily member proteins that bear both antifungal properties while

still maintaining the potential nutrient reservoir activity underpinned by typical storage proteins. Both

in qualitative and quantitative aspect, ALPs might be of minor contribution to the total nutrient reservoir

activity compared with glutenins, gliadins, and some HMW albumins and globulins (90). The induction

of TaALP under pathogen infection, illustrated that they could act as pathogen resistant proteins that

combat pathogen attack and assist plant survival under biotic stress. In our study, we hypothesized that

ALPs are composed of a few gene members that work synergistically during grain filling, which is

similar to the peptidase inhibitors of the defensin family (PR-12), which make up the third class of

continual up-regulated AMPs (318). In particular, these constitutively expressed genes are supposed to

contribute to non-host resistance (319). As was evident that most of the up-regulated cysteine-rich AMPs

124

in resistant wheat cvs. have shown expression values that were independent of the treatment (318), but

were lower or absent in the susceptible wheat cvs., which helps explains the differential transcripts

indicated by the FHB induced expression of TaALP genes in wheat cv. Mace and Spitfire (Table 1). It

is likely that ALPs, together with other AMPs, act synergistically in a generalized non-specific defence

providing a basal protection (264). AMPs transcribed at a constant level are known key components of

an immediate defence against invading pathogens, and many proteins are pathogen-inducible, for

example, in leaves were found to be constitutively present in storage tissues, such as seed (264). This

explains why wheat cv. Spitfire and the DH Line 241, which displayed high level expression of TaALP

at 7 DAP, can suppress infection much more quickly than wheat cv. Mace, which were induced later

(Table 1). Liu and others (304) described that genetically modified plants overexpressing certain

antifungal peptides, would provide a promising alternative to improve overall resistance to Fusarium

pathogen in wheat. Moreover, over-expressions of pathogen-inducible promoters directly targeting the

infection sites or the most vulnerable tissues provides an approach to reducing the pathogenesis of the

biotrophic F. graminearum fungi in colonized tissues (320). These possibilities illustrate that the

promoters of TaALP genes can be of research interest and that ALPs can be used as novel antifungal

peptides.

Variation in the amino acid sequences of the b-type proteins between the species suggest that they could

provide a source of variation for wheat improvement (91). Whether all the TaALP genes function

individually or collectively in conferring the observed broad-spectrum resistance is unknown.

Nevertheless, TaALP are discussed as candidates for an improved resistance strategy against grain-

infecting fungal pathogens and our results from RT-PCR analyses do not contradict these considerations.

Large scale Fusarium phenotyping (FHB index) indicated that resistance was associated with allelic

variation (bx-7AS allele) (Table 2). We propose that TaALP genes and their alleles are important in

Fusarium resistance and can be utilized in breeding programs. We think that breeding for the presence

of highly expressed TaALP genes can increase Fusarium resistance. Ov

4.5.5. ALPs inhibition hypothesis

ALPs has peptides possibly involved in myristylation, phosphorylation, or glycosylation, or act as

ligands of IG-MHC (Immunoglobulin major histocompatibility complex) (Figure 1B).

The synthesis of antimicrobial proteins is not restricted to plant species but seems to be ubiquitous in

nature (321). The mould Aspergillus giganteus secretes the antifungal protein Ag-AFP, which displays

inhibitory effects on the growth of phytopathogenic fungi (321). It is suggested that toxicity comes from

an interaction of positively charged sites of the small protein with negatively charged phospholipids of

susceptible fungal membranes (322). The outcomes of previous research indicated that pectin mythel

esterase (PME) genes code for enzymes that are involved in structural modifications of the plant cell

wall during plant growth and development (323). Some F. graminearum extracellular proteins,

including pectin-degrading oligogalacturonases, can act as elicitors of defence reactions (258). A

125

transgenic wheat line carrying a combination of a wheat β-1,3-glucanase and chitinase genes enhanced

resistance against F. graminearum (324). Recently published approaches such as, expression of a pectin

methyl-esterase inhibiting proteins (325) and polygalacturonase inhibiting proteins (PGIPs) (278), an

antifungal radish defensin (326), a truncated form of yeast ribosomal protein L3 (327) and a phytoalexin

Zealexin (328) have all shown to provide quantitative resistance against FHB. Defensins are a class of

PR proteins with structurally related small, highly basic, and cysteine-rich peptides, which display

broad-spectrum in vitro antifungal activities (329, 330). Maldonado et al. (220) demonstrated that LTPs,

members of the prolamin superfamily, could either be a co-signal or act as a translocator for release of

the mobile signal into the vascular system and/or chaperon the signal through the plant. Increased studies

suggest that LTPs may be active defense proteins as biological receptors of elicitins, and play a

significant role in activation of SAR mediated signalling pathways (221, 331, 332). Wheat contains

three different classes of proteinaceous xylanase inhibitors (XIs), i.e. Triticum aestivum xylanase

inhibitors (TAXIs) xylanase-inhibiting proteins (XIPs), and thaumatin-like xylanase inhibitors (TLXIs)

which are believed to act as a defensive barrier against phytopathogenic attack (277). The up-regulation

of thaumatin-like protein (TLP) is also observed, which can inhibit hyphal growth and/or spore

germination of various pathogenic fungi through a membrane permeability mechanism or through

degradation of fungal cell walls by β-1, 3 glucan binding and endo- β-1,3-glucanase activity (276).

Plant seeds, including cereal grains, contain numerous small protein inhibitors of proteinases

(241). Some are efficient inhibitors of subtilisin-/chymotrypsin-like proteinases from microbes of

insects, and it is more convincing now that they participate in an integrated broad spectrum defense

system against invading fungal or insect pests (333). In the yeast two hybrid study, we found that ALPs

are mostly like to interact with metacaspase (TaMCA4), which is a cysteine proteinase (Figure 4). In

wheat and barley, homologous cysteine proteinases with optimal activity slightly below pH 5 play a

central role in degradation of the prolamin storage proteins during germination (334). A highly possible

hypothesis is that, ALPs, with the special cysteine rich structure of gliadin domains, are similar to the

function of certain alpha-amylase inhibitors or serpins, and are likely to be toxic to fungal membranes.

Amylase inhibitors/serpins act as suicide substrate inhibitors against certain proteinases, and the reactive

centres of major serpins resemble the glutamine-rich repetitive sequences in prolamin storage proteins

(α-, γ-, and ω-gliadins and the LMW and HMW subunits of polymeric glutenin) of wheat grain (201,

335). ALPs, like the well-known serpins, as baits, are likely to attract the amylase/trypsin/serine

protease/cysteine aspartic protease by the glutamine-rich loops (mainly polyQs) between any of the four

alpha-helices, and by inhibiting the peptide hydrolysis process, that of the protease function can be

inhibited. Meanwhile. ALPs are also likely to have a weak interaction with N-myristoyltransferase

(TaNMT) (Figure 4), this results indicate that the myristolation events for ALPs are highly possible,

which lead to the PTM of certain ALPs. And most importantly, ALPs are able to interact with beta-

glucosidase of F. graminearum. As is known, pathogen beta-glucosidase are able to hydrolyse cell wall

126

components of host plants, the antifungal function of ALPs might suggest that they are able to inhibit

the beta-glucosidase activity.

The storage tissues of plant seeds are attractive host for many pathogens. Evolutionary adaptation of the

proteolytic system of some pathogen to efficient degradation of the abundant glutamine- and proline-

rich repetitive structures of the cereal grain prolamins seems likely to have occurred. Here we have

shown that the reactive centres of wheat grain ALPs contain unique glutamine-rich sequences

resembling repetitive sequences of other wheat prolamins. A working hypothesis for further studies to

elucidate the functions of the grain ALPs might be that the reactive centre loop sequences have evolved

into a complement of baits for irreversible inactivation of cysteine proteinases, etc. from infection fungal,

resulting in reduction of damage to seeds and thus in their increased survival.

4.5.6. Conclusions

For the first time, we report that a prolamin superfamily member gene that encodes a protein with gliadin

domains is involved in defense against F. graminearum. In silico analyses indicated the presence of

critical peptides in TaALPs that are active in the plant immune system. The promoter motif contains

abundant PR responsive motifs and hormone motifs. Expression levels of TaALP genes were

significantly up-regulated when induced by infection of the fungus F. graminearum. And bacterially

expressed ALPs displayed significant antifungal activity against wheat fungus F. graminearum in vitro.

Genome wide association study indicated that there were significant allelic effects of TaALP genes on

FHB indexes. For the first time, we have performed an in situ hybridization of TaALP genes in the

developing caryopses, and we found enriched transcripts in the transfer cells, aleurone, sub-aleurone

cells, and embryo of wheat caryopsis with significant FHB symptoms. In conclusion, we propose that

these TaALP genes fulfil a PR protein function and are involved in SAR.

127

5. Chapter 5 Discussion

5.1. Summary of Research Outcomes

Initially in this study, a few major protein families were characterized in relation to their environmental

background. Subsequently, more protein families were identified, and new roles were proposed for

them. ALPs represent a novel protein family which are attractive candidates as biotic stress resistant

wheat storage components. Our studies provided information of adaptations to different habitats and

assessed the relative importance of the evolutionary forces involved in differentiation. A total of 15

gene sequences of wheat a-type ALPs, b-type and c-type ALPs were obtained. We provided informative

molecular markers for gene mapping.

The diversity of ALPs in emmer wheat, T. dicoccoides, was studied by genotyping, sequencing, and

PCR in 411 individuals representing 21 populations of wild emmer from Israel (Chapter 2). The results

showed that the multiple TaALP gene loci, TaALP-bx-7AS, are rich in variation, have 25 alleles. Our

results suggested that at least part of the ALPs polymorphisms in wild emmer can be accounted for by

environmental factors, the endosperm of wild emmer contains many allelic variants of ALPs that are

not present in bread wheat, and these could be utilized in breeding varieties with better quality. We

established ALP alleles associate with environment (annual mean rainfall and soil type). These

associations suggest that ALP genotype diversity is non-random and acted on by natural selection as an

adaptive environmental strategy. Great diversity at ALP loci, both between and within populations, was

detected in the populations of Israeli wild emmer wheat. It was revealed that ALPs were naturally

selected for across populations by the expected ratio of dN/dS. The results of purifying selection and

sequences of TaALP genes were contributed by both natural selection and co-evolution, which ensures

the conserved function as well as the inhibition of attack by biotic challenges such as insects and fungal

pathogens. Ecological factors, singly or in combination, explained a significant proportion of the

observed gene variation. Conflicts between genetic divergence and geographic distance also suggested

that allelic variation of TaALP genes was subject to natural selection, and ecological factors had an

important evolutionary role in gene differentiation at the TaALP loci. Population and codon analysis

suggested ALPs are adaptively selected under different environments. ALP differentiation was highly

correlated with annual rainfall and soil type at the site of collection; although it is difficult to identify

the range selective agents acting on gene frequency. The sporadic and localized distribution of some

alleles of wild emmer are undoubtedly influenced by other physical and biotic factors that not considered

in this study.

Thirteen ALPs were individually characterized by HPLC, SDS-PAGE, MALDI-TOF, MS/MS peptide

sequencing. In the experiments, described in Chapter 3, we have unambiguously allocated RP-HPLC

128

peaks, SDS-PAGE bands, and MALDI-TOF Mr. of certain ALPs, which can serve as chromosome

markers and protein markers for qualitative values.

For the first time, we report that a prolamin superfamily member gene that encodes a protein with gliadin

domains is involved in defense against Fusarium graminearum (Chapter 4). The promoter motif

contains abundant PR responsive motifs and hormone motifs. Expression levels of TaALP genes were

significantly up-regulated when induced by infection of the fungus. When expressed in bacteria, TaALP

genes displayed significant inhibition of several wheat fungi. A genome-wide association study

indicated there were significant allelic effects of TaALP genes on FHB index alleviation. For the first

time, we performed an in situ hybridization of TaALP genes in the developing caryopse, and we found

enriched transcripts in the transfer cells, aleurone, sub-aleurone cells, and embryo of wheat caryopsis

with significant FHB symptoms. Certain TaALP genes are abundant at the early stages of development,

while some TaALP genes are expressed later. These two distinct expression patterns suggest their

involvement in slightly different functions: protecting the developing seed during early seed

development and during mature state, dormancy, and germination. Such induction patterns might relate

to the promoter differences observed for TaALP genes. We propose that these genes fulfil a PR protein

function and are involved in SAR. We provided evidence to support the hypothesis that TaALP genes

encode proteins with a gliadin domain (PF13016), that they could reduce protease activity of virulent

pathogens, and thereby reduce pathogen proliferation, and they play an important role in wheat defence

responses to F. graminearum infection.

5.2. Discussion and Future Research

Nevo et al. (181) was the first to show that the estimate of genetic distance was geographically

independent. Earlier findings of Nevo et al. (150) and Levy et al. (336) showed that the level of

polymorphisms for HMW-GS-encoding genes in T. dicoccoides was much higher than that of cultivated

bread wheats. In agreement with the HMW-GS encoding genes, TaALP genes bx-7AS showed a high

degree (56%) of inactivity (silent allele ratio) in emmer wheat, in contrast to the low frequency exhibited

by the diploid putative donor of the A genome (336). The processes of diploidization may cause gene

inactivation and gene-dosage compensation due to differential gene expression. Both processes have

occurred during the evolution of allopolyploid wheats in the wild and under cultivation, and these may

be responsible for the reduction in the number or activity of duplicated genes (336). Levy et al. (337)

reported that HMW-GS encoding gene activation, following diploidization, affected mainly the A

genome, and non-randomness was also evident in the order of diploidization.

The original environments in which the three haplotypes studied were collected varied considerably.

Haplotype TaALP-bx-7AS-g was from Yehudiyya, Tabigha-Terra, and Mt. Gerizm and it clustered with

TaALP-bx-7AS-s from Beit-Oren, Daliyya, and Mt. Hermon and TaALP-bx-7AS -t from J’aba and

129

Taiyiba, with dN/dS value of 0.45, suggesting that these three haplotypes evolved under strong purifying

pressure from the environment. Though dN/dS values were calculated on haplo-type clusters in the

phylogenetic analysis (Chapter 2), there is no conclusive proof of the direct adaptiveness of ALPs gene

polymorphism. If the phenotypic effect impacts survival and reproduction, natural selection operates on

SNP alleles. On the other hand, reduction of genetic variability among higher altitude populations could

be due to the prevailing environmental conditions experienced there because certain haplotypes were

selected while others were eliminated. Significant correlations (P < 0.05) were obtained between the

population genetic indices (Nei’s gene diversity and Shannon’s information index) for TaALP genes

and eight environmental variables, including geographical (altitude), temperature (mean annual

temperature, mean August temperature, mean January temperature), water availablity (mean annual

rainfall, mean annual evaporation) and edaphic (soil type) variables. It was shown that TaALP allelic

variations between different populations were more significantly correlated with the above mentioned

environmental variables than for other factors.

Other populations in the ‘Fertile Crescent’may have novel ALP genes that underly significant antifungal

properties. Plant at high and low altitude showed distinct forms (grassy and robust). Accessions tend to

be short and slender with fewer tillers at altitudes >900 m, whereas at lower altitude plants are tall, early-

maturing, and have large spikes, more tillers and more spikelets per spike (338). These phenotype

findings reflect our study of emmer wheat populations. There was a significant negative correlation

between population genetic indices of TaALP genes and altitude, suggesting a possible association

between ALPs polymorphism and phenotypical polymorphism. The altitude of collecting sites seems to

be an important criterion: populations collected at altitudes > 900 m were less polymorphic than those

at lower altitudes. Further research should be done to clarify the correlations between agronomic traits

and allelic variations of ALPs in emmer wheat accessions.

As discussed in Chapter 3, to accurately determine components of specific fractions of flour proteins,

it is desirable to separate and quantify the proteins by type. Ideally, the fractionation procedure should

be simple, suitable for small flour samples, maximize recovery of each protein type, and minimize cross-

contamination. Normally, proteins with comparable properties are differentiated from others because

they have similar solvent solubility values; proteins with similar functions are extracted together in the

same solvent. However, protein types that overlapping in solubility and extractability make quantitative

separation difficult. Our results will facilitate future studies on the biological function of various ALPs,

particulary accurate quantification of potential antifungal properties. Using the method described in our

experiments, different types of highly purified ALPs can be obtained and used for protein crystallization

and enzymatic activity testing, as well as F. graminearum inhibition assays. Protein purification and

structural modelling of each protein will lead to more accurate functional characterization. Protein

function will be more accurately determined when more information is accumulated on protein physio-

130

chemical properties including post-translation modification, mass spectra, and tertiary structure. The

IWGSC annotation of more proteins will yield more information on protein identification and proteomic

study. Gene cloning and protein analysis coupled with advancement in separation techniques will lead

to more rapid advances in gene characterization.

To understand the defence mechanisms of wheat grain ALPs, it is necessary to broaden the range of

pathogens and plant species under study. Future in vivo studies are required to validate protease

inhibition function and antifungal activity of ALPs. Gene editing using CRISPR-Cas systems could be

used to generate ALP knockouts, and investigate their impacts on pathogen management, or specifically

on FHB.

5.3. Conclusion

The approach to improve the quality of wheat by utilizing genes from primitive landraces and wild

relatives of bread wheat has long been exploited. Ecological-genetic factors are the key to understanding

ALP differentiation in wild emmer wheat. Wild emmer wheat harbours rich genetic resources and could

provide a host of novel genetic variants of wheat storage proteins for better adaptability and quality. The

range of allelic variation in the ALP loci of wild emmer is quite remarkable and it should be seen as a

potentially valuable resource for the improving the quality of modern wheat varieties, not only for better

bread-making qualities, but also for novel anti-fungal activities, notably in response to one of the most

serious pathogens of wheat internationally, F. graminearum.

131

Abbreviation

AAIs alpha-amylase inhibitors

AAI_LTSS α-amylase inhibitors, lipid transfer and seed storage protein families

ABA abscisic acid

ACN acetonitrile

ALPs avenin-like proteins

AFP antifungal protein

AMPs antimicrobial peptides

APS ammonium persulfate

Bifun_inhib/LTP/seed_sf bifunctional inhibitor/plant lipid transfer protein/seed storage helical

domains

CBB Coomassie Brilliant Blue

cDNA complementary DNA

CDS Coding DNA sequence

CTAB cethyltrimethyl ammonium bromide

C-terminus carboxy terminus

cv cultivar

DNA deoxynucleoside triphosphate

DH Double haploid

DAP Day after pollination

DTT Dithiothreitol

dN/dS nonsynonymous to synonymous mutations

E. coli Eschericia coli

EDTA ethylenediaminetetra-acetate acid disodium salt

EST Expressed sequence tag

ET ethylene

ETI effector-triggered immunity

FHB Fusarium head blight

FTIR Fourier-transform infrared spectroscopy

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GMP glutenin macropolymer

GSP grain softness proteins

GWAS genome wide association study

He Nei's gene diversity

HMW-GS High molecular weight glutenin subunits

HR hypersensitive response

I Shannon's information index

132

IPA/DTT Protocol 55% (v/v) propan-2-ol (IPA) and 2% (w/v) dithiothreitol (DTT)

IPTG Isopropyl β-D-1-thiogalactopyranoside

IWGSC International Wheat Genome Sequencing Consortium

JA Jasmonic Acid

KDa kilo-dalton

LMW-GS Low molecular weight glutenin subunits

LTP lipid transfer protein

MALDI-TOF matrix assisted laser desorption ionization-time of flight mass spectrometry

MBA bean agar plates

MCA metacaspase 4

ML maximum likelihood

MW molecular weight

NCBI National Center for Biotechnology Information

NJ Neighbour joining

NMW Nuclear magnetic resonance spectroscopy

NMT n-myristoyltransferase

RNA ribonucleic acid

ROS reactive oxygen species

Mr molecular mass

MW molecular weight

N-terminus amino terminus

PAMPs pathogen-associated molecular patterns

PCD programmed cell death

PCR polymerase chain reaction

PGIPs polygalacturonase inhibiting proteins

Pins puroindolines

PME pectin mythel esterase

PR1.1 pathogenesis-related protein

PTI PAMP-triggered immunity

PTM post-transcriptional modification

QRT-PCR quantitative reverse transcriptional polymerase chain reaction

RP-HPLC reversed phase High-performance liquid chromatography

SA salicylic acid

SA Sinapinic acid

SAR systemic acquired resistance

SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis

SD/-Leu-Trp selective double dropout/-leucine-tryptophan

133

TAXIs Triticum aestivum xylanase inhibitors

TEMED tetramethylethylenediamine

TF transcription factors

TFA trifluoroacetic acid

TGAC The Genome Analysis Centre

XIs xylanase inhibitors

XIPs xylanase-inhibiting proteins

TLXIs thaumatin-like xylanase inhibitors

TLP thaumatin-like protein

X-α-Gal 5-bromo-4-chloro-3-indoxyl-α-D-galactopyranoside

Y2H yeast two hybrid

8CM eight-cysteine motif

4VP 4-vinylpyridine

μLC-MS/MS liquid chromatography-tandem mass spectrometry

134

Appendices

Table 1. List of all the identified albumin/globulins proteins extracted by 0.5 M NaI form wheat cultivar Mace and Spitifre flour

Band

ID

Peak

ID Accession CDD Protein Species

1 5 gi|1149764070|XP_020147251.1 AAI_LTSS Gliadin 7dybs 7D/4A Aegilops tauschii

1 5 gi|338817619|P0CZ09.1 AAI_LTSS Gliadin 7dya 7D/4A Aegilops tauschii

2 5 gi|1149818154|XP_020167734.1 Ribosomal protein P1, P2, and L12p 60S acidic ribosomal protein P1-like 7B/7A/7D Aegilops tauschii

2 5 gi|567587371|AHC92627.1 AAI_LTSS Grain softness protein 5A/5B/5D Aegilops markgrafii

3 6 gi|567587377|AHC92630.1 AAI_LTSS Grain softness protein 5A/5B/5D Aegilops searsii

3 6 gi|123956|P16851.2

AAI_LTSS Alpha-amylase/trypsin inhibitor CM2 7A/7B/7D Triticum aestivum

4 10 gi|123957|P17314.1

AAI_LTSS Alpha-amylase/trypsin inhibitor CM3 4B Triticum turgidum

5 10 gi|963585809|ALT08042.1 AAI_LTSS Gliadin avenin-like protein 7D/4A Aegilops tauschii

6 11 gi|123957|P17314.1

AAI_LTSS Alpha-amylase/trypsin inhibitor CM3 4B Triticum turgidum

7 13 gi|474186084|EMS57915.1

AAI_LTSS Alpha/beta-gliadin MM1 6A/6B/6D Triticum uratu

8 13 gi|1131740502|APU92411.1

AAI_LTSS alpha-gliadin storage protein, partial 6A/6B/6D Triticum spelta

9 14 gi|166406979|ABY87439.1

AAI_LTSS Alpha-gliadin 6A/6B/6D Triticum turgidum subsp. paleocolchicum

10 14 gi|332071054|AED99850.1

Gliadin Alpha-gliadin 6A/6B/6D Triticum aestivum

11 14 gi|332071054|AED99850.1

Gliadin Alpha-gliadin 6A/6B/6D Triticum aestivum

12 15 gi|338817616|P0CZ07.1 AAI_LTSS avenin-like a2 7A Triticum aestivum

13 15 gi|306516653|ADM96155.1 AAI_LTSS Gliadin Alpha-gliadin storage protein 6A/6B/6D Aegilops tauschii

13 15 gi|7209265|CAB76964.1 AAI_LTSS Gliadin Alpha-gliadin 6A/6B/6D Triticum aestivum

13 15 gi|545793697|AGW80490.1 AAI_LTSS Gliadin Alpha-gliadin 6A/6B/6D Aegilops tauschii

14 16 gi|166406979|ABY87439.1 AAI_LTSS Gliadin Alpha-gliadin 6A/6B/6D Triticum turgidum subsp. paleocolchicum

14 16 gi|474186084|EMS57915.1

AAI_LTSS Alpha/beta-gliadin MM1 6A/6B/6D Triticum uratu


14 16 gi|260594502|ACX46516.1

Gliadin LMW-m glutenin subunit 1A/1B/1D Triticum aestivum

14 16 gi|154268818|ABS72146.1 AAI_LTSS Gliadin Alpha gliadin 6A/6B/6D Triticum aestivum

14 16 gi|4836441|AAD30440.1 AAI_LTSS Gliadin Gamma-gliadin 1A Triticum aestivum

15 16 gi|383210739|BAM08452.1

AAI_LTSS Alpha/beta-gliadin 6A/6B/6D Triticum aestivum

https://www.ncbi.nlm.nih.gov/protein/XP_020147251?report=genbank&log$=protalign&blast_rank=1&RID=3PWDATYR014

https://www.ncbi.nlm.nih.gov/protein/P0CZ09?report=genbank&log$=protalign&blast_rank=4&RID=3PWF3U4N014

https://www.ncbi.nlm.nih.gov/protein/XP_020167734?report=genbank&log$=protalign&blast_rank=1&RID=3SXHGKK7014

https://www.ncbi.nlm.nih.gov/protein/AHC92627?report=genbank&log$=protalign&blast_rank=1&RID=3PSAST6M014

https://www.ncbi.nlm.nih.gov/protein/AHC92630?report=genbank&log$=protalign&blast_rank=1&RID=3SYHFKF4014

https://www.ncbi.nlm.nih.gov/protein/P16851?report=genbank&log$=protalign&blast_rank=1&RID=3SXJTSGP015

https://www.ncbi.nlm.nih.gov/protein/P17314?report=genbank&log$=protalign&blast_rank=1&RID=3SZD982Y015

https://www.ncbi.nlm.nih.gov/protein/ALT08042?report=genbank&log$=protalign&blast_rank=1&RID=3SZPR0XV015

https://www.ncbi.nlm.nih.gov/protein/P17314?report=genbank&log$=protalign&blast_rank=1&RID=3SZD982Y015

https://www.ncbi.nlm.nih.gov/protein/EMS57915.1?report=genbank&log$=prottop&blast_rank=1&RID=3T02CZ9H015

https://www.ncbi.nlm.nih.gov/protein/APU92411.1?report=genbank&log$=prottop&blast_rank=1&RID=3T0DGYW7014

https://www.ncbi.nlm.nih.gov/protein/ABY87439.1?report=genbank&log$=prottop&blast_rank=1&RID=3T142ACT014

https://www.ncbi.nlm.nih.gov/protein/AED99850.1?report=genbank&log$=prottop&blast_rank=3&RID=3T1DY1T4014

https://www.ncbi.nlm.nih.gov/protein/AED99850.1?report=genbank&log$=prottop&blast_rank=3&RID=3T1MEHDE015

https://www.ncbi.nlm.nih.gov/protein/P0CZ07.1?report=genbank&log$=prottop&blast_rank=1&RID=3T1W4GF5014

https://www.ncbi.nlm.nih.gov/protein/ADM96155.1?report=genbank&log$=prottop&blast_rank=1&RID=3T3XMYAT014

https://www.ncbi.nlm.nih.gov/protein/CAB76964.1?report=genbank&log$=prottop&blast_rank=1&RID=3T6UP148015

https://www.ncbi.nlm.nih.gov/protein/AGW80490.1?report=genbank&log$=prottop&blast_rank=1&RID=3T74UG6D014


https://www.ncbi.nlm.nih.gov/protein/EMS57915.1?report=genbank&log$=prottop&blast_rank=1&RID=3T02CZ9H015

https://www.ncbi.nlm.nih.gov/protein/ADM96155.1?report=genbank&log$=prottop&blast_rank=1&RID=3T7U37XD015

https://www.ncbi.nlm.nih.gov/protein/ACX46516.1?report=genbank&log$=prottop&blast_rank=1&RID=3T7VTSXW014

https://www.ncbi.nlm.nih.gov/protein/ABS72146.1?report=genbank&log$=prottop&blast_rank=1&RID=3T83TXTD014

https://www.ncbi.nlm.nih.gov/protein/AAD30440.1?report=genbank&log$=prottop&blast_rank=3&RID=3T88FUZ0014

https://www.ncbi.nlm.nih.gov/protein/BAM08452.1?report=genbank&log$=prottop&blast_rank=1&RID=3T8SBTDB014

135



15 16 gi|112735209|ABI20696.1 AAI_LTSS Gliadin Omega-gliadin ?6A or 1B Triticum timopheevii


16 16 gi|7209265|CAB76964.1 AAI_LTSS Gliadin Alpha-gliadin 6A/6B/6D Triticum aestivum

16 16 gi|383210739|BAM08452.1

AAI_LTSS Alpha/beta-gliadin 6A/6B/6D Triticum aestivum

16 16 gi|401787294|AFQ13474.1 AAI_LTSS Gliadin Alpha-gliadin 6A/6B/6D Triticum aestivum

16 16 gi|332071054|AED99850.1 Gliadin Alpha-gliadin 6A/6B/6D Triticum aestivum

17 17 gi|89143128|CAJ32658.1 AAI_LTSS Gliadin putative avenin-like a precursor 7D Aegilops markgrafii

18 17 gi|1149777227|XP_020180381.1 AAI_LTSS Gliadin Uncharacterized protein 1A/1B Triticum aestivum






24 18 gi|260401177|ACX37114.1

Gliadin Gamma gliadin 1A/1B/1D Triticum aestivum


25 19 gi|363992662|AEW46836.1

Gliadin gamma prolamin 1A/1B/1D Secale cereale subsp. tetraploidum

26 19 gi|363992568|AEW46804.1

Gliadin Gamma prolamin 1A/1B/1D Taeniatherum caput-medusae

26 19 gi|209971887|ACJ03472.1 Gliadin Gamma-gliadin 1A/1B/1D Triticum aestivum

26 19 gi|209971873|ACJ03465.1

Gliadin Gamma-gliadin 1A/1B/1D Triticum aestivum

27 19 gi|260401177|ACX37114.1

Gliadin Gamma gliadin 1A/1B/1D Triticum aestivum

28 20 gi|474329936|EMS62569.1 AAI_LTSS Gliadin M8ANS4_TRIUA Avenin-3/Gamma-gliadin B 1A Triticum urartu

29 20 gi|326468323|ADZ76044.1 AAI_LTSS Gliadin Gama-gliadin 1A/1B/1D Triticum aestivum

30 20 gi|326468323|ADZ76044.1 AAI_LTSS Gliadin Gama-gliadin 1A/1B/1D Triticum aestivum

30 20 gi|363992600|AEW46820.1 AAI_LTSS Gliadin Gama-gliadin 1A/1B/1D Australopyrum retrofractum

31 20 gi|183229592|ACC60298.1

Gliadin Low molecular weight glutenin subunit 1A/1B/1D Triticum aestivum

31 20 gi|209972039|ACJ03532.1 AAI_LTSS Gliadin Gamma-gliadin 1A/1B/1D Aegilops bicornis



https://www.ncbi.nlm.nih.gov/protein/ABI20696.1?report=genbank&log$=prottop&blast_rank=1&RID=3T965G4K015


https://www.ncbi.nlm.nih.gov/protein/CAB76964.1?report=genbank&log$=prottop&blast_rank=1&RID=3T9VETDB014

https://www.ncbi.nlm.nih.gov/protein/BAM08452.1?report=genbank&log$=prottop&blast_rank=1&RID=3T8SBTDB014

https://www.ncbi.nlm.nih.gov/protein/AFQ13474.1?report=genbank&log$=prottop&blast_rank=1&RID=3TA3675R014

https://www.ncbi.nlm.nih.gov/protein/AED99850.1?report=genbank&log$=prottop&blast_rank=3&RID=3TAAMSP7015

https://www.ncbi.nlm.nih.gov/protein/CAJ32658.1?report=genbank&log$=prottop&blast_rank=1&RID=3TAJPMFF014

https://www.ncbi.nlm.nih.gov/protein/XP_020180381.1?report=genbank&log$=prottop&blast_rank=1&RID=3TBMZBV7015






https://www.ncbi.nlm.nih.gov/protein/ACX37114.1?report=genbank&log$=prottop&blast_rank=1&RID=3TD9NGA8014


https://www.ncbi.nlm.nih.gov/protein/AEW46836.1?report=genbank&log$=prottop&blast_rank=2&RID=3TFPUYF7014

https://www.ncbi.nlm.nih.gov/protein/AEW46804.1?report=genbank&log$=prottop&blast_rank=1&RID=3TFZDG3V014

https://www.ncbi.nlm.nih.gov/protein/ACJ03465.1?report=genbank&log$=prottop&blast_rank=4&RID=3TGBWT15014

https://www.ncbi.nlm.nih.gov/protein/ACX37114.1?report=genbank&log$=prottop&blast_rank=1&RID=3TD9NGA8014

https://www.ncbi.nlm.nih.gov/protein/EMS62569.1?report=genbank&log$=prottop&blast_rank=1&RID=3TGND26H014

https://www.ncbi.nlm.nih.gov/protein/ADZ76044.1?report=genbank&log$=prottop&blast_rank=1&RID=3TGZTZB0014

https://www.ncbi.nlm.nih.gov/protein/ADZ76044.1?report=genbank&log$=prottop&blast_rank=1&RID=3TGZTZB0014

https://www.ncbi.nlm.nih.gov/protein/AEW46820.1?report=genbank&log$=prottop&blast_rank=1&RID=3THBFA0B015

https://www.ncbi.nlm.nih.gov/protein/ACC60298.1?report=genbank&log$=prottop&blast_rank=11&RID=3THSGTFC015

https://www.ncbi.nlm.nih.gov/protein/ACJ03532.1?report=genbank&log$=prottop&blast_rank=1&RID=3THVTGCR014

136

32 22 gi|209971943|ACJ03500.1

Gliadin Gamma-gliadin protein 1A/1B/1D Triticum urartu


34 23 gi|260401173|ACX37112.1 AAI_LTSS Gliadin Gamma-gliadin 1A/1B/1D Triticum aestivum



2 8 gi|1149764070|XP_020147251.1 AAI_LTSS Gliadin Farinin protein 7D/4A Aegilops tauschii


4 9 gi|1149764070|XP_020147251.1 AAI_LTSS Gliadin Farinin protein 7D/4A Aegilops tauschii



6 10 gi|1149764050|XP_020147242.1 AAI_LTSS Gliadin avenin-like a5 Aegilops tauschii subsp. tauschii


8 11 gi|1149764070|XP_020147251.1 AAI_LTSS Gliadin Farinin protein Aegilops tauschii


10 13 gi|195957140|ACG59281.1 AAI_LTSS WHEAT Major allergen CM16 4B Triticum aestivum

10 13 gi|963585809|ALT08042.1 AAI_LTSS Gliadin avenin-like protein Aegilops tauschii

11 14 gi|227809332|ACP40908.1 AAI_LTSS Dimeric alpha-amylase inhibitor 3A/3B/3D Eremopyrum bonaepartis


12 15 gi|1149827963|XP_020171299.1 AAI_LTSS alpha-amylase inhibitor 3A/3B/3D Aegilops tauschii subsp. tauschii



14 17 gi|1149705314|XP_020178784.1 Soybean trypsin inhibitor (Kunitz) endogenous alpha-amylase/subtilisin inhibitor 2A/2B/2D Aegilops tauschii

14 17 gi|338817618|D2KFH1.1 AAI_LTSS Gliadin avenin-like a4 Triticum aestivum




18 19 gi|338817620|P0CZ10.1 AAI_LTSS Gliadin avenin-like a5 Triticum aestivum

19 20 gi|338817620|P0CZ10.1 AAI_LTSS Gliadin Avenin-like a6 Triticum aestivum



22 24 gi|123957|P17314.1 AAI_LTSS Alpha-amylase/trypsin inhibitor CM3 4B Triticum turgidum

https://www.ncbi.nlm.nih.gov/protein/ACJ03500.1?report=genbank&log$=prottop&blast_rank=13&RID=3TJ997G0015

https://www.ncbi.nlm.nih.gov/protein/ACX37112.1?report=genbank&log$=prottop&blast_rank=1&RID=3TJNWDZR015







https://www.ncbi.nlm.nih.gov/protein/XP_020147242?report=genbank&log$=protalign&blast_rank=3&RID=3U575ZMJ014




https://www.ncbi.nlm.nih.gov/protein/ACG59281.1?report=genbank&log$=prottop&blast_rank=1&RID=3U6X8TFC014


https://www.ncbi.nlm.nih.gov/protein/ACP40908.1?report=genbank&log$=prottop&blast_rank=1&RID=3U7BYU4B015


https://www.ncbi.nlm.nih.gov/protein/XP_020171299.1?report=genbank&log$=prottop&blast_rank=1&RID=3U7NMYYG014



https://www.ncbi.nlm.nih.gov/protein/XP_020178784.1?report=genbank&log$=prottop&blast_rank=1&RID=3VN9Y15S01R

https://www.ncbi.nlm.nih.gov/protein/D2KFH1?report=genbank&log$=protalign&blast_rank=1&RID=3W8S8HME014

https://www.ncbi.nlm.nih.gov/protein/ALT08048?report=genbank&log$=protalign&blast_rank=1&RID=3VW5XGKC015



https://www.ncbi.nlm.nih.gov/protein/P0CZ10.1?report=genbank&log$=prottop&blast_rank=1&RID=3WBS73VK015

https://www.ncbi.nlm.nih.gov/protein/P0CZ10.1?report=genbank&log$=prottop&blast_rank=1&RID=3WBS73VK015



137

22 24 gi|338817616|P0CZ07.1 AAI_LTSS avenin-like a2 Triticum aestivum




26 28 gi|1121486973|APP89575.1

thioredoxin (TRX)-like WHEAT Protein disulfide-isomerase 4B/4A Triticum aestivum

26 28 gi|89143128|CAJ32658.1 AAI_LTSS Gliadin putative avenin-like a precursor Aegilops markgrafii





31 8 gi|567587371|AHC92627.1 AAI_LTSS Grain softness protein Aegilops markgrafii








38 15 gi|122232330|Q2A783.1 AAI_LTSS Gliadin Avenin-like b1 Triticum aestivum





43 20 no ID yet AAI_LTSS Gliadin avenin-like a Triticum aestivum


45 21 gi|1149781747|XP_020153704.1 AAI_LTSS Gliadin alpha-amylase/trypsin inhibitor CM3 4B Triticum aestivum

46 21 no ID yet AAI_LTSS Gliadin Avenin-like a Triticum aestivum

47 22 gi|338817616|P0CZ07.1 AAI_LTSS Gliadin avenin-like a2 Triticum aestivum




51 24 gi|89143128|CAJ32658.1

AAI_LTSS putative avenin-like a precursor Aegilops markgrafii





https://www.ncbi.nlm.nih.gov/protein/APP89575.1?report=genbank&log$=prottop&blast_rank=3&RID=3VYV77RX015






https://www.ncbi.nlm.nih.gov/protein/AHC92627?report=genbank&log$=protalign&blast_rank=1&RID=3PSAST6M014








https://www.ncbi.nlm.nih.gov/protein/Q2A783?report=genbank&log$=protalign&blast_rank=4&RID=3W9T9H3U01R





https://www.ncbi.nlm.nih.gov/protein/XP_020153704?report=genbank&log$=protalign&blast_rank=2&RID=3WAWNT9T01R





138


53 25 gi|89143128|CAJ32658.1


54 25 gi|89143128|CAJ32658.1


55 26 gi|89143128|CAJ32658.1


56 28 gi|474329936|EMS62569.1 AAI_LTSS Gliadin M8ANS4_TRIUA Avenin-3/Gamma-gliadin B 1A Triticum urartu





https://www.ncbi.nlm.nih.gov/protein/EMS62569.1?report=genbank&log$=prottop&blast_rank=1&RID=3WEBJEP6015

139

Table 2 Reagents and resources used in this study

Reagent or Resource Source Identifier

Fungal Strains

Fusarium graminearum Curtin University

Biological samples

Wheat varieties: Spitfire This paper

Wheat varieties: Mace This paper Wheat varieties: Spitfire×Mace DH line 241 This paper Chemicals, Peptides, and Recombinant Proteins

His-TaALPa-7D4 This paper

His-TaALPa-7D3 This paper His-TaALPb-7A5 This paper His-TaALPb-4A6 This paper His-TaALPb-7D5 This paper His-TaALPb-7D5s This paper His-TaALPc-7A This paper Critical Commercial Assays

TRIzol® Reagent Thermo Fisher Cat.#15596026

SensiFAST™ cDNA Synthesis Kit Bioline Cat.# BIO-65053

SensiFAST™ SYBR® No-ROX Kit Bioline Cat.#BIO-98005

pGEM®-T Easy Vector Systems

Promega

Corporation Cat.#A1360

GoTaq® G2 Green Master Mix

Promega

Corporation Cat.# M7822

Insitu hybridization

PSPT19

PSPT19-7dya This paper PSPT19-7ayb This paper T7 RNA Polymerase Sigma-Aldrich Cat.#10881767001

DIG RNA Labeling Kit (SP6/T7) Sigma-Aldrich Cat.#11175025910

Experimental Models: Organisms/Strains

Escherichia coli BL21 (DE3) codon plus Takara

Cat.#D90120-

9125

Bacterial Strain JM109 Clontech Cat.#P9751

Recombinant DNA

Plasmid: pet 30a

Plasmid: pet 11d Plasmid: pet 28a (+)

Y2h

Yeast Synthetic Drop-out Medium Supplements Sigma-Aldrich Cat.# Y1376



Yeast Nitrogen Base Without Amino Acids Sigma-Aldrich Cat.# Y0626

5-Bromo-4-chloro-3-indolyl α-D-

galactopyranoside Sigma-Aldrich

Cat.# 16555-

25MG

Matchmaker Gold Yeast Two-Hybrid System Clontech Takara Cat.# 630489

S.cerevisiae Y2HGold Clontech Takara S.cerevisiae Y187 Clontech Takara pGBKT7 Clontech Takara

140

pGADT7 Clontech Takara pGBKT7-53 Clontech Takara pGADT7-T Clontech Takara pGBKT7-Lam Clontech Takara pGBKT7-4aya This paper pGBKT7-7dya This paper

pGBKT7-7dybs This paper pGADT7-mca This paper pGADT7-nmt This paper BIFC recombinant

SPYCE

SPYNE SPYNE-4aya This paper SPYNE-7dya This paper SPYNE-7dybs This paper SPYCE-mca This paper SPYCE-nmt This paper

Table 3. List of primers used in this study

Primer

Target

gene/EST Sequence (5'→3')

7aybFshort: 7ayb GCTCAATTGGAAACCATTTGTAACA

7aybRshort: ATTGTCTTGCACCGGGTTTGATT

4aybFS: 4ayb TGTAGCCCAGTCGTAACACCATTCT

4aybRS1: ATTCTTGTTGGGGCTGTTGTTGAC

4aybRS2: TGTTGTTGTTGTCGCCCAAGTAGA

7DybFS: 7dyb AGAACAAGTCCTGTGCAAAGCCATA

7DybRS: TGCCTGATAGACTCTACCACATTACGA

7DxbFS: 7dxb CATTTAGCCAGTGCTTTGGACAGTC

7DxbRS: TGTTGAATGATAGCCTCTACCACGA

7dc: AGACTCATACACCGCTACACCT

4ayaFS: 4aya CATATTTGCAGTCTCAGATGTGGCG

4ayaRS: GTTGTAGGGGGTCTGAGTGATGGTC

NMT F nmt TCAACTTCCTCTGCGTCC

NMT R TGTCCACCACATCCTCCT

Taact77F actin TCCTGTGTTGCTGACTGAGG

Taact312R GGTCCAAACGAAGGATAGCA

Taxi III 170F taxi GTCCACGTGCGAGGGTAGT

Taxi III 5R CG GGTGTTCTCCACTTTGAT

PR-1.1 F PR1 ACTACGACTACGGGTCCAACA

PR-1.1 R TCGTAGTTGCAGGTGATGAAG

TaMCA4 712F MCA TCAATCCGGCTGACTCTGTT

TaMCA4 994R CACTGATGAGGATGCCGTTG

7DF 7dxa CTAGCCACTATGAAGACCATGTTCC

7DSR1: GAAGCACCATCCTCATTATCTCG

7DS2F 7dya CTCGCGGCGACTAGCGTC

7DS2R ATGACCTGGGCCACACCG

7AF 7axa CTAGCCACTATGAAGACCATGTTCA

7AS1R TGACTGGACTTATGGTGTCTGGA

7AF 7aya CTAGCCACTATGAAGACCATGTTCA

AVNLA-7AR2 CTACTCAACAACGATTTTAGCAGGT

141

4AF GATTGTATCCAGCCACTATGAAGAA

4AL2F AGCAGTCTCGTTGTCAGGCG

AVNLA-R ACGGTGATCGATCTAGCTAGC


ALP4AL1R Kauz GATTTATGCCACGCTACAGACC


ALP4AL2R: Westonia CACATCTTAGCAGACACCACCG

7dc F 7dc GGATCCTTAGACATCATGAAGACCTTG

7dc R AAGCTTAGACTCATACACCGCTACACCT

7ac F 7ac GGATCCTTAGACATCATGAAGACCTTG

7ac R AAGCTTACATTGACTCACAGACCCATC

4ac F 4ac GGATCCTTAGACATCATGAAGACCTTG

4ac R AAGCTTAGAGTCATCAACCGTCAATTC

TaALPb-7axF: 7axb TGCAGCAGCTTAGCAGCTGCCAT

TaALPb-7axR: GCTGGTAGGCTGATCCACCGGA

4axb F 4axb AACGACAGTTGGTGGAGGAGATAAG

4axb R ATTGTTGTTGCTGCTGGCATTGTAT

Construct

7ay-bF: 7ayb GGATCCCTAGCAACCATGAAGACA

7ay-bR: AAGCTTATTGATCAACTAGCAGGTACCAC

7dx-aF: GGATCCATGAAGACCATGTTCCTC

7dx-aR: AAGCTTCATCACAGATCTTAGCAGGC

7dy-aF: GGATCCACTATGAAGACCATGTTG

7dy-aR1: AAGCTTATCGGTCTAGTTAGCGCAT

7dy-aR2: AAGCTTGTTAGCGCATCACAGACC

7ay-aF: GGATCCCTAGCCACTATGAAGACCA

7ay-aR1: AAGCTTATCGATCTAGTCAGCGCAA

7ay-aR2: AAGCTTTAGTCAGCGTAACACCGATT

7dc F GGATCCTTAGACATCATGAAGACCTTG

7dc R AAGCTTAGACTCATACACCGCTACACCT

7ac F GGATCCTTAGACATCATGAAGACCTTG

7ac R AAGCTTACATTGACTCACAGACCCATC

4ac F GGATCCTTAGACATCATGAAGACCTTG

4ac R AAGCTTAGAGTCATCAACCGTCAATTC

optimized 7dyb

7dybF: short CATATGTGGAATGAACCGCAGCAAG

7dybR: GGATCCTTAACAGGTGCCATCGGTATA

F: 7dyb GGATCCAGCCTCAACAACAATAGAAT

R: AAGCTTCTAGCAGGTACCATCGTTA

Y2H

ALPa F: TCTAAACCATGGTTGCGCAGCTGGACAC

ALPa R: TCTAAAGGATCCTTAGCAGGTACCACCAAC

ALP4axb F CATATGTTCGAAACCACATGTAGCCAGG

ALP4axb R GGATCCCTAGCATGCACCACTAGTGCAGGTA

7dybF: short CATATGTGGAATGAACCGCAGCAAG

7dybR: GGATCCTTAACAGGTGCCATCGGTATA

mca ndeI F1: CATATGTCAACTGCTACGATGGGCCGCAAGCT

mca bamHi R2: GGATCCCAACGTCAATCCATGTTTCAGCAGAT

NMT nde I F1 CATATGGATCCAGCCCTCCCCACCG

NMT bamhI R2 GGATCCTCCTGAGCCTCGACCACCCTATA

142

BIFC

ALPSa_F2 TCTAAATCTAGACATGCGCAGCTGGACAC

ALPSa_R2 TCTAAAGGATCCGTAGCAGGTACCACCAAC

7dyb_Fxba TCTAGATCATATGCAGCTGGAAACCATTTGTA

7dybs_Fxba TCTAGAGTGGAATGAACCGCAGCAAG

7dybs_Rbam GGATCCGTAACAGGTGCCATCGGTATA

nmt_F1xba TCTAGACGATCCAGCCCTCCCCACCG

nmt_R2bam GGATCCTCCTGAGCCTCGACCACCATATA

mca_F1xba TCTAGAAACTGCTACGATGGGCCGCAAGCT

mca_R2bam GGATCCACGACAATCCATGTTGTAGCAGAT

recombinant

ALPa F: Nco I 4aya 7dya TCTAAACCATGGTTGCGCAGCTGGACAC

ALPa R: BamHI TCTAAAGGATCCTTAGCAGGTACCACCAAC

ALP4axb F NdeI 4axb CATATGTTCGAAACCACATGTAGCCAGG

ALP4axb R BamHI GGATCCCTAGCATGCACCACTAGTGCAGGTA

ALP4axb F NdeI 7ayb CATATGTTCGAAACCACATGTAGCCAGG

7ay-bR: HindIII AAGCTTATTGATCAACTAGCAGGTACCAC

7dybF: NdeI short CATATGTGGAATGAACCGCAGCAAG

7dybR:BamHI GGATCCTTAACAGGTGCCATCGGTATA

ALPa F: Nco I 7ac TCTAAACCATGGTTGCGCAGCTGGACAC

7ac R HindIII AAGCTTACATTGACTCACAGACCCATC

7dybF new Nco I CCATGGAACAGCTGGAAACCATTTGTA

7dybR: BamHI GGATCCTTAACAGGTGCCATCGGTATA

7dybsF new Nco I CCATGGAATGGAATGAACCGCAGCAAG

7dybR: BamHI GGATCCTTAACAGGTGCCATCGGTATA

insitu

hybridization

7ay-bF: BamHI 7ayb GGATCCCTAGCAACCATGAAGACA

7ay-bR: HindIII AAGCTTATTGATCAACTAGCAGGTACCAC

7dy-aF: BamHI 7dya GGATCCACTATGAAGACCATGTTG

7dy-aR1:HindIII AAGCTTATCGGTCTAGTTAGCGCAT

EMSI

TGA_bZIPF1 471: GGATCCTCGGCTTGGAGGTCGAGGATG

TGA_bZIPF2 477: GGATCCTGGAGGTCGAGGATGGAGGAGG

TGA_bZIPR1

2058: GAATTCAGTTCCAAGATACATTTGAATCAGTAGGC

TGA_bZIPR2

2062: GAATTCAGGTTAGTTCCAAGATACATTTGAATCAGT

ALPs PF1 GTGATGAGTCATATGGATTATCGAGGTC

ALPs PR1 CCAATCTTGGATGGTCGTCAAATATAC

ALPs PF2 CGCAAGCTGACTGATATCTACACGAT

ALPs PR2 TAGGTGGCGCTACAAGTCCAATCT

ALPs PF3 AGTATATTTGACGACCATCCAAGATTG

ALPs PR3 GCTTTTGCGTGCTTTTCCAACTGA

ALPs gene cloning

type b

ALP_B_7DF ATGAAGGTCTTCATCCTGGCT

ALP_B_F1 AGGTCTTCATCCTGGCTCT

ALP-B_F2 AGGTCTTCATCCTGGCTCTCC

ALP-B_7AR2 CTACTACGCACCAACAGGCTAA

143

ALP-B_4AR2 GACCATCTACCATTCACCACT

ALP_B_R TGCCTCAGATGATGATGTATG

ALP_B_F3 TTCAGACAACCACAAACAACACAG

ALP_B_R3 CATTTTTATCTTGCCACCGCTA

type a

7DS2F 7dya CTAGCCACTATGAAGACCATGTTGA

7DS2R AGCAGATACCACCCACACAGTTAGT

7AF 7aya CTAGCCACTATGAAGACCATGTTCA

AVNLA-7AR2 CTACTCAACAACGATTTTAGCAGGT

AVNLA-F ACATAAACACCAAAGCAAACTTATA


AVNLA-R 4axa ACGGTGATCGATCTAGCTAGC

ALP4AL1F ATAGCATACTAATAGCCAGCCACC

ALP4AL1R GATTTATGCCACGCTACAGACC

7AF CTAGCCACTATGAAGACCATGTTCA

ALP4AL2R CACATCTTAGCAGACACCACCG

4AL3R CTATCACATCACAGACCTTAGCAGA


Synthesized DNA sequences

>7dybs

CATATGTGGAATGAACCGCAGCAAGAAGCACATCTGAAAAGCATGCGTATGAGCCTGCA

GACCCTGCCGAGCATGTGTAACATTTATGTTCCGGTTCAGTGCCAGCAACAGCAACAACT

GGGTCGTCAACAACAACAGCAGCTGCAAGAACAGCTGAAACCTTGTGCAACCTTTCTGCA

GCATCAATGCCGTCCGATGACCGTTCCGTTTCCTCATACACCGGTTCAGAAACCGACCAG

CTGCCAGAATGTTCAGAGCCAGTGCTGCCGTCAACTGGCACAGATCCCTGAACAGTTTCG

TTGTCAGGCAATTCATAATGTGGTTGAAAGCATTCGCCAGCAGCAGCATCACCAGCCTCA

GCAAGAAGTTCAGCTGGAAGGTCTGCGTATGTCACTGCATACACTGCCTTCAATGTGCAA

AATCTATATTCCGGTGCAGTGTCCTGCGACCACCACCACACCGTATAGCATTACCATGAC

CGCAAGCTATACCGATGGCACCTGTTAAGGATCC

>YJ-7Dyb

CATATGCAGCTGGAAACCATTTGTAGCCAAGGTTTTGGTCAGTGTCAGCATCATCAGCAG

CTGGGTCAGCAGCAACTGCTGGATCAGATGAAACCGTGTGTTGCATTTGTTCAGCATCAG

TGTAGTCCGGTTCGTACCCCGTTTCCGCAGACACGTGGTGAACAGCATAGCAGCTGTCAG

ACCGTGCAGCACCAGTGTTGTCGTCAGCTGGTTCAGATTCCGGAACAGGCACGTTGTAAA

GCAATTCAGAGCGTTGAAGAAGCAATTATTCAGCAGCAGCCACAGCAGCAGTGGAATGA

ACCGCAGCAAGAAGCACATCTGAAAAGCATGCGTATGAGCCTGCAGACCCTGCCGAGCA

TGTGTAACATTTATGTTCCGGTTCAGTGCCAGCAACAGCAACAACTGGGTCGTCAACAAC

AACAGCAGCTGCAAGAACAGCTGAAACCTTGTGCAACCTTTCTGCAGCATCAATGCCGTC

CGATGACCGTTCCGTTTCCTCATACACCGGTTCAGAAACCGACCAGCTGCCAGAATGTTC

AGAGCCAGTGCTGCCGTCAACTGGCACAGATCCCTGAACAGTTTCGTTGTCAGGCAATTC

ATAATGTGGTTGAAAGCATTCGCCAGCAGCAGCATCACCAGCCTCAGCAAGAAGTTCAG

144

CTGGAAGGTCTGCGTATGTCACTGCATACACTGCCTTCAATGTGCAAAATCTATATTCCG

GTGCAGTGTCCTGCGACCACCACCACACCGTATAGCATTACCATGACCGCAAGCTATACC

GATGGCACCTGTTAAGGATCC

Table 4 ALPs marker screening for 35 wheat vultivars

Cultivar name 7axb 7ayb 4axb 4ayb 4axa 4aya

annuello - - C C k -

bolac + - B - w C

baxter + L B C k C

bonnie rock - - C C w C

chara + L C C k -

corack - L C C w -

cobra - - C C w -

crusader - L C C k -

cunningham + L C C k -

derrimut - - B C w -

ellison - - B C w C

elmore + L C C k -

emu rock + L C - k C

frame + - B - w -

greygogy + L C C w C

hartog + L C C w C

Janz - - C C k -

katana + - C - w -

kennedy - L C - k C

lang - L C C k -

lincoln - L C C k C

livingston - L C C k C

mace - L C - w C

maggenta + - C C k -

sapphire - L C C k -

scout + - C C k C

spitfire + L C C k C

suntop - L C C k C

sunco - L C C k -

sunvale - L C C k C

wallup - L C C w C

westonia - L C C w C

wylketchem - L C C w C

yitpi + L C C w C

CS - L C C K C

Pair allele frequency

(%)

41.18 32.35 14.71 17.65 55.88 44.12

58.82 67.65 85.29 82.35 44.12 55.88

Bibliography

1. Z. ŠRAMKOVÁ, E. GREGOVÁ, E. ŠTURDÍK, Genetic improvement of wheat- a

review. Nova Biotechnologica 9, 27-51 (2009).

2. B. Curtis, "Wheat in the world. Bread wheat: Improvement and production," (2002).

3. I. K. Vasil, Molecular genetic improvement of cereals: transgenic wheat (Triticum

aestivum L.). Plant Cell Rep 26, 1133-1154 (2007).

145

4. P. P. Jauhar, T. S. Peterson, Synthesis and characterization of advanced durum wheat

hybrids and addition lines with Thinopyrum chromosomes. Journal of heredity 104,

428-436 (2013).

5. P. R. Shewry et al., Natural variation in grain composition of wheat and related cereals.

Journal of agricultural and food chemistry 61, 8295-8303 (2013).

6. P. R. Shewry, Wheat. Journal of Experimental Botany 60, 1537-1553 (2009).

7. J. Dubcovsky, J. Dvorak, Genome plasticity a key factor in the success of polyploid wheat

under domestication. Science 316, 1862-1866 (2007).

8. P. Gepts, R. Papa, Evolution during domestication. eLS, (2002).

9. M. Feldman, Wheats. Evolution of crop plants, (1995).

10. S. Barak, D. Mudgil, B. S. Khatkar, Biochemical and Functional Properties of Wheat

Gliadins: A Review. Critical reviews in food science and nutrition 55, 357-368 (2015).

11. P. Gélinas, C. M. McKinnon, Effect of wheat variety, farming site, and bread‐baking on

total phenolics International journal of food science & technology 41, 329-332 (2006).

12. L. Stevenson, F. Phillips, K. O'sullivan, J. Walton, Wheat bran: its composition and

benefits to health, a European perspective. International journal of food sciences and

nutrition 63, 1001-1013 (2012).

13. C. M. Liyana-Pathirana, F. Shahidi, The antioxidant potential of milling fractions from

breadwheat and durum. J Cereal Sci 45, 238-247 (2007).

14. N. Mateo Anson, R. van den Berg, R. Havenaar, A. Bast, G. RMM Haenen, Ferulic acid

from aleurone determines the antioxidant potency of wheat grain (Triticum aestivum

L.). Journal of Agricultural and Food Chemistry 56, 5589-5594 (2008).

15. M. Vaher, K. Matso, T. Levandi, K. Helmja, M. Kaljurand, Phenolic compounds and the

antioxidant activity of the bran, flour and whole grain of different wheat varieties.

Procedia Chemistry 2, 76-82 (2010).

16. W. H. Vensel et al., Developmental changes in the metabolic protein profiles of wheat

endosperm. Proteomics 5, 1594-1611 (2005).

17. T. B. Osborne, The protein of the wheat kernel. (Carnegie Institute: Washington, DC.,

1907), vol. Publication No. 84.

18. P. R. Shewry, N. G. Halford, Cereal seed storage proteins: structures, properties and role

in grain utilization. J Exp Bot 53, 947-958 (2002).

19. P. L. Weegels, A. M. van de Pijpekamp, A. Graveland, R. J. Hamer, J. D. Schofield,

Depolymerisation and Re-polymerisation of Wheat Glutenin During Dough Processing.

I. Relationships between Glutenin Macropolymer Content and Quality Parameters. J

Cereal Sci 23, 103-111 (1996).

20. P. I. Payne, Genetics of wheat storage proteins and the effect of allelic variation on bread-

making quality. Annual Review of Plant Physiology 38, 141-153 (1987).

21. P. R. Shewry, A. S. Tatham, The prolamin storage proteins of cereal seeds: structure and

evolution. Biochem J 267, 1-12 (1990).

22. F. MacRitchie, Evaluation of contributions from wheat protein fractions to dough mixing

and breadmaking. J Cereal Sci 6, 259-268 (1987).

23. P. R. Shewry, A. S. Tatham, F. Barro, P. Barcelo, P. Lazzeri, Biotechnology of

breadmaking: unraveling and manipulating the multi-protein gluten complex.

Bio/technology 13, 1185-1190 (1995).

24. M. M. Falcão-Rodrigues, M. Moldão-Martins, M. L. Beirão-da-Costa, Thermal

properties of gluten proteins of two soft wheat varieties. Food Chemistry 93, 459-465

(2005).

25. H. Wieser, Chemistry of gluten proteins. Food microbiology 24, 115-119 (2007).

146

26. B. S. Khatkar, R. J. Fido, A. S. Tatham, J. D. Schofield, Functional properties of wheat

gliadins: 1. Effects on mixing characteristics and bread making quality. J Cereal Sci 35,

299-306 (2002a).

27. F. Ortolan, C. J. Steel, Protein Characteristics that Affect the Quality of Vital Wheat

Gluten to be Used in Baking: A Review. Comprehensive Reviews in Food Science and

Food Safety 16, 369-381 (2017).

28. W. Grosch, H. Wieser, Redox Reactions in Wheat Dough as Affected by Ascorbic Acid.

Journal of cereal science 29, 1-16 (1999).

29. H. Wieser, The use of redox agents. Bread Making: Improving Quality, 424-446 (2003).

30. K. A. Tilley et al., Tyrosine cross-links: Molecular basis of gluten structure and function.

Journal of Agricultural and Food Chemistry 49, 2627-2632 (2001).

31. M. Piber, P. Koehler, Identification of dehydro-ferulic acid-tyrosine in rye and wheat:

Evidence for a covalent cross-link between arabinoxylans and proteins. Journal of

Agricultural and Food Chemistry 53, 5276-5284 (2005).

32. H. Wieser, W. Bushuk, F. MacRitchie, The polymeric glutenins. Gliadin and Glutenin:

The Unique Balance of Wheat Quality, 213-240 (2006).

33. B. S. Khatkar, R. J. Fido, A. S. Tatham, J. D. Schofield, Functional properties of wheat

gliadins: 2. Effects on dynamic rheological properties of wheat gluten. J Cereal Sci 35,

307-313 (2002b).

34. B. S. Khatkar, A. E. Bell, J. D. Schofield, The dynamic rheological properties of glutens

and gluten subfractions from wheats of good and poor bread-making quality. J Cereal

Sci 22, 29-44 (1995).

35. A. Schiraldi, L. Piazza, D. Fessas, M. I. Riva, Handbook of thermal analysis and

calorimetry from macromolecules to man. R. B. E. Kemp, Ed., (Amsterdam: Elsevier,

1999), vol. 4.

36. C. Wrigley, K. Shepherd, Electrofocusing of grain proteins from wheat genotypes. Annals

of the New York Academy of Sciences 209, 154-162 (1973).

37. P. R. Shewry, A. S. Tatham, J. Forde, M. Kreis, B. J. Miflin, The classification and

nomenclature of wheat gluten proteins- A reassessment. J Cereal Sci 4, 97-106 (1986).

38. C. Hsia, O. Anderson, Isolation and characterization of wheat ω-gliadin genes.

Theoretical and Applied Genetics 103, 37-44 (2001).

39. D. D. Kasarda, J. E. Bernardin, C. C. Nimmo, WHEAT PROTEINS. Adv in Cereal Sci

and Technol 1, 158-236 (1976).

40. D. D. Kasarda, J. C. Autran, E. J. L. Lew, C. C. Nimmo, P. R. Shewry, N-terminal amino

acid sequences of ω-gliadins and ω-secalins. Implications for the evolution of prolamin

genes. Biochimica et Biophysica Acta (BBA)/Protein Structure and Molecular 747, 138-

150 (1983).

41. H. Altenbach, V. A. Eremeev, N. F. Morozov, On equations of the linear theory of shells

with surface stresses taken into account. Mech. Solids 45, 331-342 (2010).

42. B. G. Cassidy, J. Dvorak, O. D. Anderson, The wheat low-molecular-weight glutenin

genes: characterization of six new genes and progress in understanding gene family

structure. Theoretical and applied genetics 96, 743-750 (1998).

43. R. Urade, N. Sato, M. Sugiyama, Gliadins from wheat grain: an overview, from primary

structure to nanostructures of aggregates. Biophysical Reviews 10, 435-443 (2018).

44. A. S. Tatham, P. R. Shewry, The conformation of wheat gluten proteins. The secondary

structures and thermal stabilities of α-, β-, γ- and ω-Gliadins. J Cereal Sci 3, 103-113

(1985).

45. E. W. Blanch, D. D. Kasarda, L. Hecht, K. Nielsen, L. D. Barron, New insight into the

solution structures of wheat gluten proteins from Raman optical activity. Biochemistry

42, 5665-5673 (2003).

147

46. O. D. Anderson, The α -gliadin gene family. I. Characterization of ten new wheat α -

gliadin genomic clones, evidence for limited sequence conservation of flanking DNA,

and Southern analysis of the gene family. Theoretical and applied genetics 95, 50-58

(1997).

47. S. B. Altenbach, K. M. Kothari, Omega gliadin genes expressed in Triticum aestivum cv.

Butte 86: effects of post-anthesis fertilizer on transcript accumulation during grain

development. J Cereal Sci 46, 169-177 (2007).

48. R. J. Hamer, Understanding the structure and properties of gluten: an overview, 125-131

(2000).

49. J. E. Kohn et al., Random-coil behavior and the dimensions of chemically unfolded

proteins. P Natl Acad Sci USA 101, 12491-12496 (2004).

50. N. H. Thomson et al., Small angle X-ray scattering of wheat seed-storage proteins: α-, γ-

and ω-gliadins and the high molecular weight (HMW) subunits of glutenin. Biochimica

et Biophysica Acta (BBA)-Protein Structure and Molecular Enzymology 1430, 359-366

(1999).

51. N. Sato et al., Molecular assembly of wheat gliadins into nanostructures: A small-angle

X-ray scattering study of gliadins in distilled water over a wide concentration range.

Journal of agricultural and food chemistry 63, 8715-8721 (2015).

52. E. W. Cole, D. D. Kasarda, D. Lafiandra, The conformational structure of A-gliadin:

intrinsic viscosities under conditions approaching the native state and under denaturing

conditions. Biochimica et Biophysica Acta (BBA)-Protein Structure and Molecular

Enzymology 787, 244-251 (1984).

53. A. León, C. M. Rosell, C. B. De Barber, A differential scanning calorimetry study of

wheat proteins. European Food Research and Technology 217, 13-16 (2003).

54. T. Ukai, Y. Matsumura, R. Urade, Disaggregation and reaggregation of gluten proteins by

sodium chloride. J Agric Food Chem 56, 1122-1130 (2008).

55. P. R. Shewry, High molecular weight subunits of wheat glutenin. J. Cereal Sci. 15, 105-

120 (1992).

56. P. R. Shewry, A. S. Tatham, Disulphide bonds in wheat gluten proteins. Journal of cereal

science 25, 207-227 (1997).

57. S. M. Gilbert et al., Expression and characterisation of a highly repetitive peptide derived

from a wheat seed storage protein. Biochimica et Biophysica Acta (BBA) - Protein

Structure and Molecular Enzymology 1479, 135-146 (2000).

58. P. S. Belton, Mini Review: On the Elasticity of Wheat Gluten. Journal of Cereal Science

29, 103-107 (1999).

59. T. Mita, H. Matsumoto, Flow properties of aqueous gluten and gluten methyl ester

dispersions [Wheat flour]. Cereal chemistry, (1981).

60. S. Zhen et al., Deletion of the low-molecular-weight glutenin subunit allele Glu-A3a of

wheat (Triticum aestivum L.) significantly reduces dough strength and breadmaking

quality. BMC plant biology 14, 367 (2014).

61. R. D’Ovidio, C. Marchitelli, L. Ercoli Cardelli, E. Porceddu, Sequence similarity between

allelic Glu-B3 genes related to quality properties of durum wheat. Theoretical and

Applied Genetics 98, 455-461 (1999).

62. P. R. Shewry, N. G. Halford, A. S. Tatham, The high molecular weight subunits of wheat,

barley and rye: genetics, molecular biology, chemistry and role in wheat gluten

structure and functionality. I. M. B. (ed), Ed., Oxford Surveys of Plant Molecular and

Cell Biology (Oxford University Press, Oxford, 1989), vol. 6.

63. Y.-K. Lee, M. Ciaffi, R. Appels, M. Morell, The low-molecular-weight glutenin subunit

proteins of primitive wheats. II. The genes from A-genome species. Theoretical and

applied genetics 98, 126-134 (1999).

148

64. S. Masci, R. D'Ovidio, D. Lafiandra, D. D. Kasarda, Characterization of a low-molecular-

weight glutenin subunit gene from bread wheat and the corresponding protein that

represents a major subunit of the glutenin polymer. Plant Physiology 118, 1147-1158

(1998).

65. T. M. Ikeda, T. Nagamine, H. Fukuoka, H. Yano, Identification of new low-molecular-

weight glutenin subunit genes in wheat. Theoretical and Applied Genetics 104, 680-687

(2002).

66. C. Patacchini, S. Masci, R. D’Ovidio, D. Lafiandra, Heterologous expression and

purification of native and mutated low molecular mass glutenin subunits from durum

wheat. Journal of chromatography. B, Analytical technologies in the biomedical and

life sciences 786, 215-220 (2003).

67. E. J.-L. Lew, D. Kuzmicky, D. D. Kasarda, Characterization of low molecular weight

glutenin subunits by reversed-phase high-performance liquid chromatography, sodium

dodecyl sulfate-polyacrylamide gel electrophoresis, and N-terminal amino acid

sequencing. Cereal Chem 69, 508-508 (1992).

68. D. D. Kasarda, Glutenin polymers: The in vitro to in vivo transition. Cereal Food World

44, 566-571 (1999).

69. C. Primno-Martin, R. Calera, M. A. Martinez-Anaya, Effect of pentosanase AND

oxidases on the characteristics of doughs AND the gluten in macro polymer

(GMP). Journal of Agriculture and Food Chemistry 51, 4673-4679 (2003).

70. H. Xu et al., Functional properties of a new low-molecular-weight glutenin subunit gene

from a bread wheat cultivar. Theor Appl Genet 113, 1295-1303 (2006).

71. G. Salcedo, J. Prada, C. Aragoncillo, Low MW gliadin-like proteins from wheat

endosperm. Phytochemistry 18, 725-727 (1979).

72. O. D. Anderson, C. C. Hsia, A. E. Adalsteins, E. J. L. Lew, D. D. Kasarda, Identification

of several new classes of low-molecular-weight wheat gliadin-related proteins and

genes. Theoretical and Applied Genetics 103, 307-315 (2001).

73. B. C. Clarke, T. Phongkham, M. C. Gianibelli, H. Beasley, F. Bekes, The characterisation

and mapping of a family of LMW-gliadin genes: effects on dough properties and bread

volume. Theor Appl Genet 106, 629-635 (2003).

74. Y. Kan et al., Transcriptome analysis reveals differentially expressed storage protein

transcripts in seeds of Aegilops and wheat. J Cereal Sci 44, 75-85 (2006).

75. F. M. DuPont, R. Chan, R. Lopez, W. H. Vensel, Sequential Extraction and Quantitative

Recovery of Gliadins, Glutenins, and Other Proteins from Small Samples of Wheat

Flour. Journal of agricultural and food chemistry 53, 1575-1584 (2005).

76. F. M. DuPont, R. Chan, R. Lopez, W. H. Vensel, Sequential extraction and quantitative

recovery of gliadins, glutenins, and other proteins from small samples of wheat flour. J

Agric Food Chem 53, 1575-1584 (2005).

77. B. C. Clarke, M. Hobbs, D. Skylas, R. Appels, Genes active in developing wheat

endosperm. Funct Integr Genomics 1, 44-55 (2000).

78. P. R. Shewry, J. Jenkins, F. Beaudoin, E. N. C. Mills, The classification, functions and

evolutionary relationships of plant proteins in relation to food allergens. E. N. C. Mills,

Shewry, P.R. , Ed., Plant Food Allergens (Blackwell Science, Oxford, UK, 2004).

79. R. D'Ovidio, S. Masci, The low-molecular-weight glutenin subunits of wheat gluten. J

Cereal Sci 39, 321-339 (2004).

80. P. R. Shewry, A. S. Tatham, The characteristics, structures and evolutionary relationships

of prolamins. P. R. Shewry, Casey, R. , Ed., Seed Proteins (Kluwer, Dordrecht, 1999).

81. C. Aragoncillo, R. Sanchez-Monge, G. Salcedo, Two groups of low- molecular-weight

hydrophobic proteins from barley endosperm. Journal of Experimental Botany 32,

1279-1286 (1981).

149

82. G. Salcedo, R. Sanchez-Monge, A. Argamenteria, C. Aragoncillo, Low-molecular-weight

prolamins- purification of a component from barley endosperm. Journal of Agriculture

and Food Chemistry 30, 1155-1157 (1982).

83. A. Rocher, M. Calero, F. Soriano, E. Mrndez, Identification of major rye secalins as

coeliac immunoreactive proteins. Biochim Biophys Acta 1295, 13-22 (1996).

84. P. Chen et al., Cloning, expression and characterization of novel avenin-like genes in

wheat and related species. J Cereal Sci 48, 734-740 (2008).

85. G. Mamone, S. D. Caro, A. D. Luccia, F. Addeo, P. Ferranti, Proteomic‐based analytical

approach for the characterization of glutenin subunits in durum wheat. Journal of mass

spectrometry 44, 1709-1723 (2009).

86. S. De Caro, P. Ferranti, F. Addeo, G. Mamone, Isolation and characterization of Avenin-

like protein type-B from durum wheat. J Cereal Sci 52, 426-431 (2010).

87. M. Kreis, P. R. Shewry, B. G. Forde, J. Forde, B. J. Miflin, Structure and evolution of

seed storage proteins and their genes, with particular reference to those of wheat, barley

and rye. B. J. Miflin, Ed., Oxford Surveys of Plant Cell and Molecular Biology (Oxford

University Press, Oxford, UK, 1985b), vol. 2.

88. P. Chen, R. Li, R. Zhou, G. He, P. R. Shewry, Heterologous expression and dough mixing

studies of a novel cysteine-rich Avenin-like protein. Cereal Research Communications

38, 406-418 (2010).

89. D. D. Kasarda, E. Adalsteins, E. J. L. Lew, G. R. Lazo, S. B. Altenbach, Farinin:

Characterization of a Novel Wheat Endosperm Protein Belonging to the Prolamin

Superfamily. Journal of Agricultural and Food Chemistry 61, 2407-2417 (2013).

90. W. H. Vensel, C. K. Tanaka, S. B. Altenbach, Protein composition of wheat gluten

polymer fractions determined by quantitative two-dimensional gel electrophoresis and

tandem mass spectrometry. Proteome Sci 12, 8 (2014).

91. X. Y. Chen et al., Genetic characterization of cysteine-rich type-b avenin-like protein

coding genes in common wheat. Scientific Reports 6, (2016).

92. F. Ma et al., Overexpression of avenin-like b proteins in bread wheat (Triticum aestivum

L.) improves dough mixing properties by their incorporation into glutenin polymers.

PLoS One 8, e66758 (2013).

93. T. A. Egorov, A. K. Musolyamov, J. S. Andersen, P. Roepstorff, The Complete Amino

Acid Sequence and Disulphide Bond Arrangement of Oat Alcohol‐soluble Avenin‐3. The FEBS Journal 224, 631-638 (1994).

94. S. Huebener et al., Specific nongluten proteins of wheat are novel target antigens in celiac

disease humoral response. J Proteome Res 14, 503-511 (2014).

95. M. Kreis, B. G. Forde, S. Rahman, B. J. Miflin, P. R. Shewry, Molecular evolution of the

seed storage proteins of barley, rye and wheat. Journal of Molecular Biology 183, 499-

502 (1985a).

96. J. P. Douliez, T. Michon, K. Elmorjani, D. Marion, Mini Review: Structure, Biological

and Technological Functions of Lipid Transfer Proteins and Indolines, the Major Lipid

Binding Proteins from Cereal Kernels. J Cereal Sci 32, 1-20 (2000).

97. M. Josè-Estanyol, P. Puigdomènech, Plant cell wall glycoproteins and their genes. Plant

Physiology and Biochemistry 38, 97-108 (2000).

98. M. L. Colgrave et al., Proteomic profiling of 16 cereal grains and the application of

targeted proteomics to detect wheat contamination. J Proteome Res 14, 2659-2668

(2015).

99. R. S. Chesnut, M. A. Shotwell, S. K. Boyer, B. A. Larkins, Analysis of avenin proteins

and the expression of their mRNAs in developing oat seeds. The Plant Cell 1, 913-924

(1989).

150

100. A. V. Balakireva, A. A. Zamyatnin, Properties of gluten intolerance: gluten structure,

evolution, pathogenicity and detoxification capabilities. Nutrients 8, 644 (2016).

101. P. Shewry, Plant storage proteins. Biological Reviews 70, 375-426 (1995).

102. P. R. Shewry, N. G. Halford, A. S. Tatham, The high molecular weight subunits of wheat

glutenin and their role in determining wheat processing properties. Advances in Food

and Nutrition Research 45, 219-302 (2003).

103. D. Wang et al., Molecular genetic and genomic analysis of wheat milling and end-use

traits in China: Progress and perspectives. The Crop Journal, (2017).

104. F. Ma et al., Transformation of common wheat ( L.) with - gene improves flour mixing

properties. Mol Breed 32, 853-865 (2013).

105. S. Gorjanović, A review: biological and technological functions of barley seed

Pathogenesis‐related proteins (PRs). Journal of the Institute of Brewing 115, 334-360

(2009).

106. T. Iimure et al., Construction of a novel beer proteome map and its use in beer quality

control. Food Chemistry 118, 566-574 (2010).

107. G. Picariello et al., Shotgun proteome analysis of beer and the immunogenic potential of

beer polypeptides. Journal of proteomics 75, 5872-5882 (2012).

108. G. Picariello et al., Proteomics, peptidomics, and immunogenic potential of wheat beer

(Weissbier). Journal of agricultural and food chemistry 63, 3579-3586 (2015).

109. T. Iimure, M. Kihara, K. Sato, K. Ogushi, Purification of barley dimeric α-amylase

inhibitor-1 (BDAI-1) and avenin-like protein-a (ALP) from beer and their impact on

beer foam stability. Food chemistry 172, 257-264 (2015).

110. H. Li et al., Using LC-MS to examine the fermented food products vinegar and soy sauce

for the presence of gluten. Food chemistry 254, 302-308 (2018).

111. M. L. Colgrave, K. Byrne, M. Blundell, C. A. Howitt, Identification of barley-specific

peptide markers that persist in processed foods and are capable of detecting barley

contamination by LC-MS/MS. Journal of proteomics 147, 169-176 (2016).

112. C. Larré et al., Brachypodium distachyon grain: identification and subcellular localization

of storage proteins. Journal of Experimental Botany 61, 1771-1783 (2010).

113. J. Wu, R. Thilmony, Y. Gu, in Genetics and Genomics of Brachypodium. (Springer, 2015),

pp. 219-243.

114. J.-H. Xu, J. Messing, Organization of the prolamin gene family provides insight into the

evolution of the maize genome and gene duplications in grass species. Proceedings of

the National Academy of Sciences 105, 14330-14335 (2008).

115. P. Högy, C. Zörb, G. Langenkämper, T. Betsche, A. Fangmeier, Atmospheric CO2

enrichment changes the wheat grain proteome. J Cereal Sci 50, 248-254 (2009).

116. P. M. S. Arachchige et al., Wheat (Triticum aestivum L.) grain proteome response to

elevated [CO2] varies between genotypes. J Cereal Sci 75, 151-157 (2017).

117. F. Verrillo et al., Elevated field atmospheric CO2 concentrations affect the characteristics

of winter wheat (cv. Bologna) grains. Crop and Pasture Science 68, 713-725 (2017).

118. P. A. Donaldson, T. Anderson, B. G. Lane, A. L. Davidson, D. H. Simmonds, Soybean

plants expressing an active oligomeric oxalate oxidase from the wheat gf-2.8 (germin)

gene are resistant to the oxalate-secreting pathogen Sclerotina sclerotiorum.

Physiological and Molecular Plant Pathology 59, 297-307 (2001).

119. A. Gu et al., Integrated proteome analysis of the wheat embryo and endosperm reveals

central metabolic changes involved in the water deficit response during grain

development. Journal of agricultural and food chemistry 63, 8478-8487 (2015).

120. X. Wang et al., Protein interactions during flour mixing using wheat flour with altered

starch. Food chemistry 231, 247-257 (2017).

151

121. H. Cao et al., Distinct metabolic changes between wheat embryo and endosperm during

grain development revealed by 2D‐DIGE‐based integrative proteome analysis.

Proteomics 16, 1515-1536 (2016).

122. M. Yang, J. Dong, W. Zhao, X. Gao, Characterization of proteins involved in early stage

of wheat grain development by iTRAQ. Journal of proteomics 136, 157-166 (2016).

123. M. Collado-Romero, E. Alós, P. Prieto, Effect of 7 H ch Hordeum chilense Chromosome

Introgressions on the Wheat Endosperm Proteomic Profile. Journal of agricultural and

food chemistry 63, 3793-3802 (2015).

124. S. B. Altenbach, C. K. Tanaka, L. C. Whitehand, W. H. Vensel, Effects of post-anthesis

fertilizer on the protein composition of the gluten polymer in a US bread wheat. J Cereal

Sci 68, 66-73 (2016).

125. S. B. Altenbach, C. K. Tanaka, P. V. Allen, Quantitative proteomic analysis of wheat grain

proteins reveals differential effects of silencing of omega-5 gliadin genes in transgenic

lines. J Cereal Sci 59, 118-125 (2014).

126. A. Fallahbaghery, W. Zou, K. Byrne, C. A. Howitt, M. L. Colgrave, Comparison of Gluten

Extraction Protocols Assessed by LC-MS/MS Analysis. Journal of agricultural and

food chemistry 65, 2857-2866 (2017).

127. T. Gao et al., Function of the ERFL1a Transcription Factor in Wheat Responses to Water

Deficiency. International journal of molecular sciences 19, 1465 (2018).

128. S. Subburaj et al., Molecular characterization and evolutionary origins of farinin genes in

Brachypodium distachyon L. Journal of applied genetics 57, 287-303 (2016).

129. D. Cao et al., Genetic diversity of avenin-like b genes in Aegilops tauschii Coss. Genetica

146, 45-51 (2018).

130. A. Juhász, R. Haraszi, C. Maulis, ProPepper: a curated database for identification and

analysis of peptide and immune-responsive epitope composition of cereal grain protein

families. Database 2015, bav100 (2015).

131. G. Gell, K. Kovács, G. Veres, I. R. Korponay-Szabó, A. Juhász, Characterization of

globulin storage proteins of a low prolamin cereal species in relation to celiac disease.

Scientific reports 7, 39876 (2017).

132. D. C. Schriemer, M. Rey. (Google Patents, 2017).

133. K. Kobrehel, P. Feillet, Identification of genomes and chromosomes involved in

peroxidase synthesis of wheat seeds. Canadian Journal of Botany 53, 2336-2344 (1975).

134. J. Anderson, Y. Ogihara, M. Sorrells, S. Tanksley, Development of a chromosomal arm

map for wheat based on RFLP markers. Theoretical and Applied Genetics 83, 1035-

1043 (1992).

135. K. M. Devos, J. Dubcovsky, J. Dvorak, C. N. Chinoy, M. D. Gale, Structural Evolution

of Wheat Chromosomes 4a, 5a, and 7b and Its Impact on Recombination. Theoretical

and Applied Genetics 91, 282-288 (1995).

136. J. Ewart, Isolation of a cappelle‐desprez gliadin. Journal of the Science of Food and

Agriculture 26, 1021-1025 (1975).

137. A. Rocher, M. Calero, F. Soriano, E. Mendez, Identification of major rye secalins as

coeliac immunoreactive proteins. Biochimica et Biophysica Acta (BBA)-Protein

Structure and Molecular Enzymology 1295, 13-22 (1996).

138. B. C. Clarke, Hobbs, · M., Skylas, · D., Appels, R. , Genes active in developing wheat

endosperm. Functional & integrative genomics 1, 44-55 (2000).

139. Y. Kan et al., Transcriptome analysis reveals differentially expressed storage protein

transcripts in seeds of Aegilops and wheat. Journal of Cereal Science 44, 75-85 (2006).

140. Y. Zhang et al., Wheat avenin-like protein and its significant Fusarium Head Blight

resistant functions. bioRxiv, (2018).

152

141. E. Nevo, A. Brown, D. Zohary, N. Storch, A. Beiles, Microgeographic edaphic

differentiation in allozyme polymorphisms of wild barley (Hordeum spontaneum,

Poaceae). Plant Systematics and Evolution 138, 287-292 (1981).

142. E. Nevo, A. Beiles, Genetic diversity of wild emmer wheat in Israel and Turkey : Structure,

evolution, and application in breeding. Theor Appl Genet 77, 421-455 (1989).

143. Y. Li et al., Microsatellite diversity correlated with ecological-edaphic and genetic factors

in three microsites of wild emmer wheat in North Israel. Mol Biol Evol 17, 851-862

(2000).

144. E. M. Golenberg, E. Nevo, Multilocus differentiation and population structure in a selfer,

wild emmer wheat, Triticum dicoccoides. Heredity 58, 451 (1987).

145. E. Nevo, A. Beiles, T. Krugman, Natural selection of allozyme polymorphisms: a

microgeographical differentiation by edaphic, topographical, and temporal factors in

wild emmer wheat (Triticum dicoccoides). Theor Appl Genet 76, 737-752 (1988).

146. E. Nevo, A. Beiles, T. Krugman, Natural selection of allozyme polymorphisms: a

microgeographic climatic differentiation in wild emmer wheat (Triticum dicoccoides).


147. E. Nevo, in Evolutionary biology. (Springer, 1988), pp. 217-246.

148. Y. Li et al., Microsatellite diversity correlated with ecological-edaphic and genetic factors

in three microsites of wild emmer wheat in North Israel. Molecular Biology and

Evolution 17, 851-862 (2000).

149. Y.-C. Li et al., Natural selection causing microsatellite divergence in wild emmer wheat

at the ecologically variable microsite at Ammiad, Israel. Theoretical and Applied

Genetics 100, 985-999 (2000).

150. E. Nevo, P. I. Payne, Wheat storage proteins: diversity of HMW glutenin subunits in wild

emmer from Israel : 1. Geographical patterns and ecological predictability. Theor Appl

Genet 74, 827-836 (1987).

151. E. Nevo, B. F. Carver, A. Beiles, Photosynthetic performance in wild emmer wheat,

Triticum dicoccoides: ecological and genetic predictability. Theor Appl Genet 81, 445-

460 (1991).

152. E. Nevo, K. Nishikawa, Y. Furuta, Y. Gonokami, A. Beiles, Genetic polymorphisms of

alpha- and beta-amylase isozymes in wild emmer wheat, Triticum dicoccoides, in Israel.

Theor Appl Genet 85, 1029-1042 (1993).

153. E. Nevo, M. A. Pagnotta, A. Beiles, E. Porceddu, Wheat storage proteins: glutenin DNA

diversity in wild emmer wheat, Triticum dicoccoids, in Israel and Turkey. 3.

Environmental correlates and allozymic associations. Theor Appl Genet 91, 415-420

(1995).

154. M. A. Pagnotta, E. Nevo, A. Beiles, E. Porceddu, Wheat storage proteins: glutenin

diversity in wild emmer, Triticum dicoccoides, in Israel and Turkey. 2. DNA diversity

detected by PCR. Theor Appl Genet 91, 409-414 (1995).

155. T. Fahima et al., RAPD polymorphism of wild emmer wheat populations, Triticum

dicoccoides, in Israel. Theoretical and Applied Genetics 98, 434-447 (1999).

156. J. R. Wang et al., Molecular evolution of dimeric alpha-amylase inhibitor genes in wild

emmer wheat and its ecological association. BMC Evol Biol 8, 91 (2008).

157. J. R. Wang et al., The impact of single nucleotide polymorphism in monomeric alpha-

amylase inhibitor genes from wild emmer wheat, primarily from Israel and Golan. BMC

Evol Biol 10, 170 (2010).

158. E. Nevo, Evolution of wild emmer wheat and crop improvement. Journal of systematics

and evolution 52, 673-696 (2014).

153

159. D. Zohary, M. Hopf, E. Weiss, Domestication of Plants in the Old World: The origin and

spread of domesticated plants in Southwest Asia, Europe, and the Mediterranean Basin.

(Oxford University Press on Demand, 2012).

160. B. C. Clarke, T. Phongkham, M. Gianibelli, H. Beasley, F. Bekes, The characterisation

and mapping of a family of LMW-gliadin genes: effects on dough properties and bread

volume. Theoretical and Applied Genetics 106, 629 (2003).

161. O. Emanuelsson, S. Brunak, G. Von Heijne, H. Nielsen, Locating proteins in the cell using

TargetP, SignalP and related tools. Nature protocols 2, 953 (2007).

162. D. T. Jones, W. R. Taylor, J. M. Thornton, The rapid generation of mutation data matrices

from protein sequences. Comput Appl Biosci 8, 275-282 (1992).

163. Z. H. Yang, PAML 4: Phylogenetic analysis by maximum likelihood. Mol Biol Evol 24,

1586-1591 (2007).

164. S. Lalitha, Primer premier 5. Biotech Software & Internet Report: The Computer Software

Journal for Scient 1, 270-272 (2000).

165. F. C. Yeh, R. Yang, T. Boyle, Z. Ye, J. X. Mao, POPGENE, version 1.32: the user friendly

software for population genetic analysis. Molecular Biology and Biotechnology Centre,

University of Alberta, Edmonton, AB, Canada, (1999).

166. A. W. Schreiber et al., Comparative transcriptomics in the Triticeae. BMC genomics 10,

285 (2009).

167. G. F. Wang, G. Wang, X. W. Zhang, F. Wang, R. T. Song, Isolation of High Quality RNA

from Cereal Seeds Containing High Levels of Starch. Phytochem Analysis 23, 159-163

(2012).

168. K. J. Livak, T. D. Schmittgen, Analysis of relative gene expression data using real-time

quantitative PCR and the 2− ΔΔCT method. methods 25, 402-408 (2001).

169. E. R. Sears, The aneuploids of common wheat. Mo. Agric. Exp. Stn. Res. Bull. 572, 1-58

(1954).

170. R. D. Finn et al., The Pfam protein families database: towards a more sustainable future.

Nucleic acids research 44, D279-D285 (2015).

171. Z. Yang, PAML 4: phylogenetic analysis by maximum likelihood. Molecular biology and

evolution 24, 1586-1591 (2007).

172. M. Hassani, M. Gianibelli, M. Shariflou, P. Sharp, Molecular structure of a novel y-type

HMW glutenin subunit gene present in Triticum tauschii. Euphytica 141, 191-198

(2005).

173. Y. Liu, Z.-Y. Xiong, Y.-G. He, P. R. Shewry, G.-y. He, Genetic diversity of HMW glutenin

subunit in Chinese common wheat (Triticum aestivum L.) landraces from Hubei

province. Genetic resources and crop evolution 54, 865-874 (2007).

174. J. T. Christeller, Evolutionary mechanisms acting on proteinase inhibitor variability. The

FEBS journal 272, 5710-5722 (2005).

175. M. Laskowski Jr, M. Qasim, What can the structures of enzyme-inhibitor complexes tell

us about the structures of enzyme substrate complexes? Biochimica et Biophysica Acta

(BBA)-Protein Structure and Molecular Enzymology 1477, 324-337 (2000).

176. T. Gojobori, K. Ikeo, Molecular evolution of serine protease and its inhibitor with special

reference to domain evolution. Phil. Trans. R. Soc. Lond. B 344, 411-415 (1994).

177. X. Wang et al., Genomic adaptation to drought in wild barley is driven by edaphic natural

selection at the Tabigha Evolution Slope. Proceedings of the National Academy of

Sciences 115, 5223-5228 (2018).

178. S. Wright, Isolation by distance. Genetics 28, 114-138 (1943).

179. L. D. Hurst, Genetics and the understanding of selection. Nature Reviews Genetics 10, 83

(2009).

154

180. E. Nevo, A. Beiles, Genetic diversity of wild emmer wheat in Israel and Turkey.


181. E. Nevo, E. Golenberg, A. Beiles, A. Brown, D. Zohary, Genetic diversity and

environmental associations of wild wheat, Triticum dicoccoides, in Israel. Theoretical


182. W. J. Mattson, R. A. Haack, The role of drought in outbreaks of plant-eating insects.

Bioscience 37, 110-118 (1987).

183. E. Nevo, E. Golenberg, A. Beiles, A. Brown, D. Zohary, Genetic diversity and

environmental associations of wild wheat, Triticum dicoccoides, in Israel. TAG


184. P. H. Sneath, R. R. Sokal, Numerical taxonomy. The principles and practice of numerical

classification. (1973).

185. M. Nei, S. Kumar, Molecular evolution and phylogenetics. (Oxford university press,

2000).

186. S. Kumar, G. Stecher, K. Tamura, MEGA7: molecular evolutionary genetics analysis

version 7.0 for bigger datasets. Molecular biology and evolution 33, 1870-1874 (2016).

187. R. C. Lewontin. (Nature Publishing Group, 1972).

188. R. B. Gupta, I. L. Batey, F. Macritchie, Relationships between Protein-Composition and

Functional-Properties of Wheat Flours. Cereal Chem 69, 125-131 (1992).

189. C. Law, P. Payne, Genetical aspects of breeding for improved grain protein content and

type in wheat. J Cereal Sci 1, 79-93 (1983).

190. J. W. Pence, N. Weinstein, D. Mecham, The albumin and globulin contents of wheat flour

and their relationship to protein quality. Cereal Chem 31, 303-311 (1954).

191. M. C. Chamla, The Chemistry of Cereal Proteins - Lasztity,R. B Mem Soc Anthro Par 11,

354-354 (1984).

192. E. Cole, J. Fullington, D. D. Kasarda, Grain protein variability among species of Triticum

and Aegilops: quantitative SDS-PAGE studies. Theoretical and Applied Genetics 60,

17-30 (1981).

193. E. Triboï, P. Martre, A. M. Triboï‐Blondel, Environmentally‐induced changes in

protein composition in developing grains of wheat are related to changes in total protein

content. Journal of Experimental Botany 54, 1731-1742 (2003).

194. H. Wieser, W. Seilmeier, The influence of nitrogen fertilisation on quantities and

proportions of different protein types in wheat flour. Journal of the Science of Food and

Agriculture 76, 49-55 (1998).

195. J. H. Wong et al., Thioredoxin targets of developing wheat seeds identified by

complementary proteomic approaches. Phytochemistry 65, 1629-1640 (2004).

196. D. Skylas et al., Proteome approach to the characterisation of protein composition in the

developing and mature wheat-grain endosperm. J Cereal Sci 32, 169-188 (2000).

197. C. Finnie, B. Svensson, Feasibility study of a tissue-specific approach to barley proteome

analysis: aleurone layer, endosperm, embryo and single seeds. J Cereal Sci 38, 217-227

(2003).

198. C. S. Mcwilliams, The Chemistry and Technology of Cereals as Food and Feed - Matz,Sa.

J Home Econ 51, 898-898 (1959).

199. V. Buonocore, M. G. Debiasi, P. Giardina, E. Poerio, V. Silano, Purification and Properties

of an Alpha-Amylase Tetrameric Inhibitor from Wheat Kernel. Biochim Biophys Acta

831, 40-48 (1985).

200. P. R. Shewry et al., The purification and N-terminal amino acid sequence analysis of the

high molecular weight gluten polypeptides of wheat. Biochimica et Biophysica Acta

(BBA)-Protein Structure and Molecular Enzymology 788, 23-34 (1984).

155

201. H. Østergaard, S. K. Rasmussen, T. H. Roberts, J. Hejgaard, Inhibitory Serpins from

Wheat Grain with Reactive Centers Resembling Glutamine-rich Repeats of Prolamin

Storage Proteins CLONING AND CHARACTERIZATION OF FIVE MAJOR

MOLECULAR FORMS. Journal of Biological Chemistry 275, 33272-33279 (2000).

202. F. García Olmedo et al., Characterization and analysis of thionin genes. Plant Gene

Research. Genes Involved in Plant Defense, 283-302 (1992).

203. C. F. Morris, Puroindolines: the molecular genetic basis of wheat grain hardness. Plant

molecular biology 48, 633-647 (2002).

204. M. Black, J. D. Bewley, Seed technology and its biological basis. (CRC Press, 2000).

205. J. Singh, J. H. Skerritt, Chromosomal control of albumins and globulins in wheat grain

assessed using different fractionation procedures. J Cereal Sci 33, 163-181 (2001).

206. J. Singh, M. Blundell, G. Tanner, J. H. Skerritt, Albumin and globulin proteins of wheat

flour: immunological and N-terminal sequence characterisation. J Cereal Sci 34, 85-

103 (2001).

207. B. Fu, M. Kovacs, Research Note: Rapid single-step procedure for isolating total glutenin

proteins of wheat flour. J Cereal Sci 29, 113-116 (1999).

208. J. Jia et al., Annotation and expression profile analysis of 2073 full‐length cDNAs from

stress‐induced maize (Zea mays L.) seedlings. The Plant Journal 48, 710-727 (2006).

209. M. Gijzen, S. S. Miller, K. Kuflu, R. I. Buzzell, B. L. Miki, Hydrophobic protein

synthesized in the pod endocarp adheres to the seed surface. Plant physiology 120, 951-

960 (1999).

210. D. E. Enstone, C. A. Peterson, M. Gijzen, Soybean Hydrophobic Protein is Present in a

Matrix Secreted by the Endocarp Epidermis during Seed Development. Scientific

reports 5, 15074 (2015).

211. F. Baud, E. Pebay-Peyroula, C. Cohen-Addad, S. Odani, M. S. Lehmann, Crystal structure

of hydrophobic protein from soybean; a member of a new cysteine-rich family. J Mol

Biol 231, 877-887 (1993).

212. M. Jose-Estanyol, L. Ruiz-Avila, P. Puigdomenech, A maize embryo-specific gene

encodes a proline-rich and hydrophobic protein. Plant Cell 4, 413-423 (1992).

213. I. John, H. Wang, B. M. Held, E. S. Wurtele, J. T. Colbert, An mRNA that specifically

accumulates in maize roots delineates a novel subset of developing cortical cells. Plant

molecular biology 20, 821-831 (1992).

214. A. Mousavi, Y. Hotta, Glycine-rich proteins. Applied biochemistry and biotechnology 120,

169-174 (2005).

215. C. D. Carpenter, J. A. Kreps, A. E. Simon, Genes encoding glycine-rich Arabidopsis

thaliana proteins with RNA-binding motifs are influenced by cold treatment and an

endogenous circadian rhythm. Plant Physiology 104, 1015-1025 (1994).

216. J. Gómez et al., A gene induced by the plant hormone abscisic acid in response to water

stress encodes a glycine-rich protein. Nature 334, 262 (1988).

217. H. Mehansho, L. G. Butler, D. M. Carlson, Dietary tannins and salivary proline-rich

proteins: interactions, induction, and defense mechanisms. Annual review of nutrition 7,

423-440 (1987).

218. D. J. Bradley, P. Kjellbom, C. J. Lamb, Elicitor-and wound-induced oxidative cross-

linking of a proline-rich plant cell wall protein: a novel, rapid defense response. Cell 70,

21-30 (1992).

219. S. Sprunck et al., Egg cell–secreted EC1 triggers sperm cell activation during double

fertilization. Science 338, 1093-1097 (2012).

220. A. M. Maldonado, P. Doerner, R. A. Dixon, C. J. Lamb, R. K. Cameron, A putative lipid

transfer protein involved in systemic resistance signalling in Arabidopsis. Nature 419,

399-403 (2002).

156

221. S. Sarowar et al., Overexpression of lipid transfer protein (LTP) genes enhances

resistance to plant pathogens and LTP functions in long-distance systemic signaling in

tobacco. Plant cell reports 28, 419-427 (2009).

222. L. P. Cruz et al., Isolation and partial characterization of a novel lipid transfer protein

(LTP) and antifungal activity of peptides from chilli pepper seeds. Protein Pept Lett 17,

311-318 (2010).

223. U. Zottich et al., Purification, biochemical characterization and antifungal activity of a

new lipid transfer protein (LTP) from Coffea canephora seeds with alpha-amylase

inhibitor properties. Biochim Biophys Acta 1810, 375-383 (2011).

224. X. L. Zhu et al., Overexpression of wheat lipid transfer protein gene TaLTP5 increases

resistances to Cochliobolus sativus and Fusarium graminearum in transgenic wheat.

Funct Integr Genomic 12, 481-488 (2012).

225. S. Y. Wang, J. H. Wu, T. Ng, X. Y. Ye, P. F. Rao, A non-specific lipid transfer protein with

antifungal and antibacterial activities from the mung bean. Peptides 25, 1235-1242

(2004).

226. J. Warchalewski, Purification and characteristics of an endogenous alpha‐amylase and

trypsin inhibitor from wheat seeds. Molecular Nutrition & Food Research 31, 1015-

1031 (1987).

227. R. Heidari, S. Zareae, M. Heidarizadeh, Extraction, purification, and inhibitory effect of

alpha-amylase inhibitor from wheat (Triticum aestivum Var. Zarrin). Pakistan J Nutr 4,

101-105 (2005).

228. C. Jolly, S. Rahman, A. A. Kortt, T. Higgins, Characterisation of the wheat Mr 15000

“grain-softness protein” and analysis of the relationship between its accumulation in the

whole seed and grain softness. Theoretical and Applied Genetics 86, 589-597 (1993).

229. M. Giroux, C. Morris, A glycine to serine change in puroindoline b is associated with

wheat grain hardness and low levels of starch-surface friabilin. Theoretical and Applied

Genetics 95, 857-864 (1997).

230. M. J. Giroux, C. F. Morris, Wheat grain hardness results from highly conserved mutations

in the friabilin components puroindoline a and b. Proceedings of the National Academy

of Sciences 95, 6262-6266 (1998).

231. T. W. van Herpen et al., Alpha-gliadin genes from the A, B, and D genomes of wheat

contain different sets of celiac disease epitopes. BMC genomics 7, 1 (2006).

232. B. S. Shorrosh et al., A novel cereal storage protein: molecular genetics of the 19 kDa

globulin of rice. Plant molecular biology 18, 151-154 (1992).

233. K. Miyahara, T. Nishio, Rice mutant lines lacking α-globulin. Japanese Journal of

Breeding 48, 45-49 (1998).

234. F. R. Terras et al., Small cysteine-rich antifungal proteins from radish: their role in host

defense. The Plant Cell 7, 573-588 (1995).

235. M. D. Templeton, E. H. Rikkerink, R. Beever, Small, cysteine-rich proteins and

recognition in fungal-plant interactions. MPMI-Molecular Plant Microbe Interactions

7, 320-325 (1994).

236. K. A. Silverstein et al., Small cysteine‐rich peptides resembling antimicrobial peptides

have been under‐predicted in plants. The Plant Journal 51, 262-280 (2007).

237. M. Kussmann et al., Matrix-assisted laser desorption/ionization mass spectrometry

sample preparation techniques designed for various peptide and protein analytes.

Journal of Mass Spectrometry 32, 593-601 (1997).

238. S. P. Fling, D. S. Gregerson, Peptide and protein molecular weight determination by

electrophoresis using a high-molarity tris buffer system without urea. Analytical

biochemistry 155, 83-88 (1986).

157

239. C. Schafer-Nielsen, C. Rose, Separation of nucleic acids and chromatin proteins by

hydrophobic interaction chromatography. Biochimica et Biophysica Acta (BBA)-Gene

Structure and Expression 696, 323-331 (1982).

240. S. Bringans et al., Proteomic analysis of the venom of Heterometrus longimanus (Asian

black scorpion). Proteomics 8, 1081-1096 (2008).

241. C. A. Ryan, Protease inhibitors in plants: genes for improving defenses against insects

and pathogens. Annual review of phytopathology 28, 425-449 (1990).

242. R. Gupta, K. Shepherd, F. MacRitchie, Genetic control and biochemical properties of

some high molecular weight albumins in bread wheat. J Cereal Sci 13, 221-235 (1991).

243. D. B. Bechtel, J. D. Wilson, P. R. Shewry, Immunocytochemical localization of the wheat

storage protein triticin in developing endosperm tissue. Cereal chemistry (USA), (1991).

244. P. R. Shewry et al., N-terminal amino acid sequences of chloroform/methanol-soluble

proteins and albumins from endosperms of wheat, barley and related species: Homology

with inhibitors of α-amylase and trypsin and with 2 S storage globulins. FEBS letters

175, 359-363 (1984).

245. J. D. Jones, J. L. Dangl, The plant immune system. Nature 444, 323-329 (2006).

246. J. A. Ryals et al., Systemic acquired resistance. The plant cell 8, 1809 (1996).

247. S. H. Spoel, X. Dong, How do plants achieve immunity? Defence without specialized

immune cells. Nature Reviews Immunology 12, 89-100 (2012).

248. A. Santner, L. I. A. Calderon-Villalobos, M. Estelle, Plant hormones are versatile

chemical regulators of plant growth. Nature chemical biology 5, 301-307 (2009).

249. A. Robert-Seilaniantz, M. Grant, J. D. Jones, Hormone crosstalk in plant disease and

defense: more than just jasmonate-salicylate antagonism. Annual review of

phytopathology 49, 317-343 (2011).

250. C. M. Pieterse, A. Leon-Reyes, S. Van der Ent, S. C. Van Wees, Networking by small-

molecule hormones in plant immunity. Nature chemical biology 5, 308-316 (2009).

251. B. P. Thomma et al., Separate jasmonate-dependent and salicylate-dependent defense-

response pathways in Arabidopsis are essential for resistance to distinct microbial

pathogens. Proceedings of the National Academy of Sciences 95, 15107-15111 (1998).

252. J. L. Dangl, J. D. Jones, Plant pathogens and integrated defence responses to infection.

nature 411, 826-833 (2001).

253. R. Dixon, M. Harrison, C. Lamb, Early events in the activation of plant defense responses.

Annual review of phytopathology 32, 479-501 (1994).

254. H. C. J. Godfray et al., Food security: the challenge of feeding 9 billion people. science

327, 812-818 (2010).

255. N. A. Brown, M. Urban, A. M. Van de Meene, K. E. Hammond-Kosack, The infection

biology of Fusarium graminearum: Defining the pathways of spikelet to spikelet

colonisation in wheat ears. Fungal Biology 114, 555-571 (2010).

256. S. Walter, P. Nicholson, F. M. Doohan, Action and reaction of host and pathogen during

Fusarium head blight disease. New Phytologist 185, 54-66 (2010).

257. F. Yang et al., Secretomics identifies Fusarium graminearum proteins involved in the

interaction with barley and wheat. Molecular plant pathology 13, 445-453 (2012).

258. J. M. Paper, J. S. Scott‐Craig, N. D. Adhikari, C. A. Cuomo, J. D. Walton, Comparative

proteomics of extracellular proteins in vitro and in planta from the pathogenic fungus

Fusarium graminearum. Proteomics 7, 3171-3183 (2007).

259. V. Phalip et al., Diversity of the exoproteome of Fusarium graminearum grown on plant

cell wall. Current genetics 48, 366-379 (2005).

260. C. Rampitsch, N. A. Tinker, R. Subramaniam, S. Barkow‐Oesterreicher, E. Laczko,

Phosphoproteome profile of Fusarium graminearum grown in vitro under nonlimiting

conditions. Proteomics 12, 1002-1005 (2012).

158

261. C. Rampitsch, R. Subramaniam, S. Djuric‐Ciganovic, N. V. Bykova, The

phosphoproteome of Fusarium graminearum at the onset of nitrogen starvation.

Proteomics 10, 124-140 (2010).

262. G. Li, Y. Yen, Jasmonate and ethylene signaling pathway may mediate Fusarium head

blight resistance in wheat. Crop Sci 48, 1888-1896 (2008).

263. C. Pritsch et al., Systemic expression of defense response genes in wheat spikes as a

response to Fusarium graminearum infection. Physiological and Molecular Plant

Pathology 58, 1-12 (2001).

264. S. Gottwald, B. Samans, S. Luck, W. Friedt, Jasmonate and ethylene dependent defence

gene expression and suppression of fungal virulence factors: two essential mechanisms

of Fusarium head blight resistance in wheat? Bmc Genomics 13, (2012).

265. A. Bernardo et al., Fusarium graminearum-induced changes in gene expression between

Fusarium head blight-resistant and susceptible wheat cultivars. Funct Integr Genomic

7, 69-77 (2007).

266. A. Leon-Reyes et al., Ethylene signaling renders the jasmonate response of Arabidopsis

insensitive to future suppression by salicylic acid. Molecular Plant-Microbe

Interactions 23, 187-197 (2010).

267. Y. X. Sun et al., The role of wheat jasmonic acid and ethylene pathways in response to

Fusarium graminearum infection. Plant Growth Regulation 80, 69-77 (2016).

268. P. F. Qi et al., Jasmonic acid and abscisic acid play important roles in host-pathogen

interaction between Fusarium graminearum and wheat during the early stages of

fusarium head blight. Physiological and Molecular Plant Pathology 93, 39-48 (2016).

269. B. A. Adie et al., ABA is an essential signal for plant resistance to pathogens affecting JA

biosynthesis and the activation of defenses in Arabidopsis. The Plant Cell 19, 1665-

1681 (2007).

270. K. A. T. Silverstein et al., Small cysteine-rich peptides resembling antimicrobial peptides

have been under-predicted in plants. Plant Journal 51, 262-280 (2007).

271. M. Guo et al., Crystal structure of the cysteine-rich secretory protein stecrisp reveals that

the cysteine-rich domain has a K+ channel inhibitor-like fold. Journal of Biological

Chemistry 280, 12405-12412 (2005).

272. E. Marshall, L. M. Costa, J. Gutierrez-Marcos, Cysteine-rich peptides (CRPs) mediate

diverse aspects of cell–cell communication in plant reproduction and development.

Journal of experimental botany 62, 1677-1686 (2011).

273. H. Chepyshko, C.-P. Lai, L.-M. Huang, J.-H. Liu, J.-F. Shaw, Multifunctionality and

diversity of GDSL esterase/lipase gene family in rice (Oryza sativa L. japonica) genome:

new insights from bioinformatics analysis. BMC genomics 13, 309 (2012).

274. J. Kraut, Serine proteases: structure and mechanism of catalysis. Annual review of

biochemistry 46, 331-358 (1977).

275. J. Pütter, in Methods of Enzymatic Analysis (Second Edition), Volume 2. (Elsevier, 1974),

pp. 685-690.

276. Y. Sakamoto et al., Lentinula edodes tlg1 encodes a thaumatin-like protein that is

involved in lentinan degradation and fruiting body senescence. Plant physiology 141,

793-801 (2006).

277. E. Croes, K. Gebruers, N. Luyten, J. A. Delcour, C. M. Courtin, Immunoblot

quantification of three classes of proteinaceous xylanase inhibitors in different wheat

(Triticum aestivum) cultivars and milling fractions. Journal of agricultural and food

chemistry 57, 1029-1035 (2009).

278. S. Ferrari et al., Transgenic expression of polygalacturonase‐inhibiting proteins in

Arabidopsis and wheat increases resistance to the flower pathogen Fusarium

graminearum. Plant Biology 14, 31-38 (2012).

159

279. S. Tundo et al., PvPGIP2 Accumulation in Specific Floral Tissues But Not in the

Endosperm Limits Fusarium graminearum Infection in Wheat. Molecular Plant-

Microbe Interactions 29, 815-821 (2016).

280. J. Imler, J. Hoffmann, in Toll-Like Receptor Family Members and Their Ligands.

(Springer, 2002), pp. 63-79.

281. J. Zou et al., Expression profiling soybean response to Pseudomonas syringae reveals

new defense-related genes and rapid HR-specific downregulation of photosynthesis.

Molecular Plant-Microbe Interactions 18, 1161-1174 (2005).

282. Y. Belkhadir, R. Subramaniam, J. L. Dangl, Plant disease resistance protein signaling:

NBS–LRR proteins and their partners. Current opinion in plant biology 7, 391-399

(2004).

283. Z. Y. Chen, R. L. Brown, J. S. Russin, A. R. Lax, T. E. Cleveland, A Corn Trypsin Inhibitor

with Antifungal Activity Inhibits Aspergillus flavus alpha-Amylase. Phytopathology 89,

902-907 (1999).

284. O. L. Franco, D. J. Rigden, F. R. Melo, M. F. Grossi‐de‐Sá, Plant α‐amylase

inhibitors and their interaction with insect α‐amylases. The FEBS Journal 269, 397-

412 (2002).

285. A. M. Showalter, B. D. Keppler, X. Liu, J. Lichtenberg, L. R. Welch, Bioinformatic

identification and analysis of hydroxyproline-rich glycoproteins in Populus trichocarpa.

BMC plant biology 16, 229 (2016).

286. X. Y. Chen et al., Genetic characterization of cysteine-rich type-b avenin-like protein

coding genes in common wheat. Scientific reports 6, 30692 (2016).

287. M. McMullen, R. Jones, D. Gallenberg, Scab of wheat and barley: A re-emerging disease

of devastating impact. Plant Dis 81, 1340-1348 (1997).

288. H. Kouchi, S. Hata, Isolation and characterization of novel nodulin cDNAs representing

genes expressed at early stages of soybean nodule development. Molecular and General

Genetics MGG 238, 106-119 (1993).

289. W. F. Broekaert, F. R. Terras, B. P. Cammue, J. Vanderleyden, An automated quantitative

assay for fungal growth inhibition. FEMS Microbiology Letters 69, 55-59 (1990).

290. F. Terras et al., Analysis of two novel classes of plant antifungal proteins from radish

(Raphanus sativus L.) seeds. Journal of Biological Chemistry 267, 15301-15309 (1992).

291. S. Fields, O.-k. Song, A novel genetic system to detect protein–protein interactions.

Nature 340, 245 (1989).

292. C.-T. Chien, P. L. Bartel, R. Sternglanz, S. Fields, The two-hybrid system: a method to

identify and clone genes for proteins that interact with a protein of interest. Proceedings

of the National Academy of Sciences 88, 9578-9582 (1991).

293. S. Atwell et al., Genome-wide association study of 107 phenotypes in Arabidopsis

thaliana inbred lines. Nature 465, 627-631 (2010).

294. Y. Xiang et al., A jacalin-related lectin-like gene in wheat is a component of the plant

defence system. Journal of experimental botany 62, 5471-5483 (2011).

295. R. B. Ferreira et al., The role of plant defence proteins in fungal pathogenesis. Molecular

Plant Pathology 8, 677-700 (2007).

296. X.-Y. Yang, W.-J. Jiang, H.-J. Yu, The expression profiling of the lipoxygenase (LOX)

family genes during fruit development, abiotic stress and hormonal treatments in

cucumber (Cucumis sativus L.). International journal of molecular sciences 13, 2481-

2500 (2012).

297. A. Pekkarinen, The serine proteinases of Fusarium grown on cereal proteins and in barley

grain and their inhibition by barley proteins. (2003).

298. L. Chen et al., Overexpression of TiERF1 enhances resistance to sharp eyespot in

transgenic wheat. Journal of Experimental Botany 59, 4195-4204 (2008).

160

299. N. Dong et al., Overexpression of TaPIEP1, a pathogen-induced ERF gene of wheat,

confers host-enhanced resistance to fungal pathogen Bipolaris sorokiniana. Funct Integr

Genomic 10, 215-226 (2010).

300. B. Liu, Y. Lu, Z. Xin, Z. Zhang, Identification and antifungal assay of a wheat β-1, 3-

glucanase. Biotechnology letters 31, 1005-1010 (2009).

301. O. Lorenzo, R. Piqueras, J. J. Sánchez-Serrano, R. Solano, ETHYLENE RESPONSE

FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense.

The Plant Cell 15, 165-178 (2003).

302. M. Pré et al., The AP2/ERF domain transcription factor ORA59 integrates jasmonic acid

and ethylene signals in plant defense. Plant physiology 147, 1347-1357 (2008).

303. C. M. Pieterse, A. Leon-Reyes, S. Van der Ent, S. C. Van Wees, Networking by small-

molecule hormones in plant immunity. Nat Chem Biol 5, 308-316 (2009).

304. Z. W. Liu et al., Enhanced overall resistance to Fusarium seedling blight and Fusarium

head blight in transgenic wheat by co-expression of anti-fungal peptides. Eur J Plant

Pathol 134, 721-732 (2012).

305. S. Shin et al., Transgenic wheat expressing a barley class II chitinase gene has enhanced

resistance against Fusarium graminearum. Journal of experimental botany 59, 2371-

2378 (2008).

306. M. Janni et al., The expression of a bean PGIP in transgenic wheat confers increased

resistance to the fungal pathogen Bipolaris sorokiniana. Molecular Plant-Microbe

Interactions 21, 171-177 (2008).

307. K. H. Oldach, D. Becker, H. Lörz, Heterologous expression of genes mediating enhanced

fungal resistance in transgenic wheat. Molecular Plant-Microbe Interactions 14, 832-

838 (2001).

308. A. Juhász et al., Genome mapping of seed-borne allergens and immunoresponsive

proteins in wheat. Science Advances 4, eaar8602 (2018).

309. A. C. Vlot, D. M. A. Dempsey, D. F. Klessig, Salicylic acid, a multifaceted hormone to

combat disease. Annual review of phytopathology 47, 177-206 (2009).

310. K. Chao et al., Genetic and physical mapping of a putative Leymus mollis-derived stripe

rust resistance gene on wheat chromosome 4A. Plant Dis, (2017).

311. D. F. Gruis, D. A. Selinger, J. M. Curran, R. Jung, Redundant proteolytic mechanisms

process seed storage proteins in the absence of seed-type members of the vacuolar

processing enzyme family of cysteine proteases. The Plant Cell 14, 2863-2882 (2002).

312. T. Shimada et al., Vacuolar processing enzymes are essential for proper processing of

seed storage proteins in Arabidopsis thaliana. Journal of Biological Chemistry 278,

32292-32299 (2003).

313. G. L. Rosano, E. A. Ceccarelli, Recombinant protein expression in Escherichia coli:

advances and challenges. Recombinant protein expression in microbial systems 7,

(2014).

314. S. Gubatz, P. R. Shewry, S. Ullrich, The development, structure, and composition of the

barley grain. Barley: production, improvement, and uses 11, 391 (2010).

315. J. Royo et al., Two maize END-1 orthologs, BETL9 and BETL9like, are transcribed in a

non-overlapping spatial pattern on the outer surface of the developing endosperm.

Frontiers in plant science 5, (2014).

316. S. Campo, M. Carrascal, M. Coca, J. Abian, B. San Segundo, The defense response of

germinating maize embryos against fungal infection: a proteomics approach.

Proteomics 4, 383-396 (2004).

317. M. J. Chrispeels, N. V. Raikhel, Lectins, lectin genes, and their role in plant defense. The

plant cell 3, 1 (1991).

318. T. Schultz, University of Pretoria, (2011).

161

319. R. Panstruga, Establishing compatibility between plants and obligate biotrophic

pathogens. Current Opinion in Plant Biology 6, 320-326 (2003).

320. B. Louis, P. Roy, Engineered pathogenesis related and antimicrobial proteins weaponry

against Phytopthora infestans in potato plant: A review. Biotechnology and Molecular

Biology Reviews 5, 61-66 (2010).

321. R. E. Hancock, R. Lehrer, Cationic peptides: a new source of antibiotics. Trends in

biotechnology 16, 82-88 (1998).

322. J. Lacadena et al., Characterization of the Antifungal Protein Secreted by the

MouldAspergillus giganteus. Archives of biochemistry and biophysics 324, 273-281

(1995).

323. A. Zega, R. D'Ovidio, Genome-wide characterization of pectin methyl esterase genes

reveals members differentially expressed in tolerant and susceptible wheats in response

to Fusarium graminearum. Plant Physiology and Biochemistry 108, 1-11 (2016).

324. C. A. Mackintosh et al., Overexpression of defense response genes in transgenic wheat

enhances resistance to Fusarium head blight. Plant cell reports 26, 479-488 (2007).

325. C. Volpi et al., The ectopic expression of a pectin methyl esterase inhibitor increases

pectin methyl esterification and limits fungal diseases in wheat. Molecular Plant-

Microbe Interactions 24, 1012-1019 (2011).

326. Z. Li et al., Expression of a radish defensin in transgenic wheat confers increased

resistance to Fusarium graminearum and Rhizoctonia cerealis. Funct Integr Genomic

11, 63-70 (2011).

327. R. Di, A. Blechl, R. Dill-Macky, A. Tortora, N. E. Tumer, Expression of a truncated form

of yeast ribosomal protein L3 in transgenic wheat improves resistance to Fusarium head

blight. Plant science 178, 374-380 (2010).

328. A. Huffaker et al., Novel acidic sesquiterpenoids constitute a dominant class of pathogen-

induced phytoalexins in maize. Plant physiology 156, 2082-2097 (2011).

329. S. Jha, B. B. Chattoo, Expression of a plant defensin in rice confers resistance to fungal

phytopathogens. Transgenic research 19, 373-384 (2010).

330. R. W. Osborn et al., Isolation and characterisation of plant defensins from seeds of

Asteraceae, Fabaceae, Hippocastanaceae and Saxifragaceae. FEBS letters 368, 257-262

(1995).

331. J.-P. Blein, P. Coutos-Thévenot, D. Marion, M. Ponchet, From elicitins to lipid-transfer

proteins: a new insight in cell signalling involved in plant defence mechanisms. Trends

in plant science 7, 293-296 (2002).

332. M. Ponchet et al., Are elicitins cryptograms in plant-Oomycete communications?

Cellular and Molecular Life Sciences 56, 1020-1047 (1999).

333. C. Bolter, M. A. Jongsma, The adaptation of insects to plant protease inhibitors. J Insect

Physiol 43, 885-895 (1997).

334. A. Davy et al., Substrate specificity of barley cysteine endoproteases EP-A and EP-B.

Plant physiology 117, 255-261 (1998).

335. P. R. Shewry, J. A. Napier, A. S. Tatham, Seed storage proteins: structures and

biosynthesis. The plant cell 7, 945 (1995).

336. A. Levy, M. Feldman, Ecogeographical distribution of HMW glutenin alleles in

populations of the wild tetraploid wheat Triticum turgidum var. dicoccoides. Theoretical


337. A. Levy, G. Galili, M. Feldman, Polymorphism and genetic control of high molecular

weight glutenin subunits in wild tetraploid wheat Triticum turgidum var. dicoccoides.

Heredity 61, 63 (1988).

338. H. Poyarkova, Morphology, geography and infraspecific taxonomics of Triticum

dicoccoides Körn. A retrospective of 80 years of research. Euphytica 38, 11-23 (1988).

wheat grain avenin-like protein dynamics in relation to ... · the recently discovered non-gluten...

Documents