Supplementary Information

Supplementary information is provided in three files: a word file containing materials and methods, phylogenetic analysis results, legend to supplementary figures 1, 2, 3, 4, 5, 6, 7 and 8; supplementary tables 1, 2 and 3, sequences of Skeletonema marinoi transcripts of the prostaglandin pathway reported in the main text; a word file with the sequences used in the phylogenetic analysis; eight pdf file containing the supplementary figures 1, 2, 3, 4, 5, 6, 7 and 8.

Supplementary information: file 1.

Content: materials and methods, phylogenetic analysis results, legend to supplementary figures 1, 2, 3, 4, 5, 6, 7 and 8; supplementary tables 1, 2 and 3; sequences of Skeletonema marinoi transcripts of the prostaglandin pathway reported in the main text.

Materials and Methods

Bioinformatic identification of the Prostaglandin pathway

Transcriptome sequencing of Skeletonema marinoi stain FE7 and FE60 (MMETSP1039 and MMETSP1040 respectively) were obtained thanks to the Marine Microbial Eukaryote Transcriptome Sequencing Project initiative, by the National Centre for Genome resources (NGR) (Santa Fe, New Mexico, USA), supported by the Betty and Gordon Moore Foundation (www.moore.org). Sequences are now freely available in the public database CAMERA (http://camera.crbs.ucsd.edu/mmetsp/list.php) and iMicrobes interactive query tool for microbial data (http://data.imicrobe.us/sample/view/1867 http://data.imicrobe.us/sample/view/1868).

To identify expressed metabolic pathways, Skeletonema marinoi FE7 and FE60 contigs were submitted to the Kyoto Encyclopaedia of Genes and Genome (KEGG) Automatic Annotation Server (KAAS, http://www.genome.jp/tools/kaas/) as Complete or Draft Genome using bi-directional best hit assignment method and adding to the default organisms the following others: Phaeodactylum tricornutum, Thalassiosira pseudonana, Ostreococcus lucimarinus, Ostreococcus tauri and Cyanidioschyzon merolae. Enzymes involved in prostaglandin synthesis were found annotated in map 0590 relative to arachidonate metabolism (Supplementary Figure S1). The protein sequence annotated as prostaglandin transporter was found exploring the annotation list obtained using Blast2go PRO software (http://www.blast2go.com/b2ghome) with default parameters. Phytoplankton cultures

The two Skeletonema marinoi strains, FE7 and FE60, were isolated from phytoplankton samples collected during diatom blooms in the northern Adriatic Sea in 1997 and 2005, respectively (Gerecht et al., 2011). Three replicate cultures of each clone, with initial cell concentrations of 5000 cells/mL, were grown in f2-medium (Guillard, 1975) in 10 lt polycarbonate bottles under gentle bubbling with sterile-filtered ambient air and kept in a climate chamber at 20C on a 12:12 light: dark (L:D) cycle at 100 mol photons m-2 s-1. Culture growth was followed in each replicates by daily cell enumeration in a Sedgewick-Rafter counting chamber (Hausser Scientific, Horsham, PA, USA), up to the 11th day from the inoculation. All cultures were harvested always at the same time of the day in order to avoid interference due to circadian variability. Samples were collected on day 4, 7 and 11 representing exponential, stationary and senescent phases of the growth curve, respectively (Supplementary figure S2). Cultures were concentrated by centrifugation in a cooled centrifuge at 2753g for 15 min with a swing-out rotor (DR 15P, Braun Biotechnology International, Allentown, PA, USA), immediately frozen in liquid nitrogen, and kept at -80C until analysis.

Silica starvation experiment were conducted in triplicates as described in Orefice et al. (Orefice et al., 2015).

RNA extraction and reverse transcription

Total RNA was extracted from 500 ml of cultures harvested at day 4 and 300 ml of cultures harvested at days 7 and 11. Each pellet was treated following the procedure described in Barra et al. (Barra et al., 2013). DNase treatment was carried out using DNAse I recombinant, RNAse-free (Roche, Basel, Switzerland) method according to manufacturer's protocol to eliminate potential genomic DNA contamination. Total RNA sample was purified and concentrated using RNeasy MinElute Cleanup Kit (Qiagen, Venlo, Netherlands) and eluted in 20 l RNase-free water. Concentration of the resulting RNA samples was assessed by absorbance at 260 nm (ND-1000 Spectrophotometer; NanoDrop Technologies, Wilmington, DE, USA). The integrity of total RNA was checked with agarose gel electrophoresis. From each RNA sample 1g was retro-transcribed in the T100 Thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA) following the manufacturer's instructions of the sensiFAST cDNA synthesis kit (Bioline, Cat. No. BIO-65054).

Primer design and real time quantitative pcr

Transcript of interest were selected considering the annotation of the putative protein sequences reported in the transcriptome of S. marinoi strain FE7 from CAMERA: MMETSP1039-20121108|4563_1 Prostaglandin G/H synthase 1/2 (Ptgs 1/2) or cyclooxygenase-1 (COX-1), MMETSP1039-20121108|5744_1 Prostaglandin E synthase 2 (PtgEs), MMETSP1039-20121108|1431_1 Glutatione S-transferase o Prostaglandin H2 D-isomerase (PtgHi or PtgDs), MMETSP1039-20121108|17278_1 Prostaglandin Transport (PtgT).

Primers, designed using Primer3 program V. 0.4.0 (Untergasser et al., 2012; Koressaar and Remm, 2007), are:

COX-1: Ptgs_F: GGGTGGGATGATGAACGTGT; Ptgs_R: AAGGACCTGGCTCGACTTTG; PtgEs: PtgEs_F: GAGTTGAAACCATGGTCAGGAG; PtgEs_R: TGTGTATCAAGTAGCGCATCG; PtgDs or PtgHi: PtgHi_F: AAAAGAATGGCGGAGTGGGA; PtgHi_R: GTCGCCACAATACCCGCATA; for PtgT: PtgTr_F: GGAGAGCATTGGAGTCAGCA; PtgTr_R: TTCGCCACCCTCTGAAATGT.

Each sequence was initially tested by standard PCR. Reactions were carried out in 25 l volume with 2,5 l of 10 PCR reaction buffer (Roche, Basel, Switzerland), 2,5 l of 10 2 mM dNTP, 0.2 l of 5 U/l Taq (Roche, Basel, Switzerland), 1,25l 10 of each oligo, 1 l of cDNA templates and nuclease-free water up to 25 l. The PCR program consisted of a denaturation step at 95 C for 3 min, 40 cycles at 95 C for 30 s, 53 C 30s, 72 C for 30s, and a final extension step at 72 C for 7 min. Amplified PCR products were analysed by agarose gel electrophoresis. The resulting bands were excised from the gel and extracted according to the GenElute Gel Extraction Kit protocol (Sigma-Aldrich, St. Louis, MO, USA). Sequences were obtained by BigDye Terminator Cycle Sequencing Technology (Applied Biosystems, Foster City, CA, USA) and purified using the Agencourt CleanSEQ Dye terminator removal Kit (Agencourt Bioscience Corporation, Beverly, MA, USA) in automated robotic station Biomek FX (Beckman Coulter, Pasadena, CA, USA). Products were analysed on the Automated Capillary Electrophoresis Sequencer 3730 DNA Analyser (Applied Biosystems, Foster City, CA, USA). Alignments were performed with BioEdit software V. 7.0.5.3 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html).

Selected reference genes were ribosomal protein small subunit 30S (RPS), actin (ACT) and ubiquitin (UB) which were the best reference genes in Orefice et al. (Orefice et al., 2015).

Reverse transcription-quantitative PCR (RT-qPCR) experiments were performed in MicroAmp Optical 384-Well reaction plate (Applied Biosystems, Foster City, CA, USA) with Optical Adhesive Covers (Applied Biosystems, Foster City, CA, USA) in a Viia7 Real Time PCR System (Applied Biosystem, Foster City, CA, USA). Five serial dilutions of mixed cDNAs were used to determine primer reaction efficiency (E= 101/slope) that for each oligo couple was two. The PCR volume for each sample was 10l, with 5l of Fast Start SYBR Green Master Mix with ROX (Roche, Basel, Switzerland), 1l of cDNA template (1 to 5 dilution each template) and 1l of 10M oligo mix (forward and reverse). Program reaction used was: 95C for 20s, 40 cycles of 95C for 1s and 60C for 20s. The program was set to reveal the melting curve of each amplicon from 60C to 95C, and read every 0.5C. Single peaks for all genes confirmed gene-specific amplification and the absence of primer-dimers. All RT-qPCR reactions were carried out in triplicate to capture intra-assay variability. Each assay included three no-template negative controls for each primer pair.

The expression levels of each gene of interest relative to the most stable reference genes were calculated by using the REST tool (Relative Expression Software Tool) (Pfaffl et al., 2002). The evaluation of gene expression along the growth curve of S. marinoi, was calculated considering the exponential phase at the fourth day of the growth curve as the reference condition.

Data are represented in graph as log2 x-fold difference in the expression level of the analysed genes in the stationary (Day7) and senescent (Day11) phases compared to the control exponential phase (Day4). Results of silica starvation experiment are reported as log2 x-fold difference in the expression level of the analysed genes for each growth phase under silica starvation with respect to the corresponding phase in standard culturing conditions (control: complete medium). Relative expression ratios above two fold were considered significant. Statistical analysis was performed using the Pair Wise Fixed Reallocation Randomisation test by REST.

Prostaglandin extraction

500 ml of cell culture from day 4 and 300 ml of cell culture from days 7 and 11 were harvested by centrifugation at 2753g for 15 minutes. The pellets were re-suspended in 1 ml PBS per gr wet weight, added with 1g of Prostaglandin E2-d4 (CAYMAN CHEMICAL, Michigan, USA) as internal standard and sonicated with 1-minute pulse, 30 seconds on ice and another 30 seconds of pulse at 20% of maximum intensity. After sonication, an aliquot of 50 l was taken to measure proteins concentration by Bradford assay (PanReac AppliChem, product code A6932). Samp