What is a Genetically

Modified Organism (GMO)? Would you ever eat a GMO?

A Genetically Modified Organism

is a living thing whose DNA has been altered by

humans.

Transgenic Organisms (Genetically Modified Organisms)

Transgenic Zebra Fish Reading

1. Actively read through quick article: Glowing Fish – First Genetically Modified Organism Available as a Pet

2. Class Discussion

How will the world be different when

you are your parent’s age?

JQ: If you could create a transgenic

glowing human, what would you

choose to trigger the human to glow?

Transgenic Zebra Fish Reading

1. Zebra Fish vs. GloFish?2. Transgenic?3. Promotor?4. Creating Transgenic?5. Estrogen vs. Stress

Induced Promotors?6. Ethical Issues?7. Avatar?

Using Glofish to study water pollution

Promoter: TATAGCTAGCC

DNA code before geneturns gene on or off

Normal Zebrafish DNA:AGTTATGACCTCATTCAGCGTATCT

Glofish Glows!ATCCTAGTATA

ATCCTAGTATA

AGTTATGACCTCATTCAGCGTATCTGlofish doesn’t glowATCCTAGTATAX X

How Did Scientists Engineer the Transgenic Glowfish? It is called DNA Microinjection

Glo Gene: ATCCTAGTATA

DNA code for glowing protein

ATCCTAGTATA Normal Zebrafish DNA:

AGTTATGACCTCATTCAGCGTATCTTransgenic Glofish!

Think back to the video

Journal Question : Should humans be altering the DNA of

organisms?

Nova: Harvest of Fear

Part 1 Part 2 Part 3 Part 4

If you could choose which traits your baby will have,

would you do it? Explain.

JQ: Do soul mates exist?

Explain.

JQ: What are enzymes, and why are they so important for living

organisms? You need your textbook today.

H2O + CO2 H2CO3

ReactantsProduct

What is an enzyme?Specialized proteins that speed up the rate of a chemical reaction by

lower its activation energy.

Structure of an Enzyme• Active Site – for

attaching onto reactants aka substrates

• The chemical(s) that enzyme attaches to is called the substrate.

• Highly specific with what they bind onto.

• Lock and Key analogy

Analogies for Enzymes

• Mentos and Diet coke

Active site? _______ Substrate? _______

• Stapler analogy Active site? _______ Substrate? _______

link

Essential Concept: Enzymes are involved in almost every

cellular process, including DNA replication

Read pages 300 - 303 in your text book, and answer

questions 1, 2, 5 on pages 303

JQ: Why does DNA need to replicate

itself?

What is DNA replication?

Replication is the process where DNA makes an exact copy of

itself. Why does DNA

replicate?

Original DNA

Building Blocks for new DNA

(Nucleotides)

DNA Helicase (Protein)

DNA Polymerase

(Protein)

2 identical pieces of DNA

DNA Replication Steps1. DNA Helicase (enzyme) splits open

double strand right through hydrogen bonds in the middle.

3. DNA Polymerase (enzyme) attaches free floating nucleotides to the open strands, making sure to proofread along the way.4. End product is two identical strands of DNA.

2. Binding Proteins holds two strands apart, so they don’t reattach to one another.

Where do the free-floating nucleotides come from?

Link

DNA Replication Play - Brainstorm1. What roles, or characters, will we need

to perform a play about DNA replication?

2. How will we form, or represent our DNA using people?

How do the enzymes make all this happen?

In order to break a bond within a molecule, a certain amount of energy must be used.

Reactants

ActivationEnergy

ProductsGlucose & Galactose

C12H22O11 C6H12O6 + C6H12O6

If you wanted that bond to break more easily, you would have to lower the amount

of energy it would require to break the bond. An enzyme can lower the “Activation

Energy” of a reaction

Reactants

ActivationEnergy

Products

Lactose

Glucose & Galactose

C12H22O11 C6H12O6 + C6H12O6

Reactants

Products

AE w/o Enzyme

AE w/ Enzyme

Reaction pathway with enzyme

Reaction pathway w/o enzyme

JQ: Why does your body sweat

& shiver? Okay I know what you will say, “to regulate body temperature.”

That is true, but why must you

do that?

Enzymes Only Work in Specific Conditions

Enzymes need the right

conditions to work In extreme

conditions they Denature –

change shape and don’t work

Toothpick Enzyme Activity

1. Read the Pre-Lab, and answer the pre-lab questions.

2. Read through the lab

3. Find a partner, and perform the lab

4. Clean up

5. Collect Class Data on Board

6. Answer Post-Lab Questions

Class Data:Name Normal Cold

Average

Name Normal Denatured (taped)

Average

Journal Question: What are three things that you are thankful for?

H2 + O2 H2OReactants Products

Energy-Absorbing Reaction

Bonds are formed

Activation energy

Reactants

Products

Energy-Absorbing Reaction

Potential Energy

•Energy at rest. Stored Energy.

H2 + O2H2O

Reactants Products

Energy-Releasing Reaction

Bonds are broken

Decomposition

Energy-Releasing Reaction

Products

Activation energy

Reactants

Kinetic Energy

•Energy in motion. Releasing energy.

Lactase Post Lab Discussion

1. What happens when you alter the environment of an enzyme?

2. What happens when you alter the active site of an enzyme?

HomeostasisNegative feedback systems &

positive feedback systems

Welcome to the day you’ve been

preparing for all semester long.

You have 10 minutes to prepare for your

presentation.Please hand in the

presentation rubrics you were given.

Good Luck!-Romanoffski

Why can’t scientists just

inject your arm today with glo-fish genes and

have you glow?

Review DNA Model

1. Monomer & Polymer

2. Sides vs. Center3. Base pairing4. Hydrogen

Bonding5. # of DNA strands6. Antiparallel7. Helix8. Function9. Genes

What does a typical day look like for a

cell?

When does a cell divide? Is it the same for every

cell?

Cell Type Life Span Cell Division

Red Blood Cell Less than 120 days

NO

Skeletal Muscle Long-lived NOLining of

Esophagus2-3 days Yes

Stomach Cell 2 days YesNerve Cell Very Long

Lived??Most Do Not

Sperm Cell 2-4 days outside the

body

Yes

How long do certain cells live within your body?

Let’s take a look at the

life cycle of a somatic cell!

1.All body cells except sperm or egg cells

2. Somatic cells are Diploid Cell

What is a somatic cell?

# of sets

# of DNA pieces in each set

What is a diploid cell?

N = 23; 23 pieces from MOM & 23 from DAD

What would a human somatic cell look like?

Dad’s & Mom’s Chromosomes are homologous – meaning they match up.

Dad’s Chromo.

Mom’s Chromo

Eye Color Gene

Blue EyesBrown

Eyes

What is unique about mom and dads chromosomes?

JQ: Do you think humans will ever become immortal? Would you want to

live forever?

Karyotype – shows an organism’s homologous chromosomes in order

How is this karyotype different from the first?

JQ: No Journal Question today.

Hand in your Group’s Avatar Scientific Paper

JQ: Why would our cells need to make more

of themselves? Give specific examples.

JQ: What is the most prized

thing that you own? Explain.

What does the cell cycle look like?

Two Parts: 1. Interphase 2. m-phase

Cell Cycle Visual Non-Audio Version

M-phase

Part 1: Interphase – Cell growth, DNA

replication and Preparation for

Division

Part 2: M-phase – Division of Nucleus

& Cytoplasm

Mitosis is the division of the nucleus (DNA).

Cytokinesis is the division of the cytoplasm (cell).

After Interphase? After

Mitosis?After

Cytokinesis?

M-phase

9246

46

4646

•Animal cell – cell membrane pinches in forming a cleavage furrow = 2 new cells

How does cytokinesis work?

•Plant cell – cell plate (membrane & wall) forms between two cells = 2 new cells

How long does it take to make a new cell?

If Dr. Evil and mini me’s

cells are the same size, what make

them different?

Large cells require too

many proteins to be made at

the same time. DNA

cannot keep up.

1. DNA Overload

Big cells demand more nutrients

and produce more waste, but do not

have enough roadways to get the nutrients in and waste out

efficiently.

2. Supply and Demand Issues

What could she grow up

to be? Explain.

Stem Cells:Cells that haven’t turned into a specific cell type yet (they’re undifferentiated)

Once a stem cell becomes particular cell type (heart cell, liver cell, lung cell) it is called Differentiated

All of the somatic cells in your body have the same DNA in them, and the same genes in them

Not all 20,000 genes are turned on at the same time maybe 5,000 at a time

Example: heart cell has different genes turned on than liver, muscle, or brain cell.

How does a stem cell turn into a specialized cell?

Stem Cell Video

Stem Cells

Please read the article and answer the questions to

follow

Cancer and Cell Phones

JQ: What is Interphase? Recap what

occurs during interphase.(Take out

your homework)

How does a cell know when to

divide? Every cell

contains proteins called cyclins

which monitors external and

internal activity, and communicate to cells when it is

time to make a new one.

Cell Cycle! Making new

cells.

JQ: Do children really need

parents? Explain.

P53

Cyclin & CDK the protein

supervisors of the cell cycle!

JQ: Propose a way that we

can stop cancer. (Think outside the box. There are no silly

ideas)

Retinal Cancer

Cancer is the uncontrolled cell

growth of abnormal cells in

the body.

What is cancer?

How do cells become

abnormal?•Cyclin is a protein that turns the cell cycle on and off.

• If the gene for cyclin is mutated, or cell’s ability to respond to cyclin fails, cancer can occur

How do cells become

abnormal?• DNA miscopying• Exposure to mutagens – agents that can mutate DNA

Examples: Food, UV Rays, Tobacco products, viruses, non-stick pans, chemical carcinogens, cell phones?

mutation causes cell to lose its ability to start and

stop cell replication.Cyclin is Sleeping

continual cell growth will lead to a

mass of cells called a tumor.

What types of tumors exist?

Fast growing and are likely to

spread to other parts of the body

and cause problems

(metastasize – when a tumor spreads)

Malignant Tumors

Slow growing and do not

metastasize. ISOLATED

Benign Tumors

Warning: Graphic Content

Cancer Treatment Activity:Cancer treatment has come a long way, but we still have

much more work to do as a species. Cancer is the leading cause of death worldwide

I will assign you and a partner one of the following treatments: Radiation, Chemotherapy, Targeted therapy, transplants, gene therapy

Using your smartphone/electronic device, access this website: http://www.cancer.gov/cancertopics/treatment/types-of-treatment

Write answers the following questions, and be prepared to explain them to the class next time. A few sentences for each.

1. What is your treatment?2. What does it do?3. How does it work?4. What are the side effects?5. Other important / interesting information?

Please read the article and answer the questions to

follow

Cancer and Cell Phones

If all of your diploid cells

have the same DNA in it, then what makes a

skin, heart, lung, and brain

cell so different?

Journal Question:

JQ: If humans make 2.5x10^7 cells per minute, how many will they make in 1

hour? Place answer in scientific notation.