· web view31.boniface k, bernard fx, garcia m, et al. il-22 inhibits epidermal differentiation...
TRANSCRIPT
Disrupted balance of CD4+ T-cell subsets in bone marrow of patients
with primary immune thrombocytopenia
Short Title BM CD4+ T-cell abnormalities in ITP
Qian Wang1 2 Juan Li1 Tian-shu Yu2 Yu Liu3 Kai Li4 Shuang Liu5 Yang Liu2 Qi
Feng2 Lei Zhang6 Guo-sheng Li2 Lin-lin Shao2 Jun Peng2 Ming Hou2 7 and Xin-
guang Liu2
1Department of Clinical Laboratory Qilu Hospital Shandong University (Qingdao)
758 Hefei Road Qingdao P R China2Department of Hematology Qilu Hospital Shandong University 107 West Wenhua
Road Jinan P R China3School of Chemistry and Pharmaceutical Engineering Qilu University of
Technology 3501 Daxue Road Jinan P R China4Department of Radiotherapy Zhangqiu Peoplersquos Hospital 1920 Huiquan Road
Jinan P R China5Department of Hematology Taian Central Hospital Taian P R China6Department of Orthopedics Shandong Provincial Qianfoshan Hospital Shandong
University Jinan China7Key Laboratory of Cardiovascular Remodeling and Function Research Chinese
Ministry of Education and Chinese Ministry of Health Jinan China
Corresponding author Xin-guang Liu Department of Hematology Qilu Hospital
Shandong University 107 West Wenhua Road Jinan 250012 Shandong China E-
mail Liuxingrant163com or ming Hou Key Laboratory of Cardiovascular
Remodeling and Function Research Chinese Ministry of Education and Chinese
Ministry of Health Jinan China E-mail Houmingmedmailcomcn
Abstract
Disequilibrium of CD4+ T-cell subpopulations in peripheral blood (PB) of patients
with primary immune thrombocytopenia (ITP) has been well established whereas the
profile of CD4+ T-cell subpopulations in bone marrow (BM) remains elusive In the
present study the frequencies of T helper 22 (Th22) Th17 Th1 Th2 follicular T
helper (Tfh) cells and regulatory T cells (Tregs) as well as their effector cytokines in
BM and PB from active ITP patients and healthy controls (HCs) were determined
Results showed that the frequencies of Th22 Th17 Th1 and Tfh cells were
significantly higher but Treg number was remarkably lower in BM from ITP patients
than from HCs In the ITP group it was notable that the numbers of BM Th22 Th17
Th1 Th2 and Tfh cells were significantly elevated compared with the matched PB
counterparts while Treg number in BM was considerably reduced compared with that
in PB In consistence with the BM Th subset pattern plasma levels of interleukin
(IL)-22 IL-17A and interferon (INF)-γ in BM from ITP patients were significantly
increased compared with that from HCs Therefore the balance of CD4+ T-cell subsets
was disrupted in both BM and PB of ITP patients suggesting that this might play
important roles in the pathophysiological process of ITP
Keywords Primary immune thrombocytopenia T helper cells regulatory T cells
bone marrow
Introduction
Primary immune thrombocytopenia (ITP) is an acquired organ-specific autoimmune
disorder [1] characterized by transient or persistent decrease of the peripheral blood
(PB) platelet count to less than 100 times 109L in the absence of conditions known to
cause thrombocytopenia The overall incidence of ITP ranges from 20 to 53 per 105
adults each year [2-4] Manifestations of ITP are very heterogeneous Most of the
patients exhibit no symptoms or minimal bruising while others may have severe
bleeding events such as gastrointestinal hemorrhage or intracranial hemorrhage
Aside from the severity of thrombocytopenia additional factors (age lifestyle etc)
affect the risk of bleeding in ITP [5]
Traditionally ITP is regarded as an autoantibody-mediated disease in which
platelets are opsonized by glycoprotein-specific autoantibodies and prematurely
cleared in the reticuloendothelial system [6] Antiplatelet autoantibody production is
subtly regulated by T helper (Th) cells and enhanced antiplatelet T-cell reactivity has
been observed in ITP [7] It is well known that Th subset balance in peripheral blood
(PB) of ITP patients is disrupted and increased numbers of circulating Th1 Th17
Th22 cells as well as reduced number or function of CD4+CD25+FoxP3+ regulatory T
cells (Tregs) has been reported [8-10] In addition cytotoxic T lymphocyte (CTL)-
mediated platelet lysis also contributes to thrombocytopenia in ITP [11] Therefore
the paradigm for the understanding of ITP pathogenesis has skewed toward a T-cell-
centered scheme in this decade [12]
The production of platelets is a complex process that involves the commitment
of multipotent stem cells to the megakaryocyte (MK) lineage and the proliferation
maturation and terminal differentiation of MKs Bone marrow (BM) is a highly
cellular and dynamic tissue composed of hematopoietic cells stromal cells
endothelial cells and many types of immune cells The hematopoietic niches
including the osteoblastic niche and the vascular niche provide the necessary
microenvironment for MK maturation and platelet formation [13] A growing body of
emerging evidence indicates that the process of thrombopoiesis is impaired in ITP A
shift to a typical morphological feature of immature less polyploid and fewer mature
platelet-producing megakaryocytes is commonly observed in ITP [14] It has been
demonstrated that antiplatelet autoantibodies could suppress the maturation and
apoptosis of megakaryocytes leading to reduced platelet production [15] T cells are
important components of BM microenvironments Elevated number of CD3+ T cells
has been reported in BM of patients with ITP [16] Moreover BM CD8+ T cells in ITP
were shown to be platelet-specific and activated which could impair the apoptosis of
MKs and contribute to decreased platelet production [17] As CD4+ T cells are also
abundant in BM their contribution in situ is reasonable However there are relatively
few data regarding the role of BM CD4+ T-cell subsets in the development of ITP In
the present study the profile of BM CD4+ T-cell subsets in active ITP patients was
determined We found that the frequencies of Th1 Th17 Th22 and follicular T helper
(Tfh) cells were increased while Treg number was decreased in BM of ITP patients
These results provide new insights into the mechanisms of the underlying
immunopathogenic process in ITP
Materials and methods
Patients and controls
Twenty-seven ITP patients with active disease (15 females and 12 males) were
enrolled in this study The median age of patients was 50 years (range 20 - 76 years)
Enrollment took place between September 2016 and June 2017 at the Department of
Hematology Qilu Hospital Shandong University Patients were diagnosed according
to the criteria established by the International Working Group [18] including history
physical examination complete blood count and peripheral blood smear examination
consistent with ITP The patientsrsquo platelet counts ranged between 3 and 28 times 109L
with a median count of 10 times 109L Cases complicated with diabetes cardiovascular
diseases pregnancy activate infection or connective tissue diseases such as systemic
lupus erythematosus (SLE) were excluded Previous therapy including rescue had to
be completed at least 6 weeks before enrollment BM aspiration and biopsy were done
in all patients to further exclude other causes of thrombocytopenia such as
myelodysplasia syndrome (MDS) and aplastic anemia (AA) Bleeding severity was
graded using the ITP-specific Bleeding Assessment Tool (ITP-BAT) [19]
The healthy control (HC) group consisted of 15 healthy adult volunteers (9
females and 6 males age range 34 - 60 years median 47 years) who donated their BM
for hematopoietic stem cell transplantation Platelet counts ranged between 240 and
350 times 109L with a median count of 324 times 109L
Th2 cells and Tfh cells as well as chemokine receptors including CXCR3 CCR4
CCR6 and CCR10 were determined in 6 active ITP patients and 6 HCs
Immunofluorescence microscopy analysis of different CD4+ T-cell subsets was
performed in 5 active ITP patients and 5 HCs The main characteristics of the enrolled
patients are presented in Table 1
This study was approved by the Medical Ethical Committees of Qilu Hospital
Shandong University Informed consent was obtained from all patients and HCs
before enrollment in the study in accordance with the Declaration of Helsinki
Flow cytometry analysis of BM and peripheral CD4+ T-cell subsets
BM aspirates of the posterior superior iliac spine were obtained by experienced
physicians To evaluate peripheral blood dilution BM aspirate smears were examined
simultaneously Peripheral venous blood was also collected for determination of
circulating CD4+ T-cell subsets Levels of intracellular cytokines were measured by
flow cytometry in cytokine-producing cells Briefly 400 μl of heparinized BM or
peripheral whole blood in equal volume of Roswell Park Memorial Institute (RPMI)-
1640 were incubated for 4 hours at 37 degC under 5 CO2 in the presence of 25 ngml
phorbol myristate acetate (PMA) 1 μgml ionomycin and 17 μgml Golgiplug
(Monensin all from Alexis Biochemicals San Diego CA USA) PMA and
ionomycin were pharmacological T-cell-activating agents that mimicked signals
generated by T-cell receptor (TCR) complex and had the advantage of stimulating T
cells of any antigen specificity Golgiplug could block intracellular transport
mechanisms leading to the accumulation of cytokines in the cells After incubation
the cells were stained with phycoerythrin (PE)-Cy5-conjugated anti-CD4 monoclonal
antibodies (mAbs) at room temperature in the dark for 20 minutes Then these cells
were stained with fluorescein isothiocyanate (FITC)-conjugated anti-interferon (IFN)-
γ mAbs PE-conjugated anti-IL-17 mAbs and allophycocyanin (APC)-conjugated
anti-IL22 mAbs after fixation and permeabilization (eBioscience San Diego CA
USA) IgGs of the same-species same-isotype were used as isotype controls Analysis
was performed on a BD FACSCanto II equipped with BD FACSDiva software (BD
Biosciences Franklin Lakes NJ USA)
CD4+CD25+FoxP3+ Tregs were determined using the Human Regulatory T cell
Staining Kit (eBioscience San Diego CA USA) In brief 100 μl of heparinized BM
or peripheral whole blood were incubated with a cocktail of FITC-conjugated anti-
CD4 mAbs and PE-conjugated anti-CD25 mAbs fixed and permeabilized and further
stained APC-conjugated anti-FoxP3 mAbs Th2 Tfh cells and chemokine receptors
including CXCR3 CCR4 CCR6 CCR10 were also determined in 6 ITP patients and
6 HCs Briefly heparinized BM and PB blood were incubated with PMA ionomycin
and Golgiplug Then cells were stained with PerCP-conjugated anti-CD4 mAbs fixed
and permeabilized and finally stained with FITC-conjugated anti-IFN-γ mAbs and
PE-conjugated anti-IL-4 mAbs For measurement of Tfh cells peripheral blood
mononuclear cells (PBMCS) and BM blood mononuclear cells (BBMCs) were
isolated by gradient centrifugation and stained with FITC-conjugated anti-CD4
mAbs APC-conjugated anti-CXCR5 mAbs and PE-conjugated anti-ICOS mAbs
Surface expression of chemokine receptors were presented as median fluorescence
intensity (MFI) and were calculated based on the intensity of the cells incubated with
appropriate isotype-matched control IgG as a reference Cells were also analyzed on a
BD FACSCanto II equipped with BD FACSDiva software (BD Biosciences Franklin
Lakes NJ USA)
Levels of BM Th22 Th17 Th1 Th2 Tfh cells and Tregs were also determined in
smear using multiple channels immunofluorescence staining The reagents and
experimental protocols were described in detail in the Supplemental Methods
Enzyme-linked immunosorbent assay real-time PCR and chemokine
Quantibodyreg Array
BM aspirates and PB were collected into heparin-anticoagulant vacutainer tubes
Plasma was obtained from all subjects by centrifugation and stored at -80 degC for
cytokine detection
Levels of IFN-γ IL-17A and IL-22 were measured using commercial enzyme-
linked immunosorbent assay (ELISA) kits (eBioscience San Diego CA USA)
following the manufacturerrsquos protocols The lower detection limits for IFN-γ IL-17A
and IL-22 were 099 pgml 15 pgml and 27 pgml respectively
mRNA expression of IL-4 in PBMCs and BBMC was measured by real-time
reverse transcription polymerase chain reaction (RT-PCR) according to a previous
described method [20] The primers for IL-4 and GAPDH were as follows IL-4-F
AGCAGTTCCACAGGCACAAG IL-4-R TACTCTGGTTGGCTTCCTTCAC
GAPDH-F GCACCGTCAAGGCTGAGAAC GAPDH-R
TGGTGAAGACGCCAGTGGA
Chemokines in BM and PB plasma samples from 7 ITP patients and 4 HCs were
determined As shown in Supplemental Table 1 the Quantibodyreg array
(RayBiotech Norcross GA USA) capable of detecting 40 kinds of
chemokinescytokines simultaneously was used according to the manufacturerrsquos
instruction
The indirect modified monoclonal antibody-specific immobilization of platelet
antigens assay
The modified mAb-specific immobilization of platelet antigens (MAIPA) assay was
carried out according to a previous described method [21] Briefly 1 times 109 platelets
from healthy donors with blood type O were sensitized with 100 μl plasma from
patients or HCs washed and solubilized in Tris-buffered saline containing 1 Triton
X-100 and 01 mgml leupeptin Microtiter plates were coated with affinity-purified
goat-anti mouse IgG and incubated with anti-CD41a mAbs or anti-CD42b mAbs (BD
Pharmingen San Jose CA USA) for 60 minutes at room temperature After washing
the sensitized platelet lysate was added in duplicates to each well and incubated for
another 60 minutes IgG bound to captured GPIIbIIIa or GPIbIX was detected by
alkaline-phosphatase-conjugated goat anti-human IgG p-Nitrophenyl-phosphate was
used as the substrate and the plates were read on an automated microtiter plate reader
(Thermo-Multiskan Mk3 Hudson NH USA) using dual wavelength (405 and 492
nm) A positive result was defined as absorbance above mean + 3 standard deviations
(SDs) of normal controls
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
mail Liuxingrant163com or ming Hou Key Laboratory of Cardiovascular
Remodeling and Function Research Chinese Ministry of Education and Chinese
Ministry of Health Jinan China E-mail Houmingmedmailcomcn
Abstract
Disequilibrium of CD4+ T-cell subpopulations in peripheral blood (PB) of patients
with primary immune thrombocytopenia (ITP) has been well established whereas the
profile of CD4+ T-cell subpopulations in bone marrow (BM) remains elusive In the
present study the frequencies of T helper 22 (Th22) Th17 Th1 Th2 follicular T
helper (Tfh) cells and regulatory T cells (Tregs) as well as their effector cytokines in
BM and PB from active ITP patients and healthy controls (HCs) were determined
Results showed that the frequencies of Th22 Th17 Th1 and Tfh cells were
significantly higher but Treg number was remarkably lower in BM from ITP patients
than from HCs In the ITP group it was notable that the numbers of BM Th22 Th17
Th1 Th2 and Tfh cells were significantly elevated compared with the matched PB
counterparts while Treg number in BM was considerably reduced compared with that
in PB In consistence with the BM Th subset pattern plasma levels of interleukin
(IL)-22 IL-17A and interferon (INF)-γ in BM from ITP patients were significantly
increased compared with that from HCs Therefore the balance of CD4+ T-cell subsets
was disrupted in both BM and PB of ITP patients suggesting that this might play
important roles in the pathophysiological process of ITP
Keywords Primary immune thrombocytopenia T helper cells regulatory T cells
bone marrow
Introduction
Primary immune thrombocytopenia (ITP) is an acquired organ-specific autoimmune
disorder [1] characterized by transient or persistent decrease of the peripheral blood
(PB) platelet count to less than 100 times 109L in the absence of conditions known to
cause thrombocytopenia The overall incidence of ITP ranges from 20 to 53 per 105
adults each year [2-4] Manifestations of ITP are very heterogeneous Most of the
patients exhibit no symptoms or minimal bruising while others may have severe
bleeding events such as gastrointestinal hemorrhage or intracranial hemorrhage
Aside from the severity of thrombocytopenia additional factors (age lifestyle etc)
affect the risk of bleeding in ITP [5]
Traditionally ITP is regarded as an autoantibody-mediated disease in which
platelets are opsonized by glycoprotein-specific autoantibodies and prematurely
cleared in the reticuloendothelial system [6] Antiplatelet autoantibody production is
subtly regulated by T helper (Th) cells and enhanced antiplatelet T-cell reactivity has
been observed in ITP [7] It is well known that Th subset balance in peripheral blood
(PB) of ITP patients is disrupted and increased numbers of circulating Th1 Th17
Th22 cells as well as reduced number or function of CD4+CD25+FoxP3+ regulatory T
cells (Tregs) has been reported [8-10] In addition cytotoxic T lymphocyte (CTL)-
mediated platelet lysis also contributes to thrombocytopenia in ITP [11] Therefore
the paradigm for the understanding of ITP pathogenesis has skewed toward a T-cell-
centered scheme in this decade [12]
The production of platelets is a complex process that involves the commitment
of multipotent stem cells to the megakaryocyte (MK) lineage and the proliferation
maturation and terminal differentiation of MKs Bone marrow (BM) is a highly
cellular and dynamic tissue composed of hematopoietic cells stromal cells
endothelial cells and many types of immune cells The hematopoietic niches
including the osteoblastic niche and the vascular niche provide the necessary
microenvironment for MK maturation and platelet formation [13] A growing body of
emerging evidence indicates that the process of thrombopoiesis is impaired in ITP A
shift to a typical morphological feature of immature less polyploid and fewer mature
platelet-producing megakaryocytes is commonly observed in ITP [14] It has been
demonstrated that antiplatelet autoantibodies could suppress the maturation and
apoptosis of megakaryocytes leading to reduced platelet production [15] T cells are
important components of BM microenvironments Elevated number of CD3+ T cells
has been reported in BM of patients with ITP [16] Moreover BM CD8+ T cells in ITP
were shown to be platelet-specific and activated which could impair the apoptosis of
MKs and contribute to decreased platelet production [17] As CD4+ T cells are also
abundant in BM their contribution in situ is reasonable However there are relatively
few data regarding the role of BM CD4+ T-cell subsets in the development of ITP In
the present study the profile of BM CD4+ T-cell subsets in active ITP patients was
determined We found that the frequencies of Th1 Th17 Th22 and follicular T helper
(Tfh) cells were increased while Treg number was decreased in BM of ITP patients
These results provide new insights into the mechanisms of the underlying
immunopathogenic process in ITP
Materials and methods
Patients and controls
Twenty-seven ITP patients with active disease (15 females and 12 males) were
enrolled in this study The median age of patients was 50 years (range 20 - 76 years)
Enrollment took place between September 2016 and June 2017 at the Department of
Hematology Qilu Hospital Shandong University Patients were diagnosed according
to the criteria established by the International Working Group [18] including history
physical examination complete blood count and peripheral blood smear examination
consistent with ITP The patientsrsquo platelet counts ranged between 3 and 28 times 109L
with a median count of 10 times 109L Cases complicated with diabetes cardiovascular
diseases pregnancy activate infection or connective tissue diseases such as systemic
lupus erythematosus (SLE) were excluded Previous therapy including rescue had to
be completed at least 6 weeks before enrollment BM aspiration and biopsy were done
in all patients to further exclude other causes of thrombocytopenia such as
myelodysplasia syndrome (MDS) and aplastic anemia (AA) Bleeding severity was
graded using the ITP-specific Bleeding Assessment Tool (ITP-BAT) [19]
The healthy control (HC) group consisted of 15 healthy adult volunteers (9
females and 6 males age range 34 - 60 years median 47 years) who donated their BM
for hematopoietic stem cell transplantation Platelet counts ranged between 240 and
350 times 109L with a median count of 324 times 109L
Th2 cells and Tfh cells as well as chemokine receptors including CXCR3 CCR4
CCR6 and CCR10 were determined in 6 active ITP patients and 6 HCs
Immunofluorescence microscopy analysis of different CD4+ T-cell subsets was
performed in 5 active ITP patients and 5 HCs The main characteristics of the enrolled
patients are presented in Table 1
This study was approved by the Medical Ethical Committees of Qilu Hospital
Shandong University Informed consent was obtained from all patients and HCs
before enrollment in the study in accordance with the Declaration of Helsinki
Flow cytometry analysis of BM and peripheral CD4+ T-cell subsets
BM aspirates of the posterior superior iliac spine were obtained by experienced
physicians To evaluate peripheral blood dilution BM aspirate smears were examined
simultaneously Peripheral venous blood was also collected for determination of
circulating CD4+ T-cell subsets Levels of intracellular cytokines were measured by
flow cytometry in cytokine-producing cells Briefly 400 μl of heparinized BM or
peripheral whole blood in equal volume of Roswell Park Memorial Institute (RPMI)-
1640 were incubated for 4 hours at 37 degC under 5 CO2 in the presence of 25 ngml
phorbol myristate acetate (PMA) 1 μgml ionomycin and 17 μgml Golgiplug
(Monensin all from Alexis Biochemicals San Diego CA USA) PMA and
ionomycin were pharmacological T-cell-activating agents that mimicked signals
generated by T-cell receptor (TCR) complex and had the advantage of stimulating T
cells of any antigen specificity Golgiplug could block intracellular transport
mechanisms leading to the accumulation of cytokines in the cells After incubation
the cells were stained with phycoerythrin (PE)-Cy5-conjugated anti-CD4 monoclonal
antibodies (mAbs) at room temperature in the dark for 20 minutes Then these cells
were stained with fluorescein isothiocyanate (FITC)-conjugated anti-interferon (IFN)-
γ mAbs PE-conjugated anti-IL-17 mAbs and allophycocyanin (APC)-conjugated
anti-IL22 mAbs after fixation and permeabilization (eBioscience San Diego CA
USA) IgGs of the same-species same-isotype were used as isotype controls Analysis
was performed on a BD FACSCanto II equipped with BD FACSDiva software (BD
Biosciences Franklin Lakes NJ USA)
CD4+CD25+FoxP3+ Tregs were determined using the Human Regulatory T cell
Staining Kit (eBioscience San Diego CA USA) In brief 100 μl of heparinized BM
or peripheral whole blood were incubated with a cocktail of FITC-conjugated anti-
CD4 mAbs and PE-conjugated anti-CD25 mAbs fixed and permeabilized and further
stained APC-conjugated anti-FoxP3 mAbs Th2 Tfh cells and chemokine receptors
including CXCR3 CCR4 CCR6 CCR10 were also determined in 6 ITP patients and
6 HCs Briefly heparinized BM and PB blood were incubated with PMA ionomycin
and Golgiplug Then cells were stained with PerCP-conjugated anti-CD4 mAbs fixed
and permeabilized and finally stained with FITC-conjugated anti-IFN-γ mAbs and
PE-conjugated anti-IL-4 mAbs For measurement of Tfh cells peripheral blood
mononuclear cells (PBMCS) and BM blood mononuclear cells (BBMCs) were
isolated by gradient centrifugation and stained with FITC-conjugated anti-CD4
mAbs APC-conjugated anti-CXCR5 mAbs and PE-conjugated anti-ICOS mAbs
Surface expression of chemokine receptors were presented as median fluorescence
intensity (MFI) and were calculated based on the intensity of the cells incubated with
appropriate isotype-matched control IgG as a reference Cells were also analyzed on a
BD FACSCanto II equipped with BD FACSDiva software (BD Biosciences Franklin
Lakes NJ USA)
Levels of BM Th22 Th17 Th1 Th2 Tfh cells and Tregs were also determined in
smear using multiple channels immunofluorescence staining The reagents and
experimental protocols were described in detail in the Supplemental Methods
Enzyme-linked immunosorbent assay real-time PCR and chemokine
Quantibodyreg Array
BM aspirates and PB were collected into heparin-anticoagulant vacutainer tubes
Plasma was obtained from all subjects by centrifugation and stored at -80 degC for
cytokine detection
Levels of IFN-γ IL-17A and IL-22 were measured using commercial enzyme-
linked immunosorbent assay (ELISA) kits (eBioscience San Diego CA USA)
following the manufacturerrsquos protocols The lower detection limits for IFN-γ IL-17A
and IL-22 were 099 pgml 15 pgml and 27 pgml respectively
mRNA expression of IL-4 in PBMCs and BBMC was measured by real-time
reverse transcription polymerase chain reaction (RT-PCR) according to a previous
described method [20] The primers for IL-4 and GAPDH were as follows IL-4-F
AGCAGTTCCACAGGCACAAG IL-4-R TACTCTGGTTGGCTTCCTTCAC
GAPDH-F GCACCGTCAAGGCTGAGAAC GAPDH-R
TGGTGAAGACGCCAGTGGA
Chemokines in BM and PB plasma samples from 7 ITP patients and 4 HCs were
determined As shown in Supplemental Table 1 the Quantibodyreg array
(RayBiotech Norcross GA USA) capable of detecting 40 kinds of
chemokinescytokines simultaneously was used according to the manufacturerrsquos
instruction
The indirect modified monoclonal antibody-specific immobilization of platelet
antigens assay
The modified mAb-specific immobilization of platelet antigens (MAIPA) assay was
carried out according to a previous described method [21] Briefly 1 times 109 platelets
from healthy donors with blood type O were sensitized with 100 μl plasma from
patients or HCs washed and solubilized in Tris-buffered saline containing 1 Triton
X-100 and 01 mgml leupeptin Microtiter plates were coated with affinity-purified
goat-anti mouse IgG and incubated with anti-CD41a mAbs or anti-CD42b mAbs (BD
Pharmingen San Jose CA USA) for 60 minutes at room temperature After washing
the sensitized platelet lysate was added in duplicates to each well and incubated for
another 60 minutes IgG bound to captured GPIIbIIIa or GPIbIX was detected by
alkaline-phosphatase-conjugated goat anti-human IgG p-Nitrophenyl-phosphate was
used as the substrate and the plates were read on an automated microtiter plate reader
(Thermo-Multiskan Mk3 Hudson NH USA) using dual wavelength (405 and 492
nm) A positive result was defined as absorbance above mean + 3 standard deviations
(SDs) of normal controls
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Introduction
Primary immune thrombocytopenia (ITP) is an acquired organ-specific autoimmune
disorder [1] characterized by transient or persistent decrease of the peripheral blood
(PB) platelet count to less than 100 times 109L in the absence of conditions known to
cause thrombocytopenia The overall incidence of ITP ranges from 20 to 53 per 105
adults each year [2-4] Manifestations of ITP are very heterogeneous Most of the
patients exhibit no symptoms or minimal bruising while others may have severe
bleeding events such as gastrointestinal hemorrhage or intracranial hemorrhage
Aside from the severity of thrombocytopenia additional factors (age lifestyle etc)
affect the risk of bleeding in ITP [5]
Traditionally ITP is regarded as an autoantibody-mediated disease in which
platelets are opsonized by glycoprotein-specific autoantibodies and prematurely
cleared in the reticuloendothelial system [6] Antiplatelet autoantibody production is
subtly regulated by T helper (Th) cells and enhanced antiplatelet T-cell reactivity has
been observed in ITP [7] It is well known that Th subset balance in peripheral blood
(PB) of ITP patients is disrupted and increased numbers of circulating Th1 Th17
Th22 cells as well as reduced number or function of CD4+CD25+FoxP3+ regulatory T
cells (Tregs) has been reported [8-10] In addition cytotoxic T lymphocyte (CTL)-
mediated platelet lysis also contributes to thrombocytopenia in ITP [11] Therefore
the paradigm for the understanding of ITP pathogenesis has skewed toward a T-cell-
centered scheme in this decade [12]
The production of platelets is a complex process that involves the commitment
of multipotent stem cells to the megakaryocyte (MK) lineage and the proliferation
maturation and terminal differentiation of MKs Bone marrow (BM) is a highly
cellular and dynamic tissue composed of hematopoietic cells stromal cells
endothelial cells and many types of immune cells The hematopoietic niches
including the osteoblastic niche and the vascular niche provide the necessary
microenvironment for MK maturation and platelet formation [13] A growing body of
emerging evidence indicates that the process of thrombopoiesis is impaired in ITP A
shift to a typical morphological feature of immature less polyploid and fewer mature
platelet-producing megakaryocytes is commonly observed in ITP [14] It has been
demonstrated that antiplatelet autoantibodies could suppress the maturation and
apoptosis of megakaryocytes leading to reduced platelet production [15] T cells are
important components of BM microenvironments Elevated number of CD3+ T cells
has been reported in BM of patients with ITP [16] Moreover BM CD8+ T cells in ITP
were shown to be platelet-specific and activated which could impair the apoptosis of
MKs and contribute to decreased platelet production [17] As CD4+ T cells are also
abundant in BM their contribution in situ is reasonable However there are relatively
few data regarding the role of BM CD4+ T-cell subsets in the development of ITP In
the present study the profile of BM CD4+ T-cell subsets in active ITP patients was
determined We found that the frequencies of Th1 Th17 Th22 and follicular T helper
(Tfh) cells were increased while Treg number was decreased in BM of ITP patients
These results provide new insights into the mechanisms of the underlying
immunopathogenic process in ITP
Materials and methods
Patients and controls
Twenty-seven ITP patients with active disease (15 females and 12 males) were
enrolled in this study The median age of patients was 50 years (range 20 - 76 years)
Enrollment took place between September 2016 and June 2017 at the Department of
Hematology Qilu Hospital Shandong University Patients were diagnosed according
to the criteria established by the International Working Group [18] including history
physical examination complete blood count and peripheral blood smear examination
consistent with ITP The patientsrsquo platelet counts ranged between 3 and 28 times 109L
with a median count of 10 times 109L Cases complicated with diabetes cardiovascular
diseases pregnancy activate infection or connective tissue diseases such as systemic
lupus erythematosus (SLE) were excluded Previous therapy including rescue had to
be completed at least 6 weeks before enrollment BM aspiration and biopsy were done
in all patients to further exclude other causes of thrombocytopenia such as
myelodysplasia syndrome (MDS) and aplastic anemia (AA) Bleeding severity was
graded using the ITP-specific Bleeding Assessment Tool (ITP-BAT) [19]
The healthy control (HC) group consisted of 15 healthy adult volunteers (9
females and 6 males age range 34 - 60 years median 47 years) who donated their BM
for hematopoietic stem cell transplantation Platelet counts ranged between 240 and
350 times 109L with a median count of 324 times 109L
Th2 cells and Tfh cells as well as chemokine receptors including CXCR3 CCR4
CCR6 and CCR10 were determined in 6 active ITP patients and 6 HCs
Immunofluorescence microscopy analysis of different CD4+ T-cell subsets was
performed in 5 active ITP patients and 5 HCs The main characteristics of the enrolled
patients are presented in Table 1
This study was approved by the Medical Ethical Committees of Qilu Hospital
Shandong University Informed consent was obtained from all patients and HCs
before enrollment in the study in accordance with the Declaration of Helsinki
Flow cytometry analysis of BM and peripheral CD4+ T-cell subsets
BM aspirates of the posterior superior iliac spine were obtained by experienced
physicians To evaluate peripheral blood dilution BM aspirate smears were examined
simultaneously Peripheral venous blood was also collected for determination of
circulating CD4+ T-cell subsets Levels of intracellular cytokines were measured by
flow cytometry in cytokine-producing cells Briefly 400 μl of heparinized BM or
peripheral whole blood in equal volume of Roswell Park Memorial Institute (RPMI)-
1640 were incubated for 4 hours at 37 degC under 5 CO2 in the presence of 25 ngml
phorbol myristate acetate (PMA) 1 μgml ionomycin and 17 μgml Golgiplug
(Monensin all from Alexis Biochemicals San Diego CA USA) PMA and
ionomycin were pharmacological T-cell-activating agents that mimicked signals
generated by T-cell receptor (TCR) complex and had the advantage of stimulating T
cells of any antigen specificity Golgiplug could block intracellular transport
mechanisms leading to the accumulation of cytokines in the cells After incubation
the cells were stained with phycoerythrin (PE)-Cy5-conjugated anti-CD4 monoclonal
antibodies (mAbs) at room temperature in the dark for 20 minutes Then these cells
were stained with fluorescein isothiocyanate (FITC)-conjugated anti-interferon (IFN)-
γ mAbs PE-conjugated anti-IL-17 mAbs and allophycocyanin (APC)-conjugated
anti-IL22 mAbs after fixation and permeabilization (eBioscience San Diego CA
USA) IgGs of the same-species same-isotype were used as isotype controls Analysis
was performed on a BD FACSCanto II equipped with BD FACSDiva software (BD
Biosciences Franklin Lakes NJ USA)
CD4+CD25+FoxP3+ Tregs were determined using the Human Regulatory T cell
Staining Kit (eBioscience San Diego CA USA) In brief 100 μl of heparinized BM
or peripheral whole blood were incubated with a cocktail of FITC-conjugated anti-
CD4 mAbs and PE-conjugated anti-CD25 mAbs fixed and permeabilized and further
stained APC-conjugated anti-FoxP3 mAbs Th2 Tfh cells and chemokine receptors
including CXCR3 CCR4 CCR6 CCR10 were also determined in 6 ITP patients and
6 HCs Briefly heparinized BM and PB blood were incubated with PMA ionomycin
and Golgiplug Then cells were stained with PerCP-conjugated anti-CD4 mAbs fixed
and permeabilized and finally stained with FITC-conjugated anti-IFN-γ mAbs and
PE-conjugated anti-IL-4 mAbs For measurement of Tfh cells peripheral blood
mononuclear cells (PBMCS) and BM blood mononuclear cells (BBMCs) were
isolated by gradient centrifugation and stained with FITC-conjugated anti-CD4
mAbs APC-conjugated anti-CXCR5 mAbs and PE-conjugated anti-ICOS mAbs
Surface expression of chemokine receptors were presented as median fluorescence
intensity (MFI) and were calculated based on the intensity of the cells incubated with
appropriate isotype-matched control IgG as a reference Cells were also analyzed on a
BD FACSCanto II equipped with BD FACSDiva software (BD Biosciences Franklin
Lakes NJ USA)
Levels of BM Th22 Th17 Th1 Th2 Tfh cells and Tregs were also determined in
smear using multiple channels immunofluorescence staining The reagents and
experimental protocols were described in detail in the Supplemental Methods
Enzyme-linked immunosorbent assay real-time PCR and chemokine
Quantibodyreg Array
BM aspirates and PB were collected into heparin-anticoagulant vacutainer tubes
Plasma was obtained from all subjects by centrifugation and stored at -80 degC for
cytokine detection
Levels of IFN-γ IL-17A and IL-22 were measured using commercial enzyme-
linked immunosorbent assay (ELISA) kits (eBioscience San Diego CA USA)
following the manufacturerrsquos protocols The lower detection limits for IFN-γ IL-17A
and IL-22 were 099 pgml 15 pgml and 27 pgml respectively
mRNA expression of IL-4 in PBMCs and BBMC was measured by real-time
reverse transcription polymerase chain reaction (RT-PCR) according to a previous
described method [20] The primers for IL-4 and GAPDH were as follows IL-4-F
AGCAGTTCCACAGGCACAAG IL-4-R TACTCTGGTTGGCTTCCTTCAC
GAPDH-F GCACCGTCAAGGCTGAGAAC GAPDH-R
TGGTGAAGACGCCAGTGGA
Chemokines in BM and PB plasma samples from 7 ITP patients and 4 HCs were
determined As shown in Supplemental Table 1 the Quantibodyreg array
(RayBiotech Norcross GA USA) capable of detecting 40 kinds of
chemokinescytokines simultaneously was used according to the manufacturerrsquos
instruction
The indirect modified monoclonal antibody-specific immobilization of platelet
antigens assay
The modified mAb-specific immobilization of platelet antigens (MAIPA) assay was
carried out according to a previous described method [21] Briefly 1 times 109 platelets
from healthy donors with blood type O were sensitized with 100 μl plasma from
patients or HCs washed and solubilized in Tris-buffered saline containing 1 Triton
X-100 and 01 mgml leupeptin Microtiter plates were coated with affinity-purified
goat-anti mouse IgG and incubated with anti-CD41a mAbs or anti-CD42b mAbs (BD
Pharmingen San Jose CA USA) for 60 minutes at room temperature After washing
the sensitized platelet lysate was added in duplicates to each well and incubated for
another 60 minutes IgG bound to captured GPIIbIIIa or GPIbIX was detected by
alkaline-phosphatase-conjugated goat anti-human IgG p-Nitrophenyl-phosphate was
used as the substrate and the plates were read on an automated microtiter plate reader
(Thermo-Multiskan Mk3 Hudson NH USA) using dual wavelength (405 and 492
nm) A positive result was defined as absorbance above mean + 3 standard deviations
(SDs) of normal controls
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
cellular and dynamic tissue composed of hematopoietic cells stromal cells
endothelial cells and many types of immune cells The hematopoietic niches
including the osteoblastic niche and the vascular niche provide the necessary
microenvironment for MK maturation and platelet formation [13] A growing body of
emerging evidence indicates that the process of thrombopoiesis is impaired in ITP A
shift to a typical morphological feature of immature less polyploid and fewer mature
platelet-producing megakaryocytes is commonly observed in ITP [14] It has been
demonstrated that antiplatelet autoantibodies could suppress the maturation and
apoptosis of megakaryocytes leading to reduced platelet production [15] T cells are
important components of BM microenvironments Elevated number of CD3+ T cells
has been reported in BM of patients with ITP [16] Moreover BM CD8+ T cells in ITP
were shown to be platelet-specific and activated which could impair the apoptosis of
MKs and contribute to decreased platelet production [17] As CD4+ T cells are also
abundant in BM their contribution in situ is reasonable However there are relatively
few data regarding the role of BM CD4+ T-cell subsets in the development of ITP In
the present study the profile of BM CD4+ T-cell subsets in active ITP patients was
determined We found that the frequencies of Th1 Th17 Th22 and follicular T helper
(Tfh) cells were increased while Treg number was decreased in BM of ITP patients
These results provide new insights into the mechanisms of the underlying
immunopathogenic process in ITP
Materials and methods
Patients and controls
Twenty-seven ITP patients with active disease (15 females and 12 males) were
enrolled in this study The median age of patients was 50 years (range 20 - 76 years)
Enrollment took place between September 2016 and June 2017 at the Department of
Hematology Qilu Hospital Shandong University Patients were diagnosed according
to the criteria established by the International Working Group [18] including history
physical examination complete blood count and peripheral blood smear examination
consistent with ITP The patientsrsquo platelet counts ranged between 3 and 28 times 109L
with a median count of 10 times 109L Cases complicated with diabetes cardiovascular
diseases pregnancy activate infection or connective tissue diseases such as systemic
lupus erythematosus (SLE) were excluded Previous therapy including rescue had to
be completed at least 6 weeks before enrollment BM aspiration and biopsy were done
in all patients to further exclude other causes of thrombocytopenia such as
myelodysplasia syndrome (MDS) and aplastic anemia (AA) Bleeding severity was
graded using the ITP-specific Bleeding Assessment Tool (ITP-BAT) [19]
The healthy control (HC) group consisted of 15 healthy adult volunteers (9
females and 6 males age range 34 - 60 years median 47 years) who donated their BM
for hematopoietic stem cell transplantation Platelet counts ranged between 240 and
350 times 109L with a median count of 324 times 109L
Th2 cells and Tfh cells as well as chemokine receptors including CXCR3 CCR4
CCR6 and CCR10 were determined in 6 active ITP patients and 6 HCs
Immunofluorescence microscopy analysis of different CD4+ T-cell subsets was
performed in 5 active ITP patients and 5 HCs The main characteristics of the enrolled
patients are presented in Table 1
This study was approved by the Medical Ethical Committees of Qilu Hospital
Shandong University Informed consent was obtained from all patients and HCs
before enrollment in the study in accordance with the Declaration of Helsinki
Flow cytometry analysis of BM and peripheral CD4+ T-cell subsets
BM aspirates of the posterior superior iliac spine were obtained by experienced
physicians To evaluate peripheral blood dilution BM aspirate smears were examined
simultaneously Peripheral venous blood was also collected for determination of
circulating CD4+ T-cell subsets Levels of intracellular cytokines were measured by
flow cytometry in cytokine-producing cells Briefly 400 μl of heparinized BM or
peripheral whole blood in equal volume of Roswell Park Memorial Institute (RPMI)-
1640 were incubated for 4 hours at 37 degC under 5 CO2 in the presence of 25 ngml
phorbol myristate acetate (PMA) 1 μgml ionomycin and 17 μgml Golgiplug
(Monensin all from Alexis Biochemicals San Diego CA USA) PMA and
ionomycin were pharmacological T-cell-activating agents that mimicked signals
generated by T-cell receptor (TCR) complex and had the advantage of stimulating T
cells of any antigen specificity Golgiplug could block intracellular transport
mechanisms leading to the accumulation of cytokines in the cells After incubation
the cells were stained with phycoerythrin (PE)-Cy5-conjugated anti-CD4 monoclonal
antibodies (mAbs) at room temperature in the dark for 20 minutes Then these cells
were stained with fluorescein isothiocyanate (FITC)-conjugated anti-interferon (IFN)-
γ mAbs PE-conjugated anti-IL-17 mAbs and allophycocyanin (APC)-conjugated
anti-IL22 mAbs after fixation and permeabilization (eBioscience San Diego CA
USA) IgGs of the same-species same-isotype were used as isotype controls Analysis
was performed on a BD FACSCanto II equipped with BD FACSDiva software (BD
Biosciences Franklin Lakes NJ USA)
CD4+CD25+FoxP3+ Tregs were determined using the Human Regulatory T cell
Staining Kit (eBioscience San Diego CA USA) In brief 100 μl of heparinized BM
or peripheral whole blood were incubated with a cocktail of FITC-conjugated anti-
CD4 mAbs and PE-conjugated anti-CD25 mAbs fixed and permeabilized and further
stained APC-conjugated anti-FoxP3 mAbs Th2 Tfh cells and chemokine receptors
including CXCR3 CCR4 CCR6 CCR10 were also determined in 6 ITP patients and
6 HCs Briefly heparinized BM and PB blood were incubated with PMA ionomycin
and Golgiplug Then cells were stained with PerCP-conjugated anti-CD4 mAbs fixed
and permeabilized and finally stained with FITC-conjugated anti-IFN-γ mAbs and
PE-conjugated anti-IL-4 mAbs For measurement of Tfh cells peripheral blood
mononuclear cells (PBMCS) and BM blood mononuclear cells (BBMCs) were
isolated by gradient centrifugation and stained with FITC-conjugated anti-CD4
mAbs APC-conjugated anti-CXCR5 mAbs and PE-conjugated anti-ICOS mAbs
Surface expression of chemokine receptors were presented as median fluorescence
intensity (MFI) and were calculated based on the intensity of the cells incubated with
appropriate isotype-matched control IgG as a reference Cells were also analyzed on a
BD FACSCanto II equipped with BD FACSDiva software (BD Biosciences Franklin
Lakes NJ USA)
Levels of BM Th22 Th17 Th1 Th2 Tfh cells and Tregs were also determined in
smear using multiple channels immunofluorescence staining The reagents and
experimental protocols were described in detail in the Supplemental Methods
Enzyme-linked immunosorbent assay real-time PCR and chemokine
Quantibodyreg Array
BM aspirates and PB were collected into heparin-anticoagulant vacutainer tubes
Plasma was obtained from all subjects by centrifugation and stored at -80 degC for
cytokine detection
Levels of IFN-γ IL-17A and IL-22 were measured using commercial enzyme-
linked immunosorbent assay (ELISA) kits (eBioscience San Diego CA USA)
following the manufacturerrsquos protocols The lower detection limits for IFN-γ IL-17A
and IL-22 were 099 pgml 15 pgml and 27 pgml respectively
mRNA expression of IL-4 in PBMCs and BBMC was measured by real-time
reverse transcription polymerase chain reaction (RT-PCR) according to a previous
described method [20] The primers for IL-4 and GAPDH were as follows IL-4-F
AGCAGTTCCACAGGCACAAG IL-4-R TACTCTGGTTGGCTTCCTTCAC
GAPDH-F GCACCGTCAAGGCTGAGAAC GAPDH-R
TGGTGAAGACGCCAGTGGA
Chemokines in BM and PB plasma samples from 7 ITP patients and 4 HCs were
determined As shown in Supplemental Table 1 the Quantibodyreg array
(RayBiotech Norcross GA USA) capable of detecting 40 kinds of
chemokinescytokines simultaneously was used according to the manufacturerrsquos
instruction
The indirect modified monoclonal antibody-specific immobilization of platelet
antigens assay
The modified mAb-specific immobilization of platelet antigens (MAIPA) assay was
carried out according to a previous described method [21] Briefly 1 times 109 platelets
from healthy donors with blood type O were sensitized with 100 μl plasma from
patients or HCs washed and solubilized in Tris-buffered saline containing 1 Triton
X-100 and 01 mgml leupeptin Microtiter plates were coated with affinity-purified
goat-anti mouse IgG and incubated with anti-CD41a mAbs or anti-CD42b mAbs (BD
Pharmingen San Jose CA USA) for 60 minutes at room temperature After washing
the sensitized platelet lysate was added in duplicates to each well and incubated for
another 60 minutes IgG bound to captured GPIIbIIIa or GPIbIX was detected by
alkaline-phosphatase-conjugated goat anti-human IgG p-Nitrophenyl-phosphate was
used as the substrate and the plates were read on an automated microtiter plate reader
(Thermo-Multiskan Mk3 Hudson NH USA) using dual wavelength (405 and 492
nm) A positive result was defined as absorbance above mean + 3 standard deviations
(SDs) of normal controls
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Materials and methods
Patients and controls
Twenty-seven ITP patients with active disease (15 females and 12 males) were
enrolled in this study The median age of patients was 50 years (range 20 - 76 years)
Enrollment took place between September 2016 and June 2017 at the Department of
Hematology Qilu Hospital Shandong University Patients were diagnosed according
to the criteria established by the International Working Group [18] including history
physical examination complete blood count and peripheral blood smear examination
consistent with ITP The patientsrsquo platelet counts ranged between 3 and 28 times 109L
with a median count of 10 times 109L Cases complicated with diabetes cardiovascular
diseases pregnancy activate infection or connective tissue diseases such as systemic
lupus erythematosus (SLE) were excluded Previous therapy including rescue had to
be completed at least 6 weeks before enrollment BM aspiration and biopsy were done
in all patients to further exclude other causes of thrombocytopenia such as
myelodysplasia syndrome (MDS) and aplastic anemia (AA) Bleeding severity was
graded using the ITP-specific Bleeding Assessment Tool (ITP-BAT) [19]
The healthy control (HC) group consisted of 15 healthy adult volunteers (9
females and 6 males age range 34 - 60 years median 47 years) who donated their BM
for hematopoietic stem cell transplantation Platelet counts ranged between 240 and
350 times 109L with a median count of 324 times 109L
Th2 cells and Tfh cells as well as chemokine receptors including CXCR3 CCR4
CCR6 and CCR10 were determined in 6 active ITP patients and 6 HCs
Immunofluorescence microscopy analysis of different CD4+ T-cell subsets was
performed in 5 active ITP patients and 5 HCs The main characteristics of the enrolled
patients are presented in Table 1
This study was approved by the Medical Ethical Committees of Qilu Hospital
Shandong University Informed consent was obtained from all patients and HCs
before enrollment in the study in accordance with the Declaration of Helsinki
Flow cytometry analysis of BM and peripheral CD4+ T-cell subsets
BM aspirates of the posterior superior iliac spine were obtained by experienced
physicians To evaluate peripheral blood dilution BM aspirate smears were examined
simultaneously Peripheral venous blood was also collected for determination of
circulating CD4+ T-cell subsets Levels of intracellular cytokines were measured by
flow cytometry in cytokine-producing cells Briefly 400 μl of heparinized BM or
peripheral whole blood in equal volume of Roswell Park Memorial Institute (RPMI)-
1640 were incubated for 4 hours at 37 degC under 5 CO2 in the presence of 25 ngml
phorbol myristate acetate (PMA) 1 μgml ionomycin and 17 μgml Golgiplug
(Monensin all from Alexis Biochemicals San Diego CA USA) PMA and
ionomycin were pharmacological T-cell-activating agents that mimicked signals
generated by T-cell receptor (TCR) complex and had the advantage of stimulating T
cells of any antigen specificity Golgiplug could block intracellular transport
mechanisms leading to the accumulation of cytokines in the cells After incubation
the cells were stained with phycoerythrin (PE)-Cy5-conjugated anti-CD4 monoclonal
antibodies (mAbs) at room temperature in the dark for 20 minutes Then these cells
were stained with fluorescein isothiocyanate (FITC)-conjugated anti-interferon (IFN)-
γ mAbs PE-conjugated anti-IL-17 mAbs and allophycocyanin (APC)-conjugated
anti-IL22 mAbs after fixation and permeabilization (eBioscience San Diego CA
USA) IgGs of the same-species same-isotype were used as isotype controls Analysis
was performed on a BD FACSCanto II equipped with BD FACSDiva software (BD
Biosciences Franklin Lakes NJ USA)
CD4+CD25+FoxP3+ Tregs were determined using the Human Regulatory T cell
Staining Kit (eBioscience San Diego CA USA) In brief 100 μl of heparinized BM
or peripheral whole blood were incubated with a cocktail of FITC-conjugated anti-
CD4 mAbs and PE-conjugated anti-CD25 mAbs fixed and permeabilized and further
stained APC-conjugated anti-FoxP3 mAbs Th2 Tfh cells and chemokine receptors
including CXCR3 CCR4 CCR6 CCR10 were also determined in 6 ITP patients and
6 HCs Briefly heparinized BM and PB blood were incubated with PMA ionomycin
and Golgiplug Then cells were stained with PerCP-conjugated anti-CD4 mAbs fixed
and permeabilized and finally stained with FITC-conjugated anti-IFN-γ mAbs and
PE-conjugated anti-IL-4 mAbs For measurement of Tfh cells peripheral blood
mononuclear cells (PBMCS) and BM blood mononuclear cells (BBMCs) were
isolated by gradient centrifugation and stained with FITC-conjugated anti-CD4
mAbs APC-conjugated anti-CXCR5 mAbs and PE-conjugated anti-ICOS mAbs
Surface expression of chemokine receptors were presented as median fluorescence
intensity (MFI) and were calculated based on the intensity of the cells incubated with
appropriate isotype-matched control IgG as a reference Cells were also analyzed on a
BD FACSCanto II equipped with BD FACSDiva software (BD Biosciences Franklin
Lakes NJ USA)
Levels of BM Th22 Th17 Th1 Th2 Tfh cells and Tregs were also determined in
smear using multiple channels immunofluorescence staining The reagents and
experimental protocols were described in detail in the Supplemental Methods
Enzyme-linked immunosorbent assay real-time PCR and chemokine
Quantibodyreg Array
BM aspirates and PB were collected into heparin-anticoagulant vacutainer tubes
Plasma was obtained from all subjects by centrifugation and stored at -80 degC for
cytokine detection
Levels of IFN-γ IL-17A and IL-22 were measured using commercial enzyme-
linked immunosorbent assay (ELISA) kits (eBioscience San Diego CA USA)
following the manufacturerrsquos protocols The lower detection limits for IFN-γ IL-17A
and IL-22 were 099 pgml 15 pgml and 27 pgml respectively
mRNA expression of IL-4 in PBMCs and BBMC was measured by real-time
reverse transcription polymerase chain reaction (RT-PCR) according to a previous
described method [20] The primers for IL-4 and GAPDH were as follows IL-4-F
AGCAGTTCCACAGGCACAAG IL-4-R TACTCTGGTTGGCTTCCTTCAC
GAPDH-F GCACCGTCAAGGCTGAGAAC GAPDH-R
TGGTGAAGACGCCAGTGGA
Chemokines in BM and PB plasma samples from 7 ITP patients and 4 HCs were
determined As shown in Supplemental Table 1 the Quantibodyreg array
(RayBiotech Norcross GA USA) capable of detecting 40 kinds of
chemokinescytokines simultaneously was used according to the manufacturerrsquos
instruction
The indirect modified monoclonal antibody-specific immobilization of platelet
antigens assay
The modified mAb-specific immobilization of platelet antigens (MAIPA) assay was
carried out according to a previous described method [21] Briefly 1 times 109 platelets
from healthy donors with blood type O were sensitized with 100 μl plasma from
patients or HCs washed and solubilized in Tris-buffered saline containing 1 Triton
X-100 and 01 mgml leupeptin Microtiter plates were coated with affinity-purified
goat-anti mouse IgG and incubated with anti-CD41a mAbs or anti-CD42b mAbs (BD
Pharmingen San Jose CA USA) for 60 minutes at room temperature After washing
the sensitized platelet lysate was added in duplicates to each well and incubated for
another 60 minutes IgG bound to captured GPIIbIIIa or GPIbIX was detected by
alkaline-phosphatase-conjugated goat anti-human IgG p-Nitrophenyl-phosphate was
used as the substrate and the plates were read on an automated microtiter plate reader
(Thermo-Multiskan Mk3 Hudson NH USA) using dual wavelength (405 and 492
nm) A positive result was defined as absorbance above mean + 3 standard deviations
(SDs) of normal controls
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
patients are presented in Table 1
This study was approved by the Medical Ethical Committees of Qilu Hospital
Shandong University Informed consent was obtained from all patients and HCs
before enrollment in the study in accordance with the Declaration of Helsinki
Flow cytometry analysis of BM and peripheral CD4+ T-cell subsets
BM aspirates of the posterior superior iliac spine were obtained by experienced
physicians To evaluate peripheral blood dilution BM aspirate smears were examined
simultaneously Peripheral venous blood was also collected for determination of
circulating CD4+ T-cell subsets Levels of intracellular cytokines were measured by
flow cytometry in cytokine-producing cells Briefly 400 μl of heparinized BM or
peripheral whole blood in equal volume of Roswell Park Memorial Institute (RPMI)-
1640 were incubated for 4 hours at 37 degC under 5 CO2 in the presence of 25 ngml
phorbol myristate acetate (PMA) 1 μgml ionomycin and 17 μgml Golgiplug
(Monensin all from Alexis Biochemicals San Diego CA USA) PMA and
ionomycin were pharmacological T-cell-activating agents that mimicked signals
generated by T-cell receptor (TCR) complex and had the advantage of stimulating T
cells of any antigen specificity Golgiplug could block intracellular transport
mechanisms leading to the accumulation of cytokines in the cells After incubation
the cells were stained with phycoerythrin (PE)-Cy5-conjugated anti-CD4 monoclonal
antibodies (mAbs) at room temperature in the dark for 20 minutes Then these cells
were stained with fluorescein isothiocyanate (FITC)-conjugated anti-interferon (IFN)-
γ mAbs PE-conjugated anti-IL-17 mAbs and allophycocyanin (APC)-conjugated
anti-IL22 mAbs after fixation and permeabilization (eBioscience San Diego CA
USA) IgGs of the same-species same-isotype were used as isotype controls Analysis
was performed on a BD FACSCanto II equipped with BD FACSDiva software (BD
Biosciences Franklin Lakes NJ USA)
CD4+CD25+FoxP3+ Tregs were determined using the Human Regulatory T cell
Staining Kit (eBioscience San Diego CA USA) In brief 100 μl of heparinized BM
or peripheral whole blood were incubated with a cocktail of FITC-conjugated anti-
CD4 mAbs and PE-conjugated anti-CD25 mAbs fixed and permeabilized and further
stained APC-conjugated anti-FoxP3 mAbs Th2 Tfh cells and chemokine receptors
including CXCR3 CCR4 CCR6 CCR10 were also determined in 6 ITP patients and
6 HCs Briefly heparinized BM and PB blood were incubated with PMA ionomycin
and Golgiplug Then cells were stained with PerCP-conjugated anti-CD4 mAbs fixed
and permeabilized and finally stained with FITC-conjugated anti-IFN-γ mAbs and
PE-conjugated anti-IL-4 mAbs For measurement of Tfh cells peripheral blood
mononuclear cells (PBMCS) and BM blood mononuclear cells (BBMCs) were
isolated by gradient centrifugation and stained with FITC-conjugated anti-CD4
mAbs APC-conjugated anti-CXCR5 mAbs and PE-conjugated anti-ICOS mAbs
Surface expression of chemokine receptors were presented as median fluorescence
intensity (MFI) and were calculated based on the intensity of the cells incubated with
appropriate isotype-matched control IgG as a reference Cells were also analyzed on a
BD FACSCanto II equipped with BD FACSDiva software (BD Biosciences Franklin
Lakes NJ USA)
Levels of BM Th22 Th17 Th1 Th2 Tfh cells and Tregs were also determined in
smear using multiple channels immunofluorescence staining The reagents and
experimental protocols were described in detail in the Supplemental Methods
Enzyme-linked immunosorbent assay real-time PCR and chemokine
Quantibodyreg Array
BM aspirates and PB were collected into heparin-anticoagulant vacutainer tubes
Plasma was obtained from all subjects by centrifugation and stored at -80 degC for
cytokine detection
Levels of IFN-γ IL-17A and IL-22 were measured using commercial enzyme-
linked immunosorbent assay (ELISA) kits (eBioscience San Diego CA USA)
following the manufacturerrsquos protocols The lower detection limits for IFN-γ IL-17A
and IL-22 were 099 pgml 15 pgml and 27 pgml respectively
mRNA expression of IL-4 in PBMCs and BBMC was measured by real-time
reverse transcription polymerase chain reaction (RT-PCR) according to a previous
described method [20] The primers for IL-4 and GAPDH were as follows IL-4-F
AGCAGTTCCACAGGCACAAG IL-4-R TACTCTGGTTGGCTTCCTTCAC
GAPDH-F GCACCGTCAAGGCTGAGAAC GAPDH-R
TGGTGAAGACGCCAGTGGA
Chemokines in BM and PB plasma samples from 7 ITP patients and 4 HCs were
determined As shown in Supplemental Table 1 the Quantibodyreg array
(RayBiotech Norcross GA USA) capable of detecting 40 kinds of
chemokinescytokines simultaneously was used according to the manufacturerrsquos
instruction
The indirect modified monoclonal antibody-specific immobilization of platelet
antigens assay
The modified mAb-specific immobilization of platelet antigens (MAIPA) assay was
carried out according to a previous described method [21] Briefly 1 times 109 platelets
from healthy donors with blood type O were sensitized with 100 μl plasma from
patients or HCs washed and solubilized in Tris-buffered saline containing 1 Triton
X-100 and 01 mgml leupeptin Microtiter plates were coated with affinity-purified
goat-anti mouse IgG and incubated with anti-CD41a mAbs or anti-CD42b mAbs (BD
Pharmingen San Jose CA USA) for 60 minutes at room temperature After washing
the sensitized platelet lysate was added in duplicates to each well and incubated for
another 60 minutes IgG bound to captured GPIIbIIIa or GPIbIX was detected by
alkaline-phosphatase-conjugated goat anti-human IgG p-Nitrophenyl-phosphate was
used as the substrate and the plates were read on an automated microtiter plate reader
(Thermo-Multiskan Mk3 Hudson NH USA) using dual wavelength (405 and 492
nm) A positive result was defined as absorbance above mean + 3 standard deviations
(SDs) of normal controls
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
or peripheral whole blood were incubated with a cocktail of FITC-conjugated anti-
CD4 mAbs and PE-conjugated anti-CD25 mAbs fixed and permeabilized and further
stained APC-conjugated anti-FoxP3 mAbs Th2 Tfh cells and chemokine receptors
including CXCR3 CCR4 CCR6 CCR10 were also determined in 6 ITP patients and
6 HCs Briefly heparinized BM and PB blood were incubated with PMA ionomycin
and Golgiplug Then cells were stained with PerCP-conjugated anti-CD4 mAbs fixed
and permeabilized and finally stained with FITC-conjugated anti-IFN-γ mAbs and
PE-conjugated anti-IL-4 mAbs For measurement of Tfh cells peripheral blood
mononuclear cells (PBMCS) and BM blood mononuclear cells (BBMCs) were
isolated by gradient centrifugation and stained with FITC-conjugated anti-CD4
mAbs APC-conjugated anti-CXCR5 mAbs and PE-conjugated anti-ICOS mAbs
Surface expression of chemokine receptors were presented as median fluorescence
intensity (MFI) and were calculated based on the intensity of the cells incubated with
appropriate isotype-matched control IgG as a reference Cells were also analyzed on a
BD FACSCanto II equipped with BD FACSDiva software (BD Biosciences Franklin
Lakes NJ USA)
Levels of BM Th22 Th17 Th1 Th2 Tfh cells and Tregs were also determined in
smear using multiple channels immunofluorescence staining The reagents and
experimental protocols were described in detail in the Supplemental Methods
Enzyme-linked immunosorbent assay real-time PCR and chemokine
Quantibodyreg Array
BM aspirates and PB were collected into heparin-anticoagulant vacutainer tubes
Plasma was obtained from all subjects by centrifugation and stored at -80 degC for
cytokine detection
Levels of IFN-γ IL-17A and IL-22 were measured using commercial enzyme-
linked immunosorbent assay (ELISA) kits (eBioscience San Diego CA USA)
following the manufacturerrsquos protocols The lower detection limits for IFN-γ IL-17A
and IL-22 were 099 pgml 15 pgml and 27 pgml respectively
mRNA expression of IL-4 in PBMCs and BBMC was measured by real-time
reverse transcription polymerase chain reaction (RT-PCR) according to a previous
described method [20] The primers for IL-4 and GAPDH were as follows IL-4-F
AGCAGTTCCACAGGCACAAG IL-4-R TACTCTGGTTGGCTTCCTTCAC
GAPDH-F GCACCGTCAAGGCTGAGAAC GAPDH-R
TGGTGAAGACGCCAGTGGA
Chemokines in BM and PB plasma samples from 7 ITP patients and 4 HCs were
determined As shown in Supplemental Table 1 the Quantibodyreg array
(RayBiotech Norcross GA USA) capable of detecting 40 kinds of
chemokinescytokines simultaneously was used according to the manufacturerrsquos
instruction
The indirect modified monoclonal antibody-specific immobilization of platelet
antigens assay
The modified mAb-specific immobilization of platelet antigens (MAIPA) assay was
carried out according to a previous described method [21] Briefly 1 times 109 platelets
from healthy donors with blood type O were sensitized with 100 μl plasma from
patients or HCs washed and solubilized in Tris-buffered saline containing 1 Triton
X-100 and 01 mgml leupeptin Microtiter plates were coated with affinity-purified
goat-anti mouse IgG and incubated with anti-CD41a mAbs or anti-CD42b mAbs (BD
Pharmingen San Jose CA USA) for 60 minutes at room temperature After washing
the sensitized platelet lysate was added in duplicates to each well and incubated for
another 60 minutes IgG bound to captured GPIIbIIIa or GPIbIX was detected by
alkaline-phosphatase-conjugated goat anti-human IgG p-Nitrophenyl-phosphate was
used as the substrate and the plates were read on an automated microtiter plate reader
(Thermo-Multiskan Mk3 Hudson NH USA) using dual wavelength (405 and 492
nm) A positive result was defined as absorbance above mean + 3 standard deviations
(SDs) of normal controls
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
mRNA expression of IL-4 in PBMCs and BBMC was measured by real-time
reverse transcription polymerase chain reaction (RT-PCR) according to a previous
described method [20] The primers for IL-4 and GAPDH were as follows IL-4-F
AGCAGTTCCACAGGCACAAG IL-4-R TACTCTGGTTGGCTTCCTTCAC
GAPDH-F GCACCGTCAAGGCTGAGAAC GAPDH-R
TGGTGAAGACGCCAGTGGA
Chemokines in BM and PB plasma samples from 7 ITP patients and 4 HCs were
determined As shown in Supplemental Table 1 the Quantibodyreg array
(RayBiotech Norcross GA USA) capable of detecting 40 kinds of
chemokinescytokines simultaneously was used according to the manufacturerrsquos
instruction
The indirect modified monoclonal antibody-specific immobilization of platelet
antigens assay
The modified mAb-specific immobilization of platelet antigens (MAIPA) assay was
carried out according to a previous described method [21] Briefly 1 times 109 platelets
from healthy donors with blood type O were sensitized with 100 μl plasma from
patients or HCs washed and solubilized in Tris-buffered saline containing 1 Triton
X-100 and 01 mgml leupeptin Microtiter plates were coated with affinity-purified
goat-anti mouse IgG and incubated with anti-CD41a mAbs or anti-CD42b mAbs (BD
Pharmingen San Jose CA USA) for 60 minutes at room temperature After washing
the sensitized platelet lysate was added in duplicates to each well and incubated for
another 60 minutes IgG bound to captured GPIIbIIIa or GPIbIX was detected by
alkaline-phosphatase-conjugated goat anti-human IgG p-Nitrophenyl-phosphate was
used as the substrate and the plates were read on an automated microtiter plate reader
(Thermo-Multiskan Mk3 Hudson NH USA) using dual wavelength (405 and 492
nm) A positive result was defined as absorbance above mean + 3 standard deviations
(SDs) of normal controls
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Statistical analysis
Statistical analysis was performed using SPSS 190 software All continuous values
were expressed as means plusmn standard deviation (SD) Descriptive statistics were used
to summarize demographic and baseline clinical characteristics of the enrolled
patients Statistical difference between ITP patients and HCs was determined by
independent sample t test unless the data were not normally distributed in which case
the Mann-Whitney U test was used Comparisons of absolute values between BM and
PB in ITP patients or HCs were made using the paired Student t test Pearson
correlation test was used for correlation analysis depending on data distribution P
values lt 005 were considered statistically significant
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Results
Elevated levels of Th22 cells and IL-22 in the BM and PB of ITP patients
BM aspirate smears were performed for all enrolled patients and HCs and peripheral
blood dilution in the BM was not observed in any of the included subjects
Frequencies of different CD4+ T-cell subsets were analyzed based on cytokine patterns
after in vitro activation by PMAionomycin The cells were gated by forward and side
scatter for lymphocytes (Figure 1A) and then CD4+IFN-γ- T cells (Figure 1B) were
identified for analysis of Th17 and Th22 cells Th22 subset was defined as
CD4+IL22+IFNγ-IL17- T cells thereby excluding Th1 and Th17 cells The typical dot
plots of BM and PB Th22 cells in ITP patients and HCs were shown in Figure 1C D
E and F The percentage of BM Th22 cells from ITP patients was significantly higher
than from HCs (218 plusmn 080 vs 084 plusmn 017 P lt 0001 Figure 1G)
Immunofluorescence microscopy also revealed that the percentage of BM Th22 cells
was higher from ITP patients than from HCs but this difference did not achieve
statistical significance (P = 0082 Supplemental Figure 1 A B and Supplemental
Figure 2A) The discrepancy might be due to the greater sensitivity of flow cytometry
when compared to immunofluorescence microscopy In line with the BM Th22
pattern frequency of PB Th22 cells from ITP patients was also remarkably higher
compared to HCs (139 plusmn 061 vs 083 plusmn 016 P = 0001 Figure 1H) In the ITP
group it was notable that the percentage of BM Th22 cells was significantly elevated
than the paired PB Th22 cells (218 plusmn 080 vs 139 plusmn 061 P lt 0001 Figure 1I)
With regard to the HCs BM Th22 cells showed no statistical difference compared to
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
their PB counterparts (084 plusmn 017 vs 083 plusmn 016 P = 0870)
Plasma IL-22 concentrations of BM and PB were measured by ELISA Level of
BM IL-22 from ITP patients was significantly higher than from HCs (3326 plusmn 1677
vs 2180 plusmn 206 pgml P = 0005 Figure 1J) Consistent with our previous reports
[22] plasma level of IL-22 in PB from ITP patients was also considerably increased
in comparison with that from HCs (2804 plusmn 1296 vs 2067 plusmn 349 pgml P = 0020
Figure 1K) Moreover in the ITP group level of BM IL-22 was significantly
elevated compared with that of the paired PB IL-22 (3326 plusmn 1677 vs 2804 plusmn 1296
pgml P = 0007 Figure 1L) By contrast no statistical difference was found in
plasma IL-22 level between BM and PB in HCs (2180 plusmn 206 vs 2067 plusmn 349 pgml
P = 0360) In ITP patients positive correlations were found between the frequency of
Th22 cells and IL-22 level both in BM and in PB (BM r = 0796 P lt 0001 PB r =
0737 P lt 0001 respectively Figure 1M and N)
Skewed balance of Th17Treg in the BM and PB of ITP patients
Th17 cells and Tregs were analyzed using the well-established gating strategy The
population of CD4+IFN-γ-IL17+ T cells was identified as Th17 subset (Figure 1C D
E and F) and Tregs were defined as CD4+CD25+FoxP3+ T cells (Figure 2A B C and
D) Results showed that the percentage of BM Th17 cells from ITP patients was
significantly higher than from HCs (338 plusmn 118 vs 139 plusmn 017 P lt 0001
Figure 2E) and the level of PB Th17 cells from ITP patients was also remarkably
increased compared to HCs (213 plusmn 090 vs 132 plusmn 022 P = 0001 Figure 2F)
Moreover BM Th17 cells determined by immunofluorescence microscopy were also
higher from ITP patients compared with HCs but statistical significance was not
reached (P = 0190 Supplemental Figure 1 C D and Supplemental Figure 2B) By
contrast the frequencies of BM Tregs determined by flow cytometry or
immunofluorescence microscopy were considerably lower from ITP patients than
from HCs (flow cytometry 173 plusmn 066 vs 612 plusmn 030 P lt 0001 Figure 2G
immunofluorescence microscopy P = 0015 Supplemental Figure 1I G and
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Supplemental Figure 2C) and the percentage of PB Tregs from ITP patients was
also reduced in comparison with that from HCs (405 plusmn 105 vs 621 plusmn 018 P lt
0001 Figure 2H) As a result the ratio of Th17 cells to Tregs in BM and PB from
ITP patients was significantly higher than from HCs (BM 227 plusmn 118 vs 019 plusmn 003
P lt 0001 PB 067 plusmn 064 vs 018 plusmn 003 P = 0006 respectively Figure 2I and J)
Interestingly significantly increased level of Th17 and decreased level of Tregs in BM
were observed compared with those in PB from ITP patients (Th17 338 plusmn 118 vs
213 plusmn 090 P lt 0001 Tregs 173 plusmn 066 vs 405 plusmn 105 P lt 0001
respectively Figure 2K and Figure 2L) Therefore the ratio of Th17 cells to Tregs
was higher in BM than in PB from ITP patients (227 plusmn 118 vs 067 plusmn 064 P lt
0001 Figure 2M) With respect to HCs there was no statistical difference in
frequency of Th17 cells between BM and PB (139 plusmn 017 vs 132 plusmn 022 P =
0304) nor for Tregs frequency between BM and PB (612 plusmn 030 vs 621 plusmn 018
P = 0354)
The level of BM IL-17A from ITP patients was higher than from HCs (1641 plusmn
243 vs1305 plusmn 327 pgml P = 0001 Figure 2N) Moreover the PB IL-17A level
from ITP patients also showed a slight increase in comparison with that from HCs but
this increase did not achieve statistical significance (1596 plusmn 293 vs1477 plusmn 285
pgml P = 0232 Figure 2O) We did not observe any statistical difference in IL-17A
levels between BM and PB from ITP patients or HCs (ITP 1641 plusmn 243 vs1596 plusmn
293 pgml P = 0658 Figure 2P HCs 1305 plusmn 327 vs1477 plusmn 285 pgmL P =
0126)
There was no statistical correlation between the frequency of Th17 cells and IL-
17A level in BM from ITP patients (P = 0630) Additionally frequencies of Th17
cells in PB also failed to show any statistical correlation with plasma level of IL-17A
in PB from ITP patients (P = 0281) There was no significant correlation between
levels of IL-17 and IL-22 or IFN-γ in BM nor between levels of IL-17 and IL-22 or
IFN-γ in PB from ITP patients (all P gt 005)
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Increased expression of Th1 cells in the BM and PB of ITP patients
The population of CD4+IFN-γ-+ T cells was identified as Th1 cells (Figure 3A B C
and D) As demonstrated in Figure 3E the portion of BM Th1 cells from ITP patients
was remarkably increased compared to HCs (2462 plusmn 637 vs 770 plusmn 112 P lt
0001) and the percentage of PB Th1 cells in ITP group was also significantly higher
than in HCs (1581 plusmn 347 vs 711 plusmn 133 P lt 0001 Figure 3F) Consistently
BM Th1 cells determined by immunofluorescence microscopy were marked elevated
from ITP patients compared with HCs (P = 0048 Supplemental Figure 1 E F G H
and Supplemental Figure 2D) We also observed that the percentage of Th1 cells in
BM was significantly increased in comparison with PB from ITP patients (2462 plusmn
637 vs 1581 plusmn 347 P lt 0001 Figure 3G) yet no statistical difference was
found in the portion of Th1 cells between BM and PB from HCs (770 plusmn 1128 vs
711 plusmn 133 P = 0083)
Plasms IFN-γ levels in BM and PB from enrolled subjects were also evaluated
The data showed that BM IFN-γ concentration from ITP patients was significantly
higher than from HC (540 plusmn 250 vs 321 plusmn 057 pgml P =0001 Figure 3H) and
PB IFN-γ concentration from ITP patients and HCs showed a similar pattern (398 plusmn
165 vs 300 plusmn 031 pgml P = 0014 Figure 3I) Compared to the IFN-γ level in PB
from ITP patients the paired BM IFN-γ level was remarkably increased (398 plusmn 165
vs 540 plusmn 250 pgml P lt 0001 Figure 3J) With regard to HCs there was no
statistical difference in IFN-γ level between BM and PB (321 plusmn 057 vs 300 plusmn 031
pgml P = 0209) In ITP patients percentage of Th1 cells correlated positively with
plasma level of IFN-γ in both BM and PB (BM r = 0744 P lt 0001 PB r = 0488
P = 0025 respectively Figure 3K and L)
Expression of Th2 and Tfh cells in the BM and PB of ITP patients
Th2 subset was identified as CD4+IL-4+IFN-γ- T cells (Figure 4A B C and D) As
shown in Figure 4E there was no statistical difference in BM Th2 frequency between
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
ITP patients and HCs when measured by flow cytometry (147 plusmn 051 vs 149 plusmn
041 P = 0949) or immunofluorescence microscopy (P = 0692 Supplemental
Figure 1 C D and Supplemental Figure 2E) On the contrary PB Th2 frequency
from ITP patients was significantly lower than from HCs (081 plusmn 030 vs 140 plusmn
033 P = 0007 Figure 4F) In the ITP group BM Th2 percentage was remarkably
higher than the pair PB counterpart (147 plusmn 051 vs 081 plusmn 030 P = 0012 Figure
4G) By contrast there was no statistical difference in Th2 frequency between BM
and PB in HCs (149 plusmn 041 vs 140 plusmn 033 P = 0721)
The frequencies of CD4+CXCR5+ Tfh cells and CD4+CXCR5+ICOS+ Tfh cells
were measured (Figure 5A B C and D) We found that BM CD4+CXCR5+ and
CD4+CXCR5+ICOS+ Tfh levels from ITP patients were considerably increased than
from HCs (CD4+CXCR5+ 2143 plusmn 394 vs 1071 plusmn 221 P lt 0001
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 126 plusmn 024 P lt 0001 Figure 5E and F)
Consistently PB CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh levels from ITP
patients were also higher than from HCs (CD4+CXCR5+ 1701 plusmn 447 vs 1001 plusmn
060 P = 0001 CD4+CXCR5+ICOS+ 321 plusmn 175 vs 118 plusmn 019 P = 0036
Figure 5G and H) Moreover BM CD4+CXCR5+ Tfh and CD4+CXCR5+ICOS+ Tfh
percentages were significantly higher than their PB counterparts in ITP group
(CD4+CXCR5+ 2143 plusmn 394 vs 1701 plusmn 447 P = 0016
CD4+CXCR5+ICOS+ 542 plusmn 256 vs 321 plusmn 175 P = 0018 Figure 5I and J)
No statistical significance was found in CD4+CXCR5+ Tfh or CD4+CXCR5+ICOS+
Tfh percentages between BM and PB in HCs (CD4+CXCR5+ 1071 plusmn 221 vs
1001 plusmn 060 P = 0499 CD4+CXCR5+ICOS+ 126 plusmn 024 vs 118 plusmn 019 P
= 0465)
mRNA expression of IL-4 the key cytokine of Th2 cells was also determined
using real-time RT-PCR It was observed that PB IL-4 mRNA level from ITP patients
was significantly lower than from HCs (0000206 plusmn 0000038 vs 000033 plusmn 0000071
P = 0017) while no statistical difference was observed in BM IL-4 mRNA level
between ITP patient and HCs (0000345 plusmn 0000107 vs 0000369 plusmn 0000099 P =
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
0630) In the ITP group BM IL-4 mRNA level was considerably increased compared
to its PB counterpart (0000345 plusmn 0000107 vs 0000206 plusmn 0000038 P = 0012) We
did not find any statistical difference in IL-4 mRNA level between BM and PB in the
HC group (0000369 plusmn 0000099 vs 000033 plusmn 0000071 P = 0354)
Association of different CD4+ T-cell subsets in BM and PB with disease duration
previous treatments and bleeding severity in ITP patients
Subgroup analyses were performed to explore whether the aberrant CD4+ T-cell
distribution was related to disease duration previous treatments or bleeding severity
As shown in Table 2 3 and 4 there was no statistical difference in BM or PB levels
of Th22 Th17 Th1 cells Tregs and Th17Treg ratios as well as their signature
cytokines between newly diagnosedpersistent and chronic ITP patients nor between
treatment-naive and recurrent ITP patients With respect to bleeding severity
frequency of PB Th22 cells was significantly higher from bleeding grade 2 or 3
patients than from bleeding grade 1 patients (178 plusmn 050 vs 131 plusmn 053 P =
0017) Level of BM Th22 cells from bleeding grade 2 or 3 patients was also elevated
compared with that from bleeding grade 1 patients but this elevation did not achieve
statistical significance (254 plusmn 065 vs 203 plusmn 072 P = 0053) In addition we
also observed that frequency of BM Th1 cells from bleeding grade 2 or 3 patients was
remarkably increased than from bleeding grade 1 patients (3028 plusmn 672 vs 2419plusmn
600 P = 0006) whereas there was no statistical difference in level of PB Th1
cells between grade 2 or 3 patients and grade 1 patients (1913 plusmn 794 vs 1737 plusmn
502 P = 0404) We did not observe any statistical difference in BM and PB Th17
cells Tregs and Th17Treg ratios between bleeding grade 2 or 3 patients and bleeding
grade 1 patients (all P gt 005 Table 5)
Chemokine receptor expression on different CD4+ T-cell subsets and chemokine
profile in BM and PB of ITP patients and HCs
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Several chemokine receptors which were critical for migration and differentiation of
different CD4+ T-cell subsets were determined by flow cytometry MFI of CXCR3 on
CD4+IFN-γ+ T cells (Figure 6A and B) CCR4 on CD4+IL-4+ T cells (Figure 6C and
D) CCR4 and CCR6 on CD4+IL-17+ T cells (Figure 6E F and G) and CCR4 and
CCR10 on CD4+IL-22+ T cells (Figure 6H I and J) were assessed As shown in
Table 6 CXCR3 levels on BM and PB CD4+IFN-γ+ T cells from ITP patients were
significantly higher than from HCs (BM 15273 plusmn 2161 vs 10635 plusmn 2175 P =
0001 PB 17055 plusmn 2351 vs 12937 plusmn 1416 P = 0002) In the ITP group
CD4+IFN-γ+ T cells in BM expressed lower level of CXCR3 than in PB (15273 plusmn
2161 vs 17055 plusmn 2351 P = 0033) Moreover CXCR3 level on BM CD4+IFN-γ+ T
cells was also decreased comparted with its PB counterpart in HCs (10635 plusmn 2175
vs 12937 plusmn 1416 P = 0009)
CCR4 levels on BM and PB CD4+IL-22+ T cells from ITP patients were remarkably
elevated compared with HCs (BM 25843 plusmn 8245 vs 16248 plusmn 2174 P = 0005 PB
24028 plusmn 6073 vs 14962 plusmn 1554 P = 0008) By contrast CCR4 on CD4+IL-4+ and
CD4+IL-17+ T cells CCR6 on CD4+IL-17+ T cells CCR10 on CD4+IL-22+ T cells
and CXCR4 on CD4+FoxP3+ T cells in BM or PB showed no statistical difference
between ITP patients and HCs (all P gt 005)
Results of the Quantibodyreg array showed that BM levels of CCL27 osteopontin
(OPN) and CCL18 from ITP patients were significantly higher than from HCs
(CCL27 321839 vs 119038 P = 0041 OPN 817597 vs 229369 P = 0016
CCL18 80764 vs 62895 P = 0039 Figure 7) By contrast the 40 kinds of
chemokinescytokines in PB showed no statistical difference between ITP patients and
HCs In the ITP group BM levels of macrophage migration inhibitory factor (MIF)
was considerably higher while CCL23 was remarkably lower than their PB
counterparts (MIF 1181448 vs 241242 P = 0025 CCL23 59024 vs 74520 P =
0018 Figure 8)
Correlations of every different CD4+ T-cell subset between BM and PB in ITP
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
patients
Pearson correlation test was performed to evaluate the correlations between BM and
PB for the frequencies of each CD4+ T subpopulation in ITP patients The data
demonstrated that frequency of Th22 cells in BM was positively correlated with that
in PB (r = 0814 P lt 0001 Figure 9A) Likewise frequencies of Th17 cells and
Tregs in BM were positively correlated with those in PB (Th17 r =0635 P = 0002
Treg r = 0624 P = 0002 Figure 9B and C) With respect to Th1 subset its BM
frequency also showed positive correlation with the PB counterpart in ITP patients (r
= 0549 P = 0010 Figure 9D)
Correlations of different CD4+ T-cell subsets in BM and PB with autoantibodies
in ITP patients
To evaluate whether the altered CD4+ T-cell profile was associated with platelet GP-
specific autoantibody production plasma GPIIbIIIa and GPIbIX autoantibodies were
determined Results showed that there was no significant difference in the frequencies
of BM Th22 Th17 Th1 cells and Tregs between ITP patients with positive
autoantibodies and those with negative results (all P gt 005) nor for the frequencies
of PB Th22 Th17 Th1 cells and Tregs between antibody-positive patients and
antibody-negative patients (all P gt 005 Supplemental Table 2)
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Discussion
T cells still take the center-stage in the immunopathogenesis of ITP by initiating
propagating and maintaining the antiplatelet autoimmunity [12] Peripheral tolerance
defects of CD4+ T cells in ITP have been attributed to enhanced antiplatelet T-cell
reactivity [7] resistance of autoreactive T cells to activation induced cell death
(AICD) [23] increased numbers of Th1 Th17 Th22 cells and reduced number or
function of Tregs [1011] Thrombopoiesis which occurs from megakaryocytes in the
BM has been shown to be impaired in ITP [15] So far relatively little is known
about the profile of CD4+ T cells in BM of ITP patients We investigated the levels of
different CD4+ T-cell subpopulations and found that significantly elevated numbers of
Th1 Th17 and Th22 cells coincided with considerably decreased number of Tregs in
BM of active ITP patients suggesting dysregulated immune responses might take
place in the BM microenvironment
Th22 subset is a more recently identified CD4+ Th subpopulation characterized
by secretion of IL-22 but not IL-17 or IFN-γ [2425] It is a terminally differentiated
T-cell subtype and can be induced from naiumlve T cells in the presence of tumor necrosis
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
factor (TNF)-α and IL-6[24] A growing body of emerging evidence have indicated that
Th22 cells were involved in the pathogenesis of a variety of autoimmune diseases in
humans such as SLE [26] rheumatoid arthritis (RA) [27] psoriasis [28] and Crohnrsquos
disease [29] In PB of ITP patients our group along with several others reported
consistently that frequency of Th22 cells was significantly increased [930]
Consistently our present study further confirmed the elevated level of PB Th22 cells
in ITP patients Of note we demonstrated for the first time that level of BM Th22
cells and IL-22 was even higher than their PB counterparts in ITP patients Up to now
the mechanism through which these upregulated Th22 cells take part in the
pathophysiological process of ITP still remains to be elucidated As the receptor of IL-
22 is only expressed on epithelial and stromal cells instead of immune cells [31] IL-
22 produced by Th22 cells might exacerbate the immune dysregulation of ITP through
unknown indirect mechanisms Recently Muntildeoz et al demonstrated that IL-22
promoted the secretion of IL-18 from epithelial cells during intestinal infection [32]
With regard to ITP our published data have established the pathogenetic role of IL-18
in Th1 polarization [33] Therefore IL-22-mediated enhancement of Th1 response
through IL-18 upregulation might be possible Aside from IL-22 Th22 cells also
produce TNF-α to some extent which might play a role in macrophage activation and
platelet destruction in ITP [34]
Th17 cells have strong proinflammatory abilities and play important roles in a
variety of inflammatory and autoimmune diseases [35] On the contrary
CD4+CD25+FoxP3+ Tregs shed suppression on the activation and proliferation of T
effector cells by cell-to cell contact and secretion of anti-inflammatory cytokines such
as IL-10 and transform growth factor (TGF)-β [36] Both Th17 cells and Tregs can
develop from naiumlve CD4+ T cells under the influence of the same cytokine TGF-β1
[37] whereas accumulating evidence indicates that Th17 cells and Tregs functionally
antagonize each other [38-40] In patients with ITP our previous study have shown
that PB Th17 cells were significantly increased while PB Tregs were numerically
decreased and functionally impaired [10] Genotype analysis also indicated that IL-
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
17F 7488 A allele was associated with increased risk of ITP [41] More recently
Song et al reported that Th17 cells were elevated in parallel with a decrease in Tregs
in BM of ITP patients [42] In consistence with these previous reports our present
data showed BM of ITP patients had significantly increased percentage of Th17 cells
and remarkably decreased percentage of Tregs Moreover levels of the BM Th17 cells
were higher but Tregs were lower than their paired PB counterparts suggesting a
more severe immune dysregulation occurs in BM of ITP patients
Th1 cells another subtype of CD4+ T cells have been widely known to be
abnormally overactivated in ITP patients [43] Our study observed significantly higher
levels of Th1 cells and IFN-γ in BM and PB from patients with ITP confirming that
ITP has a Th1 dominant profile
It seemed that patients with relative severe bleeding episodes (grade 2 or 3) had
higher levels of BM Th1 cells and PB Th22 cells compared to these patients with mild
bleeding episodes (grade 1) It might be possible that patients with severe bleeding
episodes had a more inflammatory environment Th22 cells act mostly in skin and
mucosal tissues as they express the chemokine receptor CCR6 and the skin homing
receptor CCR4 and CCR10 [24] In addition IL-22R1 the receptor subunit of IL-22
was expressed abundantly by barrier surface such as skin mucosal and vascular
endothelial cells [25] further indicating involvement of Th22 cells in barrier
homeostasis regulation Bleeding symptoms indicated existence of peripheral vascular
endothelial damages and inflammation which might facilitate the chemotaxis of Th22
cells and subsequent wound healing [44] This also might partly explain why
frequency of PB Th22 cells was higher from bleeding grade 2 or 3 patients than from
bleeding grade 1 patients
The precise mechanism how Th1 Th17 and Th22 cells accumulated in BM of
ITP patients was still unclarified Migration of these Th cells from PB into BM might
be one possible way CCL27 is a well-known chemoattractant for attracting memory T
cells to the sites of skin lesions [4546] More recently it has been confirmed that
CCR10 the receptor for CCL27 is abundantly expressed in Th22 cells [46]
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Consequently the elevation in BM CCL27 could attract more Th22 cells to migrate to
BM in ITP patients OPN is a multifunctional extracellular matrix protein produced by
a variety of cells and tissues It is a major amplifier of the Th1-immune response and
has been recognized as a proinflammatory cytokine associated with local
inflammation [47] Therefore increased level of BM OPN could promote the Th1
response which might be a possible explanation for BM Th1 upregulation in ITP
MIF is a pleiotropic inflammatory mediator which could be secreted by
monocytesmacrophages T- and B-cells as well as endothelia and epithelial cells [48]
By counter-regulating glucocorticoid suppression of immune responses and inhibiting
activation-induce apoptosis MIF functions as an essential mediator in T-cell
activation [49] Moreover MIF also exerts a chemokine-like function by promoting
migration and recruitment of monocytes and T cells [48] Our observation about MIF
elevation might be a reflection of elevated inflammation in BM of ITP patients and
its effect on CD4+ T-cell modulation in ITP still needs further investigation
The relationship between platelet GP-specific autoantibodies and imbalance of
CD4+ T-cell subsets in ITP remains unclarified Hu et al reported circulating Th22
cells were higher in ITP patients who had no detectable anti-GP autoantibodies than
those with positive anti-GPIIbIIIa or anti-GPIbIX autoantibodies [9] By contrast
our previous studies did not show any correlation between anti-GP autoantibodies and
circulating Th17 or Th1 cells in ITP patients [50] Consistently we did not observe
any statistical difference in levels of different BM or PB CD4+ T-cell subsets between
ITP patients with positive anti-GP autoantibodies and those with negative anti-GP
autoantibodies As autoantibody production involves a complex interaction between
antigen presenting cells T cells B cells and platelet autoantigens the precise role of
BM CD4+ T-cell subset dysregulation in the disturbance of humoral immune response
in ITP still awaits further investigation
Taking together the present study demonstrated that ITP had numerically
increased numbers of Th22 Th17 Th1 and Tfh cells in parallel with significantly
reduced percentage of Tregs in BM suggesting that the imbalance of CD4+ T-cell
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
subsets might be involved in the pathophysiological process of the disease Although
further functional studies are need to clarify the direct influence of these abnormal
CD4+ T cells on platelet production and destruction strategies to restore the balance
of BM CD4+ T-cell subsets might provide therapeutic benefits for ITP patients
Acknowledgements
This work was supported by grants from National Natural Science Foundation of
China (No 81570103 No 81500094) the 973 Program (No 2015CB755402) and
Wu Jie Ping Medical Foundation (No 320675017181)
Authors Contributions
Qian Wang and Xin-guang Liu designed research performed research analyzed data
and wrote the manuscript Juan Li Tian-shu Yu Yu Liu Shuang Liu Yang Liu Qi
Feng Lei Zhang and Guo-sheng Li performed experiments and analyzed data Lin-lin
Shao and Jun Peng performed experiments Ming Hou performed experiments
analyzed data and wrote the manuscript
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Competing interests
The authors declare no conflict of interest The funder had no role in the design of the
study in the collection analyses or interpretation of data in the writing of the
manuscript or in the decision to publish the results
Abbreviations
ITP primary immune thrombocytopenia
PB peripheral blood
BM bone marrow
Th T helper
Tfh follicular T helper
Tregs regulatory T cells
IL interleukin
ELISA enzyme-linked immunosorbent assay
CTL cytotoxic T lymphocyte
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
MK megakaryocyte
MDS myelodysplasia syndrome
AA aplastic anemia
ITP-BAT ITP-specific Bleeding Assessment Tool
HC healthy control
RPMI Roswell Park Memorial Institute
PMA phorbol myristate acetate
PE phycoerythrin
mAbs monoclonal antibodies
FITC fluorescein isothiocyanate
APC allophycocyanin
MFI median fluorescence intensity
MAIPA mAb-specific immobilization of platelet antigens
GP glycoprotein
AICD activation induced cell death
TNF tumor necrosis factor
SLE systemic lupus erythematosus
RA rheumatoid arthritis
TGF transform growth factor
OPN osteopontin
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Reference
1 Matzdorff A Woumlrmann B Diagnosis and Therapy of Immune thrombocytopenia
Dtsch Med Wochenschr 2018 143(15)1076-81
2 Khan AM Mydra H Nevarez A et al Clinical Practice Updates in the
Management Of Immune Thrombocytopenia P T 2017 42(12)756-63
3 Lee JY Lee JH Lee H et al Epidemiology and management of primary immune
thrombocytopenia A nationwide population-based study in Korea Thromb
Res 2017 15586-91
4 Moulis G Lapeyre-Mestre M Adoue D et al Epidemiology and
pharmacoepidemiology of immune thrombocytopenia Rev Med Interne 2017
38(7)444-9
5 Provan D Stasi R Newland AC et al International consensus report on the
investigation and management of primary immune thrombocytopenia Blood
2010 115(2)168-86
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
6 Najaoui A Bakchoul T Stoy J et al Autoantibody-mediated complement
activation on platelets is a common finding in patients with immune
thrombocytopenic purpura (ITP) Eur J Haematol 2012 88(2)167-74
7 Goette NP Glembotsky AC Lev PR et al Platelet Apoptosis in Adult Immune
Thrombocytopenia Insights into the Mechanism of Damage Triggered by Auto-
Antibodies PLoS One 2016 11(8)e0160563
8 Zhao X Qi X Wang C et al Idiopathic thrombocytopenic purpura pathogenesis
and potential therapeutic approach Minerva Med 2017 108(6)502-6
9 Hu Y Li H Zhang L et al Elevated profiles of Th22 cells and correlations with
Th17 cells in patients with immune thrombocytopenia Hum Immunol 2012
73(6)629-35
10 Zahran AM Elsayh KI CD4+CD25+ High FoxP3+ regulatory T cells B
lymphocytes and T lymphocytes in patients with acute ITP in Assiut Children
Hospital Clin Appl Thromb Hemost 2014 20(1) 61-711 Zhu F Qiao J Cao J et al Decreased level of cytotoxic T lymphocyte antigen-4
(CTLA-4) in patients with acute immune thrombocytopenia (ITP) Thromb Res
2015 136(4)797-802
12 Semple JW Provan D The immunopathogenesis of immune thrombocytopenia
T cells still take center-stage Curr Opin Hematol 2012 19(5)357-62
13 Boulais PE Frenette PS Making sense of hematopoietic stem cell niches Blood
2015 125(17)2621-9
14 Bhasin TS Sharma S Manjari M et al Changes in megakaryocytes in cases
of thrombocytopenia bone marrow aspiration and biopsy analysis J Clin Diagn
Res 2013 7(3) 473-9
15 Iraqi M Perdomo J Yan F et al Immune thrombocytopenia antiplatelet
autoantibodies inhibit proplatelet formation by megakaryocytes and impair
platelet production in vitro Haematologica 2015 100(5)623-32
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
16 Olsson B Ridell B Carlsson L et al Recruitment of T cells into bone marrow of
ITP patients possibly due to elevated expression of VLA-4 and CX3CR1 Blood
2008 112(4)1078-84
17 Yang L Wang L Zhao CH et al Contributions of TRAIL-mediated
megakaryocyte apoptosis to impaired megakaryocyte and platelet production in
immune thrombocytopenia Blood 2010 116(20)4307-16
18 Rodeghiero F Stasi R Gernsheimer T et al Standardization of terminology
definitions and outcome criteria in immune thrombocytopenic purpura of adults
and children report from an international working group Blood 2009
113(11)2386-93
19 Rodeghiero F Michel M Gernsheimer T et al Standardization of bleeding
assessment in immune thrombocytopenia report from the International Working
Group Blood 2013 121(14)2596-606
20 Qu MM Liu XN Liu XG et al Cytokine changes in response to TPO receptor
agonist treatment in primary immune thrombocytopenia Cytokine 2017
92110-7
21 Liu XG Li JL Qin P et al Determination of platelet-bound glycoprotein-
specific autoantibodies by flow cytometric immunobead assay in primary
immune thrombocytopenia Eur J Haematol 2011 86(4)339-46
22 Jernarings M Hou Y Stroumlmberg Ceacutelind F et al Altered cytokine levels in
pediatric ITP Platelets 2015 26(6) 589-92
23 Olsson B Andersson PO Jacobsson S et al Disturbed apoptosis of T-cells in
patients with active idiopathic thrombocytopenic purpura Thromb Haemost
2005 93(1)139-44
24 Duhen T Geiger R Jarrossay D et al Production of interleukin 22 but not
interleukin 17 by a subset of human skin-homing memory T cells Nat Immunol
2009 10(8)857-63
25 Azizi G Yazdani R Mirshafiey A Th22 cells in autoimmunity a review of
current knowledge Eur Ann Allergy Clin Immunol 2015 47(4)108-17
26 Zhong W Jiang Y Ma H et al Elevated levels of CCR6+enspT helper 22 cells
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
correlate with skin and renal impairment in systemic lupus erythematosus Sci
Rep 2017 7(1)12962
27 Miyazaki Y Nakayamada S Kubo S et al Th22 Cells Promote Osteoclast
Differentiation via Production of IL-22 in Rheumatoid Arthritis Front Immunol
2018 92901
28 Guttman-Yassky E Krueger JG Atopic dermatitis and psoriasis two different
immune diseases or one spectrum Curr Opin Immunol 2017 4868-73
29 Li J Ueno A Iacucci M Crossover Subsets of CD4+ T Lymphocytes in the
Intestinal Lamina Propria of Patients with Crohns Disease and Ulcerative
Colitis Dig Dis Sci 2017 62(9)2357-68
30 Cao J Chen C Li L et al Effects of high-dose dexamethasone on regulating
interleukin-22 production and correcting Th1 and Th22 polarization in immune
thrombocytopenia J Clin Immunol 2012 32(3)523-9
31 Boniface K Bernard FX Garcia M et al IL-22 inhibits epidermal differentiation
and induces proinflammatory gene expression and migration of human
keratinocytes J Immunol 2005 174(6)3695-702
32 Muntildeoz M Eidenschenk C Ota N et al Interleukin-22 induces interleukin-18
expression from epithelial cells during intestinal infection Immunity 2015
42(2)321-31
33 Shan NN Zhu XJ Peng J et al Interleukin 18 and interleukin 18 binding protein
in patients with idiopathic thrombocytopenic purpura Br J Haematol 2009
144(5)755-61
34 Tacchini-Cottier F Vesin C Redard M et al Role of TNFR1 and TNFR2 in
TNF-induced platelet consumption in mice J Immunol 1998 160(12)6182-6
35 Beringer A Miossec P IL-17 and IL-17-producing cells and liver diseases with
focus on autoimmune liver diseases Autoimmun Rev 2018 17(12)1176-85
36 Davids M Pooran AS Pietersen E et al Regulatory T Cells Subvert
Mycobacterial Containment in Patients Failing Extensively Drug-Resistant
Tuberculosis Treatment Am J Respir Crit Care Med 2018 198(1)104-16
37 Eisenstein EM Williams CB The T(reg)Th17 cell balance a new paradigm for
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
autoimmunity Pediatr Res 2009 65(5 Pt 2)26R-31R
38 Gibson SA Yang W Yan Z et al CK2 Controls Th17 and Regulatory T Cell
Differentiation Through Inhibition of FoxO1 J Immunol 2018 201(2)383-92
39 Crouser ED Role of imbalance between Th17 and regulatory T-cells in sarcoi-
dosis Curr Opin Pulm Med 2018 24(5)521-6
40 Diefenhardt P Nosko A Kluger MA et al IL-10 Receptor Signaling Empowers
Regulatory T Cells to Control Th17 Responses and Protect from GN J Am Soc
Nephrol 2018 29(7)1825-37
41 Li H Zhou Z Tai W et al Decreased Frequency of IL-17F rs763780 Site Allele
G is Associated With Genetic Susceptibility to Immune Thrombocytopenia in
a Chinese Population Clin Appl Thromb Hemost 2017 23(5) 466-71
42 Song Y Wang YT Huang XJ et al Abnormalities of the bone marrow immune
microenvironment in patients with immune thrombocytopenia Ann Hematol
2016 95(6)959-65
43 Liu X Hou Y Peng J Advances in immunopathogenesis of adult immune
thrombocytopenia Front Med 2013 7(4)418-24
44 Pickert G Neufert C Leppkes M et al STAT3 links IL-22 signaling in intestinal
epithelial cells to mucosal wound healing J Exp Med 2009 206(7)1465-72
45 Zahran A Attia A Mansell H et al Contribution of diminished kidney
transplant GFR to increased circulating chemokine ligand 27 level J Inflamm
(Lond) 2018 1518
46 Yssel H Bensussan A Is there a novel subset of Th22 lymphocytes in the skin
distinct from Th17 lymphocytes Med Sci (Paris) 2010 26(1)12-4
47 Yan A Luo G Zhou Z et al Tear osteopontin level and its relationship
with local Th1Th2Th17Treg cytokines in children with allergic conjunctivitis
Allergol Immunopathol (Madr) 2018 46(2)144-8
48 Giannoni Eacute Schneider A Calandra T et al Macrophage migration inhibitory
factor (MIF) a regulator of neonatal innate immune response Med Sci
(Paris) 2016 32(12)1062-4
49 Bacher M Metz CN Calandra T et al An essential regulatory role for
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
macrophage migration inhibitory factor in T-cell activation Proc Natl Acad Sci
U S A 1996 93(15)7849-54
50 Zhu X Ma D Zhang J et al Elevated interleukin-21 correlated to Th17 and Th1
cells in patients with immune thrombocytopenia J Clin Immunol
201030(2)253-9
Tables Table 1 Demographic and clinical characteristics of ITP patients
PatientNo
SexAge(years)
Course of disease
(months)
Bleeding symptoms (the SOMG index
bleeding grade)
Platelet count (times 109L)
Major previous therapy
1 M62 14 PT (S1 1) 21 GC2 M39 2 EP PT (S1M2 2) 25 None3 F73 12 PT (S1 1) 10 GC rhTPO RTX4 F20 120 ME EC (S1O1 1) 6 GC RTX Danzol5 F54 4 GH (M1 1) 5 None6 F50 4 GUH PT (S1O2 2) 7 GC7 F48 2 PT (S1 1) 5 GC IVIg8 M75 4 PT EC (S1 1) 10 GC9 F73 12 GIH EC (S1O3 3) 9 GC Danazol10 F41 3 PT (S1 1) 28 GC IVIg11 M46 5 GH PT (S1M1 1) 3 GC12 M53 3 PT EC (S1 1) 12 GC
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
13 F76 9 PT EC (S1 1) 19 GC IVIg14 F24 14 CH PT EC (S1M1 1) 4 GC rhTPO RTX15 M53 0 PT EC (S1 1) 16 None16 F30 3 CH PT (S1M1 1) 22 GC rhTPO17 F54 5 GH PT (S1M1 1) 18 GC rhTPO IVIg18 M59 3 EC (S1 1) 10 GC19 F36 9 PT EC (S2 2) 4 GC rhTPO CA
20 M54 60 EC GH (S1M3 3) 24GC rhTPO RTX
DCT21 F60 0 PT (S1 1) 11 None22 M56 3 EC (S1 1) 13 GC23 F30 132 PT ME (S1O2 2) 38 GC TPO DCT24 M38 2 PT EC GH (S1M1 1) 9 None25 M58 120 PT (S1 1) 17 GC TPO26 F29 11 PT ME (S1O1 1) 32 GC
27 M72 180PT GH GIH
(S1M3O1 3)7
GC IVIg TPO
Median 53 4 14Range 20-76 0-180 3-28
PT petechiae EP epistaxis ME menorrhagia EC ecchymoses GH gingival
haemorrhage GUH genitourinary haemorrhage GIH gastrointestinal haemorrhage
CH conjunctival haemorrhage GC glucocorticoid rhTPO recombinant human
thrombopoietin RTX Rituximab IVIg intravenous immunoglobulin CA caffeic
acid DCT decitabine
Table 2 CD4+ T-cell subsets and their signature cytokines in newly
diagnosedpersistent chronic ITP patients and HCs
Group
Subset
ITPn+p BM
(n = 18)
ITPc BM
(n = 9) sect
ITPn+p PB
(n = 18)amp1
ITPc PB
(n = 9) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1
ampampamp2 ampampampamp
Th22 () 222 plusmn 061 205 plusmn 096$ 142 plusmn 051 145 plusmn 068$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3694 plusmn 1405 3822 plusmn 2363$ 3050 plusmn 1186 3150 plusmn 1665$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 337 plusmn 121 314 plusmn 100$ 216 plusmn 091 217 plusmn 081$ 139 plusmn 017 132 plusmn 022$
Tregs () 185 plusmn 075 171 plusmn 078$ 395 plusmn 111 368 plusmn 144$ 612 plusmn 030 621 plusmn 018$
Th17Treg 220 plusmn 123 217 plusmn 108$ 070 plusmn 068 081 plusmn 068$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
IL-17 (pgml) 1677 plusmn 237 1612 plusmn 177$ 1645 plusmn 246$ 1527 plusmn 282$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2578 plusmn 578 2574 plusmn 783$ 1745 plusmn 582 1860 plusmn 600$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 545 plusmn 223 540 plusmn 229$ 413 plusmn 156 408 plusmn 144$ 321 plusmn 057 300 plusmn 031$
ITPn+p newly diagnosed or persistent ITP ITPC chronic ITP amp1ITPn+p BM vs
ITPn+p PB amp2ITPc BM vs ITPc PB ampamp1ITPn+p BM vs HC BM ampamp2ITPc BM vs HC
BM ampampamp1ITPn+p PB vs HC PB ampampamp2ITPc PB vs HC PB ampampampampHC BM vs HC PB sectITPn+p BM vs ITPC BM sectsectITPn+p PB vs ITPC PB P lt 005 P lt 001 $P gt 005
Table 3 CD4+ T-cell subsets and their signature cytokines in HCs and ITP
patients receiving nofirst-line therapy and second-line therapy
Group
Subset
ITPno1st-line BM
(n = 17)
ITP2nd-line BM
(n = 10) sect
ITPno1st-line PB
(n = 17) amp1
ITP2nd-line PB
(n = 10) amp2 sectsect
HC BM
(n = 15) ampamp1
ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2
ampampampamp
Th22 () 212 plusmn 066 223 plusmn 086$ 131 plusmn 049 164 plusmn 063$ 084 plusmn 017 083 plusmn 016$
IL-22 (pgml) 3673 plusmn 1690 3844 plusmn 1899$ 3009 plusmn 1263 3209 plusmn 1505$ 2180 plusmn 206 2067 plusmn 349$
Th17 () 320 plusmn 121 344 plusmn 100$ 215 plusmn 095 220 plusmn 072$ 139 plusmn 017 132 plusmn 022$
Tregs () 184 plusmn 062 170 plusmn 099$ 394 plusmn 092 374 plusmn 164$ 612 plusmn 030 621 plusmn 018$
Th17Tregs 201 plusmn 113 274 plusmn 178$ 059 plusmn 036 099 plusmn 097$ 019 plusmn 003 018 plusmn 003$
IL-17 (pgml) 1689 plusmn 245 1598 plusmn 155$ 1598 plusmn 319$ 1620 plusmn 113$$ 1305 plusmn 327 1477 plusmn 285$$$
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Th1 () 2595plusmn 620 2547 plusmn 700$ 1682 plusmn 399 1953 plusmn 796$ 770 plusmn 112 711 plusmn 133
IFN-γ (pgml) 543 plusmn 224 545 plusmn 227$ 397 plusmn 150 435 plusmn 152$ 321 plusmn 057 300 plusmn 031$
ITPno1st-line ITP patients that has not been treated or used to be treated with first-line
drugs ITP2nd-line ITP patients that used to be treated with second-line drugs amp1ITPno1st-
line BM vs ITPno1st-line PB amp2ITP2nd-line BM vs ITP2nd-line PB ampamp1ITPno1st-line BM vs HC
BM ampamp2ITP2nd-line BM vs HC BM ampampamp1ITPno1st-line PB vs HC PB ampampamp2ITP2nd-line PB vs
HC PB ampampampampHC BM vs HC PB sectITPno1st-line BM vs ITP2nd-line BM sectsectITPno1st-line PB vs
ITP2nd-line PB P lt 005 P lt 001 $P gt 005
Table 4 CD4+ T-cell subsets and their signature cytokines in treatment-naiumlve ITP
patients recurrent ITP patients and HCs
Group
Subset
ITPr BM
(n = 22)
ITPtn BM c
(n = 5) sect
ITPr PB
(n = 22) amp1
ITPtn PB
(n = 5) amp2 sectsect
HC BM
(n = 15) ampamp1 ampamp2
HC PB
(n = 15) ampampamp1 ampampamp2 ampampampamp
Th22 () 219 plusmn 074 205 plusmn 071$ 146 plusmn 059 129 plusmn 038$ 084 plusmn 017 083 plusmn 016$$
IL-22 (pgml) 3829 plusmn 1721 3331 plusmn 1946$ 3192 plusmn 1361 2004 plusmn 1212$$ 2180 plusmn 206$ 2067 plusmn 349$$
Th17 () 339 plusmn 121 284 plusmn 045$ 224 plusmn 086 186 plusmn 087$ 139 plusmn 017 132 plusmn 022$$
Tregs () 178 plusmn 083 183 plusmn 043$ 385 plusmn 125 393 plusmn 111$ 612 plusmn 030 621 plusmn 018$
Th17Treg 242 plusmn 152 268 plusmn 069$ 077 plusmn 070 059 plusmn 056$ 019 plusmn 003 018 plusmn 003$$
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
IL-17 (pgml) 1688 plusmn 221 1511 plusmn 138$ 1591 plusmn 280$ 1669 plusmn 139$$ 1305 plusmn 327$ 1477 plusmn 285$$$
Th1 () 2532 plusmn 633 2775 plusmn 697$ 1768 plusmn 510 1850 plusmn 899$ 770 plusmn 112 711 plusmn 133$
IFN-γ (pgml) 541 plusmn 209 555plusmn 294$ 408 plusmn 143 387 plusmn 179$ 321 plusmn 057 300 plusmn 031$$
ITPr recurrent ITP ITPtn treatment-naive ITP amp1ITPr BM vs ITPr PB amp2ITPtn BM vs
ITPtn PB ampamp1ITPr BM vs HC BM ampamp2ITPtn BM vs HC BM ampampamp1ITPr PB vs HC PB ampampamp2ITPtn PB vs HC PB ampampampampHC BM vs HC PB sectITPr BM vs ITPtn BM sectsectITPr PB vs
ITPtn PB P lt 005 P lt 001 $P gt 005
Table 5 CD4+ T-cell subsets in bleeding grade 1 patients bleeding grade 2 or 3
patients and HCs
Group
Subset
ITPgrade 1 BM
(n = 20)
ITPgrade 2+3 BM
(n = 7)sect
ITPgrade 1 PB
(n = 20)
ITPgrade 2+3 PB
(n = 7)sectsect
HC BM
(n = 20)ampamp1 ampamp2
HC PB
(n = 7)ampampamp1 ampampamp2
Th22 () 203 plusmn 072 254 plusmn 065$ 131 plusmn 053 178 plusmn 050 084 plusmn 017 083 plusmn 016
Th17 () 326 plusmn 116 336 plusmn 110$ 210 plusmn 092 236 plusmn 066$ 139 plusmn 017 132 plusmn 022
Tregs () 189 plusmn 082 149 plusmn 048$ 400 plusmn 121 347 plusmn 120$ 612 plusmn 030 621 plusmn 018
Th17Tregs 215 plusmn 129 263 plusmn 181$ 070 plusmn 069 084 plusmn 064$ 019 plusmn 003 018 plusmn 003
Th1 () 2419plusmn 600 3028 plusmn 672 1737 plusmn 502 1913 plusmn 794$ 770 plusmn 112 711 plusmn 133
ITPgrade 1 Bleeding grade 1 patients ITPgrade 2+3 Bleeding grade 2 or 3 patients
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
ampamp1ITPgrade 1 BM vs HC BM ampamp2ITPgrade 2+3 BM vs HC BM ampampamp1ITPgrade 1 PB vs HC PB ampampamp2ITPgrade 2+3 PB vs HC PB sectITPgrade 1 BM vs ITPgrade 2+3 BM sectsectITPgrade 1 PB vs ITPgrade
2+3 PB P lt 005 P lt 001 $P gt 005
Table 6 Chemokine receptors expressed by different CD4+ T-cell subsets in BM and PB of ITP patients and HCsGroup
Chemokine receptor
ITP BM ITP PBamp HC BMampamp HC PBampampamp ampampampamp
n = 6 n = 6 n = 6 n = 6
CXCR3 on CD4+IFN-γ+ 15273 plusmn 2161 17055 plusmn 2351 10635 plusmn 2175 12937 plusmn 1416
CCR4 on CD4+IL-4+ 166663 plusmn 71642 171003 plusmn 81868$ 133637 plusmn 5391$ 135897 plusmn 6047$ $
CCR4 on CD4+IL-17+ 11607 plusmn 3938 10475 plusmn 5248$ 13752 plusmn 1669$ 11733 plusmn 2828$ $
CCR6 on CD4+IL-17+ 12592 plusmn 2732 13503 plusmn 3959$ 15082 plusmn 1410$ 13792 plusmn 1270$ $
CCR4 on CD4+IL-22+ 25843 plusmn 8245 24028 plusmn 6073$ 16248 plusmn 2174 14962 plusmn 1554 $
CCR10 on CD4+IL-22+ 16730 plusmn 3573 16663 plusmn 3648$ 14955 plusmn 1063$ 15143 plusmn 1055$ $
CXCR4 on CD4+FoxP3+ 19288 plusmn 1543 18615 plusmn 2402$ 17520 plusmn 1123$ 17523 plusmn 1285$ $
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
ampITP BM vs ITP PB ampampITP BM vs HC BM ampampampITP PB vs HC PB ampampampampHC BM vs
HC PB P lt 005 P lt 001 $P gt 005
Figure legends
Figure 1 The percentages of Th22 cells and plasma levels of IL-22 in BM and PB
from ITP patients and healthy controls (HCs) Heparinized BM and PB from all
subjects were stained with labeled antibodies and analyzed by flow cytometry (A)
Lymphocytes were gated based on their forward and side scatter (B) CD4+IFN-γ-
lymphocytes were further gated for analysis of Th22 and Th17 cells (C D E F)
Representative scattergrams of Th22 and Th17 cells in BM and PB from ITP patients
and HCs (G H J K) Th22 cells and IL-22 in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (I L) In
ITP group the percentage of BM Th22 cells and plasma level of IL-22 were
remarkably higher than the PB counterparts (M N) Plasma levels of IL-22 correlated
positively with the percentages of Th22 cells both in BM and PB in ITP group Bars
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
represent means plusmn SD P lt 005 P lt 0001
Figure 2 The percentages of Th17 cells and Tregs as well as plasma levels of IL-
17 in BM and PB from ITP patients and HCs (A B C D) Representative
scattergrams of Tregs in BM and PB from ITP patients and HCs (E F G H) The
percentages of Th17 cells were significantly higher while Tregs were remarkably
lower than their matched BM and PB counterparts from HCs (I J) BM and PB
Th17Treg ratios were markedly elevated from ITP patients compared to their
counterparts from HCs (K L) In ITP group the percentage of BM Th17 cells was
remarkably higher while Tregs was considerably lower than the PB counterparts (M)
BM Th17Treg ratio was considerably higher than the PB counterparts from ITP
patients (N) Plasma level of IL-17A in BM from ITP patients was significantly
higher than from HCs (O) There was no statistical difference in plasma PB IL-17A
level between ITP patients and HCs (P) In ITP group no statistical difference was
found in plasma levels of IL-17A between BM and PB Bars represent means plusmn SD
P lt 005 P lt 0001
Figure 3 BM and PB Th1 cells and INF-γ from ITP patients and HCs (A B C
D) Representative scattergrams of Th1 cells in BM and PB from ITP patients and
HCs (E F H I) Th1 cells and INF-γ in BM and PB from ITP patients were
significantly higher than their matched BM and PB counterparts from HCs (G J) In
ITP group BM Th1 cells and INF-γ were remarkably higher than the PB counterparts
(K L) Plasma levels of INF-γ correlated positively with the percentages of Th1 cells
both in BM and PB in ITP group Bars represent means plusmn SD P lt 005 P lt
0001
Figure 4 BM and PB Th2 cells from ITP patients and HCs (A B C D)
Representative scattergrams of Th2 cells in BM and PB from ITP patients and HCs
(E) There was no statistical difference in BM Th2 cells between ITP patients and
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
HCs (F) Th2 cells in PB from ITP patients was significantly lower compared with
HCs (G) In ITP group frequency of BM Th2 cells was remarkably higher than the
PB counterparts Bars represent means plusmn SD P lt 005
Figure 5 Tfh and ICOS+ Tfh cells in BM and PB from ITP patients and HCs (A
B C D) Representative scattergrams of Tfh and ICOS+ Tfh cells in BM and PB from
ITP patients and HCs (E F G H) Tfh and ICOS+ Tfh cells in BM and PB from ITP
patients were significantly higher than their matched BM and PB counterparts from
HCs (I J) In ITP group BM Tfh and ICOS+ Tfh cells were remarkably higher than
the PB counterparts Bars represent means plusmn SD P lt 005 P lt 0001
Figure 6 MFI histogram of Chemokine receptors on different CD4+ T-cell
subsets in BM and PB from ITP patients and HCs (A B) Representative MFI
histogram of CXCR3 on CD4+IFN-γ+ T cells in BM and PB from ITP patients and
HCs (C D) Representative MFI histogram of CCR4 on CD4+IL-4+ T cells in BM and
PB from ITP patients and HCs (E F G) Representative MFI histogram of CCR4 and
CCR6 on CD4+IL-17+ T cells in BM and PB from ITP patients and HCs (H I J)
Representative MFI histogram of CCR4 and CCR10 on CD4+IL-22+ T cells in BM
and PB from ITP patients and HCs
Figure 7 Heatmap of differential expressed proteins between ITP BM and HC
BM
Figure 8 Heatmap of differential expressed proteins between ITP BM and ITP
PB
Figure 9 Correlations of each CD4+ T-cell subpopulation between BM and PB
from ITP patients Pearson correlation analysis revealed that the percentages of BM
Th22 Th17 Th1 cells and Tregs correlated positively with their PB counterparts in
ITP group
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 6
Figure 7
Figure 8
Figure 9
Figure 7
Figure 8
Figure 9
Figure 9