Supplementary Figure 1. Kinome siRNA screening and target selection.

(A) Schematics of reverse transfection, irradiation, and CCK-8 assay of kinome-wide siRNA

screening. (B) The result of the secondary screening using 4 individual siRNAs targeting

candidate kinases identified by the primary screening. SF4 = cell viability at 4 Gy/cell viability at

0 Gy. Red dots, A549 cells; black dots, MiaPaCa2 cells. (C) FES protein expression after various

times of irradiation in MiaPaCa2 and A549 cells. γH2AX was used as a positive control.

1

Supplementaryl Figure 2. Radiosensitizing effect of FES knockdown in MiaPaCa2, Panc1,

and normal cells. (A) Cell viability of FES or control siRNA transfected MiaPaCa2 cells

assessed by CCK-8 assay after irradiation at the indicated doses (N = 3). Data were normalized

to non-irradiated cells of each siRNA condition. (B) Cell viability of FES or control siRNA

transfected Panc1 cells assessed by CCK-8 assay after irradiation at the indicated doses (N = 3).

Data were normalized to non-irradiated cells of each siRNA condition. (C) Clonogenic cell-

survival curves of irradiated MiaPaCa2 cells (N = 3). (D) Clonogenic cell-survival curves of

irradiated Panc1 cells (N = 3). (E) Clonogenic cell-survival curves of irradiated normal human

astrocytes (NHA) (N = 2). (F) Clonogenic cell-survival curves of human embryonic kidney 293

cells (HEK293T) (N = 2). All values are mean ± SEM. Asterisks indicate statistical significance

between control siRNA and FES-siRNAs; *p < 0.05, **p < 0.01, ***p < 0.001.

2

Supplementary Figure 3. Cell viability and apoptosis analyses of FES knockdown cells.

(A) Western blot analysis showing a reduction of FES after transfection of FES siRNAs. (B)

Viability of FES or control siRNA transfected cells assessed by CCK-8 assay 3 days after

transfection without irradiation (N = 3). (C) Apoptotic cell count 3 days after transfection of FES

or control siRNA without irradiation (N = 3). (D) Western blot analysis of apoptosis-related

factors. Cells transfected with FES or control siRNA were irradiated with 4 Gy, and then protein

was extracted 6 h after irradiation.

3

Supplementary Figure 4. Sanger sequencing validation of FES-knockout (KO) A549 cell.

4

Supplementary Figure 5. Results of in vivo xenograft assay of FES-wild type (WT) and

FES-knockout (KO) A549 cells, and in vitro validation of the inducible knockdown system.

(A) Representative growth curves of A549 xenograft tumors in Balb/c-nude mouse. Tumor

volume of each group (n= 3 mice) is shown. (B) Photos of xenograft tumors at 37 days after

implantation (representative results from three independent experiments). Red circles indicate

xenograft tumors. (C) Quantitative PCR of relative FES gene expression with or without

doxycycline in lentiviral transduced A549 cells (N = 2). (D) Knockdown of FES at the protein

level after doxycycline treatment. (E) Viability of A549 cells with or without doxycycline after 6

Gy irradiation (N = 3). All values are mean ± SEM. Asterisks indicate statistical significance; *p

< 0.05, **p < 0.01.

5

Supplementary Figure 6. Kaplan-Meier survival curves analyzing an association between

FES gene expression and patient survival. Data were acquired from the Cancer Genome Atlas

(TCGA) database. (A) Glioblastoma (GBM), (B) Low grade glioma (LGG), (C) Lung squamous

cell carcinoma (LUSC), (D) Lung adenocarcinoma (LUAD), (E) Pancreatic adenocarcinoma

(PAAD), and (F) Pooled analysis integrating above five cancers. FES gene expression values

were divided by median cutoff in all panels. TPM, transcript per million mapped reads; HR,

hazard ratio.

6

Supplementary Figure 7. Effects of FES depletion on irradiation-mediated cell-cycle arrest,

mitotic catastrophe, and DNA damage. (A) Cell-cycle distribution assay assessed by flow

cytometry. (B) Representative results of immunofluorescent staining to assess mitotic

catastrophe. Cells were stained with anti-tubulin antibody (red) and nuclei were visualized with

DAPI (blue) in control and FES knockdown cells 48 h after 4 Gy irradiation (scale bar 30 μm).

(C) Representative results of immunofluorescent staining for γH2AX foci (green) and DAPI

(blue) in control and FES knockdown cells 6 h after 4 Gy irradiation (scale bar 30 μm). (D)

Quantification of the number of mitotic catastrophic cells after transfection of FES or control

siRNA without irradiation (N = 3). (E) Quantification of γH2AX positive cells after transfection

of FES or control siRNA without irradiation (N = 3). All values are mean ± SEM. (F)

Representative results of comet assay 6 h after 4 Gy irradiation (scale bar 30 μm). DNA was

stained with VistaGreen DNA Dye.

7

Supplementary Figure 8. FES depletion promotes reactive-oxygen species (ROS)

production and the S6K-MDM2-p53 pathway activation. (A) Quantification of the MRE11

positive cells after various times of irradiation (N = 3). (B) Western blot analysis of DNA repair

proteins in FES-WT and FES-KO A549 cells (C) Flow cytometry analysis of total cellular ROS

contents with or without FES siRNA transfection. Red, control siRNA; Cyan, siFES-1; yellow,

siFES-2. (D) Western blot analysis of the S6K/MDM2/p53 pathway inFES-WT/KO A549 cells.

Cells were irradiated with 4 Gy, and then protein was extracted 6 h after irradiation. In lower

panel, nuclear fractions (nuc) 24 h after irradiation were used. (E) Effect of selective S6K

inhibition by PF-4708671 with or without FES-depletion on the cell viability of irradiated tumor

cells (N = 3). KO, knockout; KD, knockdown; S6Ki, S6k inhibition by PF-4708671. All values

are mean ± SEM. Asterisks indicate statistical significance; *p < 0.05.

8

Supplementary Figure 9. A schematic model for a FES inhibition-mediated radiosensitizing

mechanism.

9

Supplemental methods

Irradiation. Cells were irradiated at a dose rate of 2.16 Gy/min using a Cs-137 irradiator

(Gammacell 3000 Elan, Best Theratronics) or using 6 megavoltage photon beams from linear

accelerator (Clinac IX, Varian Medical Systems). Dosimetric quality assurance was performed

using nanoDots (Al2O3:C) optically stimulated luminescence dosimeters (Landauer), which

were read using a MicroStar OSL reader (Landauer).

Cell viability assay. CCK-8 assay was performed to assess the cell viability. Cells were

irradiated with different doses (0, 2, 4, and 6 Gy), seeded in 96-well plates, and incubated for

three to seven days. Then CCK-8 reagent was added and incubated for 2 h. A VERSAmax

Microplate reader (Molecular Devices) was used to measure the absorbance at a wavelength of

450 nm.

Clonogenic assay. Clonogenic survival assays were performed as previously described

(1). Briefly, cells were transfected, trypsinised after 48 h, irradiated with a dose of 0, 2, 4, and 6

Gy, and plated into 6-well culture plates. After 10 to 14 days incubation, the resulting colonies

were fixed with methanol/acetic acid and stained with 1% crystal violet solution. those that

contained >50 cells were counted using ImageJ software (version 1.50, NIH). The surviving

fraction (SF) was fitted to a linear-quadratic model, and survival curves were generated. The

increased sensitizer enhancement ratio at 0.1 (SER0.1) was defined as the ratio of the dose at SF

0.1 without FES knockdown to that with FES knockdown.

Apoptosis and cell-cycle distribution assay. Apoptosis levels were measured according

to the manufacturer’s protocol using a fluorescein isothiocyanate-Annexin V Apoptosis

Detection kit (BD Biosciences). The cells were harvested and stained with 10 μl PI (2.5 mg/ml)

and 5 μl Annexin V. After 15 minutes incubation, the cells were analyzed using flow cytometry

10

(BD Biosciences). The positive annexin-V cells representing early/late apoptosis were used to

calculate the rates of apoptotic cells. For the cell-cycle distribution assay, cells were transfected

with FES-siRNAs or control-siRNA for 48 h prior to 4 Gy irradiation. After 24 h of irradiation,

cells were harvested and fixed for 2 h with cold 70% ethanol. The cells were labeled with PI 2

mg/ml and incubated at 37’C in the dark for 30 m. Then the cells was analyzed by flow

cytometry. Data was analyzed by FlowJo V10 software.

Immunofluorescence staining and mitotic catastrophe. Cells were grown in eight-well

Lab-Tek II chamber slides (Nunc), irradiated, and fixed with 4% paraformaldehyde for 8 min.

After removing fixative and rinsing cells with PBS, they were incubated with blocking solution

(PBS with 5% FBS, 0.02% sodium azide, and 0.3% Trixon-X-100) for 10 m at RT. Then, cells

were incubated with primary antibodies at RT for 1 h, with Alexa Fluor 488- or 594-conjugated

secondary antibody (Thermofisher) at RT for the next 1 h. Cells were covered with mounting

solution (75% glycerol, 20 nM Tris, and 0.02% NaN3) containing 0.5 μg/ml 4, 6,-diamidino-2-

phenylinidole (DAPI, Sigma-Aldrich-Aldrich) for fluorescence microscopic imaging.

DeltaVision Spectris Imaging System (Applied Precision) equipped with an Olympus IX70

inverted microscope was used for immunofluorescence image acquisition. For γH2AX

quantification, foci were counted in at least 100 cells in each condition. The mitotic catastrophe

was characterized as cells with multilobulated giant nuclei and cells with abnormal mitoses,

which were visualized with α-tubulin antibody. At least 100 cells per group were counted, and

three independent experiments were performed.

Western blotting. Cells were lysed on ice in RIPA buffer (20 mM HEPES, 150 mM

NaCl, 1% NP-40, and 0.25% sodium deoxycholate, and 10% glycerol) supplemented with

Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher). After sonication and

11

centrifugation, protein concentrations of cleared lysates were quantified with Pierce BCA Protein

Assay Kit (Thermo Fisher). Lysates were loaded on SDS-polyacrylamide gels and transferred

onto nitrocellulose membranes. The membranes were blocked for 30 m at RT with blocking

solution (5% BSA in TBST buffer) and were incubated with the primary antibody at 4 ℃

overnight. Following incubation with an HRP-conjugated primary host-specific secondary

antibody (abcam) at 4 for 1 h, a chemiluminescence western-blot detection solution ℃

(WesternBright, Advansta) was applied. Membranes were visualized on a ImageQuant LAS4000

System (GE healthcare).

Antibodies. The antibodies used for western blotting and/or immunofluorescence

staining were as follows: anti-FES (1:1000, ab108418, abcam), anti-γH2AX (1:1000, #2577, Cell

signaling), anti-GAPDH (1:2000, sc-59540, Santa Cruz), anti-PARP (1:1000, #9542, Cell

signaling), anti-cleaved PARP (1:1000, #5625, Cell signaling), anti-cleaved caspase-3 (1:1000,

#9664, Cell signaling), anti-cleaved caspase-7 (1:1000, #8438, Cell signaling), anti-cleaved

caspase-9 (1:1000, #7237, Cell signaling), anti-phospho p70S6K (1:1000, #9205, Cell signaling),

anti-p70S6K (1:1000, #9202, Cell signaling), anti-phospho MDM2 (1:1000, #3521, Cell

signaling), anti-MDM2 (1:200, sc-965, Santa Cruz), anti-P53 (1:5000, sc-126, Santa Cruz), anti-

lamin B (1:1000, ab16048, abcam), anti-Ku80 (1:1000, #2180, Cell signaling), anti-RAD51

(1:500, PC130, Calbiochem), anti-phospho p38MAPK (1:1000, #4511, Cell signaling), anti-

phospho DNA-PK (1:500, ab18192, abcam), anti-MRE11 (1:500, #4847, Cell signaling), and

anti-α-tubulin (1:10000, T6047, Sigma-Aldrich).

Comet assay. Oxiselect Comet Assay Kit (Cell Biolabs) was used to assess DNA damage

according to the manufacturer’s protocol. Briefly, cells were harvested after 15 m, 1 h, and 6 h of

irradiation, mixed with agarose at 1:10 ratio (v/v), and immediately transferred onto the

12

OxiSelect Comet Slide (Cell Biolabs). After stepwise incubation with lysis buffer and alkaline

solution at 4 in the dark, alkaline electrophoresis was performed by applying 30 V for 30 m. ℃

After neutralizing and drying the slide, DNA was stained with VistaGreen DNA Dye for 15 m

and examined under a fluorescence microscope. At least 50 comets per group were analyzed

using OpenComet v1.3.1 open-source software, and tail moment (the percentage of tail DNA

content times length of tail) was calculated as an indicator of DNA damage.

FES-knockout cell-line establishment by CRISPR-cas9 and validation. pSpCas9(BB)-

2A-Puro (PX459) V2.0 Plasmid vector (#62988, Addgene) expressing sgRNA (5’-

GGTACTTGCGCTTGGCTTGG-3’) specific for FES exon 5 (pSpCas9(BB)-2A-Puro-FES) was

constructed according to a published protocol (2). Plasmid transfection was performed using

Lipofectamine LTX and PLUS reagent (Invitrogen) according to the manufacturer’s forward

transfection protocol. To establish an FES knockout cell line, A549 wild-type cells were

transfected with pSpCas9(BB)-2A-Puro-FES, and selected with 3 μg/mL puromycin for three

days. Subsequently, a single colony harboring frame-shift mutations on both copies of the FES

gene was selected for further study. Sequences sequencing primers are as follows: forward-

CTGACGACAGGACCTTTCCAG, backward: AGGCTGCGCACATACTTGTC.

Inducible FES-knockdown cell-line establishment. Doxycycline inducible pTRIPZ

lentiviral short hairpin RNA (shRNA) and packaging vectors were obtained from Dharmacon.

The targeted sequence for FES was 5’-CGCTTTCGGAGGAGTAGCG-3’. The TRIPZ Inducible

Lentiviral Non-silencing shRNA Control vector (Dharmacon) was used as a negative control.

Viral particles were generated in the HEK293 cells according to the manufacturer’s protocol. For

infections, A549 cells were plated (5 × 104 cells/well) in 24-well plates and spin-infected for 20

m at 1,000 rpm with virus and 10 μg/ml polybrene (Sigma-Aldrich). After 4 h incubation, cells

13

were washed and returned to normal culture medium. To establish stable knockdown cell lines,

A549 cells were cultured with complete medium containing 1 μg/ml puromycin (Sigma-Aldrich)

72 h after transduction. Cells were further sorted using RFP expression. For in vitro experiments,

cells were treated with 2 μg/ml of doxycycline 4 days prior to irradiation.

In vivo tumor growth measurement. Specific pathogen-free 8-9 weeks-old Balb/c-nude

mice (ORIENT BIO) were divided into two groups receiving 7 × 106 cells of FES-knockout or -

wild type A549 injections subcutaneously at the back. Tumor growth was measured every 2-3

days when tumors became palpable, and the tumor volume in mm3 was calculated by the formula

volume = (width)2 × (length)/2. For inducible-knockdown system, mice were injected with 1 ×

107 A549 cells containing shCont (non-silencing shRNA) or shFES at the right hind leg,

respectively. In vivo FES-silencing were induced by adding doxycycline at 100 μg/ml (20

mg/kg/day) into the mice drinking water from day 17 after tumor injection, after xenograft

establishment. Doxycycline was replenished every 3 days until day 23. When tumors reached an

average size around 100 mm3, they were irradiated with three fractions of 4 Gy on day 21, 22,

and 23 using custom-made immobilization zig. Linear accelerator (Clinac IX, Varian Medical

Systems) was used for the irradiation procedure.

The Cancer Genome Atlas (TCGA) analysis. To complement our experimental results,

additional analyses for the association between FES gene expression and patient survival were

performed using a publicly available the Cancer Genome Atlas (TCGA) database. Survival

estimates were calculated by the Kaplan-Meier method and compared using the log-rank test.

Graphs were obtained from an interactive web tool (3).

ROS measurement. We assessed ROS generation by measuring the fluorescence of DCF,

which is formed by the oxidation of 2',7'–dichlorofluorescin diacetate (H2-DCFDA) by

14

peroxides. Cells were irradiated and harvested after 4 h of incubation. After centrifuging and

washing with HBSS (Welgene), target cells were resuspended with pre-warmed HBSS

containing 5μM DCFDA at 37°C for 15 m, whereas incubated cells with PBS were used as a

negative unstained control. These cells were washed with PBS at 1400 rpm for 5 m twice and

immediately measured using FACS with FITC channel (BD Biosciences). A histogram of relative

fluorescence intensities was used to compare ROS level. Data was analyzed by FlowJo V10

software.

Supplementary Table S1. Primary kinome siRNA library screening result.

Supplementary references

1. Kim BH, Jung H-W, Seo SH, Shin H, Kwon J, Suh JM. Synergistic actions of FGF2 and bone marrow transplantation mitigate radiation-induced intestinal injury. Cell Death Dis. 2018;9:383.

2. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8:2281–308.

3. Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017;45:W98–102.

15