welcome to the webinar - eurofins genomics€¦ · microsoft powerpoint - eurofins webinar 23042013...

30

Upload: others

Post on 23-Jul-2020

3 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15
Page 2: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Welcome to the webinar:

TINA - Twisted Intercalating Nucleic Acid

Improve the efficiency of your stressed PCR

Page 3: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA - Twisted Intercalating Nucleic Acid

Improve the efficiency of your stressed PCR

Dr. Jutta HuberManaging Director

Eurofins MWG GmbH

Page 4: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Introduction• Eurofins MWG Operon is serving a large global customer base as provider for

oligonucleotides which are used in

– Research and development

– Kit components

– Diagnostic assays

• As a member of the Eurofins Scientific group we have an intensive exchange on

performance criteria for

– PCR assays and assay developments

– GMO and food testing

– Forensic and regulatory requirements

Page 5: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Our Focus in DNA Synthesis

• Bridging know-how in chemistry to applications.

• Adapting synthetic procedures to best performance results in specific applications –

“Optimised Application Oligos”.

• Finding new interesting molecules which can contribute to better results and efficiency in

a diversity of applications.

Page 6: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Cooperation with QuantiBact Inc.

• QuantiBact is developing novel amplification and quantification procedures utilising

nucleic acid intercalators, such as TINA.

• Eurofins MWG Operon is happy to be the preferred supplier for TINA modified

oligonucleotides.

• We are pleased to work with QuantiBact and our customers to identify interesting

applications where TINA can make a difference.

Page 7: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA - Twisted Intercalating Nucleic Acid

Improve the efficiency of your stressed PCR

Gorm Lisby, MD PhDSenior Vice President, Founder

QuantiBact, Inc.

Page 8: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

PCR

- frequent challenges….

Page 9: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

- primer-limiting situations

- complex sample material

- multiplexing

Page 10: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

PCR with TINA-modified Primers

Page 11: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA primers

• 5´ modification• Re-design of primers not necessary• Works with end-point as well as Real-time PCR• Increases “on-time” in primer/template hybridization• Protects primers against exonucleases• Stability and storage as conventional DNA primers• Tested successfully with many different buffer/enzymes• Available from Eurofins MWG Operon

Page 12: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Twisted Intercalating Nucleic AcidTINA

Page 13: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA-PCRPCR components

TINA intercalator

5´ATAATCGACGTACGAGTC3´

3´CGCATTACGTGACTCATC 5´

3´………TATTAGCTGCATGCTCAG………………………………CGCATTACGTGACTCATC……………5´

5´………ATAATCGACGTACGAGTC………………………………GCGTAATGCACTGAGTAG……………3´Target

Forward primer

TINA intercalator

Reverse primerPlus:

PCR buffer

Nucleotides

DNA polymerase

z

z

Page 14: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA-PCRPCR amplicons

TINA intercalator

ATAATCGACGTACGAGTC………………………………GCGTAATGCACTGAGTAGTATTAGCTGCATGCTCAG………………………………CGCATTACGTGACTCATC

PCR amplicon

TINA intercalator

zz

Page 15: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA-modified Primers

Impact on Annealing TemperaturePrimer Concentration

Page 16: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Effect of annealing temperature and different primer concentrations

Page 17: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA-modified Primers

Impact on Design Flexibility

Page 18: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

• Preliminary singleplex PCR test of “xxx” primers• Annealing gradient from 55 to 70°C.• TINA primers increase annealing:

HPLC DNA primers HPLC TINA primers (2bp shorter)HPLC TINA primers

TINA PCR

Page 19: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA-modified Primers

Impact on PCR Efficiency

Page 20: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Streptomyces detectionComparison of amplification curves with TINA-modified primers (high fluorescence) and non-modified primers (low fluorescence), detection with SYBR Green - 500.000 to 50 target copies. All negative controls were negative (data not shown).

50 target copies, DNA primers Cq = 35

50 target copies, TINA primers Cq = 27

5 target copies, DNA primers

5 target copies, TINA primers

Page 21: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA-modified Primers

Impact on Multiplex PCR

Complex sample material

Page 22: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

crud

e10 10

010

0010

000

NC

crud

e10 10

010

0010

000

NC

rrselt

estAhUnmodified

primers5’-TINA mo-

dified primers

500400

300

200

100

1000 bp

Octaplex end-point PCR by unmodified primers and 5’-TINA modified primers. The red box highlights the lack of amplicons for the estAh gene with unmodified primers. 10-fold target dilution series for an Escherichia coli strain entailing three of eight target genes. Assay with unmodified primers published by Brandal et al, J Microbiol Meth (2007) 68:331-341

TINA Multiplex PCR

Page 23: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Multiplex PCRcomplex test material

• Soil• Feces

Page 24: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA Multiplex PCRDegenerate Primers

TINA improves:multiplex PCR efficiency - from 82.6% to 95.6%multiplex PCR sensitivity - from Cq=27.0 to Cq=25.5 (103 copies)

TINA primersDNA primers 25.527.0

Page 25: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Direct detection of DEC in feces with Multiplex TINA-PCR Assay

Laboratory workflow:Total turn-around time: 2.5 hrs

Standardsampling

Patient

Transport tolaboratory

Multiplex TINA-PCRwith MagPlex beads

Simple lysisat 95CTurn-around Time

Sample prep.

PCR prep.

PCR run

MagPix detc.

Page 26: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Standard PCR

Cliffhanger

05

10152025

30

35

40

45

stx1eae

estAhestAp

rrs(internalcontrol)

ipaHelt

stx2

No. of p

atients

stx1 eae estAh estAp rrs(internal control) ipaH elt stx2

Standard PCR 1 12 1 1 44 1 1 0Cliffhanger 3 19 3 6 44 6 10 2

Cliffhanger vs. Current Gold Standard PCR

All ”Standard PCR” positive samples were also tested positive by Cliffhanger

Page 27: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

TINA PCR - ConclusionImproved PCR efficiency

• No need for special primer design, just add TINA to the 5´ terminal position of the priming sequence

• Works with end-point as well as Real-time PCR• Increases Ta and decreases C primer• Increased freedom of primer design• Improves PCR efficiency whenever primers are limiting• Improves sensitivity• Faster cycling parameters

Improved PCR robustness• Protects primers against exonuclease activity

Improved multiplexing• Improved efficiency and sensitivity of multiplex PCR

Page 28: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

When to use TINA-modified primers

When you need a more efficient PCR- the primers are limiting the reaction

- you need design freedom (e.g. shorter primer)

- you want to shorten the PCR cycle parameters

- you want to use more stringent buffers (low salt buffer)

When you are working with “complex” test material- you are testing impure sample material (you need robustness)

- you are designing degenerated primers

When you are designing multiplexed PCR assays- you are designing a multiplex real-time PCR

- you are designing a multiplex end-point PCR

Page 29: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15

Thank you for your attention!

We are looking forward to your questions:

Dr. Jutta HuberManaging Director

Eurofins MWG GmbH

Gorm Lisby, MD PhDSenior Vice President, Founder

QuantiBact, Inc.

Ursula DoerProduct Manager

Eurofins MWG GmbH

Page 30: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15