· web view(d) molecular interpretation of sense and antisense dog1 transcripts analysis in cpl1-9...
TRANSCRIPT
SUPPLEMENTAL FIGURES:
Supplemental Figure 1
(A) Diagram of CPL1 protein domain structure generated using SMART (Letunic et al., 2015;
Schultz et al., 1998): CPDc – catalytic domain of CTD-like phosphatases; pink rectangle – low
complexity region; DSRM – double-stranded RNA binding motif. Sites of T-DNA insertion and
amino acid substitutions in mutants used in this study are marked.
(B) CPL1 gene expression in wild-type Col-0 and mutants used in this study determined by RT-
PCR using material from seedlings. UBC expression is used as a control.
Supplemental Figure 2
Germination efficiency curves of (A) freshly harvested seeds of Col-0 and cpl1 mutants; (B)
freshly harvested seeds of cpl1-9 dog1-4 double and single mutants; Col-0 is shown as a control.
Graphs show mean values for at least four biological replicates; error bars show SD.
Supplemental Figure 3
Half-life of shDOG1 and lgDOG1 transcripts in Col-0 and cpl1-9 seedlings, calculated based on
degradation curves after cordycepin treatment. Means and standard deviation from 3
independent experiments are shown; n.s. – non-significant. Table on the right shows also values
for control transcripts: stable transcript of housekeeping gene EIF4a and short-lived mRNA
transcribed from At3g45970 gene.
Supplemental Figure 4
Beta to alpha DOG1 splicing forms expression level ratio in Col-0 and the cpl1-9 mutant assayed by
RT-qPCR using splice-isoform-specific primers (Schwab, 2008). RT-qPCR results were double
normalized against the UBC transcript level and Col-0. Bars represent mean values from at least
seventeen biological replicates; error bars show SD; n.s. – non-significant.
Supplemental Figure 5
Luciferase activity assay of transgenic seeds containing the LUC gene fused to (A) the asDOG1
promoter, (B) the whole DOG1 gene, or (C) the sense DOG1 promoter. Photographs show the light
signal produced by equal seed aliquots: each column contains seeds from an individual plant, rows
contain technical replicates. The colored scale next to each image represents light intensity in CPS –
Counts Per Second. #1, #2, #3 indicate different transgenic lines.
Supplemental Figure 6
Agarose gels with RT-PCR results used in ImageJ quantification to produce Figure 1K. Panels A and B
show the results from two separate experiments.
Supplemental Figure 7
(A) Representative example of ChIP experiments shown in Figure 1M. The data were double
normalized using control gene ACTIN 7 (AT5G09810) and Col-0. Bars represent mean values
from at least two biological replicates; error bars show SD. Student’s t-test was used for
statistical analysis: * – p< 0.05; n.s. – non significant.
(B) Regions (showed as black bars) amplified by primers used in analysis of H2Bubq level on
DOG1 gene.
Supplemental Figure 8
Characterization of cpl1-9 hub1-5 double mutant.
(A) Germination efficiency 8 days after sowing (left panel) and germination efficiency curves (right
panel) of cpl1-9 hub1-5 double mutant and single mutants, with Col-0 as a control. Mean values from
at least 3 biological replicates are presented.
(B) Relative expression of shDOG1 and lgDOG1 mRNA and the ratio of these two isoforms in freshly
harvested seeds of cpl1-9 hub1-5 double mutant and single mutants, with Col-0 as a control. RT-qPCR
was double normalized against the UBC transcript level and Col-0. Bars represent mean values from
at least 3 biological replicates.
(C) Relative expression level of asDOG1 in freshly harvested seeds of cpl1-9 hub1-5 mutant and single
mutants, with Col-0 as a control. It was measured by strand specific, adapter mediated RT-qPCR,
double normalized against the UBC mRNA level and Col-0. Bars represent mean values from at least 3
biological replicates.
(D) Molecular interpretation of sense and antisense DOG1 transcripts analysis in cpl1-9 hub1-5
double mutant. Similar upregulation of antisense expression in the double compared to single
mutants suggests that CPL1 and HUB1 regulates asDOG1 through the same pathway. Intermediate
levels of shDOG1, lgDOG1 and seed dormancy in cpl1-9 hub1-5 in comparison to single mutants, is
consistent with a model where CPL1, apart from influencing DOG1 sense expression through asDOG1
repressed by H2Bubq, also regulates DOG1 APA site selection.
Error bars show the SD and Student’s t-test was used for statistical analysis of changes in mutants in comparison to Col-0, * – p<0.05; ** – p<0.01; *** – p<0.001, n.s. – non significant.
SUPPLEMENTAL TABLES:
No. Gene IDFold change (cpl1-9/Col-0)
Fold change SD p-value
1 At4g01440 0,88 0,00 0,092 At2g38170 1,06 0,23 0,243 At5g54670 1,04 0,04 0,704 At3g16360 1,94 0,93 0,025 At1g01580 0,83 0,29 0,206 At1g31860 1,04 0,00 0,577 At4g27430 0,90 0,15 0,358 At5g02450 1,67 0,23 0,059 At5g08450 1,26 0,18 0,11
10 At1g30460 1,08 0,10 0,3411 At4g18260 4,86 2,26 0,0012 At5g46490 0,61 0,14 0,0013 At4g00970 1,03 0,01 0,4914 At3g54500 1,14 0,20 0,4115 At2g29340 1,12 0,27 0,5416 At4g25550 1,06 0,16 0,5517 At3g01500 0,86 0,44 0,4718 At5g11330 0,40 0,06 0,0019 At4g23840 0,92 0,31 0,4920 At3g60140 1,23 0,43 0,4621 At2g24060 1,25 0,24 0,04
22 At4g20830 0,99 0,09 0,9423 At2g43410 0,85 0,24 0,1624 At2g41630 0,79 0,17 0,0125 At3g05410 0,83 0,09 0,1826 At4g16280 0,81 0,08 0,3027 At2g19110 1,17 0,18 0,3028 At2g26780 1,07 0,14 0,4629 At4g12230 0,97 0,01 0,5330 At4g19970 1,16 0,32 0,5631 At4g24880 0,98 0,14 0,7832 At5g57015 1,06 0,10 0,5833 At5g58270 1,15 0,30 0,2634 At1g68570 1,01 0,50 0,9735 At2g39800 0,76 0,09 0,3136 At1g06630 1,01 0,04 0,7737 At4g32610 0,98 0,24 0,8238 At5g14140 1,07 0,24 0,65
39At5g46470(proximal form ending in 3rd intron/full lengh) 0,63 0,28 0,01
40 At4g23895 1,16 0,08 0,2241 At1g20620 1,04 0,22 0,81
Supplemental Table 1
Fold change in proximal to distal alternative polyadenylation mRNA forms in cpl1-9 vs Col-0 in 14
days old plants.
Genes on which proximal or distal APA site usage is enhanced in cpl1-9 mutant are highlighted in
green or red, respectively. For At5g46490 gene, which has 3 APA isoforms, full length APA isoform
and one ending in 3rd intron were analyzed. For statistical analysis Student's t-test was used.
No. Primer Gene ID intron localization RT-PCR AS type WT cpl1-9 (cpl1-9 - WT )
iso SD iso SD P-value isoΔ
1 DEE_003 At1g09140 1 CDS
1043'SS
0,46 0,02 0,48 0,03 0,555 0,01
442 0,54 0,02 0,52 0,03 0,555 -0,01
1046 *IR 0,00 0,00 0,00 0,00 - 0,00
2 DEE_007 At1g55310 3&4 CDS
199ES
0,63 0,05 0,57 0,03 0,124 -0,06
361 0,12 0,00 0,12 0,00 0,954 0,00
802 *IR' 0,04 0,01 0,05 0,01 0,090 0,01
964 *IR'/*IR'' 0,20 0,05 0,26 0,02 0,149 0,05
3 DEE_013 At1g79650 4&5&6 CDS
1563'SS
0,23 0,01 0,24 0,01 0,463 0,01
174 0,75 0,00 0,74 0,00 0,055 -0,01
238 *IR'' 0,02 0,00 0,02 0,00 0,763 0,00
331 *IR''/*IR''' 0,00 0,01 0,01 0,00 0,416 0,00
4 DEE_019 At2g32330 1 CDS
2023'SS
0,44 0,02 0,43 0,03 0,684 -0,01
273 0,55 0,01 0,55 0,03 0,770 0,01
630 *IR 0,01 0,01 0,01 0,00 0,737 0,00
5 DEE_030 At3g53270 1&2&3 5'UTR
212
ES/3'SS/3'SS
0,04 0,00 0,04 0,01 0,761 0,00
264 0,33 0,02 0,32 0,02 0,385 -0,01
270 0,08 0,00 0,07 0,01 0,331 -0,01
277 0,08 0,00 0,08 0,01 0,342 -0,01
360IR''/3'SS
0,13 0,00 0,13 0,01 0,831 0,00
367 0,15 0,01 0,16 0,01 0,121 0,01
678 *IR'/IR'' 0,19 0,03 0,20 0,01 0,643 0,01
6 DEE_036 At4g12790 1&2 5'UTR
181
3'SS
0,05 0,05 0,08 0,00 0,471 0,02
212 0,44 0,02 0,42 0,01 0,228 -0,02
338 0,50 0,03 0,50 0,01 0,924 0,00
7 DEE_042 At5g04430 5 CDS
1423'SS 0,66 0,11 0,70 0,08 0,674 0,04
205 0,32 0,09 0,29 0,07 0,687 -0,03
705 *IR 0,02 0,02 0,02 0,01 0,637 -0,01
8 DEE_043 At5g09230 1&2 5'UTR/CDS
113ES
0,46 0,03 0,46 0,01 0,883 0,00
196 0,20 0,02 0,18 0,01 0,207 -0,02
196 5'SS/3'SS 0,35 0,02 0,36 0,01 0,414 0,01
9 DEE_044 At5g13730 2 CDS
2753'SS
0,65 0,01 0,60 0,04 0,13 -0,05
287 0,31 0,01 0,36 0,03 0,07 0,05
459 *IR 0,05 0,00 0,04 0,01 0,51 0,00
10 DEE_049 At5g41150 5 CDS
2933'SS
0,80 0,02 0,79 0,00 0,475 -0,01
346 0,14 0,01 0,15 0,01 0,095 0,02
555 IR 0,06 0,01 0,05 0,01 0,427 -0,01
11 DEE_050 At5g43910 8&9 CDS
1913'SS
0,36 0,03 0,33 0,03 0,275 -0,03
222 0,54 0,01 0,60 0,02 0,027 0,05
308 *IR'' 0,09 0,01 0,07 0,01 0,055 -0,02
402 *IR' 0,00 0,00 0,00 0,00 - 0,00
519 *IR'/*IR'' 0,01 0,02 0,01 0,01 0,756 0,00
12 DEE_059 At5g66010 1 (single) CDS
1053'SS
0,36 0,01 0,36 0,04 0,780 -0,01
182 0,19 0,07 0,26 0,04 0,191 0,07
556 *IR 0,45 0,05 0,38 0,06 0,241 -0,06
13 DEE_124 At2g37060 1 5'UTR
232
3'SS
0,07 0,02 0,09 0,00 0,210 0,02
252 0,15 0,02 0,14 0,01 0,442 -0,01
256 0,78 0,03 0,74 0,01 0,085 -0,04
403 *IR 0,00 0,00 0,03 0,00 0,000 0,03
14 DEE_126 At2g34830 2 (last) CDS
2063'SS
0,30 0,02 0,39 0,05 0,046 0,09
218 0,62 0,02 0,55 0,05 0,066 -0,08
817 IR 0,08 0,01 0,06 0,01 0,070 -0,02
15 DEE_128 At2g15530 1&2&3 5'UTR
222
ES/5'SS
0,31 0,01 0,36 0,01 0,001 0,05
241 0,38 0,01 0,39 0,00 0,092 0,01
360 0,14 0,00 0,16 0,00 0,000 0,03
379 0,18 0,00 0,09 0,01 0,000 -0,09
16 DEE_193 At1g07350 4&5 CDS/3'UTR
200ES
0,40 0,04 0,38 0,03 0,524 -0,02
296 0,37 0,05 0,40 0,01 0,398 0,03
443 IR'' 0,08 0,01 0,08 0,01 1,000 0,00
453 IR' 0,04 0,00 0,04 0,01 0,305 -0,01
600 IR'/IR'' 0,11 0,02 0,11 0,01 0,953 0,00
17 DEE_198 At4g36690 11 CDS/3'UTR
1313'SS
0,39 0,01 0,38 0,03 0,725 -0,01
304 0,37 0,01 0,37 0,04 0,783 0,01
404 IR 0,25 0,01 0,25 0,01 0,982 0,00
18 DEE_204 At3g53500 2&3 5'UTR/CDS
155 3'SS 0,83 0,02 0,84 0,02 0,683 0,01
272 IR'' 0,02 0,00 0,02 0,00 0,900 0,00
373 3'SS 0,08 0,00 0,08 0,01 0,586 0,00
490 IR''/3'SS 0,04 0,01 0,04 0,01 0,278 -0,01
643 IR' 0,01 0,00 0,01 0,00 0,920 0,00
760 IR'/IR'' 0,01 0,01 0,02 0,00 0,702 0,00
19 DEE_226 At4g24740 3&4&5 CDS
145ES
0,11 0,01 0,13 0,02 0,398 0,01
309 0,80 0,02 0,78 0,01 0,197 -0,02
407 *IR'' 0,01 0,00 0,00 0,00 0,764 0,00
418 *IR' 0,00 0,00 0,00 0,00 - 0,00
458 *IR''' 0,04 0,00 0,04 0,00 0,948 0,00
556 *IR''/*IR''' 0,02 0,00 0,03 0,02 0,471 0,01
665 *IR'/*IR''/*IR''' 0,02 0,02 0,02 0,01 0,889 0,00
20 DEE_343 At3g29160 1 5'UTR159
5'SS0,36 0,02 0,36 0,03 0,866 0,00
307 0,64 0,02 0,64 0,03 0,866 0,00
21 DEE_381 At5g53450 1 5'UTR/CDS
1063'SS
0,23 0,03 0,24 0,01 0,720 0,01
187 0,75 0,04 0,74 0,01 0,816 -0,01
435 *IR 0,02 0,01 0,02 0,00 0,795 0,00
Supplemental Table 2
Splicing profile of analyzed transcripts in 14 days old plants: wild type (WT) and cpl1-9 .
The relative abundance of alternatively spliced isoforms is presented as a ratio of the products for
wild type (WT) and mutants. The standard deviations derived from two or three repeat experiments
are given with the ratios. Change between the wild type (WT) and mutant is significant if P≤0,05 and
if the change is ≥ 5% (shaded in grey). ES—exon skipping; 5'SS—alternative 5' splice site; 3'SS—
alternative 3'SS splice site; IR—intron retention; *-intron not defined as alternative in databases;
'/''/'''/''''- number of analyzed introns; CDS—coding sequence; 5'UTR—5' untranslated region; 3'UTR
—3' untranslated region.
no name sequence 5`-3` application
1 ShD;LgD_F TGAGATCCGTGTGACTCAGTTT RT-qPCR forward primer for the amplification of short and long DOG1
2 ShD_R ACCTTGCTACCATAAGTCTTCAG RT-qPCR reverse primer for the amplification of short DOG1
3 LgD_R TTGTCGAGACGAGATCATGTTG RT-qPCR reverse primer for the amplification of long DOG1
4 AS_SS_RT GACTGGAGCACGAGGACACTGCTAAAATCAATGTGTTGCATGT
Tagged, strand specific primer for synthesis of antisense DOG1 by reverse transcription
5 AS_F GACTGGAGCACGAGGACACT RT-qPCR forward primer for the amplification of fragment of antisense DOG1 transcript
6 AS_R ACGTTAGGCTCTCCGACATT RT-qPCR reverse primer for the amplification of fragment of antisense DOG1 transcript
7 UBC1 CTGCGACTCAGGGAATCTTCTAA Forward primer used in RT-qPCR fragment of control gene amplification - PEX4(AT5G25760)
8 UBC2 TTGTGCCATTGAATTGAACCC Reverse primer used in RT-qPCR fragment of control gene amplification - PEX4(AT5G25760)
9 PP2A_F TATCGGATGACGATTCTTCGTGCAG Forwar primer for PP2A gene (AT1G13320) fragment used in DNase treatment efficiency check
10 PP2A_R GCTTGGTCGACTATCGGAATGAGAG
Reverse primer for PP2A gene (AT1G13320) fragment used in DNase treatment efficiency check
11 Exon2_qRT_F GGATTCTATCTCCGGTACAAGGAGCGGATTTC
Forward RT-qPCR primer for DOG1 splicing forms recognition (M. Schwab PhD thesis, 2008)
12 alpha_reverse CCACTATTCACAGTTGTACATGCATCGAATATTACTTC
Reverse RT-qPCR primer for DOG1 splicing form alpha recognition (M. Schwab PhD thesis, 2008)
13 beta_reverse CCACTATTCACAGTTGTACATGCATCGAATATTACTATAG
Reverse RT-qPCR primer for DOG1 splicing form beta recognition (M. Schwab PhD thesis, 2008)
14 CPL1 exp LP GGATAGCTGCTCCCGTTCAGTTCC RT-qPCR forward primer for the amplification of fragment of CPL1 cDNA
15 CPL1 exp RP GTGTTTAGCTATTGATGTCGGTTGTTGAGGT
RT-qPCR reverse primer for the amplification of fragment of CPL1 cDNA
16 pDOG1senseCol-0 F GTGTGTCGGCTTCCGTAACT Forward primer for amplification of DOG1 promoter fragment used in H2Bubq ChIP analysis
17 pDOG1senseCol-0 R GAGTGCGAGTTGTTGTTCCA Reverse primer for amplification of DOG1 promoter fragment used in H2Bubq ChIP analysis
18 DOG1 exon 1 ChIP F AGCTCAACGACGATCTCAC Forward primer for amplification of DOG1 exon 1 fragment used in H2Bubq ChIP analysis
19 DOG1 exon 1 ChIP R ACATCGGTGAGCAAGATCAG Reverse primer for amplification of DOG1 exon 1 fragment used in H2Bubq ChIP analysis
20 DOG1 exon 2 ChIP F TGTGGCTTACGAGATGGAGA Forward primer for amplification of DOG1 exon 2 fragment used in H2Bubq ChIP analysis
21 DOG1 exon 2 ChIP R CCCGAGGATCTTCGCTAAAG Reverse primer for amplification of DOG1 exon 2 fragment used in H2Bubq ChIP analysis
22 DOG1 exon 3 ChIP F CCCACGGAGACGACAAATAATG Forward primer for amplification of DOG1 exon 3 fragment used in H2Bubq ChIP analysis
23 DOG1 exon 3 ChIP R TTGTCGAGACGAGATCATGTTG Forward primer for amplification of DOG1 exon 3 fragment used in H2Bubq ChIP analysis
24 IGN5B-F TCCCGAGAAGAGTAGAACAAATGCTAAAA
Forward primer for amplification of IGN5B transposon fragment used in H2Bubq ChIP as negative control
25 IGN5B-R CTGAGGTATTCCATAGCCCCTGATCC
Reverse primer for amplification of IGN5B transposon fragment used in H2Bubq ChIP as negative control
26 ACT 2/7.2_Fw CCCTCGTAGATTGGCACAGT Forward primer for amplification of actin 7 (AT5G09810) fragment used in H2Bubq ChIP as normalisation control
27 ACT 2/7.2_R GGCCGTTCTTTCTCTCTATGC Reverse primer for amplification of actin 7 (AT5G09810) fragment used in H2Bubq ChIP as normalisation control
28 eif4aF GGCGTAAGGTTGATTGGCTCAC Forward primer for amplification of EIF4A gene, used in RNA stability assay
29 eif4aR GATGAGAACACGGGAGGAACCAG Reverse primer for amplification of EIF4A gene, used in RNA stability assay
30 At3g45970-1 GTATCCACCGGTTACTACGAACCTG Forward primer for amplification of At3g45970 gene, used in RNA stability assay
31 At3g45970-2 CAAGTCGGTTCATCGCCAAATTGGG
Reverse primer for amplification of At3g45970 gene, used in RNA stability assay
Primers used in APA changes analysis
no name sequence 5`-3` application
1 AT4g01440.lg_F ACTTCTCTTTGCGGGTAGTAGC primer for long polyadenylation form of At4g01440 gene
2 AT4g01440.lg_R TTGGATGGTGCCAAAGAAGG primer for long polyadenylation form of At4g01440 gene
3 AT4g01440.sh_F TGGATTTCGAAGTTATGGTTAAGCT primer for short polyadenylation form of At4g01440 gene
4 AT4g01440.sh_R GCAACAACAGGACAATTACGCA primer for short polyadenylation form of At4g01440 gene
5 AT2g38170.lg_F AGCGAGAGACAATGGAGAAAGG primer for long polyadenylation form of AT2g38170 gene
6 AT2g38170.lg_R TTGCAAAACCCACCCACAAG primer for long polyadenylation form of AT2g38170 gene
7 AT2g38170.sh_F GTTAGTTTTCAAATGTATATGCATGCT primer for short polyadenylation form of AT2g38170 gene
8 AT2g38170.sh_R GGAACCTATTTAACCCGTTTTAACT primer for short polyadenylation form of AT2g38170 gene
9 AT5g54670.lg_F AAACGCGGTGAGAAAGAACG primer for long polyadenylation form of AT5g54670gene
10 AT5g54670.lg_R AAATGGCGATCACGGTCATC primer for long polyadenylation form of AT5g54670gene
11 AT5g54670.sh_F TTCTACTTTTTCACCCACCTCA primer for short polyadenylation form of AT5g54670 gene
12 AT5g54670.sh_R ACACAACGGATCCAACGAGA primer for short polyadenylation form of AT5g54670 gene
13 at3g16360.lg_F AATGCGGAAGGATGCTTGAG primer for long polyadenylation form of At3g16360 gene
14 at3g16360.lg_R TTACTTGGGCCTACGTGCTG primer for long polyadenylation form of At3g16360 gene
15 at3g16360.sh_F AGAAGAGCTCCAAGATGATGCA primer for short polyadenylation form of At3g16360 gene
16 at3g16360.sh_R AAACAAAATAATACTCACAAAGCTTGG primer for short polyadenylation form of At3g16360 gene
17 At1g01580.sh_F CCCTGCTTCCGCCGATTT primer for short polyadenylation form of At1g01580 gene
18 At1g01580.sh_R TTGAAATGCAAGTCAATCAAGTTTCC primer for short polyadenylation form of At1g01580 gene
19 At1g01580.lg_F ACAAGAATCGCTCGTGCAAC primer for long polyadenylation form of At1g01580 gene
20 At1g01580.lg_R ACGCAATCACCAGCTGAAAC primer for long polyadenylation form of At1g01580 gene
21 AT1g31860.sh_F TGACATGTGGGTTTGGACTG primer for short polyadenylation form of AT1g31860 gene
22 AT1g31860.sh_R AATGGAGCCAAGTCATCACG primer for short polyadenylation form of AT1g31860 gene
23 AT1g31860.lg_F TGAGGCTTCAGGAAACAAGC primer for long polyadenylation form of AT1g31860 gene
24 AT1g31860.lg_R GTGTTCTGCATAACTCGTCAGC primer for long polyadenylation form of AT1g31860gene
25 AT4g27430.sh_F TCTTCTTCTCCGGCATCATCG primer for short polyadenylation form of AT4g27430 gene
26 AT4g27430.sh_R ACACACTCAAATGCCCACTTTC primer for short polyadenylation form of AT4g27430 gene
27 AT4g27430.lg_F GGAAAAGCTTCAGGAGACAGAG primer for long polyadenylation form of AT4g27430 gene
28 AT4g27430.lg_R GGTTCGAACCCTCAACCTTTAAG primer for long polyadenylation form of AT4g27430 gene
29 AT5g02450.lg_F AGTTGCCAAGCGAAAGTTGG primer for long polyadenylation form of AT5g02450 gene
30 AT5g02450.lg_R AAGAAACAGAGCGCTGAACC primer for long polyadenylation form of AT5g02450 gene
31 AT5g02450.sh_F TGAAGTTCCTTGCTCTGTTCA primer for short polyadenylation form of AT5g02450 gene
32 AT5g02450.sh_R TCAACAAGGCTACGAAGAATCA primer for short polyadenylation form of AT5g02450 gene
33 at5g08450.lg_F AATGCTCTGCGGCAACAAAG primer for long polyadenylation form of At5g08450 gene
34 at5g08450.lg_R TGTTGTGAGGCTTGGATTGC primer for long polyadenylation form of At5g08450 gene
35 at5g08450.sh_F GGTCATCTACGAACACACATGC primer for short polyadenylation form of At5g08450 gene
36 at5g08450.sh_R AAAGCCAGGGCAGTAAGTAAC primer for short polyadenylation form of At5g08450 gene
37 30460 prox F AATCACAACACCAGGTCAGC primer for short polyadenylation form of At1g30460 gene
38 30460 prox R ACCTTAGGACTCTGAACACACC primer for short polyadenylation form of At1g30460 gene
39 30460 dist F AATGTGGCCTCCTCAAATGC primer for long polyadenylation form of At1g30460 gene
40 30460 dist R ACCCATGCCAAATGGATCTG primer for long polyadenylation form of At1g30460 gene
41 18260 dist F AAGCGAGAGAAAAGGCAACC primer for long polyadenylation form of At4g18260 gene
42 18260 dist R CGAGCTGCTTCCGAAGATAAG primer for long polyadenylation form of At4g18260 gene
43 18260 prox F TCAACAGCTAGATATACATGCATCG primer for short polyadenylation form of At4g18260 gene
44 18260 prox R GTGTGTCCTTATAGTTCCTTTCCC primer for short polyadenylation form of At4g18260 gene
45 46490 dist F AGAGTTTGGTGGAGCTTCCTTC primer for long polyadenylation form of At5g46490 gene
46 46490 dist R ACTAAGGCGGTCCAGAGATTTG primer for long polyadenylation form of At5g46490 gene
47 46490 prox F TCTCCGTTTCTTAGAAATTAAGGATTT primer for short polyadenylation form of At5g46490 gene
48 46490 prox R GTCTAATAATCAAAAAGTTATACCATTCGG primer for short polyadenylation form of At5g46490 gene
49 00970 prox F GCAACTAATGACTTCTCTCGTGAC primer for short polyadenylation form of At4g00970gene
50 00970 prox R CGGGAAACAAAGATCATAAACATGAG primer for short polyadenylation form of At4g00970 gene
51 00970 dist F GTGTGTTCAGGAGAATGCAGAG primer for long polyadenylation form of At4g00970 gene
52 00970 dist R TCCATCTCCCGAGTAAAATGCG primer for long polyadenylation form of At4g00970 gene
53 54500 dist F TGATATGTTGGCGGCAAAGC primer for long polyadenylation form of At3g54500gene
54 54500 dist R TGCATTCCCCAAAGCAAGTG primer for long polyadenylation form of At3g54500 gene
55 54500 prox F AAGTGTCCCAAGTGTACGTG primer for short polyadenylation form of At3g54500 gene
56 54500 prox R AGCAATAACCAGCAGTCTGC primer for short polyadenylation form of At3g54500 gene
57 29340 dist F AACTTCACTTCGTCGCGTTG primer for long polyadenylation form of At2g29340gene
58 29340 dist R CCTCCATCAATACAAATGGTTTGACC primer for long polyadenylation form of At2g29340 gene
59 29340 prox F CCTGCAGCTTCTTATATTACTGGTC primer for short polyadenylation form of At2g29340 gene
60 29340 prox R CGAGACATGACCATACTCAAACC primer for short polyadenylation form of At2g29340 gene
61 25550 dist F TATCAACCATTCCGCAGCAG primer for long polyadenylation form of At4g25550 gene
62 25550 dist R TCTCTAATCCGGTAGCTACAGC primer for long polyadenylation form of At4g25550gene
63 25550 prox F AGCGTTGAAGGGATTCTACTGG primer for short polyadenylation form of At4g25550 gene
64 25550 prox R TGGCCACTCAAGTCTTGAAC primer for short polyadenylation form of At4g25550 gene
65 AT2g43410.lg_F TTTCAAGCTGCCATGCAACC primer for long polyadenylation form of AT2g43410 gene
66 AT2g43410.lg_R TGTTGCTGCTGTTTCTGCTG primer for long polyadenylation form of AT2g43410 gene
67 AT2g43410.sh_F CGTCTGTTGTGCTCGTTGTG primer for short polyadenylation form of AT2g43410 gene
68 AT2g43410.sh_R TGCCAAAAATGAATCAACACCA primer for short polyadenylation form of AT2g43410 gene
69 At3g01500.lg_F AGGGTGCTTTTGAGCTTTGG primer for long polyadenylation form of At3g01500gene
70 At3g01500.lg_R TGTGAAATCGGGTAAGGCTTC primer for long polyadenylation form of At3g01500 gene
71 At3g01500.sh_F ACATAACTTACATTGCTGTTTACGT primer for short polyadenylation form of At3g01500 gene
72 At3g01500.sh_R ATGGCAATTGCAGAATCTATATAAT primer for short polyadenylation form of At3g01500 gene
73 At4g20830.lg_F TTAAAACCGCGGTTGATCCC primer for long polyadenylation form of At4g20830 gene
74 At4g20830.lg_R TAAGACCACCGTCGCAACTAC primer for long polyadenylation form of At4g20830 gene
75 At4g20830.sh_F TTAAAACCGCGGTTGATCCC primer for short polyadenylation form of At4g20830 gene
76 At4g20830.sh_R TGAGCTTGTTGTAGAGTTCCATG primer for short polyadenylation form of At4g20830 gene
77 11330 prox F CAGACTCATAGCGTGTTTTACG primer for long polyadenylation form of At5g11330 gene
78 11330 prox R CACTTGTAGACGCATCCTAATC primer for long polyadenylation form of At5g11330 gene
79 11330 dist F GCCTGTTGTTTCTGAGCAAG primer for short polyadenylation form of At5g11330 gene
80 11330 dist R GGAGCACAGGAAAAGAATGG primer for short polyadenylation form of At5g11330 gene
81 23840 prox F AAGCGGCTTCTTTTCCCTTC primer for short polyadenylation form of At4g23840 gene
82 23840 prox R CCCAAGCGATCACTCAATATC primer for short polyadenylation form of At4g23840 gene
83 23840 dist F CAGAGGGTGAAGTACAATAGGG primer for long polyadenylation form of At4g23840 gene
84 23840 dist R CGGAATCAGCAAGAAGTTCC primer for long polyadenylation form of At4g23840 gene
85 60140 prox F GATGAAGGAGCTAAACATGGAC primer for long polyadenylation form of At3g60140 gene
86 60140 prox R AAAATCAACAAAAAGAGAGAGAGAG primer for long polyadenylation form of At3g60140 gene
87 60140 dist F CAAATGGTTTAAGCGGTTCC primer for short polyadenylation form of At3g60140 gene
88 60140 dist R CTCCTCGATTGGTTCATTGC primer for short polyadenylation form of At3g60140 gene
89 24060 prox F TACAGATACGAACAGCAAAAGAGG primer for short polyadenylation form of At2g24060 gene
90 24060 prox R GATAAGCATATCATCTCCAACTCTAAGAC primer for short polyadenylation form of At2g24060 gene
91 24060 dist F CAAGAACCACCCACAAGAAAG primer for long polyadenylation form of At2g24060 gene
92 24060 dist R AATCGATCTGTAGAGGCTCTGG primer for long polyadenylation form of At2g24060 gene
93 41630 prox F TCCGATCGTGGTTTGATTC primer for short polyadenylation form of At2g41630 gene
94 41630 prox R CCAATAGGATTAAGGATCGTGTG primer for short polyadenylation form of At2g41630 gene
95 41630 dist F ATGCGACAGGAGTAGCAGAAG primer for long polyadenylation form of At2g41630 gene
96 41630 dist R TCCTCTTCCTTTGCATACCAAC primer for long polyadenylation form of At2g41630 gene
97 05410 prox F GTGTTATCGTTTCCCCTGTCTC primer for short polyadenylation form of At3g05410 gene
98 05410 prox R TCATGTCGCATTCATTGTAAC primer for short polyadenylation form of At3g05410 gene
99 05410 dist F TGGAGGGCCAAAAGAAGTAG primer for long polyadenylation form of At3g05410 gene
100 05410 dist R CGGAAAAGAGGTGATTCGAC primer for long polyadenylation form of At3g05410 gene
101 16280 dist F TGTTCGAACGAGAGCAACAG primer for long polyadenylation form of At4g16280 gene
102 16280 dist R TGCTGCTGAACTTGTTGTGG primer for long polyadenylation form of At4g16280 gene
103 16280 prox F GAGAACTGGACAGCAGCAAG primer for short polyadenylation form of At4g16280 gene
104 16280 prox R AATGATGAGACTGGGGTTGC primer for short polyadenylation form of At4g16280 gene
105 19110 prox F CCTTGGGTGCAATTAAGATG primer for short polyadenylation form of At2g19110 gene
106 19110 prox R TGCTTAGCGTTTTTCTATCTATGG primer for short polyadenylation form of At2g19110 gene
107 19110 dist F ACCGGGGAAATAACTCTTGC primer for long polyadenylation form of At2g19110 gene
108 19110 dist R CCAGTTTCCATGTCCAAACC primer for long polyadenylation form ofAt2g19110 gene
109 26780 prox F GGAATGGAGTTCACCGTGTG primer for short polyadenylation form of At2g26780 gene
110 26780 prox R TCATACTGTCTGCTTTTACACACAAC primer for short polyadenylation form of At2g26780 gene
111 26780 dist F TGCTTGAGCTCATCGAACTG primer for long polyadenylation form of At2g26780 gene
112 26780 dist R CGAAGGGAGATTTGCAAGAG primer for long polyadenylation form of At2g26780 gene
113 12230 dist F AAAGTTCCGGAAGCTCCAAC primer for long polyadenylation form of At4g12230 gene
114 12230 dist R TAAAACCACCACCGTGAACC primer for long polyadenylation form of At4g12230 gene
115 12230 prox F ATGAAAGGCGTCTCTTCGAC primer for short polyadenylation form of At4g12230 gene
116 12230 prox R GCCGAATAGAATGCAGAATCG primer for short polyadenylation form of At4g12230 gene
117 19970 dist F TCCATTTCCTCGGCTGTATC primer for long polyadenylation form of At4g19970 gene
118 19970 dist R CTCGATGCTTCTGTGGTTTG primer for long polyadenylation form of At4g19970gene
119 19970 prox F AAGGCAGCTCTCGAAGATTG primer for short polyadenylation form of At4g19970 gene
120 19970 prox R AACCGACTCCAATAATCAACG primer for short polyadenylation form of At4g19970 gene
121 24880 dist F CAGGAAGTCTTATTCGCTTTGC primer for long polyadenylation form of At4g24880 gene
122 24880 dist R TCGGGCTCGATTTGATACAC primer for long polyadenylation form of At4g24880 gene
123 24880 prox F CATCTGATGATCCACCTGTACC primer for short polyadenylation form of At4g24880 gene
124 24880 prox R GGCTGATCAGGATATATAAACCAC primer for short polyadenylation form of At4g24880 gene
125 57015 dist F CACAATCAGCAGGATCATCG primer for long polyadenylation form of At5g57015 gene
126 57015 dist R TGAAACCTTTCGTCGGAGAC primer for long polyadenylation form of At5g57015 gene
127 57015 prox F ACCACCAATGGATTCGTCAC primer for short polyadenylation form of At5g57015 gene
128 57015 prox R GCTAAAGCAGTGTTTGTTCGTG primer for short polyadenylation form of At5g57015 gene
129 58270 dist F TACTGGAAAACGGGAAGGTG primer for long polyadenylation form of At5g58270 gene
130 58270 dist R GCTGCATCAAGCATATCCAC primer for long polyadenylation form of At5g58270 gene
131 58270 prox F AGTTGTGCCGCAAGATACTG primer for short polyadenylation form of At5g58270 gene
132 58270 prox R GGCGAGAAACAAATGAATGC primer for short polyadenylation form of At5g58270 gene
133 68570 dist F AAACCGGATGGGAGCAATTG primer for long polyadenylation form of At1g68570 gene
134 68570 dist R ACCGGACTACTATCTTCCTTGC primer for long polyadenylation form of At1g68570 gene
135 68570 prox F ATCCAGATAGTCACGAGGAGAC primer for short polyadenylation form of At1g68570 gene
136 68570 prox R CTGGTTTCACCCAGTTGACAAG primer for short polyadenylation form of At1g68570 gene
137 39800 dist F ACAACGCCAGCACAAGATTC primer for long polyadenylation form of At2g39800 gene
138 39800 dist R AGCTTGGATGGGAATGTCCTG primer for long polyadenylation form of At2g39800 gene
139 39800 prox F AGGCAAAGGCTTCGTTATCG primer for short polyadenylation form of At2g39800 gene
140 39800 prox R ACATAAGCCAAAATGGTCCATCC primer for short polyadenylation form of At2g39800 gene
141 06630 dist F CTGATGCTTCTTCCTCAGACAC primer for long polyadenylation form of At1g06630 gene
142 06630 dist R TCTCACCACACCAATGTAACCC primer for long polyadenylation form of At1g06630 gene
143 06630 prox F ACCAAGTGAAGGAGTTGCAG primer for short polyadenylation form of At1g06630 gene
144 06630 prox R AACTCCAGGAAGTCCCTTTTCG primer for short polyadenylation form of At1g06630 gene
145 32610 dist F CAACTCGGATGCTGCAAGTG primer for long polyadenylation form of At4g32610 gene
146 32610 dist R TTCCTTTGCAGCAGCTGTTG primer for long polyadenylation form of At4g32610 gene
147 32610 prox F TATTACGCTACCACTGCTCCAC primer for short polyadenylation form of At4g32610 gene
148 32610 prox R TTTGGACTTGTGACCTCAGC primer for short polyadenylation form of At4g32610 gene
149 14140 dist F ACGGTCTTGTTTCAGCACTG primer for long polyadenylation form of At5g14140 gene
150 14140 dist R TCCTGGTGCAGACGAAGATTC primer for long polyadenylation form of At5g14140 gene
151 14140 prox F GTGACATTGGACTTCACAGAAGATG primer for short polyadenylation form of At5g14140 gene
152 14140 prox R ACTATCAGAAAACAGTCCGCAAC primer for short polyadenylation form of At5g14140 gene
153 46470 dist F TGCTGCAGGTCTATGAATGC primer for long polyadenylation form of At5g46470 gene
154 46470 dist R TGCCTCTGTTTCGTTTCTGC primer for long polyadenylation form of At5g46470 gene
155 46470 prox F ACGTTTCTTCTTCCCCCAAC primer for short polyadenylation form of At5g46470 gene
156 46470 prox R AAAGGACCAGTTACCTTGTCC primer for short polyadenylation form of At5g46470 gene
157 23895 dist F ATACATGGAAGCGATGGACCAG primer for long polyadenylation form of At4g23895 gene
158 23895 dist R AGTTCAGTTCTGGCCGTAGATC primer for long polyadenylation form of At4g23895 gene
159 23895 prox F GATTCGTGGTTGTCGGTTTTGC primer for short polyadenylation form of At4g23895 gene
160 23895 prox R GAAAACTATCCAGAGCAGTGACC primer for short polyadenylation form of At4g23895 gene
161 20620 dist F GGACAGAAACTTGCAAGCCG primer for long polyadenylation form of At1g20620 gene
162 20620 dist R GACGGATTTAACGACCAAGCG primer for long polyadenylation form of At1g20620 gene
163 20620 prox F ATGGATCCTTACAAGGTATCTTCG primer for short polyadenylation form of At1g20620 gene
164 20620 prox R CCACATGTGGCGTGTCTTTC primer for short polyadenylation form of At1g20620 gene
Supplemental Table 3
Primer list
MATERIALS AND METHODS
Plant materials and growth conditions
Arabidopsis thaliana plants were grown on soil in a greenhouse under long day conditions (16-h
light/8-h dark) at 22°C/18°C. For analysis of splicing, alternative polyadenylation and CPL1 expression,
14-day-old seedlings were grown on ½ MS with 1.5% sucrose in phytotrons under long day conditions
(16-h light/8-h dark) at 22°C/18°C. The mutants used (all in the Col-0 background) have been
described previously: cpl1-7 (Manavella et al., 2012), cpl1-8 (GK-165H09), cpl1-9 (GK-849H10), dog1-
4 (SM_3_20886), fy-2 (Simpson et al., 2003); hub1-5 (salk_044415).
Germination assay
Germination assays were performed as described previously (Cyrek et al., 2016). Briefly, about 100
freshly harvested seeds were sown in plates on wet blue germination paper (Anchor) with two layers
of thick fabric underneath. The plates were watered, sealed and placed in a phytotron under long
day conditions (16-h light/8-h dark) at 22°C/18°C. Photographs were taken once a day and seeds with
root protrusion were counted.
RNA Extraction, cDNA Synthesis and PCR Analysis
For RNA extraction, about 100 µl of seeds freshly harvested from single plants were collected in 1.5
ml microfuge tubes and frozen in liquid nitrogen. The seeds were ground while frozen using a plastic
pellet pestle fitted in an electric drill and then 500 µl of homogenization buffer (100 mM Tris-HCl pH
8.0; 5 mM EDTA pH 8.0; 100 mM NaCl; 0.5 % SDS; 1% 2-mercaptoethanol) were added and the
samples shaken for 5 min. 250 µl of chloroform were added and the tubes were shaken for 15 min.
Next 250 µl of phenol (pH 8.0) were added and the tubes were shaken for a further 15 min. The
samples were then centrifuged for 10 min at 14 000g at room temperature to separate the phases.
The aqueous layers (approx. 550 µl) were transferred to fresh tubes and an equal volume of
phenol:chloroform:isoamyl alcohol (25:24:1; pH 8.0) was added to each. The samples were shaken
for 10 min and then centrifuged as before. The aqueous layers (approx. 500 µl) were transferred to
fresh tubes, then 50 µl of 3M sodium acetate (pH5.2) and 400 µl isopropanol were added, mixed in
by inversion and the tubes held at -80°C for 15 min. The samples were centrifuged for 30 min at
14 000 g at 4°C, the supernatants discarded and the pellets washed with 80% ethanol. After
centrifuging for 5 min as before, the supernatants were discarded, the pellets air-dried for up to 10
min and then suspended in 30 µl of milliQ H2O.
RNA extraction from seedlings was performed as above except that the initial extraction was made
using hot (60°C) phenol followed by chloroform.
DNA in the samples was digested using a TURBO DNA-free kit (Life Technologies) according to the
manufacturer’s protocol. The efficiency of DNA removal was checked by PCR using primers to the
PP2A gene (AT1G13320). The RNA quality and quantity were confirmed by agarose gel
electrophoresis and using a Nanodrop 2000 spectrophotometer, respectively. Reverse transcription
using 1 µg of RNA was performed with a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher
Scientific) according to the manufacturer's protocol. For cDNA synthesis of sense DOG1, oligo(dT)
primers were used. For antisense DOG1, strand-specific adapter-mediated cDNA was synthesized
using a tagged AS_SS_RT primer (Fedak et al., 2016) with a UBC2 primer as a normalization control.
Diluted cDNA (10-times for odT cDNA and 5-times for strand-specific cDNA) was used in PCR with
DreamTaq Green Master Mix (Thermo Scientific) or in qPCR (LightCycler 480; Roche) with SYBR Green
mix (Roche). The primers used are listed in Supplemental Table 3.
Vectors and Plant Transformation
Vectors and transgenic plants were generated as described previously (Fedak et al., 2016).
Luciferase measurement
About 100 seeds were placed in wells of a white 96-well PCR plate and covered with 60 µl of 0.5 mM
beetle luciferin (potassium salt, Promega). After overnight incubation in darkness, the light signal
from the wells was measured using a NightSHADE camera (Berthold), with exposure times ranging
from 10 to 30 min.
Chromatin ImmunoPrecipitation (ChIP) for monoubiquitylated histone H2B
1 ml of freshly harvested seeds was frozen in liquid nitrogen and ground with a pellet pestle attached
to an electric drill. The ground material was then suspended in HBM buffer (440 mM sucrose; 25 mM
Tris-HCl pH 7.5; 10 mM MgCl2; 0.1% Triton X-100; 2 mM spermine; 10 mM 2-mercaptoethanol; 1 mM
PMSF, 1× Complete EDTA-free protease inhibitor) and filtered through a double layer of Miracloth
Quick Filtration Material. The collected filtrate was centrifuged for 10 min at 1000 g at 4°C. The pellet
was suspended in HBB buffer (425 mM sucrose; 25 mM Tris-HCl pH 7.5; 10mM MgCl2; 0,1% Triton X-
100; 10 mM 2-mercaptoethanol) and layered on top of a 40% Percoll cushion in a centrifuge tube.
After centrifuging for 40 min at 400 g at 4°C, the layer containing nuclei (at the top of the Percoll)
was collected and mixed with HBB buffer. This suspension was then centrifuged again for 10 min at
1000 g at 4°C. The pellet was suspended in 500 µl DB buffer (16 mM Tris-HCl pH 7.5; 50 mM NaCl; 2.5
mM CaCl2, 0.01 mM PMSF, 1×Complete EDTA-free protease inhibitor) and part of each sample was
saved as a non-digested control. The rest of the sample was mixed with 1.5 µl Micrococcal Nuclease
(300U/µl; Thermo Scientific) and 2 µl RNase A (Fermentas) and digested for 50 min on a rotating
wheel in a cold room. The reaction was stopped by the addition of 2 µl of 0.5 M EDTA.
Dynabeads Protein G (Invitrogen) were washed and suspended in ChIP Dilution Buffer (1.1% Triton X-
100; 1.2 mM EDTA; 16.7 mM Tris-HCl pH 8.0, 167 mM NaCl; 1 mM PMSF; 1× Complete EDTA-free
protease inhibitor). Anti-Ubiquitinated Histone H2B Antibody (NRO3) (MM-0029-P, MediMabs; 1
mg/1 ml) was added and the Dynabeads plus antibody were mixed on a rotating wheel in a cold
room for >2 hours. During this period, the samples of prepared nuclei were fully disrupted by passing
them through a 20-gauge needle followed by a 26-gauge needle, 4 times each. After centrifuging for
10 min at 10 620 g at 4°C the supernatants containing chromatin were collected. The pelleted
material was suspended in High Salt Buffer (590 mM NaCl; 0.75 mM EDTA; 10 mM Tris-HCl pH 7.5;
0.1% Triton X-100), incubated on a rotating wheel in a cold room for 2 hours and then centrifuged for
15 min at 14 000 g at 4°C. The supernatants were added to the previously collected chromatin
supernatants and these were mixed with 800 µl of ChIP Dilution Buffer and Dynabeads carrying 2 µg
of antibody. The samples were mixed on a rotating wheel in a cold room overnight. The Dynabeads
were then washed 3 times with 1 ml of IP buffer (10 mM Tris-HCl pH 8.0; 0.75 mM EDTA; 70 mM
NaCl; 0.5 mM PMSF; 0.5× Complete EDTA-free protease inhibitor) and suspended in 500 µl of PK
buffer (10 mM Tris-HCl pH 8.0; 0.75 mM EDTA; 70 mM NaCl; 0.5% SDS). 2 µl of proteinase K
(Fermentas) was added to each sample and they were incubated for 20 min at 55°C followed by 20
min at 65°C. Then 500 µl of phenol:chloroform:isoamyl alcohol mixture (25:24:1; pH 8.0) were added
and the samples were shaken for 10 min at 22°C. After centrifugation for 10 min at 14 000 g the
upper aqueous layers were collected and 2 µl of glycogen (Ambion), 40 µl of 3M sodium acetate (pH
5.2) and 1 ml 96% ethanol were added to each. The mixed samples were held at -80°C for >1 hour.
The samples were then centrifuged for 30 min at 14 000 g at room temperature and the
supernatants discarded. The pellets were washed with cold 70% ethanol, air-dried and suspended in
water.
Measurements of APA changes
Genes with known alternative polyadenylation sites were selected based on literature data (Wu et
al., 2011). The positions of the alternative polyadenylation sites were determined by reanalysis of
published direct RNA sequencing data (Duc et al., 2013; Sherstnev et al., 2012). Primers specific to
the long and short polyadenylation forms were designed (Supplemental Table 3) and qPCRs were
performed using oligo(dT) cDNA from Col-0 and cpl1-9 seedlings as templates. The ratio of short to
long polyadenylation forms was calculated for each genotype.
Splicing analysis
Splicing analysis was performed as described previously (Dolata et al., 2015).
RNA stability assay
RNA stability assay was performed as described previously (Fedak et al., 2016). Samples were
collected immediately and after 10, 20, 30, 50 min of cordycepin treatment.
Accession Numbers
The sequences of the genes examined in this study can be found in The Arabidopsis Information
Resource data library under the following accession numbers: DOG1 (At5g45830), CPL1 (AT4G21670),
FY (At5g13480), HUB1 (AT2G44950).
SUPPLEMENTAL REFERENCES
Cyrek, M., Fedak, H., Ciesielski, A., Guo, Y., Sliwa, A., Brzezniak, L., Krzyczmonik, K., Pietras, Z., Kaczanowski, S., Liu, F., et al. (2016). Seed Dormancy in Arabidopsis Is Controlled by Alternative Polyadenylation of DOG1. Plant Physiol. 170, 947–955.
Dolata, J., Guo, Y., Kołowerzo, A., Smoliński, D., Brzyżek, G., Jarmołowski, A., and Świeżewski, S. (2015). NTR1 is required for transcription elongation checkpoints at alternative exons in Arabidopsis. EMBO J. 34, 544–558.
Duc, C., Sherstnev, A., Cole, C., Barton, G.J., and Simpson, G.G. (2013). Transcription Termination and Chimeric RNA Formation Controlled by Arabidopsis thaliana FPA. PLoS Genet. 9, e1003867.
Fedak, H., Palusinska, M., Krzyczmonik, K., Brzezniak, L., Yatusevich, R., Pietras, Z., Kaczanowski, S., and Swiezewski, S. (2016). Control of seed dormancy in Arabidopsis by a cis-acting noncoding antisense transcript. Proc. Natl. Acad. Sci. U. S. A.
Letunic, I., Doerks, T., and Bork, P. (2015). SMART: recent updates, new developments and status in 2015. Nucleic Acids Res. 43, D257–D260.
Manavella, P.A., Hagmann, J., Ott, F., Laubinger, S., Franz, M., Macek, B., and Weigel, D. (2012). Fast-Forward Genetics Identifies Plant CPL Phosphatases as Regulators of miRNA Processing Factor HYL1. Cell 151, 859–870.
Schultz, J., Milpetz, F., Bork, P., and Ponting, C.P. (1998). SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. U. S. A. 95, 5857–5864.
Schwab, M. (2008). Identification of Novel Seed Dormancy Mutants in Arabidopsis thaliana and Molecular and Biochemical Characterization of the Seed Dormancy Gene DOG1. University of Cologne.
Sherstnev, A., Duc, C., Cole, C., Zacharaki, V., Hornyik, C., Ozsolak, F., Milos, P.M., Barton, G.J., and Simpson, G.G. (2012). Direct sequencing of Arabidopsis thaliana RNA reveals patterns of cleavage and polyadenylation. Nat. Struct. Mol. Biol. 19, 845–852.
Simpson, G.G., Dijkwel, P.P., Quesada, V., Henderson, I., and Dean, C. (2003). FY is an RNA 3’ end-processing factor that interacts with FCA to control the Arabidopsis floral transition. Cell 113, 777–787.
Wu, X., Liu, M., Downie, B., Liang, C., Ji, G., Li, Q.Q., and Hunt, A.G. (2011). Genome-wide landscape of polyadenylation in Arabidopsis provides evidence for extensive alternative polyadenylation. Proc. Natl. Acad. Sci. U. S. A. 108, 12533–12538.