DNA Transcription and Translation

DNA is the genetic code of life. It stores the directions necessary for the cell to make proteins. However, this information is written in a language our cells cannot understand and locked tightly in the nucleus where organelles cannot reach it. To make this information accessible to our cells, the DNA must be opened and written in a language cells can understand. These processes are called transcription and translation. This is the central dogma of biology:

Transcription (DNA RNA):________________________ is the process of copying a short segment of DNA into _________________ using the enzyme called _________________________. We know this is an enzyme because it ends in the letters ______________. This process occurs in the ____________.

____________ is a ________________________ nucleic acid with a sugar-phosphate backbone. Unlike DNA, RNA uses ______________________ as its sugar (instead of deoxyribose) and the bases adenine, guanine, cytosine and __________________. Note – thymine is unique to DNA. The monomers of RNA are called ____________________. There are three types of RNA:

1. ____________________________2. ____________________________3. ____________________________

The cellular process transcription has three steps:1. _____________________________2. _____________________________3. _____________________________

DNA RNA Protein

In the first step the enzyme __________________________ binds to the antisense (3’ to 5’) strand, also called the template strand, of DNA at a location called the _____________________________. This is called the promoter sequence because it promotes replication. RNA polymerase begins to ___________________ DNA so the genetic code (also called ____________________) are accessible.

Why is it called the antisense strand? Is there a sense strand too?

In the second step __________________________ (mRNA) is built. This is the transcript that will take the instructions outside of the cell to the ________________ that build proteins. RNA polymerase builds mRNA by matching _____________________ to those on the antisense strand of DNA.

In DNA A pairs with T, but there is no T in RNA. Which base in RNA pairs with the A from DNA?

In the third step RNA polymerase stops building mRNA when it reaches the ________________ ______________________. The completed mRNA transcript detaches from the DNA, and the double helix closes tightly again. The mRNA transcript leaves the nucleus through ________________________ and goes to the ___________________ where it will be translated into proteins.

How is mRNA like a transcript or a text message? Explain in your own words.

How are DNA and RNA similar and different? DNA RNA

Sugar

Bases

Number of Strands

Function

Translation (RNA Protein):__________________ is the process of translating ______________ into ________________. This process takes place in the ________________ and uses the organelles called ________________. Ribosomes are made of _________ and have _______ subunits called the small subunit and the _____________ subunit.

The cellular process translation has three steps:1. _____________________________2. _____________________________3. _____________________________

When the newly made mRNA enters the cytoplasm it is grabbed by a ___________________. This is the initiation step of translation. The ribosome scans the mRNA for the _______________________ with the letters ________. mRNA is always read _______ letters at a time. These letters are called __________________ because they code for specific ______________________________.

In step two the ribosome will continue to build the protein by matching ______________ with the correct ______________________ to the codons on the mRNA template. The tRNA brings with it an ___________________ which bind together to make a ________________________ chain which is also called a protein.

The ribosome continues to read the mRNA building a long chain of amino acids. In the third step, the ribosome encounters a _____________________________ and detaches from the mRNA releasing the newly made protein into the _______________________. The protein will then go to another location in the cell where it will be modified before it can serve its purpose.

Proteins are also called polypeptides because they form a chemical bond between amino acids called a _________________________.

What organelles are involved with protein building and modification?

Use this interactive lesson from PBS media to practice transcription and translation http://www.pbslearningmedia.org/resource/lsps07.sci.life.stru.celltrans/cell-transcription-and-translation/

Transcription and Translation Practice - Answer the questions below

Where in the cell does transcription take place?

Where in the cell does translation take place?

What does a codon do?

What is in charge of bringing the amino acids to the ribosomes? How does this work?

How are amino acids and proteins related?

Translating proteins: Use your codon chart to translate codons into amino acids.

UAG: AAU: GCC: CGGUAC:

Transcribing and Translating:

DNA: TAAGCTACCTTCGCATGGCATGCATC

RNA:

Find the start codon. Now, read the mRNA one codon at a time left to right, circling the codons ad you go. Use your codon chart to write the amino acid chain below.

Amino Acid Chain:

DNA: ATTACCATGTGGACAACATCCT

RNA:

Amino Acid Chain: