volume 16 - number 7 volume 1 - number 1 may - september

Volume 1 - Number 1 May - September 1997

Volume 16 - Number 7 July 2012

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with

the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific

Research (CNRS) on its electronic publishing platform I-Revues.

Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.

INIST-CNRS

OPEN ACCESS JOURNAL

Atlas of Genetics and Cytogenetics in Oncology and Haematology

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in

open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases.

It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more

traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology,

and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information,

University Hospital

F-86021 Poitiers, France

tel +33 5 49 44 45 46 or +33 5 49 45 47 67

[email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Jérémy Cigna, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre,

Anne Malo, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski.

Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave

Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times

a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of

the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

© ATLAS - ISSN 1768-3262

mailto:[email protected]


http://www.inist.fr/

http://www.atlasgeneticsoncology.org/

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7)

INIST-CNRS

OPEN ACCESS JOURNAL


Editor

Jean-Loup Huret

(Poitiers, France)

Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section

Alessandro Beghini (Milan, Italy) Genes Section

Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections

Judith Bovée (Leiden, The Netherlands) Solid Tumours Section

Vasantha Brito-Babapulle (London, UK) Leukaemia Section

Charles Buys (Groningen, The Netherlands) Deep Insights Section

Anne Marie Capodano (Marseille, France) Solid Tumours Section

Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections

Antonio Cuneo (Ferrara, Italy) Leukaemia Section

Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section

Louis Dallaire (Montreal, Canada) Education Section

Brigitte Debuire (Villejuif, France) Deep Insights Section

François Desangles (Paris, France) Leukaemia / Solid Tumours Sections

Enric Domingo-Villanueva (London, UK) Solid Tumours Section

Ayse Erson (Ankara, Turkey) Solid Tumours Section

Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections

Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section

Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections

Anne Hagemeijer (Leuven, Belgium) Deep Insights Section

Nyla Heerema (Colombus, Ohio) Leukaemia Section

Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections

Sakari Knuutila (Helsinki, Finland) Deep Insights Section

Lidia Larizza (Milano, Italy) Solid Tumours Section

Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section

Edmond Ma (Hong Kong, China) Leukaemia Section

Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections

Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections

Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section

Fredrik Mertens (Lund, Sweden) Solid Tumours Section

Konstantin Miller (Hannover, Germany) Education Section

Felix Mitelman (Lund, Sweden) Deep Insights Section

Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section

Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections

Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections

Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section

Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section

Mariano Rocchi (Bari, Italy) Genes Section

Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section

Albert Schinzel (Schwerzenbach, Switzerland) Education Section

Clelia Storlazzi (Bari, Italy) Genes Section

Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections

Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections

Dan Van Dyke (Rochester, Minnesota) Education Section

Roberta Vanni (Montserrato, Italy) Solid Tumours Section

Franck Viguié (Paris, France) Leukaemia Section

José Luis Vizmanos (Pamplona, Spain) Leukaemia Section

Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections

INIST-CNRS

OPEN ACCESS JOURNAL


Volume 16, Number 7, July 2012

Table of contents

Gene Section

ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1) 442 Hisataka Sabe, Yasuhito Onodera, Ari Hashimoto, Shigeru Hashimoto

CD38 (CD38 molecule) 445 Silvia Deaglio, Tiziana Vaisitti

CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1) 452 Edward J Kelly, Vladimir Yarov-Yarovoy, Allan E Rettie

DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) 458 Chon-Hwa Tsai-Morris, Maria L Dufau

EPHB6 (EPH receptor B6) 462 Lokesh Bhushan, Raj P Kandpal

FOXF1 (forkhead box F1) 466 Pang-Kuo Lo

FXYD3 (FXYD domain containing ion transport regulator 3) 470 Hiroto Yamamoto, Shinji Asano

MCAM (melanoma cell adhesion molecule) 475 Guang-Jer Wu

MIR100 (microRNA 100) 479 Katia Ramos Moreira Leite

MIR145 (microRNA 145) 484 Mohit Sachdeva, Yin Yuan Mo

MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)) 487 Tiangang Zhuang, Mayumi Higashi, Venkatadri Kolla, Garrett M Brodeur

PTBP1 (polypyrimidine tract binding protein 1) 491 Laura Fontana

SOCS3 (suppressor of cytokine signaling 3) 495 Zoran Culig

Leukaemia Section

i(17q) solely in myeloid malignancies 497 Vladimir Lj Lazarevic

inv(11)(q13q23) 501 Adrian Mansini, Claus Meyer, Marta Susana Gallego, Jorge Rossi, Patricia Rubio, Adriana Medina, Rolf

Marschalek, Maria Felice, Cristina Alonso

t(2;9)(q37;q34) 505 Purvi M Kakadia, Stefan K Bohlander

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7)

INIST-CNRS

OPEN ACCESS JOURNAL

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

Solid Tumour Section

Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24) 508 Karolin H Nord

Case Report Section

t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia 513 Helena Podgornik, Peter Cernelc

Gene Section Review

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 442

INIST-CNRS

OPEN ACCESS JOURNAL


ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1) Hisataka Sabe, Yasuhito Onodera, Ari Hashimoto, Shigeru Hashimoto

Hokkaido University Graduate School of Medicine, Department of Molecular Biology, Sapporo,

Japan (HS, YO, AH, SH)

Published in Atlas Database: February 2012

Online updated version : http://AtlasGeneticsOncology.org/Genes/ASAP1ID44351ch8q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI ASAP1ID44351ch8q24.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Other names: AMAP1, CENTB4, DDEF1,

KIAA1249, PAG2, PAP, ZG14P

HGNC (Hugo): ASAP1

Location: 8q24.21

DNA/RNA

Description

The ASAP1 locus spans 391,75 kb, on the minus

strand of chromosome 8 from 131456099 to

131064346.

Transcription

Transcription produces 16 different mRNAs, 12

alternatively spliced variants and 4 unspliced forms.

There are 9 probable alternative promotors, 6 non

overlapping alternative last exons and 5 validated

alternative polyadenylation sites.

The mRNAs appear to differ by truncation of the 5'

end, truncation of the 3' end, presence or absence of

15 cassette exons, overlapping exons with different

boundaries (NCBI).

The ASAP1 gene maps on chromosome 8, at 8q24.1-q24.2 according to Entrez Gene (adapted from GeneCards).

http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/av.cgi?db=human&c=Gene&l=ASAP1

http://www.genecards.org/cgi-bin/carddisp.pl?gene=ASAP1

ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1)

Sabe H, et al.


Protein

Description

P. Randazzo's group was the first to identify two

variants of a 130-kDa phosphatidylinositol 4,5-

bisphosphate (PIP2)-dependent Arf1 GTPase-

activating protein (GAP), and named them ASAP1a

and ASAP1b (ArfGAP, SH3, ankyrin repeat, PH

protein) (Brown et al., 1998).

At almost the same time, T. Roberts' group isolated

a homologue of ASAP1 from bovine brain as a Src

SH3 domain-binding protein, and named it DEF-1

(differentiation-enhancing factor-1) because its

ectopic expression in fibroblasts resulted in their

differentiation into adipocytes (King et al., 1999).

J. Schlessinger's group also identified a similar

protein as a Pyk2 binding protein, and named it Pap

(Andreev et al., 1999). Later on, we also isolated

several ArfGAPs as paxillin-binding proteins, and

tentatively called them paxillin-associated ArfGAPs

(PAG1, PAG2 and PAG3) (Kondo et al., 2000;

Mazaki et al., 2001; Sabe et al., 2006). ASAPs were

moreover identified as centaurin β3 and β4.

To avoid this confusion of naming, it was proposed

internationally to unify the names according to

functional domains that these proteins bear:

ASAP1, DEF1, PAG2, centaurin β4 were hence

proposed to be called AMAP1 (a multiple-domain

ArfGAP protein 1); and Pap, DDEF2, PAG3,

centaurin β3 to be called AMAP2 (a multiple-

domain ArfGAP protein 2) (Kahn, 2004). Since

then, we have stopped calling these proteins PAG2

and PAG3, and instead now call them AMAP1 and

AMAP2.

Then after, the HUGO Gene Nomenclature

Committee has nevertheless decided to call

AMAP1 as ASAP1, and AMAP2 as ASAP2. We

hereby call these proteins and genes according to

names used in the original reports.

Expression

Epithelial cells, fibroblasts, macrophages, brain (for

references see above), and endothelial cells

(Hashimoto et al., 2011). Not determined with the

other types of cells.

Localisation

Intracellular tubulovesicular structures and vesicles,

plasma membrane protrusions and leading edges,

and invadopodia/podosome structures (Hashimoto

et al., 2004; Hashimoto et al., 2005; Onodera et al.,

2005).

Function

ASAP1 has an ArfGAP zinc-finger domain and

exhibits phosphatidylinositol 4,5-bisphosphate-

dependent GAP activities for Arf1 and Arf5 but

102- to 10

3-fold less activity for Arf6 (Brown et al.,

1998; Andreev et al., 1999). ASAP1 was shown to

enhance cell motility, and this activity was

proposed to be mediated by its GAP activity

towards Arf1 (Furman et al., 2002). ASAP1 was

also shown to associate with focal adhesion kinase

(FAK) and contribute to focal adhesion assembly

(Liu et al., 2002). Hashimoto et al. (2004 and 2005)

have shown that AMAP1 and AMAP2 have the

ability to bind stably with GTP-Arf6, but not GDP-

Arf6 or other GTP-/GDP-Arf isoforms, in vitro and

in vivo. Through this binding, AMAP1 and

AMAP2 appear to function as downstream effectors

for GTP-Arf6 (Hashimoto et al., 2004; Hashimoto

et al., 2005; Onodera et al., 2005). AMAP1 binds to

paxillin and cortactin, which are essential

components of the invadopodia of MDA-MB-231

breast cancer cells, and acts to recruit these proteins

to the sites of Arf6 activation to form invadopodia

(Onodera et al., 2005). AMAP1 is hence essential

for invasion and metastasis of some breast cancer

cells, while AMAP2 is not a component of

invadopodia (Onodera et al., 2005; Hashimoto et

al., 2006; Nam et al., 2007; Morishige et al., 2008;

Sabe et al., 2009). AMAP1 appears to be a useful

diagnostic marker as well as therapeutic target of

different types of human cancers (see below).

Implicated in

Breast cancer

Note

In primary breast cancers, AMAP1 protein, but not

AMAP2 protein, is abnormally overexpressed in

their significant population in a manner

independent of the transcriptional upregulation of

the AMAP1 gene, and levels of AMAP1 protein

expression correlates well with the malignant

phenotypes (Onodera et al., 2005).

Melanoma

Note

With the name DDEF1, this gene was identified to

be located in an amplified region of chromosome

8q24.12, and the amplification of chromosome 8q

in uveal melanomas was found to correlate most

strongly with the expression of this gene in

melanomas (Ehlers et al., 2005).

Colorectal cancer

Note

Protein expression of ASAP1 is upregulated in

colorectal cancer cells, and this expression

correlates with poor metastasis-free survival and

prognosis in colorectal cancer patients (Müller et

al., 2010).

It is worth noting, on the other hand, that a previous

study on the copy number changes at 8q11-24 in

colorectal carcinomas showed that although the

MYC gene, located at 8q24.12-q24.13, is indeed

amplified and correlates with the advanced stages

of colorectal carcinoma, the DDEF1 gene was not

amplified (Buffart et al., 2005).

ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1)

Sabe H, et al.


Prostate cancer

Note

Additional gene copies of ASAP1 were also

detected in a large population of primary prostate

cancers, and ASAP1 protein staining was found to

be elevated in 80% of primary prostate cancers with

substantially higher amounts observed in metastatic

lesions compared with benign prostate tissue (Lin et

al., 2008).

Pancreatic ductal adenocarcinoma

Note

DDEF1 gene was found to be frequently amplified,

most likely to be oncogenic, in pancreatic ductal

adenocarcinomas, accompanied by enhanced

expression of this gene (Harada et al., 2009).

VEGF- and tumor-induced angiogenesis

Note

AMAP1 protein is highly expressed in endothelial

cells upon their treatment with vascular endothelial

growth factor (VEGF), and an essential component

of VEGF- and tumor-induced angiogenesis, and

also choroidal neovascularization (Hashimoto et al.,

2011).

References Brown MT, Andrade J, Radhakrishna H, Donaldson JG, Cooper JA, Randazzo PA. ASAP1, a phospholipid-dependent arf GTPase-activating protein that associates with and is phosphorylated by Src. Mol Cell Biol. 1998 Dec;18(12):7038-51

Andreev J, Simon JP, Sabatini DD, Kam J, Plowman G, Randazzo PA, Schlessinger J. Identification of a new Pyk2 target protein with Arf-GAP activity. Mol Cell Biol. 1999 Mar;19(3):2338-50

King FJ, Hu E, Harris DF, Sarraf P, Spiegelman BM, Roberts TM. DEF-1, a novel Src SH3 binding protein that promotes adipogenesis in fibroblastic cell lines. Mol Cell Biol. 1999 Mar;19(3):2330-7

Kondo A, Hashimoto S, Yano H, Nagayama K, Mazaki Y, Sabe H. A new paxillin-binding protein, PAG3/Papalpha/KIAA0400, bearing an ADP-ribosylation factor GTPase-activating protein activity, is involved in paxillin recruitment to focal adhesions and cell migration. Mol Biol Cell. 2000 Apr;11(4):1315-27

Mazaki Y, Hashimoto S, Okawa K, Tsubouchi A, Nakamura K, Yagi R, Yano H, Kondo A, Iwamatsu A, Mizoguchi A, Sabe H. An ADP-ribosylation factor GTPase-activating protein Git2-short/KIAA0148 is involved in subcellular localization of paxillin and actin cytoskeletal organization. Mol Biol Cell. 2001 Mar;12(3):645-62

Furman C, Short SM, Subramanian RR, Zetter BR, Roberts TM. DEF-1/ASAP1 is a GTPase-activating protein (GAP) for ARF1 that enhances cell motility through a GAP-dependent mechanism. J Biol Chem. 2002 Mar 8;277(10):7962-9

Liu Y, Loijens JC, Martin KH, Karginov AV, Parsons JT. The association of ASAP1, an ADP ribosylation factor-GTPase activating protein, with focal adhesion kinase contributes to the process of focal adhesion assembly. Mol Biol Cell. 2002 Jun;13(6):2147-56

Hashimoto S, Hashimoto A, Yamada A, Kojima C, Yamamoto H, Tsutsumi T, Higashi M, Mizoguchi A, Yagi R, Sabe H. A novel mode of action of an ArfGAP, AMAP2/PAG3/Papa lpha, in Arf6 function. J Biol Chem. 2004 Sep 3;279(36):37677-84

Kahn RA.. The ARF Family. ARF Family GTPases, R.A. Kahn ed., Kluwer Acadmic Publishers, 2004.

Buffart TE, Coffa J, Hermsen MA, Carvalho B, van der Sijp JR, Ylstra B, Pals G, Schouten JP, Meijer GA.. DNA copy number changes at 8q11-24 in metastasized colorectal cancer. Cell Oncol. 2005;27(1):57-65.

Ehlers JP, Worley L, Onken MD, Harbour JW.. DDEF1 is located in an amplified region of chromosome 8q and is overexpressed in uveal melanoma. Clin Cancer Res. 2005 May 15;11(10):3609-13.

Hashimoto S, Hashimoto A, Yamada A, Onodera Y, Sabe H.. Assays and properties of the ArfGAPs, AMAP1 and AMAP2, in Arf6 function. Methods Enzymol. 2005;404:216-31.

Onodera Y, Hashimoto S, Hashimoto A, et al... Expression of AMAP1, an ArfGAP, provides novel targets to inhibit breast cancer invasive activities. EMBO J. 2005 Mar 9;24(5):963-73. Epub 2005 Feb 17.

Sabe H, Onodera Y, Mazaki Y, Hashimoto S.. ArfGAP family proteins in cell adhesion, migration and tumor invasion. Curr Opin Cell Biol. 2006 Oct;18(5):558-64. Epub 2006 Aug 9. (REVIEW)

Nam JM, Onodera Y, Mazaki Y, Miyoshi H, Hashimoto S, Sabe H.. CIN85, a Cbl-interacting protein, is a component of AMAP1-mediated breast cancer invasion machinery. EMBO J. 2007 Feb 7;26(3):647-56. Epub 2007 Jan 25.

Lin D, Watahiki A, Bayani J, Zhang F, Liu L, et al.. ASAP1, a gene at 8q24, is associated with prostate cancer metastasis. Cancer Res. 2008 Jun 1;68(11):4352-9.

Morishige M, Hashimoto S, Ogawa E, Toda Y, et al.. GEP100 links epidermal growth factor receptor signalling to Arf6 activation to induce breast cancer invasion. Nat Cell Biol. 2008 Jan;10(1):85-92. Epub 2007 Dec 16.

Harada T, Chelala C, Crnogorac-Jurcevic T, Lemoine NR.. Genome-wide analysis of pancreatic cancer using microarray-based techniques. Pancreatology. 2009;9(1-2):13-24. Epub 2008 Dec 12. (REVIEW)

Sabe H, Hashimoto S, Morishige M, Ogawa E, Hashimoto A, Nam JM, Miura K, Yano H, Onodera Y.. The EGFR-GEP100-Arf6-AMAP1 signaling pathway specific to breast cancer invasion and metastasis. Traffic. 2009 Aug;10(8):982-93. Epub 2009 Apr 21. (REVIEW)

Muller T, Stein U, Poletti A, Garzia L, Rothley M, Plaumann D, Thiele W, Bauer M, Galasso A, Schlag P, Pankratz M, Zollo M, Sleeman JP.. ASAP1 promotes tumor cell motility and invasiveness, stimulates metastasis formation in vivo, and correlates with poor survival in colorectal cancer patients. Oncogene. 2010 Apr 22;29(16):2393-403. Epub 2010 Feb 15.

Hashimoto A, Hashimoto S, Ando R, Noda K, Ogawa E, Kotani H, Hirose M, Menju T, Morishige M, Manabe T, Toda Y, Ishida S, Sabe H.. GEP100-Arf6-AMAP1-cortactin pathway frequently used in cancer invasion is activated by VEGFR2 to promote angiogenesis. PLoS One. 2011;6(8):e23359. Epub 2011 Aug 15.

This article should be referenced as such:

Sabe H, Onodera Y, Hashimoto A, Hashimoto S. ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):442-444.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


CD38 (CD38 molecule) Silvia Deaglio, Tiziana Vaisitti

Department of Genetics, Biology and Biochemistry, University of Turin, Turin, Italy (SD, TV)


Online updated version : http://AtlasGeneticsOncology.org/Genes/CD38ID978ch4p15.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CD38ID978ch4p15.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: T10

HGNC (Hugo): CD38

Location: 4p15.32

DNA/RNA

Description

The genomic DNA of CD38 extends for 71172 base

pairs with 8 exons, starting at 15779898 bp and

ending at 15851069 bp. The CD38 gene is located

at 4p15.32. The 5'-flanking promoter region of the

gene contains a CpG island that is ~900 bp long and

includes exon 1 and the 5'-end of the intron 1. This

region contains a binding site for the transcription

factor Sp1 and several potential binding for other

factors such as interleukins, interferon and

hormones. A critical region in the CD38 gene is the

retinoic acid responsive element (RARE)

responsible for the upregulation of CD38

expression induced by all-trans retinoic acid (Nata

et al., 1997; Ferrero and Malavasi, 1999). The 5'-

end of the intron 1 contains also a C→ G single

nucleotide polymorphism (SNP), rs6449182, that

leads to the presence or absence of a PvuII

restriction site (see below). The SNP is located

within a putative E-box, a region of binding of the

E proteins with a consequent regulation of gene

transcription. In the B cell compartment a relevant

role is played by E2A, that controls the expression

of several B lineage genes. E2A was demonstrated

to bind to the E-box of the CD38 gene, regulating

its expression, and the binding of the protein is

influenced by the CD38 genotype, with the G allele

resulting in a stronger binding of E2A (Saborit-

Villarroya et al., 2011).

Transcription

The mRNA of CD38 (NM_001775.2) contains

1494 bp.

Gene structure of CD38. Colored boxes represent the 8 exons; the total length, the starting and ending base pair of the gene are indicated.

CD38 (CD38 molecule) Deaglio S, Vaisitti T


CD38 protein structure. CD38 is a transmembrane molecule of 300 aa. The intracellular (IC), the transmembrane (TM) and the extracellular domains are indicated in the diagram. The different portions of the aminoacidic chain are shown as coded by the

different exons.

Protein

Description

Human CD38 is made up of a single chain of 300

aa with a corresponding molecular weight of

approximately 45 kDa. It is characterized by a short

cytoplasmic tail (21 aa), a small transmembrane

domain (23 aa) and a large extracellular domain

(256 aa). CD38 is a glycoprotein comprising 2 to 4

N-linked oligosaccharide chains containing sialic

acid residues. The overall structure of the CD38

molecule is stabilized by six pairs of disulphide

bonds.

Besides the monomeric membrane-bound form of

CD38, a soluble form of CD38 of approximately 78

kDa (p78) (Mallone et al., 1998) and a high-

molecular weight form of 190 kDa (p190) (Umar et

al., 1996), have been described. The latter fits with

a tetrameric conformation of the molecule, both

displaying enzymatic activities.

The carboxyl-terminal of the molecule harbors the

catalytic site (CD38 is defined as an ecto-enzyme)

and the binding site for CD31, the non-substrate

CD38 ligand (Deaglio et al., 1998).

The overall structure of the CD38 molecule,

obtained by crystallographic analyses, is "L"-

shaped and can be divided into two separate

domains. The N-terminal domain, formed by a

bundle of α helices (α1, α2, α3, α5, α6) and two

short β strands (β1, β3), and the C-terminal domain,

formed by four-stranded parallel β sheet (β2, β4,

β5, and β6) surrounded by two long (α8 and α9)

and two short α helices (α4 and α7). These two

distinct domains are connected by a hinge region

composed of three peptide chains. The enzyme's

overall topology is similar to the related proteins

CD157 and the Aplysia ADP-ribosyl cyclase, with

the exception of important structural changes at the

two termini. The extended positively charged N

terminus has lateral associations with the other

CD38 molecule in the crystallographic asymmetric

unit. The analysis of the CD38 substrate binding

models revealed three key residues that may be

critical in controlling CD38 enzimatic functions.

Indeed, the positions of residues Glu226, Trp125,

and Trp189, which are essential for the enzyme's

catalytic activity are highly conserved; Trp125 and

Trp189 are suggested as the residues for

recognizing and positioning the substrate by

hydrophobic interactions, while Glu226 is the

catalytic residue that takes part in the formation of

the catalytic intermediate) (Munshi et al., 2000; Liu

et al., 2005).

Expression

Human CD38 is surface expressed by various cells

of both hematopoietic and non-hematopoietic

lineages. In the T cell compartment, CD38 is

expressed by a significant fraction of human

thymocytes, mainly at the double-positive stage. In

B cells, the expression is tightly regulated during

cell ontogenesis, being present at high levels in

bone marrow precursors and in terminally

differentiated plasma cells. CD38 is expressed also

in circulating monocytes, but not in resident

macrophages, and in circulating and residential NK

cells and granulocytes.

CD38 is also present in many tissues other than

haematopoietic cells, including normal prostatic

epithelial cells, pancreatic islet cells and the brain,

where it is detected in perikarya and dendrites of

many neurons, such as the cerebellar Purkinje cells,

in rat astrocytes and in perivascular autonomic

nerve terminals. Other CD38+ cells include smooth

and striated muscle cells, renal tubules, retinal

gangliar cells and cornea (Malavasi et al., 2008).

Localisation

CD38 is a type II transmembrane protein expressed

on plasma and nuclear membranes.

Function

CD38 is a multifunctional ecto-enzyme involved in

signal transduction, cell adhesion and calcium

signaling. The binding to the ligand CD31, initiates

a signaling cascade that includes phosphorylation of

sequential intracellular targets and increases

cytoplasmic Ca2+

levels, mediating different

biological events depending on the cells type (e.g.,

activation, proliferation, apoptosis, cytokines



secretion and homing). As an enzyme, CD38

metabolizes NAD+/NADP

+, generating cADPR,

ADP-ribose and NAADP (Lee, 2006). These

products bind different receptors and channels (IP3

receptors IP3R, Ryanodine receptor RyR and

Transient receptor potential cation channel

subfamily M member 2 TRPM2) and are involved

in the regulation of intracellular Ca2+

and activation

of critical signaling pathways connected to the

control of cell metabolism, genomic stability,

apoptosis, cell signaling, inflammatory response

and stress tolerance (Guse, 2005).

Homology

The CD38 gene is conserved in human,

chimpanzee, dog, mouse, rat and chicken. Human

CD38 shares a 25-30% homology in amino acid

sequence to the Aplysia ADP ribosyl cyclase and it

is highly homologous to CD157 (BST-1),

originated by gene duplication (Ferrero and

Malavasi, 1997; Ferrero and Malavasi, 1999).

Mutations

Germinal

Not yet reported.

Implicated in

Chronic lymphocytic leukemia (CLL)

Disease

CLL is the most common adult leukemia in the

United States and Europe that results from the

accumulation of small B lymphocytes expressing

CD19/CD5/CD23 in blood, bone marrow, lymph

nodes and other lymphoid tissues (Chiorazzi and

Ferrarini, 2003). The latter districts represent

permissive niches where lymphocytes can

proliferate in response to microenvironmental

signals (Malavasi et al., 2011). The incidence rates

in men are nearly twice as high as women and it is

less common among people of African or Asian

origin. Advanced age and a family history of

leukemia and lymphoma are additional risk factors

(Dores, 2007).

Prognosis

CLL is currently categorized into prognostic groups

based on the clinical staging systems developed by

Rai and Binet (Rai et al., 1975; Binet et al., 1981).

The disease is heterogenous from the clinical point

of view with at least three group of patients.

Approximately one-third of CLL patients are

affected by an indolent form of disease that does

not require treatment. Another third of patients

presents with a leukemia that will require iterative

therapies, affecting their quality and length of life.

A small fraction of CLL patients will develop

Richter syndrome (RS), represented in most cases

by diffuse large B-cell lymphoma (DLBCL) arising

from the transformation of the original CLL clone.

RS is a highly aggressive syndrome with a median

overall survival of 5 to 8 months (Hallek et al.,

2008). Several molecular markers have been

identified with a prognostic significance to

distinguish among the different groups of patients.

The most credited molecular indicators are the

absence of mutations in the IgVH genes and the

expression of CD38 and Zap70 (Cramer and

Hallek, 2011).

Cytogenetics

CLL is associated with chromosomal deletions and

amplifications: the most frequent is trisomy of

chromosome 12 (+12; 16%) and deletion of

chromosomal regions 11q (18%), 17p (7%) and

13q14 (55%). The molecular consequences of

trisomy 12 are unknown, but probably related to an

elevated gene dosage of a proto-oncogene.

Del(11)(q22-q23) comprise ataxia teleangectasia

(ATM) gene, a gene related to genomic instability

and DNA-repair and associated with a

predisposition to lymphoid malignancies. The

inability to repair DNA-damage due to ATM-

deficiency contributes to CLL pathogenesis,

allowing accumulation of additional genetic

mutations during cellular proliferation. A similar

pathogenetic mechanism occurs in CLL with

del(17p13) that include the TP53 tumor suppressor

gene. The del(13q14) mono- or bi-allelic involves

two microRNAs, miR-15a and miR16-1, that can

be two potential candidate tumor suppressor genes,

even though their targets are still unknown (Klein

and Dalla-Favera, 2010; Zenz et al., 2010).

Oncogenesis

In CLL, elevated expression of CD38 is associated

with several adverse prognostic factors such as

advanced disease stage, higher incidence of

lymphadenopathy, high-risk cytogenetics, shorter

lymphocytes doubling time (LDT), shorter time to

initiation of first treatment (TFT) and poorer

response to therapy. Besides being a prognostic

marker, CD38 is a key element in the pathogenesis

of CLL, as a component of a molecular network

delivering growth and survival signals to CLL cells

(Deaglio et al., 2005). CD38 performs as a receptor

on leukemic cells following the binding to its ligand

CD31 and the signals are mediated by Zap70,

another negative prognosticator for the disease and

a limiting factor for the activation of the CD38-

mediated pathway (Deaglio et al., 2003; Deaglio et

al., 2007). CD38 can work in association with

chemokines and their receptors, mainly

CXCL12/CXCR4, influencing the migratory

responses and contributing to the recirculation of

neoplastic cells from blood to lymphoid organs

(Vaisitti et al., 2010) and with specific adhesion

molecules, belonging to the integrin family

(Zucchetto et al., 2009; Zucchetto et al., 2012). An

important role in the oncogenesis of CLL is likely

by the CD38 SNP (see above) that has been

recently described as an independent risk factor for



Richter syndrome (RS) transformation. The

frequency of the G allele is significantly higher in a

subset of CLL patients characterized by clinical and

molecular markers of poor prognosis, with the

highest allele frequency scored by patients with RS

(Aydin, 2008). The same G allele was

independently reported as a susceptibility factor for

CLL development in a Polish population

(Jamroziak et al., 2009). The presence of the rare G

allele is not correlated to a higher expression of

CD38 by CLL cells, but is responsible for the

ability to modulate CD38 expression in response to

environmental signals.

Multiple myeloma (MM)

Disease

Multiple myeloma is a malignancy of the immune

system characterized by accumulation of plasma

cells in the bone marrow (BM), by a high

concentration of monoclonal Ig in serum or urine

and lytic bone lesions arising from osteolytic

activity of plasma cell-activated osteoclasts. The

proliferation of plasma cells in MM may interfere

with the normal production of blood cells, resulting

in leukopenia, anemia and thrombocytopenia. The

aberrant antibodies that are produced lead to

impaired humoral immunity and patients have a

high prevalence of infection. It is diagnosed with

blood tests, microscopic examination of the bone

marrow (bone marrow biopsy) and radiographs of

commonly involved bones.

Prognosis

MM is characterized by neoplastic proliferation of

plasma cells involving more than 10% of the BM.

Increasing evidence suggests that the BM

microenvironment of tumor cells plays a pivotal

role in the pathogenesis of myeloma. MM is a

heterogenous disease, with survival ranging from 1

year to more than 10 years. The 5-year relative

survival rate is around 40%. Survival is higher in

younger people. The tumor burden (based on C-

reactive protein CRP and beta-2-microglobulin

β2m) and the proliferation rate are the two key

indicators for the prognosis in patients with MM

(Palumbo and Anderson, 2011).

Cytogenetics

MM is characterized by very complex cytogenetic

and molecular genetic aberrations. The

chromosome number is usually either hyperdiploid

with multiple trisomies or hypodiploid with one of

several types of immunoglobulin heavy chain (Ig)

translocations. The chromosome status and Ig

rearrangements are two genetic criteria to stratify

patients into a specific prognostic group. The

malignant cells of MM are the most mature cells of

the B lineage. B cell maturation is associated with a

programmed rearrangement of DNA sequence in

the process encoding the structure of mature

immunoglobulins. Indeed, MM is characterized by

over-production of monoclonal immunoglobulin G

(IgG), IgA and/or light chains. Rearrangements

involving the switch regions of immunoglobulin

heavy chain (IgH) gene at the 14q32 with various

partner genes (t(4;14), t(14;16), t(11;14)) represent

the most common structural abnormalities in MM.

Several chromosomal aberrations are acquired

during disease progression, involving MYC

rearrangements, chromosome 13 (del(13q)), 17

(del(17p)) and 1p deletions. These chromosomal

abnormalities are associated to specific oncogenes,

such as c-myc that develop early in the course of

plasma cell tumors, while changes in other

oncogenes such as N-ras and K-ras are more often

found in MM after BM relapse. Abnormalities are

also described for tumor suppressor genes such as

TP53, associated with spread to other organs.

(Sawyer, 2011).

Oncogenesis

CD38 is predominantly expressed by BM precursor

cells and terminally differentiated plasma cells.

MM cells show moderate to high expression levels

of CD38. The need for improved MM therapy has

stimulated the development of monoclonal

antibodies (mAbs) targeting either MM cells or

cells of the BM microenvironment. CD38 is one of

the candidates: recently, a human anti-CD38

(HuMax-CD38 or Daratunumab) antibody was

generated and preclinical studies indicated that it is

highly effective in killing primary CD38+CD138

+

patients MM cells and a range of MM/lymphoid

cell lines by both Antibody-dependent cellular

cytotoxicity (ADCC) and complement-dependent

cytotoxicity (CDC). Moreover, in a SCID mouse

animal model, this antibody inhibited CD38+ tumor

cell growth (Stevenson et al., 2006; de Weers et al.,

2011; Tai and Anderson, 2011). Another fully

human anti-CD38 mAb (MorphoSysAG) was

reported to efficiently trigger ADCC against CD38+

MM cell lines and patients MM cells in vitro as

well as in vivo in a xenograft mouse model

(Stevenson et al., 2006).

Acute myeloid leukemia (AML)

Disease

Acute myelogenous leukemia (AML) is a cancer of

the myeloid lineage, characterized by the rapid

growth of abnormal white blood cells that

accumulate in the bone marrow and interfere with

the production of normal blood cells (maturational

arrest of bone marrow cells in the earliest stages of

development due to the activation of abnormal

genes through chromosomal translocations and

other genetic abnormalities).

Prognosis

AML has several subtypes: 5-year survival rates

vary from 15% to 70% and relapse rates vary from

33 to 78% depending on subtype. The French-

American-British (FAB) classification system

divides AML into 8 subtypes, M0 through M7,

based on the type of cell from which the leukemia



developed and its degree of maturation

(morphology of the neoplastic cells and cytogenetic

analysis to characterize chromosomal

abnormalities). The M3 subtype, also known as

acute promyelocytic leukemia (APL), is caused by

an arrest of leukocyte differentiation at the

promyelocyte stage. Various clinical regimens

combining anthracyclines, retinoic acid (RA), that

induces APL differentiation, and arsenic trioxide,

that triggers apoptosis and differentiation, results in

a remission of 80-90% of patients (de Thé and

Chen, 2010; Kamimura et al., 2011).

Cytogenetics

Cytogenetics is the single most important

prognostic factor in AML. About 50% of AML

patients have a normal cytogenetics; certain

cytogenetic abnormalities are associated with good

outcomes (t(15;17) in acute promyelocytic

leukemia), while other cytogenetic abnormalities

are associated with a poor prognosis and a high risk

of relapse after treatment. APL is characterized by a

reciprocal translocation, t(15;17), that results in a

fusion oncogene, PML (promyelocytic leukemia)-

RARα (retinoic acid receptor α) with a consequent

block of the normal myeloid differentiation

program and increased self-renewal of leukemic

progenitors cells.

Oncogenesis

Retinoic acid (RA), the vitamin A derivative plays

a critical role during the differentiation of myeloid

progenitors towards the neutrophil lineage. This

role is primarily mediated by binding of RA to

RARalpha (RARα, a nuclear receptor that

modulates the expression of multiple downstream

targets via retinoic acid response elements.

Biochemical evidence suggests RARα performs

two opposing functions, one as a repressor of gene

expression in the absence of ligand, the second as a

transcriptional activator in the presence of ligand,

each controlled by multimeric complexes of

transcription corepressors and coactivators. The

fusion gene product PML-RARα causes the

chimeric receptor to bind more tightly to the

nuclear corepressor factor. Therefore, the gene

cannot be activated with physiologic doses of

retinoic acid. RA induces the differentiation of

leukemic cells into mature granulocytes and

complete remissions in a majority of patients with

APL. Although well tolerated, this therapeutic

regimen may be associated with a toxic side effect

known as retinoic acid syndrome (RAS),

characterized by fever, dyspnea, pulmonary edema

and infiltrates. The increased production of

inflammatory cytokines (IFN-γ and IL-1β) by

myeloid cells and an aberrant interaction between

maturating granulocytes and host tissues contribute

to RAS pathogenesis. Normal granulocytes do not

express CD38, while RA-treated APL/AML cells

express high amounts of this molecule (Drach et al.,

1994; Mehta and Cheema, 1999). The aberrant

expression of CD38 on leukemic cells enhances

their propensity to interact with CD31, expressed

by lung endothelial cells, resulting in a local

production of inflammatory cytokines, apoptosis of

endothelial cells and development of RAS (Gao et

al., 2007).

To be noted

Note

The human CD38 gene contains a well defined bi-

allelic polymorphism that can be identified by the

restriction endonuclease PvuII (PvuII site:

CAGCTG). The polymorphic site is located at the

5' end of the first intron of the CD38 gene and

marks a C→G variation at position 184. The gene

frequencies in the healthy population are 0,78 and

0,22 for the C and G allele respectively (CC 61%,

GC 33% and GG 6%). The analysis of this

polymorphism in a large cohort of CLL patients

indicate that the G allele is significantly associated

with molecular markers of unfavourable prognosis

and represents a significant risk factor for RS

transformation (Aydin et al., 2008). The correlation

between this polymorphism and genetic

susceptibility has been studied also for other

diseases, including Systemic Lupus Erythematosus

(SLE), where the CC genotype causes susceptibility

and the CG genotype confers protection for discoid

rash development (Gonzales-Escribano et al.,

2004). Recently, a role for CD38 in mediating

oxytocin (OT) release in the brain has been

described (Jin et al., 2007). Mice deficient in CD38

lack short term social memory, a defect that has

been associated to the autism spectrum disorders

(ASD) in humans. Several polymorphism across

CD38 gene (rs6449197, rs3796863 and rs1800561)

are associated with ASD (Lerer et al., 2010;

Munesue et al., 2010) and a correlation between

CD38 expression and measure of social function in

ASD observed (Riebold et al., 2011). Indeed, a

reduced expression of CD38 in lymphoblast from

ASD patients compared to parental lymphoblastoid

cell lines has been reported. Lower CD38

expression and consequently lower level of

activation of its enzymatic functions in ASD can be

linked to a dysfunction in OT transmission in this

disorder (Higashida et al., 2007; Salmina et al.,

2010; Higashida et al., 2010).

References Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood. 1975 Aug;46(2):219-34

Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, Vaugier G, Potron G, Colona P, Oberling F, Thomas M, Tchernia G, Jacquillat C, Boivin P, Lesty C, Duault MT, Monconduit M, Belabbes S, Gremy F. A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer. 1981 Jul 1;48(1):198-206



Drach J, McQueen T, Engel H, Andreeff M, Robertson KA, Collins SJ, Malavasi F, Mehta K. Retinoic acid-induced expression of CD38 antigen in myeloid cells is mediated through retinoic acid receptor-alpha. Cancer Res. 1994 Apr 1;54(7):1746-52

Di Noto R, Lo Pardo C, Schiavone EM, Ferrara F, Manzo C, Vacca C, Del Vecchio L. All-trans retinoic acid (ATRA) and the regulation of adhesion molecules in acute myeloid leukemia. Leuk Lymphoma. 1996 Apr;21(3-4):201-9

Umar S, Malavasi F, Mehta K. Post-translational modification of CD38 protein into a high molecular weight form alters its catalytic properties. J Biol Chem. 1996 Jul 5;271(27):15922-7

Ferrero E, Malavasi F. Human CD38, a leukocyte receptor and ectoenzyme, is a member of a novel eukaryotic gene family of nicotinamide adenine dinucleotide+-converting enzymes: extensive structural homology with the genes for murine bone marrow stromal cell antigen 1 and aplysian ADP-ribosyl cyclase. J Immunol. 1997 Oct 15;159(8):3858-65

Nata K, Takamura T, Karasawa T, Kumagai T, Hashioka W, Tohgo A, Yonekura H, Takasawa S, Nakamura S, Okamoto H. Human gene encoding CD38 (ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase): organization, nucleotide sequence and alternative splicing. Gene. 1997 Feb 28;186(2):285-92

Deaglio S, Morra M, Mallone R, Ausiello CM, Prager E, Garbarino G, Dianzani U, Stockinger H, Malavasi F. Human CD38 (ADP-ribosyl cyclase) is a counter-receptor of CD31, an Ig superfamily member. J Immunol. 1998 Jan 1;160(1):395-402

Mallone R, Ferrua S, Morra M, Zocchi E, Mehta K, Notarangelo LD, Malavasi F. Characterization of a CD38-like 78-kilodalton soluble protein released from B cell lines derived from patients with X-linked agammaglobulinemia. J Clin Invest. 1998 Jun 15;101(12):2821-30

Ferrero E, Malavasi F. The metamorphosis of a molecule: from soluble enzyme to the leukocyte receptor CD38. J Leukoc Biol. 1999 Feb;65(2):151-61

Ferrero E, Saccucci F, Malavasi F. The human CD38 gene: polymorphism, CpG island, and linkage to the CD157 (BST-1) gene. Immunogenetics. 1999 Jul;49(7-8):597-604

Mehta K, Cheema S. Retinoid-mediated signaling pathways in CD38 antigen expression in myeloid leukemia cells. Leuk Lymphoma. 1999 Feb;32(5-6):441-9

Munshi C, Aarhus R, Graeff R, Walseth TF, Levitt D, Lee HC. Identification of the enzymatic active site of CD38 by site-directed mutagenesis. J Biol Chem. 2000 Jul 14;275(28):21566-71

Chiorazzi N, Ferrarini M. B cell chronic lymphocytic leukemia: lessons learned from studies of the B cell antigen receptor. Annu Rev Immunol. 2003;21:841-94

Deaglio S, Capobianco A, Bergui L, Dürig J, Morabito F, Dührsen U, Malavasi F. CD38 is a signaling molecule in B-cell chronic lymphocytic leukemia cells. Blood. 2003 Sep 15;102(6):2146-55

González-Escribano MF, Aguilar F, Torres B, Sánchez-Román J, Núñez-Roldán A. CD38 polymorphisms in Spanish patients with systemic lupus erythematosus. Hum Immunol. 2004 Jun;65(6):660-4

Deaglio S, Vaisitti T, Bergui L, Bonello L, Horenstein AL, Tamagnone L, Boumsell L, Malavasi F. CD38 and CD100 lead a network of surface receptors relaying positive signals for B-CLL growth and survival. Blood. 2005 Apr 15;105(8):3042-50

Guse AH. Second messenger function and the structure-activity relationship of cyclic adenosine diphosphoribose (cADPR). FEBS J. 2005 Sep;272(18):4590-7

Liu Q, Kriksunov IA, Graeff R, Munshi C, Lee HC, Hao Q. Crystal structure of human CD38 extracellular domain. Structure. 2005 Sep;13(9):1331-9

Lee HC. Structure and enzymatic functions of human CD38. Mol Med. 2006 Nov-Dec;12(11-12):317-23

Stevenson GT. CD38 as a therapeutic target. Mol Med. 2006 Nov-Dec;12(11-12):345-6

Deaglio S, Vaisitti T, Aydin S, Bergui L, D'Arena G, Bonello L, Omedé P, Scatolini M, Jaksic O, Chiorino G, Efremov D, Malavasi F. CD38 and ZAP-70 are functionally linked and mark CLL cells with high migratory potential. Blood. 2007 Dec 1;110(12):4012-21

Dores GM, Anderson WF, Curtis RE, Landgren O, Ostroumova E, Bluhm EC, Rabkin CS, Devesa SS, Linet MS. Chronic lymphocytic leukaemia and small lymphocytic lymphoma: overview of the descriptive epidemiology. Br J Haematol. 2007 Dec;139(5):809-19

Gao Y, Camacho LH, Mehta K. Retinoic acid-induced CD38 antigen promotes leukemia cells attachment and interferon-gamma/interleukin-1beta-dependent apoptosis of endothelial cells: implications in the etiology of retinoic acid syndrome. Leuk Res. 2007 Apr;31(4):455-63

Higashida H, Salmina AB, Olovyannikova RY, Hashii M, Yokoyama S, Koizumi K, Jin D, Liu HX, Lopatina O, Amina S, Islam MS, Huang JJ, Noda M. Cyclic ADP-ribose as a universal calcium signal molecule in the nervous system. Neurochem Int. 2007 Jul-Sep;51(2-4):192-9

Jin D, Liu HX, Hirai H, Torashima T, Nagai T, Lopatina O, Shnayder NA, Yamada K, Noda M, Seike T, Fujita K, Takasawa S, Yokoyama S, Koizumi K, Shiraishi Y, Tanaka S, Hashii M, Yoshihara T, Higashida K, Islam MS, Yamada N, Hayashi K, Noguchi N, Kato I, Okamoto H, Matsushima A, Salmina A, Munesue T, Shimizu N, Mochida S, Asano M, Higashida H. CD38 is critical for social behaviour by regulating oxytocin secretion. Nature. 2007 Mar 1;446(7131):41-5

Aydin S, Rossi D, Bergui L, D'Arena G, Ferrero E, Bonello L, Omedé P, Novero D, Morabito F, Carbone A, Gaidano G, Malavasi F, Deaglio S. CD38 gene polymorphism and chronic lymphocytic leukemia: a role in transformation to Richter syndrome? Blood. 2008 Jun 15;111(12):5646-53

Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ. Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic Lymphocytic Leukemia updating the National Cancer Institute-Working Group 1996 guidelines. Blood. 2008 Jun 15;111(12):5446-56

Malavasi F, Deaglio S, Funaro A, Ferrero E, Horenstein AL, Ortolan E, Vaisitti T, Aydin S. Evolution and function of the ADP ribosyl cyclase/CD38 gene family in physiology and pathology. Physiol Rev. 2008 Jul;88(3):841-86

Jamroziak K, Szemraj Z, Grzybowska-Izydorczyk O, Szemraj J, Bieniasz M, Cebula B, Giannopoulos K, Balcerczak E, Jesionek-Kupnicka D, Kowal M, Kostyra A, Calbecka M, Wawrzyniak E, Mirowski M, Kordek R, Robak T. CD38 gene polymorphisms contribute to genetic susceptibility to B-cell chronic lymphocytic leukemia: evidence from two case-control studies in Polish Caucasians. Cancer Epidemiol Biomarkers Prev. 2009 Mar;18(3):945-53

Zucchetto A, Benedetti D, Tripodo C, Bomben R, Dal Bo M, Marconi D, Bossi F, Lorenzon D, Degan M, Rossi FM,



Rossi D, Bulian P, Franco V, Del Poeta G, Deaglio S, Gaidano G, Tedesco F, Malavasi F, Gattei V. CD38/CD31, the CCL3 and CCL4 chemokines, and CD49d/vascular cell adhesion molecule-1 are interchained by sequential events sustaining chronic lymphocytic leukemia cell survival. Cancer Res. 2009 May 1;69(9):4001-9

de Thé H, Chen Z. Acute promyelocytic leukaemia: novel insights into the mechanisms of cure. Nat Rev Cancer. 2010 Nov;10(11):775-83

Klein U, Dalla-Favera R. New insights into the pathogenesis of chronic lymphocytic leukemia. Semin Cancer Biol. 2010 Dec;20(6):377-83

Lerer E, Levi S, Israel S, Yaari M, Nemanov L, Mankuta D, Nurit Y, Ebstein RP. Low CD38 expression in lymphoblastoid cells and haplotypes are both associated with autism in a family-based study. Autism Res. 2010 Dec;3(6):293-302

Munesue T, Yokoyama S, Nakamura K, Anitha A, Yamada K, Hayashi K, Asaka T, Liu HX, Jin D, Koizumi K, Islam MS, Huang JJ, Ma WJ, Kim UH, Kim SJ, Park K, Kim D, Kikuchi M, Ono Y, Nakatani H, Suda S, Miyachi T, Hirai H, Salmina A, Pichugina YA, Soumarokov AA, Takei N, Mori N, Tsujii M, Sugiyama T, Yagi K, Yamagishi M, Sasaki T, Yamasue H, Kato N, Hashimoto R, Taniike M, Hayashi Y, Hamada J, Suzuki S, Ooi A, Noda M, Kamiyama Y, Kido MA, Lopatina O, Hashii M, Amina S, Malavasi F, Huang EJ, Zhang J, Shimizu N, Yoshikawa T, Matsushima A, Minabe Y, Higashida H. Two genetic variants of CD38 in subjects with autism spectrum disorder and controls. Neurosci Res. 2010 Jun;67(2):181-91

Salmina AB, Lopatina O, Ekimova MV, Mikhutkina SV, Higashida H. CD38/cyclic ADP-ribose system: a new player for oxytocin secretion and regulation of social behaviour. J Neuroendocrinol. 2010 May;22(5):380-92

Vaisitti T, Aydin S, Rossi D, Cottino F, Bergui L, D'Arena G, Bonello L, Horenstein AL, Brennan P, Pepper C, Gaidano G, Malavasi F, Deaglio S. CD38 increases CXCL12-mediated signals and homing of chronic lymphocytic leukemia cells. Leukemia. 2010 May;24(5):958-69

Zenz T, Mertens D, Küppers R, Döhner H, Stilgenbauer S. From pathogenesis to treatment of chronic lymphocytic leukaemia. Nat Rev Cancer. 2010 Jan;10(1):37-50

Cramer P, Hallek M. Prognostic factors in chronic lymphocytic leukemia-what do we need to know? Nat Rev Clin Oncol. 2011 Jan;8(1):38-47

de Weers M, Tai YT, van der Veer MS, Bakker JM, Vink T, Jacobs DC, Oomen LA, Peipp M, Valerius T, Slootstra JW, Mutis T, Bleeker WK, Anderson KC, Lokhorst HM, van de Winkel JG, Parren PW. Daratumumab, a novel therapeutic human CD38 monoclonal antibody, induces killing of multiple myeloma and other hematological tumors. J Immunol. 2011 Feb 1;186(3):1840-8

Kamimura T, Miyamoto T, Harada M, Akashi K. Advances in therapies for acute promyelocytic leukemia. Cancer Sci. 2011 Nov;102(11):1929-37

Malavasi F, Deaglio S, Damle R, Cutrona G, Ferrarini M, Chiorazzi N. CD38 and chronic lymphocytic leukemia: a decade later. Blood. 2011 Sep 29;118(13):3470-8

Palumbo A, Anderson K. Multiple myeloma. N Engl J Med. 2011 Mar 17;364(11):1046-60

Riebold M, Mankuta D, Lerer E, Israel S, Zhong S, Nemanov L, Monakhov MV, Levi S, Yirmiya N, Yaari M, Malavasi F, Ebstein RP. All-trans retinoic acid upregulates reduced CD38 transcription in lymphoblastoid cell lines from Autism spectrum disorder. Mol Med. 2011;17(7-8):799-806

Saborit-Villarroya I, Vaisitti T, Rossi D, D'Arena G, Gaidano G, Malavasi F, Deaglio S. E2A is a transcriptional regulator of CD38 expression in chronic lymphocytic leukemia. Leukemia. 2011 Mar;25(3):479-88

Sawyer JR. The prognostic significance of cytogenetics and molecular profiling in multiple myeloma. Cancer Genet. 2011 Jan;204(1):3-12

Tai YT, Anderson KC. Antibody-based therapies in multiple myeloma. Bone Marrow Res. 2011;2011:924058

Zucchetto A, Vaisitti T, Benedetti D, Tissino E, Bertagnolo V, Rossi D, Bomben R, Dal Bo M, Del Principe MI, Gorgone A, Pozzato G, Gaidano G, Del Poeta G, Malavasi F, Deaglio S, Gattei V. The CD49d/CD29 complex is physically and functionally associated with CD38 in B-cell chronic lymphocytic leukemia cells. Leukemia. 2012 Jun;26(6):1301-12


Deaglio S, Vaisitti T. CD38 (CD38 molecule). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):445-451.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1) Edward J Kelly, Vladimir Yarov-Yarovoy, Allan E Rettie

Department of Pharmaceutics, University of Washington, Seattle, USA (EJK), Department of

Physiology and Membrane Biology, Department of Biochemistry and Molecular Medicine, School of

Medicine, University of California, Davis, USA (VYY), Department of Medicinal Chemistry,

University of Washington, Seattle, USA (AER)


Online updated version : http://AtlasGeneticsOncology.org/Genes/CYP4B1ID40253ch1p33.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CYP4B1ID40253ch1p33.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: CYPIVB1, P-450HP

HGNC (Hugo): CYP4B1

Location: 1p33

DNA/RNA

Description

The CYP4B1 gene has 12 exons resulting in an

open reading frame of 1533 bp (isoform 1). The

CYP4B1 locus is depicted in figure 1 (NCBI).

Transcription

Two major transcripts are known to derive from

alternative splicing (NM_000779.3,

NM_001099772.1). Isoform 1 encodes a 511 amino

acid protein, while isoform 2 encodes a 512 amino

acid protein with a Ser206 insertion.

It should be noted that this is a complicated locus

with many other possibilities for alternative

splicing.

Pseudogene

No pseudogene is known for CYP4B1.

Figure 1. Localization of the CYP4B1 locus to chromosome 1p33 and sites (exons 5, 8 and 9) of polymorphic variants that describe the 7 allelic variants of CYP4B1 (see table 1 for details).

http://www.ncbi.nlm.nih.gov/nuccore/NG_007939.1

CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1)

Kelly EJ, et al.


Protein

Note

CYP4B1 belongs to the mammalian CYP4 enzyme

family that also includes CYP4A, 4F and the

recently discovered CYP 4V, 4X and 4Z sub-

families (Rettie and Kelly, 2008). P450 enzymes

usually function as monooxygenases in that they

incorporate one atom of molecular oxygen into their

substrates and reduce the other to water.

CYP4 enzymes typically catalyze fatty acid ω-

hydroxylase reactions.

Description

Structurally, P450 enzymes all share a similar fold

featuring a β-sheet rich N-terminus and an α-helix

rich C-terminus.

The hydrophobic N-terminus of eukaryotic P450s

functions as membrane anchor, whereas the C-

terminal region houses the cysteinyl heme (iron

protoporphyrin IX) cofactor that binds and activates

molecular oxygen.

Many CYP4 enzymes, including CYP4B1, possess

a unique post-translational modification at the heme

active center, wherein a conserved glutamate

residue in the core I-helix forms a covalent, ester

linkage at the C-5 methyl group of the heme

(Henne et al., 2001).

The function of the unusual modification has not

been established, although it may serve to rigidify

the enzyme's active site and modulate the substrate

selectivity of CYP4B1.

The CYP4B1 enzyme is highly conserved across

species - see figure 2 below that also highlights the

position of the cysteinyl ligand and the I-helix

glutamate.

Expression

CYP4B1 mRNA and/or protein are found typically

at the highest levels in lung and airway tissue.

Liver levels of the enzyme are usually much lower,

but inducible by phenobarbital.

Expression of the enzyme in mouse kidney is

regulated by androgens. CYP4B1 is highly

expressed in several cancer types, including colon,

adrenal gland, lung and gastric cancers.

Localisation

CYP4B1 is located in the ER membrane, although

one report suggests that the rat enzyme may be a

secreted protein in respiratory mucosa (Genter et

al., 2006).


Kelly EJ, et al.


Figure 2. Multiple sequence alignment of vertebrate CYP4B proteins. The covalently heme-linked glutamate residue is indicated in bold italics and the heme-coordinating cysteinyl ligand depicted in bold underline. The Pro>Ser substitution at position 427 in

human CYP4B1 is depicted in italics. Alignments determined using the ClustalW2 multiple sequence alignment program available online at EMBL-EBI.

http://www.ebi.ac.uk/Tools/msa/clustalw2/


Kelly EJ, et al.


Mutations

Note

Seven alleles (CYP4B1*1-*7) are listed at

http://www.cypalleles.ki.se/cyp4b1.htm and

summarized in table 1 below. The CYP4B1*1 allele

is described by a composition of the major alleles

shown in table 1. CYP4B1*2 contains the

haplotype of the 294 frameshift along with M331I,

R340C and R375C. CYP4B1*7 is the same

haplotype minus the R375C variant. CYP4B1*3/4/5

are described by the R173W, S322G and M331I

polymorphisms, respectively. CYP4B1*6 is

R173W in combination with V345I.

Nucleotide

Change,

cDNA

position

Protein

Coding

Sequence

Change

Heterozygosity1

517C>T R173W 0.28

881_882ΔAT 294

frameshift

(STOP)

0.34

964A>G S322G 0.02

993G>A M331I 0.40

1018C>T R340C 0.22

1033G>A V345I ND

1123C>T R375C 0.26

Table 1. CYP4B1 polymorphic variants including nucleotide changes and effect on protein coding sequences.

1 The

values for heterozygosity of the minor alleles are taken from NCBI. ND: not determined.

Recent exome sequencing has revealed

considerable additional polymorphism (>75 total

SNPs) in the human CYP4B1 gene (search at

Exome Variant Server).

Implicated in

Various cancers

Note

CYP4B1 mRNA and/or protein are highly

expressed in some cancer types. In particular

Imaoka et al. demonstrated increased CYP4B1 in

bladder tumor tissue at both the mRNA and protein

level (Imaoka et al., 2000). This finding is also

consistent with rodent studies demonstrating

localization of CYP4B1 in mouse and rat bladder

tissue (Imaoka et al., 1997; Imaoka et al., 2001).

However, Czerwinski et al. observed down

regulation of CYP4B1 mRNA in lung tumors

relative to normal lung (Czerwinski et al., 1994).

With breast cancer, there does not appear to be any

difference in expression of CYP4B1 when

comparing tumor tissue with surrounding healthy

tissue, but these studies did not use disease-free

subjects as a comparator (Iscan et al., 2001).

Relatively high expression of constitutive CYP4B1

mRNA has been found in human urothelial cells

(Roos et al., 2006). Peripheral blood mononuclear

cell CYP4B1 mRNA expression correlated with

human liver expression and therefore has been

suggested as a surrogate marker for hepatic

bioactivation of environmental pro-toxins

(Furukawa et al., 2004). An increased risk of

bladder cancer (OR of 1.03-2.95) has been reported

in Japanese patients carrying the CYP4B1*2 allele

(Sasaki et al., 2008). One potential explanation

could be that CYP4B1 is known to play a role in

aromatic amine bioactivation (Windmill et al.,

1997) and these compounds are known bladder

carcinogens and present in cooked meats (Jägerstad

and Skog, 2005) and cigarette smoke (Smith et al.,

1997), among other sources. However, no

association was found between lung cancer risk and

CYP4B1*1-*7 polymorphisms in Japanese (Tamaki

et al., 2011).

Angiogenesis

Note

Studies conducted in a rabbit model of corneal

wound healing have implicated that CYP4B1 may

play a role in production of inflammatory

eicosanoids and corneal neovascularization

(Mastyugin et al., 2001).

These observations are corroborated by findings in

mice, whereby heme oxygenase-I induction

attenuates corneal inflammation and is associated

with a lack of CYP4B1 induction (and eicosanoid

production) (Patil et al., 2008).

Conversely, retinoic acid (RA) has been shown to

increase CYP4B1 gene expression in ocular organ

cultures, resulting in increased metabolism of

arachidonic acid to 12-HETE and 12-HETrE

(Ashkar et al., 2004). These effects were shown to

be mediated, at least in part, by transcriptional

regulation of the rabbit CYP4B1 promoter, which

contains several RAR/RXR binding motifs (Ashkar

et al., 2004). While RA is typically associated with

corneal wound healing, the induction of CYP4B1

by RA suggests it may also have a pro-

inflammatory role in wound healing. This is

supported by the observation that systemic

treatment with 13-cis-retinoic acid (Accutane™) for

cystic acne is associated with conjunctivitis, eyelid

inflammation and keratitis, along with other ocular

effects (Lebowitz and Berson, 1988).

Further evidence that CYP4B1 is important in

ocular inflammation, eicosanoid production and

neovascularization is shown in a study by Seta et

al., using in vivo siRNA targeting of CYP4B1 in a

rabbit model of corneal wound healing.

It was found that down-regulation of CYP4B1

inhibited production of 12- HETrE and VEGF in

addition to decreasing neovascularization (Seta et

al., 2007).

http://www.cypalleles.ki.se/cyp4b1.htm

http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp

http://snp.gs.washington.edu/EVS/


Kelly EJ, et al.


Colitis

Note

Several recent studies have implicated a potential

role for CYP4B1 in inflammatory bowel disease

(IBD). In a mouse model of dextran sodium sulfate

(DSS)-induced colitis, Ye et al. found that caffeic

acid treatment decreased disease severity and this

was associated with increased expression of

Cyp4b1 in affected tissues (Ye et al., 2009). In a

subsequent study looking at the role of caffeic acid

bioavailability in this model, they found that mice

treated with DSS alone had lower colonic Cyp4b1

expression when compared to DSS plus caffeic acid

treated mice (Ye et al., 2011). In a different mouse

model of IBD, Liu et al. also found evidence that

Cyp4b1 gene expression is altered in this disease

state (Liu et al., 2009). It was found that IBD

induced by infection with Helicobacter bilis

resulted in changes in mucosal gene expression

patterns. Using microarray analysis, it was found

that H. bilis infection resulted in decreased

expression of Cyp4b1. These authors also examined

mice with IBD induced by DSS and, akin to Liu et

al., found decreased expression of Cyp4b1 in

diseased tissue. These findings suggest an anti-

inflammatory role for CYP4B1 in IBD, but these

preclinical studies must be weighed against what is

known about gastrointestinal expression of

CYP4B1 and human IBD. While rodents and

rabbits and other species are known to expression

CYP4B1 in the gut, there are species-specific

differences, with humans expressing little CYP4B1

in this tissue (McKinnon et al., 1994). Whether the

CYP4B1 gene plays any role in IBD is unclear,

particularly in light of the functionality of the

Pro427Ser human protein (Zheng et al., 1998).

Finally, in considering risk of developing IBD, a

genome wide association study by The Wellcome

Trust examining 2000 cases of Crohn's with 3000

controls, found no significant association between

CYP4B1 genetic variants and disease incidence

(Wellcome Trust Case Control Consortium, 2007).

References Lebowitz MA, Berson DS. Ocular effects of oral retinoids. J Am Acad Dermatol. 1988 Jul;19(1 Pt 2):209-11

Czerwinski M, McLemore TL, Gelboin HV, Gonzalez FJ. Quantification of CYP2B7, CYP4B1, and CYPOR messenger RNAs in normal human lung and lung tumors. Cancer Res. 1994 Feb 15;54(4):1085-91

McKinnon RA, Burgess WM, Gonzalez FJ, Gasser R, McManus ME. Species-specific expression of CYP4B1 in rabbit and human gastrointestinal tissues. Pharmacogenetics. 1994 Oct;4(5):260-70

Imaoka S, Yoneda Y, Matsuda T, Degawa M, Fukushima S, Funae Y. Mutagenic activation of urinary bladder carcinogens by CYP4B1 and the presence of CYP4B1 in bladder mucosa. Biochem Pharmacol. 1997 Sep 15;54(6):677-83

Smith CJ, Livingston SD, Doolittle DJ. An international literature survey of "IARC Group I carcinogens" reported in

mainstream cigarette smoke. Food Chem Toxicol. 1997 Oct-Nov;35(10-11):1107-30

Windmill KF, McKinnon RA, Zhu X, Gaedigk A, Grant DM, McManus ME. The role of xenobiotic metabolizing enzymes in arylamine toxicity and carcinogenesis: functional and localization studies. Mutat Res. 1997 May 12;376(1-2):153-60

Rainov NG, Dobberstein KU, Sena-Esteves M, Herrlinger U, Kramm CM, Philpot RM, Hilton J, Chiocca EA, Breakefield XO. New prodrug activation gene therapy for cancer using cytochrome P450 4B1 and 2-aminoanthracene/4-ipomeanol. Hum Gene Ther. 1998 Jun 10;9(9):1261-73

Zheng YM, Fisher MB, Yokotani N, Fujii-Kuriyama Y, Rettie AE. Identification of a meander region proline residue critical for heme binding to cytochrome P450: implications for the catalytic function of human CYP4B1. Biochemistry. 1998 Sep 15;37(37):12847-51

Imaoka S, Yoneda Y, Sugimoto T, Hiroi T, Yamamoto K, Nakatani T, Funae Y. CYP4B1 is a possible risk factor for bladder cancer in humans. Biochem Biophys Res Commun. 2000 Nov 2;277(3):776-80

Henne KR, Kunze KL, Zheng YM, Christmas P, Soberman RJ, Rettie AE. Covalent linkage of prosthetic heme to CYP4 family P450 enzymes. Biochemistry. 2001 Oct 30;40(43):12925-31

Imaoka S, Yoneda Y, Sugimoto T, Ikemoto S, Hiroi T, Yamamoto K, Nakatani T, Funae Y. Androgen regulation of CYP4B1 responsible for mutagenic activation of bladder carcinogens in the rat bladder: detection of CYP4B1 mRNA by competitive reverse transcription-polymerase chain reaction. Cancer Lett. 2001 May 26;166(2):119-23

Iscan M, Klaavuniemi T, Coban T, Kapucuoglu N, Pelkonen O, Raunio H. The expression of cytochrome P450 enzymes in human breast tumours and normal breast tissue. Breast Cancer Res Treat. 2001 Nov;70(1):47-54

Mastyugin V, Mosaed S, Bonazzi A, Dunn MW, Schwartzman ML. Corneal epithelial VEGF and cytochrome P450 4B1 expression in a rabbit model of closed eye contact lens wear. Curr Eye Res. 2001 Jul;23(1):1-10

Ashkar S, Mesentsev A, Zhang WX, Mastyugin V, Dunn MW, Laniado-Schwartzman M. Retinoic acid induces corneal epithelial CYP4B1 gene expression and stimulates the synthesis of inflammatory 12-hydroxyeicosanoids. J Ocul Pharmacol Ther. 2004 Feb;20(1):65-74

Furukawa M, Nishimura M, Ogino D, Chiba R, Ikai I, Ueda N, Naito S, Kuribayashi S, Moustafa MA, Uchida T, Sawada H, Kamataki T, Funae Y, Fukumoto M. Cytochrome p450 gene expression levels in peripheral blood mononuclear cells in comparison with the liver. Cancer Sci. 2004 Jun;95(6):520-9

Jägerstad M, Skog K. Genotoxicity of heat-processed foods. Mutat Res. 2005 Jul 1;574(1-2):156-72

Genter MB, Yost GS, Rettie AE. Localization of CYP4B1 in the rat nasal cavity and analysis of CYPs as secreted proteins. J Biochem Mol Toxicol. 2006;20(3):139-41

Roos PH, Belik R, Föllmann W, Degen GH, Knopf HJ, Bolt HM, Golka K. Expression of cytochrome P450 enzymes CYP1A1, CYP1B1, CYP2E1 and CYP4B1 in cultured transitional cells from specimens of the human urinary tract and from urinary sediments. Arch Toxicol. 2006 Jan;80(1):45-52

Sansen S, Yano JK, Reynald RL, Schoch GA, Griffin KJ, Stout CD, Johnson EF. Adaptations for the oxidation of


Kelly EJ, et al.


polycyclic aromatic hydrocarbons exhibited by the structure of human P450 1A2. J Biol Chem. 2007 May 11;282(19):14348-55

Seta F, Patil K, Bellner L, Mezentsev A, Kemp R, Dunn MW, Schwartzman ML. Inhibition of VEGF expression and corneal neovascularization by siRNA targeting cytochrome P450 4B1. Prostaglandins Other Lipid Mediat. 2007 Nov;84(3-4):116-27

. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature. 2007 Jun 7;447(7145):661-78

Patil K, Bellner L, Cullaro G, Gotlinger KH, Dunn MW, Schwartzman ML. Heme oxygenase-1 induction attenuates corneal inflammation and accelerates wound healing after epithelial injury. Invest Ophthalmol Vis Sci. 2008 Aug;49(8):3379-86

Rettie A E, Kelly EJ.. The CYP4 Family Issues in Toxicology. Cytochome P450: Role in the metabolism and toxicity of drugs and other xenobiotics; Ioannides C. Ed, Royal Society of Chemistry, London, 2008.

Sasaki T, Horikawa M, Orikasa K, Sato M, Arai Y, Mitachi Y, Mizugaki M, Ishikawa M, Hiratsuka M.. Possible relationship between the risk of Japanese bladder cancer cases and the CYP4B1 genotype. Jpn J Clin Oncol. 2008 Sep;38(9):634-40. Epub 2008 Aug 19.

Liu Z, Henderson AL, Nettleton D, Wilson-Welder JH, Hostetter JM, Ramer-Tait A, Jergens AE, Wannemuehler

MJ.. Mucosal gene expression profiles following the colonization of immunocompetent defined-flora C3H mice with Helicobacter bilis: a prelude to typhlocolitis. Microbes Infect. 2009 Mar;11(3):374-83. Epub 2009 Jan 14.

Ye Z, Liu Z, Henderson A, Lee K, Hostetter J, Wannemuehler M, Hendrich S.. Increased CYP4B1 mRNA is associated with the inhibition of dextran sulfate sodium-induced colitis by caffeic acid in mice. Exp Biol Med (Maywood). 2009 Jun;234(6):605-16. Epub 2009 Mar 23.

Tamaki Y, Arai T, Sugimura H, Sasaki T, Honda M, Muroi Y, Matsubara Y, Kanno S, Ishikawa M, Hirasawa N, Hiratsuka M.. Association between cancer risk and drug-metabolizing enzyme gene (CYP2A6, CYP2A13, CYP4B1, SULT1A1, GSTM1, and GSTT1) polymorphisms in cases of lung cancer in Japan. Drug Metab Pharmacokinet. 2011;26(5):516-22. Epub 2011 Jul 26.

Ye Z, Hong CO, Lee K, Hostetter J, Wannemuehler M, Hendrich S.. Plasma caffeic acid is associated with statistical clustering of the anticolitic efficacy of caffeic acid in dextran sulfate sodium-treated mice. J Nutr. 2011 Nov;141(11):1989-95. Epub 2011 Sep 14.


Kelly EJ, Yarov-Yarovoy V, Rettie AE. CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):452-457.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Chon-Hwa Tsai-Morris, Maria L Dufau

Section on Molecular Endocrinology, Program in Developmental Endocrinology and Genetics,

NICHD, National Institutes of Health, Bethesda, MD 20892-4510, USA (CHTM, MLD)


Online updated version : http://AtlasGeneticsOncology.org/Genes/DDX25ID46826ch11q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI DDX25ID46826ch11q24.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: GRTH

HGNC (Hugo): DDX25

Location: 11q24.2

Note

Gonadotropin Regulated Testicular RNA Helicase

(GRTH), a member of the Glu-Asp-Ala-Glu

(DEAD)-box protein family, is a testis-specific

gonadotropin/androgen-regulated RNA Helicase.

DNA/RNA

Description

Human GRTH gene contains 12 exons and all but

one of its conserved helicase motifs are contained

within single exon (Tsai-Morris et al., 2004). Motif

ARG-D resides in exon 10/11.

Transcription

The GRTH gene belongs to the TATA-less/non-

initiator class (Tsai-Morris et al., 2004). A single

transcript of 1,6 Kb is expressed in the testis (Tang

et al., 1999). Gonadotropin-induced androgen

increases cause autocrine stimulation of GRTH

gene transcription in Leydig cells through a non-

classical half-site element residing at -827/-822 5'

from the initiation codon (Tang et al., 1999; Tsai-

Morris et al., 2010; Villar et al., 2012). The

induction of the GRTH gene expression in germ

cells (meiotic spermatocytes, round and elongated

spermatids) presumbably results from paracrine

actions of androgen through cognate receptors in

Sertoli cells (adjacent to germinal cells).

Pseudogene

One related pseudo DDX25 (LOC100421309) was

found in chromosome 5.

Genomic organization of the Human GRTH gene. Exons presented by boxes. The positions of the translation initiation ATG and termination TGA codon are indicated. Conserved domains of DEAD-box family of the RNA helicase are presented above its

respective exon.

DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Tsai-Morris CH, Dufau ML


Protein

Description

GRTH contains three ATG in frame codons with

the potential for generation of multiple protein

species (61/56, 48/43 and 33 kDa) (Sheng et al.,

2003). The 61/56 kDa proteins are the major

species observed in the human testis (Tang et al.,

1999; Tsai-Morris et al., 2007).

GRTH 56- and 61-kDa species are present in

nucleus and cytoplasm (Sheng et al., 2006),

respectively.

Based on the mouse model, the 56 kDa nuclear

species interacts with CRM1 and participates in

mRNA transport in the human testis and the

phosphorylated 61 kDa species associates with

mRNAs at polysomal sites and also within the

Chromatoid Body of round spermatids.

Expression

GRTH (484 aa) is highly expressed in the testis:

somatic (Leydig cells) and germinal (meiotic

spermatocytes, round spermatids and elongated

spermatids) cells (Sheng et al., 2003; Tsai-Morris,

et al., 2004).

GRTH is genetically close to DBP5/DDX19b (63%

overall aa homology) involved in mRNA export

(Schmitt et al., 1999).

Localisation

GRTH is localized in the nucleus and at

cytoplasmic sites in polyribosomes and the

Chromatoid Body (CB) of round spermatids (Tsai-

Morris et al., 2004; Sheng et al., 2006; Sato et al.,

2010; Tsai-Morris et al., 2012).

Model of GRTH action in male germ cells during development (derived from mouse studies). 56 kDa GRTH species enters the nucleus (1), where it binds messages and associates with CRM1 (2) as mRNP complex to export messages through nuclear pores via the CRM1 pathway to the cytoplasm (3a) and to the chromatoid body (CB), either directly (via nuclear pores

adjacent to or associated with the CB) (3b) or indirectly via the cytoplasmic route (4b). It is phosphorylated at cytoplasmic sites, and participates in translation at polyribosomes (4a). In the CB, messages are potentially regulated via si/mi/pi RNA pathway (5a

and b). Stored messages are subsequently translated in polyribosomes (4a and 6) at specific times during spermatogenesis.



GRTH is essential for spermatid development and completion of spermatogenesis (derived from studies of GRTH-/-

mouse model). Top panel: Diagram of spermatogenic progression. Representative germ cells during spermatogenesis are

shown in the diagram above. Cells expressing GRTH are boxed in red. The regulation of gene expression during the developmental process is governed in a precise temporal sequence. Lower panel: I. GRTH dependent expression of proteins. II.

Schematic germ-cell development. Unlike the wild type (WT) showing progression to mature sperm, germ cells of GRTH knockout mice fail to elongate at step 8 of round spermatids (RS).

Function

GRTH is a multifunctional protein essential for

completion of spermatogenesis as a post-

transcriptional regulator of relevant genes during

germ cells development (Tsai-Morris et al., 2004;

Sheng et al., 2006; Dufau and Tsai-Morris, 2007;

Tsai-Morris et al., 2010). It contains ATPase

activity (ATP/Mg dependent), and is a bi-

directional RNA helicase. As a translational

regulator it participates in the in vitro and in vivo

translation of RNA templates. GRTH is a shuttling

protein that exports germ cell specific RNA as

mRNP particles from nucleus to cytoplasm via the

CRM1-dependent pathway. A specific set of

testicular gene transcripts, including those of

chromatin-remodeling proteins (Tp1 and Tp2, Prm1

and PRM2), cytoskeletal structural proteins

(Fsc1/Odf1) and tACE are associated with GRTH

protein. GRTH also selectively binds mRNAs of

pro-apoptotic and anti-apoptotic genes, the death

receptor and proteins involved in the NF-kB

pathways to mediate anti-apoptotic regulation

(Gutti et al., 2008). GRTH is required to maintain

the structural integrity of the chromatoid body

(storage/processing organelle of mRNAs that

contains members of the small miRNA RISC-

complex) during spermatogenesis (Sato et al.,

2010). GRTH also participates in the regulation of

microRNA biogenesis in germ cells (Dai et al.,

2011) and associates with polyribosome for

translational initiation of target genes. In Leydig

cells, GRTH prevents overstimulation of

gonadotropin-induced androgen pathway by

promoting degradation of StAR protein (Fukushima

et al., 2011).

Implicated in

Azoospermia

Note

A missense mutation (R242H) in exon 8 identified

in 5% of an infertile Japanese patient population

with non-obstructive azoospermia (NOA) abrogated

the generation of the 61 kDa phosphorylated-GRTH

species (Tsai-Morris et al., 2007; Tsai-Morris et al.,

2008). A silent mutation located in exon 10

(C1194T, nt) identified in Chinese patients with

idiopathic azoospermia was proposed to increase

the risk of impaired spermatogenesis (Zhoucun et

al., 2006). This could result from its location in the

binding motif of splicing factor 2 through affecting

pre-RNA splicing of the GRTH gene and ultimately

its expression. However, such mutation was not

observed in the infertile Japanese patients with non-

obstructive azoospermia (Tsai-Morris et al., 2008),

which indicated segregration of the mutation to the

Chinese population.

References Schmitt C, von Kobbe C, Bachi A, Panté N, Rodrigues JP, Boscheron C, Rigaut G, Wilm M, Séraphin B, Carmo-Fonseca M, Izaurralde E. Dbp5, a DEAD-box protein



required for mRNA export, is recruited to the cytoplasmic fibrils of nuclear pore complex via a conserved interaction with CAN/Nup159p. EMBO J. 1999 Aug 2;18(15):4332-47

Tang PZ, Tsai-Morris CH, Dufau ML. A novel gonadotropin-regulated testicular RNA helicase. A new member of the dead-box family. J Biol Chem. 1999 Dec 31;274(53):37932-40

Dufau ML, Tsai-Morris C, Tang P, Khanum A. Regulation of steroidogenic enzymes and a novel testicular RNA helicase. J Steroid Biochem Mol Biol. 2001 Jan-Mar;76(1-5):187-97

Sheng Y, Tsai-Morris CH, Dufau ML. Cell-specific and hormone-regulated expression of gonadotropin-regulated testicular RNA helicase gene (GRTH/Ddx25) resulting from alternative utilization of translation initiation codons in the rat testis. J Biol Chem. 2003 Jul 25;278(30):27796-803

Tsai-Morris CH, Lei S, Jiang Q, Sheng Y, Dufau ML. Genomic organization and transcriptional analysis of gonadotropin-regulated testicular RNA helicase--GRTH/DDX25 gene. Gene. 2004 Apr 28;331:83-94

Tsai-Morris CH, Sheng Y, Lee E, Lei KJ, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is essential for spermatid development and completion of spermatogenesis. Proc Natl Acad Sci U S A. 2004 Apr 27;101(17):6373-8

A Z, Zhang S, Yang Y, Ma Y, Lin L, Zhang W. Single nucleotide polymorphisms of the gonadotrophin-regulated testicular helicase (GRTH) gene may be associated with the human spermatogenesis impairment. Hum Reprod. 2006 Mar;21(3):755-9

Sheng Y, Tsai-Morris CH, Gutti R, Maeda Y, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is a transport protein involved in gene-specific mRNA export and protein translation during spermatogenesis. J Biol Chem. 2006 Nov 17;281(46):35048-56

Dufau ML, Tsai-Morris CH. Gonadotropin-regulated testicular helicase (GRTH/DDX25): an essential regulator of spermatogenesis. Trends Endocrinol Metab. 2007 Oct;18(8):314-20

Tsai-Morris CH, Koh E, Sheng Y, Maeda Y, Gutti R, Namiki M, Dufau ML. Polymorphism of the GRTH/DDX25 gene in normal and infertile Japanese men: a missense mutation associated with loss of GRTH phosphorylation. Mol Hum Reprod. 2007 Dec;13(12):887-92

Gutti RK, Tsai-Morris CH, Dufau ML. Gonadotropin-regulated testicular helicase (DDX25), an essential regulator of spermatogenesis, prevents testicular germ cell apoptosis. J Biol Chem. 2008 Jun 20;283(25):17055-64

Tsai-Morris CH, Koh E, Dufau ML. Differences in gonadotropin-regulated testicular helicase (GRTH/DDX25) single nucleotide polymorphism between Japanese and Chinese populations. Hum Reprod. 2008 Nov;23(11):2611-3

Sato H, Tsai-Morris CH, Dufau ML. Relevance of gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) in the structural integrity of the chromatoid body during spermatogenesis. Biochim Biophys Acta. 2010 May;1803(5):534-43

Tsai-Morris CH, Sheng Y, Gutti R, Li J, Pickel J, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) gene: cell-specific expression and transcriptional regulation by androgen in transgenic mouse testis. J Cell Biochem. 2010 Apr 15;109(6):1142-7

Tsai-Morris CH, Sheng Y, Gutti RK, Tang PZ, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25): a multifunctional protein essential for spermatogenesis. J Androl. 2010 Jan-Feb;31(1):45-52

Dai L, Tsai-Morris CH, Sato H, Villar J, Kang JH, Zhang J, Dufau ML. Testis-specific miRNA-469 up-regulated in gonadotropin-regulated testicular RNA helicase (GRTH/DDX25)-null mice silences transition protein 2 and protamine 2 messages at sites within coding region: implications of its role in germ cell development. J Biol Chem. 2011 Dec 30;286(52):44306-18

Dufau ML, Sato H, Gutti R, Tsai-Morris CH. Gonadotropin-regulated testicular helicase (GRTH/DDX25): a master post-transcriptional regulator of spermatogenesis. Adv Exp Med Biol. 2011;707:23-9

Fukushima M, Villar J, Tsai-Morris CH, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25), a negative regulator of luteinizing/chorionic gonadotropin hormone-induced steroidogenesis in Leydig cells: central role of steroidogenic acute regulatory protein (StAR). J Biol Chem. 2011 Aug 26;286(34):29932-40

Tsai-Morris CH, Sato H, Gutti R, Dufau ML. Role of gonadotropin regulated testicular RNA helicase (GRTH/Ddx25) on polysomal associated mRNAs in mouse testis. PLoS One. 2012;7(3):e32470

Villar J, Tsai-Morris CH, Dai L, Dufau ML. Androgen-induced activation of gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) transcription: essential role of a nonclassical androgen response element half-site. Mol Cell Biol. 2012 Apr;32(8):1566-80


Tsai-Morris CH, Dufau ML. DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):458-461.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


EPHB6 (EPH receptor B6) Lokesh Bhushan, Raj P Kandpal

Department of Basic Medical Sciences, Western University of Health Sciences, Pomona, CA 91766,

USA (LB, RPK)


Online updated version : http://AtlasGeneticsOncology.org/Genes/EPHB6ID40471ch7q34.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI EPHB6ID40471ch7q34.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: HEP, MGC129910, MGC129911

HGNC (Hugo): EPHB6

Location: 7q34

DNA/RNA

Note

EphB6 is located on chromosome 7q33-q35.

Description

Size: 16056 bases.

Orientation: plus strand.

Transcription

EphB6 mRNA size is 4044 bp.

Pseudogene

Not reported.

The chromosomal location of EPHB6 is indicated at interval q33-q35. Adapted from GeneCards.

Schematic representation of various domains in EphB6 protein.

http://www.genecards.org/cgi-bin/carddisp.pl?gene=EPHB6

EPHB6 (EPH receptor B6) Bhushan L, Kandpal RP


Protein

Note

The crystal structure of EphB6 has not yet been

determined. However, based on amino acid

sequence and domain arrangement it is classified as

a type I transmembrane protein.

It has a highly conserved N-terminal domain in the

extracellular region that is involved in ligand

recognition and binding (Labrador et al., 1997). The

N-terminal domain is followed by a cysteine rich

region and two fibronectin type-III repeats. These

repeats are involved in mediating protein-protein

interactions and receptor dimerization (Lackmann

et al., 1998).

The intracellular region contains a juxtamembrane

domain, a conserved kinase domain, a sterile α-

motif (SAM) domain and a PSD95/Dlg/ZO1 (PDZ)

domain (Kalo and Pasquale, 1999).

Description

Eph (erythropoietin producing hepatocellular

carcinoma) receptors belong to a family of receptor

tyrosine kinases, which are activated by binding to

ephrin ligands.

These receptors are involved in a diverse array of

signal transduction processes in humans.

Such diversity of signaling and the resulting

functional output is partly attributed to differential

expression and interactions among these receptors.

Based on sequence homology and affinity for

ephrin ligands, Eph receptors are classified into A

and B groups. EphB6 is a kinase-deficient receptor

(Gurniak and Berg, 1996) that has been shown to

interact with two kinase-active receptors, namely,

EphB2 and EphA2 (Fox and Kandpal, 2011).

Ephrin B2 has been reported as a ligand for this

receptor (Munthe et al., 2000).

The loss of EphB6 expression in breast carcinoma

cell lines has been correlated to their invasiveness

(Fox and Kandpal, 2004; Fox and Kandpal, 2006),

and its role as a tumor suppressor has also been

reported (Fox and Kandpal, 2009; Yu et al., 2010).

Expression

Eph receptors are expressed in a wide variety of

tissues and cells (Andres et al., 1994; Fox et al.,

1995; Ciossek et al., 1995; Lickliter et al., 1996;

Muñoz et al., 2002). In addition to other tissues and

cells, EphB6 receptor expression has been shown in

breast, prostate, thymus, mature T-cells and

leukemia cells (Shimoyama et al., 2000; Luo et al.,

2001; Luo et al., 2002; Fox and Kandpal, 2004; Fox

et al., 2006). EphB6 deficient mice develop

normally and do not display any abnormality in

their general appearance (Shimoyama et al., 2002).

Localisation

Cellular. EphB6 is a transmembrane protein.

Function

A variety of Eph receptors and their ligands are

involved in regulating cell pattern formation during

organogenesis (Xu and Wilkinson, 1997; Flanagan

and Vanderhaeghen, 1998; Holmberg et al., 2000;

Leighton et al., 2001; Kullander et al., 2001; Gerlai,

2001). EphB6 has been shown to facilitate T-cell

activation (Luo et al., 2002). Metastasis/invasion

suppressor role of EphB6 in non-small cell lung

carcinoma and breast carcinoma (Müller-Tidow et

al., 2005; Fox and Kandpal, 2009) suggests its

involvement in cell adhesion and migration.

Homology

Amino acid homology between EphB6 and other

EphB family members varies between 47% and

60%. Mouse and human homologs of EphB6 share

greater than 90% amino acid identity (Gurniak and

Berg, 1996; Matsuoka et al., 1997). The kinase

domain in EphB6 is mutated.

Implicated in

Non-small cell lung cancer

Note

Altered levels and loss of EphB6 expression have

been found in non-small cell lung carcinoma (Tang

et al., 1999a; Müller-Tidow et al., 2005; Yu et al.,

2010).

Breast cancer

Note

EphB6 silencing has been observed in breast

carcinoma cell lines and some tumors (Fox and

Kandpal, 2004; Fox and Kandpal, 2006; Fox and

Kandpal, 2009; Truitt et al., 2010). Molecular

profiling of breast carcinoma cells with or without

EphB6 expression has revealed significant changes

in proteins as well as miRNAs (Kandpal, 2010;

Bhushan and Kandpal, 2011). However, elevated

levels of EphB6 have also been reported in breast

tumor specimens (Brantley-Sieders et al., 2011).

Melanoma

Note

The progression of melanoma to metastasis has

been correlated to progressive decrease of EphB6

expression (Hafner et al., 2003).

Neuroblastoma

Note

The levels of EphB6 have been characterized as

prognostic indicators in neuroblastoma (Tang et al.,

1999b; Tang et al., 2000).

Leukemia and T-cell development

Note

EphB6 expression has been implicated in T-cell

development, and altered levels of this protein have



been observed in leukemia and lymphoma cells

(Shimoyama et al., 2000).

Colorectal and colon cancer

Note

In familial colorectal cancer EphB6 gene shows two

missense mutations in germline. These two

mutations include change of alanine to proline at

position 321 (A321P) and glycine to valine

(G914V) at position 914 (Gylfe et al., 2010).

Deletions of EphB6 gene locus have also been

reported in colon cancer (Ashktorab et al., 2010).

References Andres AC, Reid HH, Zürcher G, Blaschke RJ, Albrecht D, Ziemiecki A. Expression of two novel eph-related receptor protein tyrosine kinases in mammary gland development and carcinogenesis. Oncogene. 1994 May;9(5):1461-7

Ciossek T, Lerch MM, Ullrich A. Cloning, characterization, and differential expression of MDK2 and MDK5, two novel receptor tyrosine kinases of the eck/eph family. Oncogene. 1995 Nov 16;11(10):2085-95

Fox GM, Holst PL, Chute HT, Lindberg RA, Janssen AM, Basu R, Welcher AA. cDNA cloning and tissue distribution of five human EPH-like receptor protein-tyrosine kinases. Oncogene. 1995 Mar 2;10(5):897-905

Gurniak CB, Berg LJ. A new member of the Eph family of receptors that lacks protein tyrosine kinase activity. Oncogene. 1996 Aug 15;13(4):777-86

Lickliter JD, Smith FM, Olsson JE, Mackwell KL, Boyd AW. Embryonic stem cells express multiple Eph-subfamily receptor tyrosine kinases. Proc Natl Acad Sci U S A. 1996 Jan 9;93(1):145-50

Labrador JP, Brambilla R, Klein R. The N-terminal globular domain of Eph receptors is sufficient for ligand binding and receptor signaling. EMBO J. 1997 Jul 1;16(13):3889-97

Matsuoka H, Iwata N, Ito M, Shimoyama M, Nagata A, Chihara K, Takai S, Matsui T. Expression of a kinase-defective Eph-like receptor in the normal human brain. Biochem Biophys Res Commun. 1997 Jun 27;235(3):487-92

Xu Q, Wilkinson DG. Eph-related receptors and their ligands: mediators of contact dependent cell interactions. J Mol Med (Berl). 1997 Aug;75(8):576-86

Flanagan JG, Vanderhaeghen P. The ephrins and Eph receptors in neural development. Annu Rev Neurosci. 1998;21:309-45

Lackmann M, Oates AC, Dottori M, Smith FM, Do C, Power M, Kravets L, Boyd AW. Distinct subdomains of the EphA3 receptor mediate ligand binding and receptor dimerization. J Biol Chem. 1998 Aug 7;273(32):20228-37

Kalo MS, Pasquale EB. Signal transfer by Eph receptors. Cell Tissue Res. 1999 Oct;298(1):1-9

Tang XX, Brodeur GM, Campling BG, Ikegaki N. Coexpression of transcripts encoding EPHB receptor protein tyrosine kinases and their ephrin-B ligands in human small cell lung carcinoma. Clin Cancer Res. 1999a Feb;5(2):455-60

Tang XX, Evans AE, Zhao H, Cnaan A, London W, Cohn SL, Brodeur GM, Ikegaki N. High-level expression of EPHB6, EFNB2, and EFNB3 is associated with low tumor stage and high TrkA expression in human neuroblastomas. Clin Cancer Res. 1999b Jun;5(6):1491-6

Holmberg J, Clarke DL, Frisén J. Regulation of repulsion versus adhesion by different splice forms of an Eph receptor. Nature. 2000 Nov 9;408(6809):203-6

Munthe E, Rian E, Holien T, Rasmussen A, Levy FO, Aasheim H. Ephrin-B2 is a candidate ligand for the Eph receptor, EphB6. FEBS Lett. 2000 Jan 21;466(1):169-74

Shimoyama M, Matsuoka H, Tamekane A, Ito M, Iwata N, Inoue R, Chihara K, Furuya A, Hanai N, Matsui T. T-cell-specific expression of kinase-defective Eph-family receptor protein, EphB6 in normal as well as transformed hematopoietic cells. Growth Factors. 2000;18(1):63-78

Tang XX, Zhao H, Robinson ME, Cohen B, Cnaan A, London W, Cohn SL, Cheung NK, Brodeur GM, Evans AE, Ikegaki N. Implications of EPHB6, EFNB2, and EFNB3 expressions in human neuroblastoma. Proc Natl Acad Sci U S A. 2000 Sep 26;97(20):10936-41

Gerlai R. Eph receptors and neural plasticity. Nat Rev Neurosci. 2001 Mar;2(3):205-9

Kullander K, Mather NK, Diella F, Dottori M, Boyd AW, Klein R. Kinase-dependent and kinase-independent functions of EphA4 receptors in major axon tract formation in vivo. Neuron. 2001 Jan;29(1):73-84

Leighton PA, Mitchell KJ, Goodrich LV, Lu X, Pinson K, Scherz P, Skarnes WC, Tessier-Lavigne M. Defining brain wiring patterns and mechanisms through gene trapping in mice. Nature. 2001 Mar 8;410(6825):174-9

Luo H, Wan X, Wu Y, Wu J. Cross-linking of EphB6 resulting in signal transduction and apoptosis in Jurkat cells. J Immunol. 2001 Aug 1;167(3):1362-70

Luo H, Yu G, Wu Y, Wu J. EphB6 crosslinking results in costimulation of T cells. J Clin Invest. 2002 Oct;110(8):1141-50

Muñoz JJ, Alonso-C LM, Sacedón R, Crompton T, Vicente A, Jiménez E, Varas A, Zapata AG. Expression and function of the Eph A receptors and their ligands ephrins A in the rat thymus. J Immunol. 2002 Jul 1;169(1):177-84

Shimoyama M, Matsuoka H, Nagata A, Iwata N, Tamekane A, Okamura A, Gomyo H, Ito M, Jishage K, Kamada N, Suzuki H, Tetsuo Noda T, Matsui T. Developmental expression of EphB6 in the thymus: lessons from EphB6 knockout mice. Biochem Biophys Res Commun. 2002 Oct 18;298(1):87-94

Hafner C, Bataille F, Meyer S, Becker B, Roesch A, Landthaler M, Vogt T. Loss of EphB6 expression in metastatic melanoma. Int J Oncol. 2003 Dec;23(6):1553-9

Fox BP, Kandpal RP. Invasiveness of breast carcinoma cells and transcript profile: Eph receptors and ephrin ligands as molecular markers of potential diagnostic and prognostic application. Biochem Biophys Res Commun. 2004 Jun 11;318(4):882-92

Müller-Tidow C, Diederichs S, Bulk E, Pohle T, Steffen B, Schwäble J, Plewka S, Thomas M, Metzger R, Schneider PM, Brandts CH, Berdel WE, Serve H. Identification of metastasis-associated receptor tyrosine kinases in non-small cell lung cancer. Cancer Res. 2005 Mar 1;65(5):1778-82

Fox BP, Kandpal RP. Transcriptional silencing of EphB6 receptor tyrosine kinase in invasive breast carcinoma cells and detection of methylated promoter by methylation specific PCR. Biochem Biophys Res Commun. 2006 Feb 3;340(1):268-76

Fox BP, Tabone CJ, Kandpal RP. Potential clinical relevance of Eph receptors and ephrin ligands expressed in prostate carcinoma cell lines. Biochem Biophys Res Commun. 2006 Apr 21;342(4):1263-72



Fox BP, Kandpal RP. EphB6 receptor significantly alters invasiveness and other phenotypic characteristics of human breast carcinoma cells. Oncogene. 2009 Apr 9;28(14):1706-13

Ashktorab H, Schäffer AA, Daremipouran M, Smoot DT, Lee E, Brim H. Distinct genetic alterations in colorectal cancer. PLoS One. 2010 Jan 26;5(1):e8879

Gylfe AE, Sirkiä J, Ahlsten M, Järvinen H, Mecklin JP, Karhu A, Aaltonen LA. Somatic mutations and germline sequence variants in patients with familial colorectal cancer. Int J Cancer. 2010 Dec 15;127(12):2974-80

Kandpal RP. Tyrosine kinase-deficient EphB6 receptor-dependent alterations in proteomic profiles of invasive breast carcinoma cells as determined by difference gel electrophoresis. Cancer Genomics Proteomics. 2010 Sep-Oct;7(5):253-60

Truitt L, Freywald T, DeCoteau J, Sharfe N, Freywald A. The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 2010 Feb 1;70(3):1141-53

Yu J, Bulk E, Ji P, Hascher A, Tang M, Metzger R, Marra A, Serve H, Berdel WE, Wiewroth R, Koschmieder S,

Müller-Tidow C. The EPHB6 receptor tyrosine kinase is a metastasis suppressor that is frequently silenced by promoter DNA hypermethylation in non-small cell lung cancer. Clin Cancer Res. 2010 Apr 15;16(8):2275-83

Bhushan L, Kandpal RP. EphB6 receptor modulates micro RNA profile of breast carcinoma cells. PLoS One. 2011;6(7):e22484

Brantley-Sieders DM, Jiang A, Sarma K, Badu-Nkansah A, Walter DL, Shyr Y, Chen J. Eph/ephrin profiling in human breast cancer reveals significant associations between expression level and clinical outcome. PLoS One. 2011;6(9):e24426

Fox BP, Kandpal RP. A paradigm shift in EPH receptor interaction: biological relevance of EPHB6 interaction with EPHA2 and EPHB2 in breast carcinoma cell lines. Cancer Genomics Proteomics. 2011 Jul-Aug;8(4):185-93


Bhushan L, Kandpal RP. EPHB6 (EPH receptor B6). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):462-465.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


FOXF1 (forkhead box F1) Pang-Kuo Lo

Department of Biological Sciences, University of South Carolina, Columbia, South Carolina 29208,

USA (PKL)


Online updated version : http://AtlasGeneticsOncology.org/Genes/FOXF1ID40628ch16q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI FOXF1ID40628ch16q24.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: ACDMPV, FKHL5, FREAC1

HGNC (Hugo): FOXF1

Location: 16q24.1

Local order:

According to the NCBI Map Viewer, genes

flanking FOXF1 in centromere to telomere

direction on 16q24 are:

- LOC401864 (chloride intracellular channel 1

pseudogene);

- FLJ34515 (uncharacterized LOC400550);

- FOXF1 (forkhead box F1);

- RPL7AP63 (ribosomal protein L7a pseudogene

63);

- MTHFSD (methenyltetrahydrofolate synthetase

domain containing);

- FLJ30679 (uncharacterized protein FLJ30679);

- FOXC2 (forkhead box C2, mesenchyme forkhead

1);

- FOXL1 (forkhead box L1).

Note

This gene encodes a transcription factor of the

forkhead family which is characterized by a unique

forkhead DNA-binding domain. The function of

this gene is implicated in regulation of embryonic

development and organ morphogenesis.

The cellular role of this gene has been found to

regulate cell cycle progression and epithelial-to-

mesenchymal transition (EMT).

Dysregulation of FOXF1 gene expression has been

linked to various cancers and genomic deletions or

mutations at this gene locus have been discovered

to be associated with congenital abnormalities.

The role of FOXF1 in cancer has been proposed to

act as either an oncogene or a tumor suppressor

gene depending on cell types and disease stages.

DNA/RNA

Description

The FOXF1 gene is composed of two exons with

sizes of 1022 and 1540 bp, respectively.

Transcription

The FOXF1 gene expresses 2,58 kb mRNA with

the 1140 bp open reading frame.

The pink boxes indicate the open reading frame and the sky blue boxes indicate the untranslated mRNA region.

FOXF1 (forkhead box F1) Lo PK


Protein

Description

Human FOXF1 is a 379 amino acid protein

functioning as a transcription factor. The FOXF1

protein contains a forkhead domain (or called

winged helix, 48-125 amino acids) engaged in

binding to B-DNA (Kim et al., 2005). According to

the information from the NCBI reference sequence

NP_001442 for the FOXF1 protein, amino acids 84,

85, 94, 97, 98 and 118 are involved in interaction

with nucleotides of DNA. In addition to the

forkhead DNA-binding domain, the C-terminal of

FOXF1 possesses characteristics of the

transcriptional activation domain (Mahlapuu et al.,

1998). However, its region has not yet been

convincingly defined. The studies have shown that

FOXF1 transcripitionally modulates expression of

tissue-specific genes (e.g. lung, intestine) (Hellqvist

et al., 1996; Mahlapuu et al., 1998; Costa et al.,

2001; Ormestad et al., 2006; Madison et al., 2009).

Expression

According to published literature, the FOXF1

transcription factor has been identified to be highly

expressed in the normal human prostate transition

zone and benign prostate hyperplasia (BPH), but

decreasingly expressed in prostate cancer (Watson

et al., 2004; van der Heul-Nieuwenhuijsen et al.,

2009). FOXF1 is expressed in normal breast ductal

epithelial cells and basal-like breast cancer cells,

but is silenced in luminal breast cancer cells mainly

through the epigenetic mechanism (Lo et al., 2010;

Nilsson et al., 2010). FOXF1 expression is detected

in cancer-associated fibroblasts of human lung

cancer and its expression is associated with

activation of hedgehog signaling (Saito et al.,

2010). Upregulation of FOXF1 expression is also

found in PTCH1-associated rhabdomyosarcoma

(Wendling et al., 2008).

Localisation

Localized in the nucleus.

Function

The biological roles of forkhead box protein F1

were mostly studied in murine genetic models and

are linked to regulate embryogenesis and

organogenesis (Mahlapuu et al., 2001a; Costa et al.,

2001; Kalinichenko et al., 2001; Mahlapuu et al.,

2001b; Kalinichenko et al., 2002; Lim et al., 2002;

Ormestad et al., 2006; Astorga and Carlsson, 2007;

Yu et al., 2010). However, the functional roles of

the human FOXF1 protein are still largely

unknown. Some of published studies indicate that

FOXF1 participates in regulation of the following

normal and abnormal cellular processes:

The role of FOXF1 in an Epithelial-to-

Mesenchymal Transition (EMT): FOXF1 has

been found to be a direct repressed target of nuclear

factor 1-C2 (NF1-C2) whose expression is lost

during mammary tumor progression and is almost

absent from lymph node metastases (Nilsson et al.,

2010). FOXF1 is preferentially expressed in breast

cancer cell lines with a mesenchymal phenotype

and its ectopic overexpression in mammary

epithelial cells induces mesenchymal traits,

increased invasiveness in vitro and enhanced

xenograft tumorigenesis in vivo (Nilsson et al.,

2010). Hence FOXF1 is proposed to promote

invasion and metastasis.

The oncogenic role of FOXF1 in lung cancer-

associated fibroblasts: FOXF1 is found to be

expressed in cancer-associated fibroblasts of human

lung cancer and associated with activation of

hedgehog signaling (Saito et al., 2010). Gain- and

loss-of-function studies of FOXF1 in fibroblasts

show that FOXF1 is implicated in regulating the

contractility of fibroblasts and abilities of

fibroblasts to produce hepatocyte growth factor as

well as fibroblast growth factor-2 and to stimulate

migration of lung cancer epithelial cells (Saito et

al., 2010). The expression status of FOXF1 in

fibroblasts positively correlates with the ability of

fibroblasts to enhance xenograft tumor growth

(Saito et al., 2010). These findings suggest that

hedgehog-dependent FOXF1 is a clinically relevant

factor to grant oncogenic abilities to cancer-

associated fibroblasts for propelling development of

lung cancer.

The role of FOXF1 in regulation of cell cycle

progression: FOXF1 has been identified as a target

of epigenetic inactivation in breast cancer (Lo et al.,

2010). Ectopic reexpression of FOXF1 in FOXF1-

negative breast cancer cells induces cell growth

arrest by inhibition of the CDK2-RB-E2F cascade

(Lo et al., 2010). FOXF1 knockdown studies of

FOXF1-expressing breast cancer epithelial cells

revealed that FOXF1 is indispensable for

maintaining the stringency of DNA replication and

genomic stability by negatively modulating

expression of E2F target genes which are involved

in promoting the progression of S and G2 phases

(Lo et al., 2010; Lo et al., 2012). These lines of

evidence suggest that FOXF1 is an epigenetically

silenced tumor suppressor gene in breast cancer,

which is essential for maintaining genomic stability

by regulating the stringency of DNA replication.

Homology

- Pan troglodytes (chimpanzee), FOXF1

(XP_523449.2, 535 aa), 99% identity;

- Canis lupus (dog), FOXF1 (XP_546792.2, 354

aa), 95% identity;

- Bos taurus (cattle), FOXF1 (XP_603148.3, 382

aa), 96% identity;

- Mus musculus (mouse), Foxf1a (NP_034556.1,

353 aa), 94% identity;

- Gallus gallus (chicken), FOXF1 (XP_414186.2,

368 aa), 91% identity;



- Danio rerio (zebrafish), Foxf1 (NP_001073655.1,

380 aa), 81% identity.

Mutations

Note

Four different heterozygous mutations (frameshift,

nonsense, and non-stop) have been identified in the

FOXF1 gene in unrelated patients with sporadic

ACD/MPV (alveolar capillary dysplasia with

misalignment of pulmonary veins) and MCA

(multiple congenital anomalies) (Stankiewicz et al.,

2009). The point mutations identified in the FOXF1

gene are associated with bowel malrotation, annular

pancreas, duodenal stenosis, congenital short

bowel, small omphalocele and Meckel's

diverticulum (Stankiewicz et al., 2009).

Implicated in

Breast cancer

Oncogenesis

Loss or downregulation of FOXF1 expression is

found to be associated with FOXF1 promoter

hypermethylation in breast cancer cell lines and in

breast invasive ductal carcinomas (Lo et al., 2010).

According to analysis of 117 invasive ductal

carcinoma (IDC) cases, FOXF1 promoter was

hypermethylated in 37,6% of examined IDC cases,

which was associated with high tumor grade (Lo et

al., 2010). The gain- and loss-of-function studies of

FOXF1 in breast cancer cells indicate that FOXF1

plays an imperative role in maintaining the

stringency of DNA replication for sustaining

genomic stability (Lo et al., 2010; Lo et al., 2012).

These clinical correlation and cellular functional

studies suggest that FOXF1 is a potential tumor

suppressor gene which is epigenetically silenced in

breast cancer.

Lung cancer

Oncogenesis

Immunohistochemical (IHC) staining of FOXF1 is

found to be positive in nuclei of lung cancer-

associated fibroblasts (CAFs) (Saito et al., 2010).

The frequency of positivity of FOXF1 IHC staining

in CAFs is 110 (44,5%) out of 247 cases examined

(Saito et al., 2010). The IHC studies exhibited

stronger FOXF1 staining in the stromal cells

adjacent to lung tumor cells compared with those

further apart from the tumor cells. FOXF1

expression in CAFs is not significantly associated

with any particular histologic subtypes of lung

cancer and also does not correlate with survival in

the overall population. However, lung cancer

patients from the female population or from the

large cell lung cancer population show positive

correlation between FOXF1 expression in CAFs

and predicted poor prognosis (Saito et al., 2010).

These IHC studies, in combination with in vitro

functional studies of FOXF1 in fibroblasts (Saito et

al., 2010), suggest that FOXF1 plays an oncogenic

role in CAF-stimulated lung tumorigenesis.

Prostate cancer

Oncogenesis

FOXF1 expression is lost or downregulated in

prostate cancer compared with normal prostate

tissue (Watson et al., 2004; van der Heul-

Nieuwenhuijsen et al., 2009). This suggests that

FOXF1 is a putative tumor suppressor gene in

prostate cancer.

Nevoid basal cell carcinoma syndrome

Disease

Patients with nevoid basal cell carcinoma syndrome

(NBCCS) carry germline mutation in the tumor

suppressor gene Patched 1 (PTCH1) and are

predisposed to develop basal cell carcinoma (BCC),

medulloblastoma (MB) and rhabdomyosarcoma

(RMS).

Oncogenesis

FOXF1 expression is found to be aberrantly

upregulated in NBCCS-associated tumors

compared with the respective non-neoplastic tissue

(Wendling et al., 2008). Overexpression of FOXF1

is accompanied by increased levels of the hedgehog

target Gli1 as well as the putative FOXF1 targets

Bmi1 and Notch2 in NBCCS-associated tumors

(Wendling et al., 2008). These findings suggest a

key role for FOXF1 in hedgehog-associated

tumorigenesis.

Idiopathic interstitial pneumonias

Disease

The idiopathic interstitial pneumonias (IIP)

represent a set of diffuse parenchymal lung

disorders and are sub-classified into usual

interstitial pneumonitis (UIP), nonspecific

interstitial pneumonitis (NSIP) and the fibrotic

variant of NSIP (NSIP-F).

Examination of surgical and autopsy specimens

from 13 patients with either UIP or NSIP-F has

revealed that all of UIP cases exhibited a pattern of

strong SHH (a hedgehog ligand) expression with

weak FOXF1 expression and NSIP-F cases

displayed a complementary expression of SHH and

FOXF1 (Coon et al., 2006). These studies suggest

that morphogenetic genes (e.g. FOXF1) may

participate differentially in the pathogenesis of UIP

and NSIP-F.

Alveolar capillary dysplasia with misalignment of pulmonary veins

Disease

Alveolar capillary dysplasia with misalignment of

pulmonary veins (ACD/MPV) is a rare, neonatally

lethal developmental disorder of the lung with

defining histologic abnormalities typically



associated with multiple congenital anomalies

(MCA). Infants with ACD/MPV develop

respiratory distress and severe pulmonary

hypertension within the first two days of life.

ACD/MPV-affected infants mostly can not survive

within the first month of life due to no sustained

response to supportive measures and respiratory

failure. More than 80% of infants with ACD/MPV

have additional malformations occurring in the

cardiac, gastrointestinal, and genitourinary systems.

Intestinal malrotation is the most commonly

observed of these anomalies, and hypoplastic left

heart together with hypoplasia or coarctation of the

aortic arch are the most common associated

cardiovascular abnormalities. Of almost 200

reported ACD/MPV cases, approximately 10%

have a familial association. Four distinct

heterozygous mutations (frameshift, nonsense, and

no-stop) were identified in the FOXF1 gene in

unrelated 18 patients with sporadic ACD/MPV and

MCA (Stankiewicz et al., 2009), suggesting that an

impairment in the FOXF1 function might lead to

these observed developmental disorders.

References Hellqvist M, Mahlapuu M, Samuelsson L, Enerbäck S, Carlsson P. Differential activation of lung-specific genes by two forkhead proteins, FREAC-1 and FREAC-2. J Biol Chem. 1996 Feb 23;271(8):4482-90

Mahlapuu M, Pelto-Huikko M, Aitola M, Enerbäck S, Carlsson P. FREAC-1 contains a cell-type-specific transcriptional activation domain and is expressed in epithelial-mesenchymal interfaces. Dev Biol. 1998 Oct 15;202(2):183-95

Costa RH, Kalinichenko VV, Lim L. Transcription factors in mouse lung development and function. Am J Physiol Lung Cell Mol Physiol. 2001 May;280(5):L823-38

Kalinichenko VV, Lim L, Stolz DB, Shin B, et al.. Defects in pulmonary vasculature and perinatal lung hemorrhage in mice heterozygous null for the Forkhead Box f1 transcription factor. Dev Biol. 2001 Jul 15;235(2):489-506

Mahlapuu M, Enerbäck S, Carlsson P. Haploinsufficiency of the forkhead gene Foxf1, a target for sonic hedgehog signaling, causes lung and foregut malformations. Development. 2001a Jun;128(12):2397-406

Mahlapuu M, Ormestad M, Enerbäck S, Carlsson P. The forkhead transcription factor Foxf1 is required for differentiation of extra-embryonic and lateral plate mesoderm. Development. 2001b Jan;128(2):155-66

Kalinichenko VV, Zhou Y, Bhattacharyya D, Kim W, Shin B, Bambal K, Costa RH. Haploinsufficiency of the mouse Forkhead Box f1 gene causes defects in gall bladder development. J Biol Chem. 2002 Apr 5;277(14):12369-74

Lim L, Kalinichenko VV, Whitsett JA, Costa RH. Fusion of lung lobes and vessels in mouse embryos heterozygous for the forkhead box f1 targeted allele. Am J Physiol Lung Cell Mol Physiol. 2002 May;282(5):L1012-22

Watson JE, Doggett NA, Albertson DG, et al.. Integration of high-resolution array comparative genomic hybridization analysis of chromosome 16q with expression array data refines common regions of loss at 16q23-qter and

identifies underlying candidate tumor suppressor genes in prostate cancer. Oncogene. 2004 Apr 22;23(19):3487-94

Kim IM, Zhou Y, Ramakrishna S, Hughes DE, Solway J, Costa RH, Kalinichenko VV. Functional characterization of evolutionarily conserved DNA regions in forkhead box f1 gene locus. J Biol Chem. 2005 Nov 11;280(45):37908-16

Coon DR, Roberts DJ, Loscertales M, Kradin R. Differential epithelial expression of SHH and FOXF1 in usual and nonspecific interstitial pneumonia. Exp Mol Pathol. 2006 Apr;80(2):119-23

Ormestad M, Astorga J, Landgren H, Wang T, Johansson BR, Miura N, Carlsson P. Foxf1 and Foxf2 control murine gut development by limiting mesenchymal Wnt signaling and promoting extracellular matrix production. Development. 2006 Mar;133(5):833-43

Astorga J, Carlsson P. Hedgehog induction of murine vasculogenesis is mediated by Foxf1 and Bmp4. Development. 2007 Oct;134(20):3753-61

Wendling DS, Lück C, von Schweinitz D, Kappler R. Characteristic overexpression of the forkhead box transcription factor Foxf1 in Patched-associated tumors. Int J Mol Med. 2008 Dec;22(6):787-92

Madison BB, McKenna LB, Dolson D, Epstein DJ, Kaestner KH. FoxF1 and FoxL1 link hedgehog signaling and the control of epithelial proliferation in the developing stomach and intestine. J Biol Chem. 2009 Feb 27;284(9):5936-44

Stankiewicz P, Sen P, Bhatt SS, Storer M, Xia Z, et al.. Genomic and genic deletions of the FOX gene cluster on 16q24.1 and inactivating mutations of FOXF1 cause alveolar capillary dysplasia and other malformations. Am J Hum Genet. 2009 Jun;84(6):780-91

van der Heul-Nieuwenhuijsen L, Dits NF, Jenster G. Gene expression of forkhead transcription factors in the normal and diseased human prostate. BJU Int. 2009 Jun;103(11):1574-80

Lo PK, Lee JS, Liang X, Han L, Mori T, Fackler MJ, Sadik H, Argani P, Pandita TK, Sukumar S. Epigenetic inactivation of the potential tumor suppressor gene FOXF1 in breast cancer. Cancer Res. 2010 Jul 15;70(14):6047-58

Nilsson J, Helou K, Kovács A, Bendahl PO, Bjursell G, Fernö M, Carlsson P, Kannius-Janson M. Nuclear Janus-activated kinase 2/nuclear factor 1-C2 suppresses tumorigenesis and epithelial-to-mesenchymal transition by repressing Forkhead box F1. Cancer Res. 2010 Mar 1;70(5):2020-9

Saito RA, Micke P, Paulsson J, Augsten M, Peña C, Jönsson P, Botling J, Edlund K, Johansson L, Carlsson P, Jirström K, Miyazono K, Ostman A. Forkhead box F1 regulates tumor-promoting properties of cancer-associated fibroblasts in lung cancer. Cancer Res. 2010 Apr 1;70(7):2644-54

Yu S, Shao L, Kilbride H, Zwick DL. Haploinsufficiencies of FOXF1 and FOXC2 genes associated with lethal alveolar capillary dysplasia and congenital heart disease. Am J Med Genet A. 2010 May;152A(5):1257-62

Lo PK, Lee JS, Sukumar S. The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function. Cell Signal. 2012 Jan;24(1):316-24


Lo PK. FOXF1 (forkhead box F1). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):466-469.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


FXYD3 (FXYD domain containing ion transport regulator 3) Hiroto Yamamoto, Shinji Asano

Department of Molecular Physiology, College of Pharmaceutical Sciences, Ritsumeikan University,

Kusatsu, Shiga 525-8577, Japan (HY, SA)


Online updated version : http://AtlasGeneticsOncology.org/Genes/FXYD3ID43704ch19q13.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI FXYD3ID43704ch19q13.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: MAT8, PLML

HGNC (Hugo): FXYD3

Location: 19q13.12

Local order: Centromere, SCN1B, HPN, FXYD3,

LGI4, FXYD1, FXYD7, FXYD5, Telomere.

Note

FXYD3 is a member of the FXYD family proteins,

which regulate Na+,K+-ATPase activity to

precisely adjust the physiological ion balance of the

tissue.

DNA/RNA

Note

Morrison and Leder (1994) originally found that

FXYD3 mRNA was overexpressed in murine breast

cancer induced by neu or ras oncogenes, but not by

c-myc or int-2.

FXYD3 has two splicing variants (FXYD3a and

FXYD3b). FXYD3a and 3b are short and long

isoforms of FXYD3, respectively.

Description

DNA contains 8494 bp composed of 9 (FXYD3a)

or 8 (FXYD3b) exons.

Transcription

The FXYD3a mRNA has an in-frame deletion of 78

nucleotides in the coding sequence compared to the

FXYD3b mRNA.

FXYD3a mRNA is a major transcript product

expressed in normal tissues as well as in breast,

colon, stomach and pancreas cancer cells.

Transcription of FXYD3 mRNA was down-

regulated by TGF-b signaling in human mammary

epithelial cells (Yamamoto et al., 2011).

Pseudogene

No pseudogenes reported.

Red boxes represent shared exons between FXYD3a and FXYD3b, and a white box represents an exon specific for FXYD3b

FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S


Amino acid alignments of human FXYD3a and 3b proteins. An underline represents the FXYD (Phe-Xaa-Tyr-Asp) motif. A box represents the transmembrane segment. FXYD3b protein has 26 more amino acids in the cytoplasmic domain compared to

FXYD3a protein. .

Protein

Description

FXYD3 is a member of the "FXYD" family

proteins, which consist of seven members of small

proteins and share a signature sequence of four

amino acids "FXYD" located in the ectodomain

close to the transmembrane segment.

Human FXYD3 protein contains a hydrophobic

domain at the N terminus encoding a cleavable

signal peptide, and adopts a type I topology.

On the other hand, mouse FXYD3 may have two

transmembrane domains because of the lack of

cleavable signal peptide.

Expression

Mammary gland, lung, stomach, pancreas and

intestine.

Localisation

Plasma membrane and intracellular membrane

compartment.

Function

FXYD family proteins perform fine tuning of ion

transport by associating with and modulating the

pump activity of Na+,K+-ATPase molecules and

modifying the activity of ion channels (Geering,

2006).

FXYD3a slightly decreased the apparent affinity

both for intracellular Na+ (up to 40%) and

extracellular K+ (15 to 40%) of Na+,K+-ATPase

whereas FXYD3b slightly increased the apparent

affinity for intracellular Na+ (about 15%) and

decreased the apparent affinity for extracellular K+

(up to 50%).

Both FXYD3 isoforms induced a

hyperpolarization-activated chloride current in

Xenopus oocytes (Bibert et al., 2006). Two cysteine

residues at cytoplasmic domain of FXYD3 were

glutathionylated by oxidative stress.

As a result, glutathionylation of Na+,K+-ATPase

beta1 subunit by oxidative stress was prevented and

the pump activity of Na+,K+-ATPase was

maintained (Bibert et al., 2011). FXYD3 is

responsible for cancer cell proliferation.

Suppression of FXYD3 expression caused a

significant decrease in cellular proliferation of

breast, prostate and pancreatic cancer cell lines.

In colon cancer cell line Caco-2, silencing of

FXYD3 mRNA with shRNA specific for FXYD3

increased the apoptosis rate and inhibited the

differentiation to enterocyte-like phenotype (Bibert

et al., 2009).

Homology

FXYD family proteins have invariant amino acids

in a signature sequence of FXYD motif and two

conserved glycines and a serine residue (Sweadner

and Rael, 2000).

In mammals, this family contains seven members

including FXYD1 (phospholemman), FXYD2 (the

gamma-subunit of Na+,K+-ATPase), FXYD3 (Mat-

8), FXYD4 (corticosteroid hormone-induced

factor), FXYD5 (dysadherin), FXYD6

(phosphohippolin) and FXYD7. FXYD family

proteins are expressed in specific tissues to regulate

Na+,K+-ATPase activity, and precisely adjust the

physiological ion balance of the tissues.

Mutations

Somatic

Okudela et al. (2009) showed that somatic mutation

(D19H) occurred only in a lung cancer cell line,

H2087.

This mutation is very rare in lung cancer cell lines

and primary lung cancers.

Exogenous expression of wild-type FXYD3, but

not the mutant (FXYD3/D19H), enhanced the

cortical actin density in a lung cancer cell line,

H1299.

FXYD3/D19H distorted the outline of nuclear

envelope in H1299 cells, suggesting that loss of

FXYD3 function attenuates the integrity of the

nuclear envelope and the cytoskeleton.



Implicated in

Breast cancer

Note

Down-regulation of FXYD3 mRNA via siRNA for

FXYD3 decreased the proliferation of MCF-7

breast cancer cells.

Disease

Yamamoto et al. (2009) reported that FXYD3

protein was overexpressed in human breast cancer

specimens; invasive ductal carcinomas and intra-

ductal carcinomas compared with surrounding

normal mammary glands. On the other hand,

FXYD3 expression was low in benign lesion

specimens; mastopathy, fibroadenoma and

phyllodes tumors. Distribution pattern of FXYD3

expression was divided into two groups. In one

group, expression was observed mainly in the

cytoplasm. In the other group, expression was

observed both in the cytoplasm and at the cell

surface.

Pancreas cancer

Note

Down-regulation of FXYD3 mRNA by stable

antisense transfection decreased the proliferation of

T3M4 pancreatic cancer cells.

Disease

Kayed et al. (2006) reported that FXYD3 was

overexpressed in pancreatic cancer, and contributed

to its proliferative activity and malignancy. There

was no significant difference in FXYD3 mRNA

expression levels between chronic pancreatitis and

normal pancreatic tissues whereas FXYD3 mRNA

levels were 3.9-fold increased in pancreatic ductal

adenocarcinoma cells compared to normal ductal

cells. FXYD3 protein expression was almost absent

in normal pancreatic tissues. In contrast, chronic

pancreatitis and pancreatic ductal adenocarcinoma

tissues showed up-regulation of FXYD3 protein

which was expressed in cytoplasm and plasma

membrane. Pancreas cancer cells that had

metastasized to the liver and regional lymph nodes

also exhibited strong expression of FXYD3 protein.

Urothelial carcinoma

Disease

Zhang et al. (2011) reported FXYD3 mRNA as a

promising prognosis marker of renal and bladder

urothelial carcinoma (UC). Microarray gene

expression data showed that FXYD3 mRNA was

increased in UC whereas it was not observed in

normal kidney tissues and other type of tumors

including papillary, oncocytoma, chromophobe,

and clear cell renal carcinoma. FXYD3 protein was

expressed in about 90% of UC from renal pelvis,

and 63% of UC from bladder, however, it was not

expressed in normal kidney and bladder stromal

tissues.

Prognosis

Martin-Aguilera et al. (2008) reported that a

combination of FXYD3 and KRT20 (a member of

the keratin family) genes yielded a 100% sensitivity

and specificity differentiating lymph nodes with

bladder UC dissemination from controls. However,

there was no significantly worse survival of patients

presenting qRT-PCR positive compared to negative

lymph nodes after a median follow-up of 35

months.

Lung cancer

Disease

Okudela et al. (2009) reported that FXYD3 mRNA

and protein levels were down-regulated in some

lung cancer cell lines. Epigenetic modifications

such as DNA methylation and histone acethylation

seem to affect FXYD3 expression. In normal lung

epithelial cells, FXYD3 protein was extensively

expressed on the basolateral membrane of bronchial

epithelial cells, and in cytoplasm where it was

concentrated at the perinuclear site of alveolar

epithelial cells. In lung cancer, particularly in

poorly differentiated cancers, FXYD3 expression

was low or faint. Down-regulation of FXYD3 was

more prominent in large cell carcinomas and small

cell carcinomas than in adenocarcinomas. FXYD3

expression was decreased significantly as the

histological grade of squamous cell carcinoma

progressed from well to poorly differentiated.

Prostate cancer

Note

Grzmil et al. (2004) reported that FXYD3 (MAT-8)

plays an important role in cellular growth of

prostate carcinomas. In prostate tumors (6 out of

11), FXYD3 mRNA expression was increased (> 2

times) up to 35-fold compared to normal tissues.

FXYD3 mRNA was also expressed in prostate

cancer cell lines, PC3, DU-145 and LNCaP.

Silencing of FXYD3 mRNA via siRNA specific for

FXYD3 led to significant decrease in proliferation

of PC3 and LNCaP.

Colon cancer

Disease

Kayed et al. (2006) showed that FXYD3 mRNA

expression was decreased in colon cancers (n=40)

compared to normal colon tissues (n=27). Widegren

et al. (2009) reported that FXYD3 seems to be

involved in the development of the relatively earlier

stages of colorectal cancers. FXYD3 protein

expression was significantly higher in primary

tumor compared to adjacent normal mucosa in the

matched cases, while there was no significant

difference in the expression between primary tumor

and metastasis in the lymph nodes. FXYD3 protein

expression was positively related to the expression

of Ras, P53, Legumain and proliferative cell

nuclear antigen. Although FXYD3 expression in



Dukes stage A-C tumors was higher than that in

stage D tumors, there was no relationship between

FXYD3 expression and survival in the whole group

of the patients.

Prognosis

Loftas et al. (2009) reported that in rectal cancers,

FXYD3 expression was a prognosis factor

independent of tumor stage and differentiation in

patients receiving preoperative radiotherapy: strong

expression was associated with an unfavorable

prognosis. In the primary tumors, FXYD3

expression was increased compared with normal

mucosa. There were less tumor necrosis and a

higher rate of developing distant metastasis after

radiotherapy in tumors with high FXYD3

expression.

Gastric cancer

Disease

Zhu et al. (2010) reported that up-regulation of

FXYD3 protein expression seems to be involved in

tumorigenesis and invasion of gastric

adenocarcinoma. FXYD3 protein was present in the

cytoplasm of normal gastric epithelial cells as well

as gastric cancer cells. The rate of FXYD3 strong

expression was significantly higher in cancer (51%

of 51) than in normal mucosa (10% of 29). FXYD3

was expressed strongly in ulcerative/infiltrating

types of cancers compared to polypoid/fungating

ones. However, FXYD3 expression was not

correlated with patient's gender, age, tumor size,

lymph node status and histological grade.

Glioma

Disease

Wang et al. (2009) reported that FXYD3 expression

seems to be involved in glioma development. The

frequency of strong FXYD3 expression was higher

in the primary tumors compared to normal brain

tissues. FXYD3 expression was significantly more

increased in females than males, and in multiple

site gliomas than single sites. There was no

difference of FXYD3 expression regarding age,

tumor location, size, histological type, and tumor

grade.

References Morrison BW, Leder P. neu and ras initiate murine mammary tumors that share genetic markers generally absent in c-myc and int-2-initiated tumors. Oncogene. 1994 Dec;9(12):3417-26

Morrison BW, Moorman JR, Kowdley GC, Kobayashi YM, Jones LR, Leder P. Mat-8, a novel phospholemman-like protein expressed in human breast tumors, induces a chloride conductance in Xenopus oocytes. J Biol Chem. 1995 Feb 3;270(5):2176-82

Sweadner KJ, Rael E. The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression. Genomics. 2000 Aug 15;68(1):41-56

Grzmil M, Voigt S, Thelen P, Hemmerlein B, Helmke K, Burfeind P. Up-regulated expression of the MAT-8 gene in prostate cancer and its siRNA-mediated inhibition of expression induces a decrease in proliferation of human prostate carcinoma cells. Int J Oncol. 2004 Jan;24(1):97-105

Crambert G, Li C, Claeys D, Geering K. FXYD3 (Mat-8), a new regulator of Na,K-ATPase. Mol Biol Cell. 2005 May;16(5):2363-71

Bibert S, Roy S, Schaer D, Felley-Bosco E, Geering K. Structural and functional properties of two human FXYD3 (Mat-8) isoforms. J Biol Chem. 2006 Dec 22;281(51):39142-51

Geering K. FXYD proteins: new regulators of Na-K-ATPase. Am J Physiol Renal Physiol. 2006 Feb;290(2):F241-50

Kayed H, Kleeff J, Kolb A, Ketterer K, Keleg S, Felix K, Giese T, Penzel R, Zentgraf H, Büchler MW, Korc M, Friess H. FXYD3 is overexpressed in pancreatic ductal adenocarcinoma and influences pancreatic cancer cell growth. Int J Cancer. 2006 Jan 1;118(1):43-54

Marín-Aguilera M, Mengual L, Burset M, Oliver A, Ars E, Ribal MJ, Colomer D, Mellado B, Villavicencio H, Algaba F, Alcaraz A. Molecular lymph node staging in bladder urothelial carcinoma: impact on survival. Eur Urol. 2008 Dec;54(6):1363-72

Bibert S, Aebischer D, Desgranges F, Roy S, Schaer D, Kharoubi-Hess S, Horisberger JD, Geering K. A link between FXYD3 (Mat-8)-mediated Na,K-ATPase regulation and differentiation of Caco-2 intestinal epithelial cells. Mol Biol Cell. 2009 Feb;20(4):1132-40

Loftås P, Onnesjö S, Widegren E, Adell G, Kayed H, Kleeff J, Zentgraf H, Sun XF. Expression of FXYD-3 is an independent prognostic factor in rectal cancer patients with preoperative radiotherapy. Int J Radiat Oncol Biol Phys. 2009 Sep 1;75(1):137-42

Okudela K, Yazawa T, Ishii J, Woo T, Mitsui H, Bunai T, Sakaeda M, Shimoyamada H, Sato H, Tajiri M, Ogawa N, Masuda M, Sugimura H, Kitamura H. Down-regulation of FXYD3 expression in human lung cancers: its mechanism and potential role in carcinogenesis. Am J Pathol. 2009 Dec;175(6):2646-56

Wang MW, Gu P, Zhang ZY, Zhu ZL, Geng Y, Kayed H, Zentgraf H, Sun XF. FXYD3 expression in gliomas and its clinicopathological significance. Oncol Res. 2009;18(4):133-9

Widegren E, Onnesjö S, Arbman G, Kayed H, Zentgraf H, Kleeff J, Zhang H, Sun XF. Expression of FXYD3 protein in relation to biological and clinicopathological variables in colorectal cancers. Chemotherapy. 2009;55(6):407-13

Yamamoto H, Okumura K, Toshima S, Mukaisho K, Sugihara H, Hattori T, Kato M, Asano S. FXYD3 protein involved in tumor cell proliferation is overproduced in human breast cancer tissues. Biol Pharm Bull. 2009 Jul;32(7):1148-54

Zhu ZL, Zhao ZR, Zhang Y, Yang YH, Wang ZM, Cui DS, Wang MW, Kleeff J, Kayed H, Yan BY, Sun XF. Expression and significance of FXYD-3 protein in gastric adenocarcinoma. Dis Markers. 2010;28(2):63-9

Bibert S, Liu CC, Figtree GA, Garcia A, Hamilton EJ, Marassi FM, Sweadner KJ, Cornelius F, Geering K, Rasmussen HH. FXYD proteins reverse inhibition of the Na+-K+ pump mediated by glutathionylation of its beta1 subunit. J Biol Chem. 2011 May 27;286(21):18562-72

Yamamoto H, Mukaisho K, Sugihara H, Hattori T, Asano S. Down-regulation of FXYD3 is induced by transforming



growth factor-β signaling via ZEB1/δEF1 in human mammary epithelial cells. Biol Pharm Bull. 2011 Mar;34(3):324-9

Zhang Z, Pang ST, Kasper KA, Luan C, Wondergem B, Lin F, Chuang CK, Teh BT, Yang XJ. FXYD3: A Promising Biomarker for Urothelial Carcinoma. Biomark Insights. 2011 Feb 15;6:17-26


Yamamoto H, Asano S. FXYD3 (FXYD domain containing ion transport regulator 3). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):470-474.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


MCAM (melanoma cell adhesion molecule) Guang-Jer Wu

Department of Microbiology and Immunology, Emory University School of Medicine, 1510, Clifton

Rd NE, Atlanta, GA 30322, USA; Department of Bioscience Technology, Chung Yuan Christian

University, 200 Chung Pei Rd, 32023 Taiwan, Republic of China (GJW)


Online updated version : http://AtlasGeneticsOncology.org/Genes/MCAMID41314ch11q23.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MCAMID41314ch11q23.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: CD146, METCAM, MUC18,

Gicerin

HGNC (Hugo): MCAM

Location: 11q23.3

DNA/RNA

Description

Human METCAM (huMETCAM), a CAM in the

immunoglobulin-like gene superfamily, is an

integral membrane glycoprotein. Alternative names

for METCAM are MUC18 (Lehmann et al., 1987),

CD146 (Anfosso et al., 2001), MCAM (Xie et al.,

1997), MelCAM (Shih et al., 1994a), A32 (Shih et

al., 1994b), and S-endo 1 (Bardin et al., 1996).

To avoid confusion with mucins and to reflect its

biological functions, we have renamed MUC18 as

METCAM (metastasis CAM), which means an

immunoglobulin-like CAM that affects or regulates

metastasis, (Wu, 2005). METCAM/MUC18 gene is

located on human chromosome 11q23.3.

Transcription

The major transcript of the gene in most human

epithelial cancer cell lines is about 3,3 kb (Wu et

al., 2001a).

A distinct short form resulting from alternative

splicing of the gene of gicerin, the chicken homolog

of METCAM, has been found (Taira et al., 1995).

Though the expression of a short form of

METCAM has been briefly mentioned in human

melanoma cells (Lehmann et al., 1987), its function

is not known since it is expressed at a much lower

level than the major

form in various cancer cell lines (Wu, unpublished

observation). Interestingly, a truncated form with a

deletion in some portion of the cytoplasmic domain

has been found in a prostate cancer specimen

X9479, a cell line derived from specimens of

nasopharyngeal carcinomas and other cancers (Wu,

unpublished observations).

Further systematic search for the function of this

minor form should be carried out.

Pseudogene

METCAM/MUC18 may not have a pseudogene.

Protein

Note

Human METCAM/MUC18 cDNA encodes 646

amino acids, about 115-150 kDa protein.

Description

The huMETCAM has 646 amino acids that include

a N-terminal extra-cellular domain of 558 amino

acids, which has 28 amino acids characteristics of a

signal peptide sequence at its N-terminus, a

transmembrane domain of 24 amino acids (amino

acids 559-583), and a cytoplasmic domain of 64

amino acids at the C-terminus. HuMETCAM has

eight putative N-glycosylation sites (Asn-X-

Ser/Thr), of which six are conserved, and are

heavily glycosylated and sialylated resulting in an

apparent molecular weight of 113000-150000.The

extra-cellular domain of the protein comprises five

immunoglobulin-like domains (V-V-C2-C2-C2)

(Lehmann et al., 1987; Wu et al., 2001a; Wu, 2005)

and an X domain (Wu et al., 2001a; Wu, 2005).

MCAM (melanoma cell adhesion molecule) Wu GJ


HuMETCAM protein structure. SP stands for signal peptide sequence, V1, V2, C2, C2', C2'' for five Ig-like domains (each held by a disulfide bond) and X for one domain (without any disulfide bond) in the extracellular region, and TM for transmembrane domain. P stands for five potential phosphorylation sites (one for PKA, three for PKC, and one for CK2) in the cytoplasmic tail. The six conserved N-glycosylation sites are shown as wiggled lines in the extracellular domains of V1, between C2' and C2'',

C2'', and X.

The cytoplasmic tail contains peptide sequences

that will potentially be phosphorylated by protein

kinase A (PKA), protein kinase C (PKC), and

casein kinase 2 (CK 2) (Lehmann et al., 1987; Wu

et al., 2001a; Wu, 2005). My lab has also cloned

and sequenced the mouse METCAM

(moMETCAM) cDNA, which contains 648 amino

acids with a 76,2% identity with huMETCAM,

suggesting that moMETCAM is likely to have

biochemical properties and biological functions

similar to the human counter part (Yang et al.,

2001; Wu, 2005).

The structure of the huMETCAM protein is

depicted in figure above, suggesting that

METCAM, similar to most CAMs, plays an active

role in mediating cell-cell and cell-extracellular

interactions, crosstalk with many intracellular

signaling pathways, and modulating the social

behaviors of cells (Cavallaro and Christofori, 2004;

Wu, 2005). Recent work supports an emerging

novel function of METCAM in tumor angiogenesis

and perhaps it plays an important role in the

metastasis of tumor cells (Wu, 2010; Wu, 2012).

Expression

HuMETCAM is expressed in a limited number of

normal tissues, such as hair follicular cells, smooth

muscle cells, endothelial cells, cerebellum, normal

mammary epithelial cells, basal cells of the lung,

activated T cells, intermediate trophoblast (Shih,

1999), and normal nasopharyngeal epithelial cells

(Lin et al., 2012).

Localisation

HuMETCAM is a cytoplasmic membrane protein.

Most of the protein is located on the cell membrane

in normal tissues. However, increasing presence of

the protein in the cytoplasm appears to be related to

the higher pathological grades and malignant

cancers of prostate and breast, and melanoma and

nasopharyngeal carcinoma (Wu et al., 2001b).

Function

Similar to other cell adhesion molecules (CAMs),

METCAM/MUC18 does not merely act as a

molecular glue to hold together homotypic cells in a

specific tissue or to facilitate interactions of

heterotypic cells; It also actively governs the social

behaviors of cells by affecting the adhesion status

of cells and modulating cell signaling (Cavallaro

and Christofori, 2004).

It controls cell motility and invasiveness by

mediating the remodeling of cytoskeleton

(Cavallaro and Christofori, 2004).

It also actively mediates the cell-to-cell and cell-to-

extracellular matrix interactions to allow cells to

constantly respond to physiological fluctuations and

to alter/remodel the surrounding microenvironment

for survival (Chambers et al., 2002).

It does so by crosstalk with cellular surface growth

factor receptors, which interact with growth factors

that may be secreted from stromal cells or released

from circulation and embedded in the extracellular

matrix (Chambers et al., 2002; Cavallaro and

Christofori, 2004).

Thus an altered expression of METCAM/MUC18

affects the motility and invasiveness of many

epithelial tumor cells in vitro and metastasis in vivo

(Chambers et al., 2002; Cavallaro and Christofori,

2004; Wu, 2005). METCAM/MUC18 may also

play an important role in the favorable soil that

provides a proper microenvironment at a suitable

period to awaken the dormant metastatic tumor

cells to enter into an aggressive growth phase.

Evidence have been documented that aberrant

expression of huMETCAM/MUC18 actually affects

the motility and invasiveness of many tumor cells

in vitro and metastasis in vivo.

Thus HuMETCAM/MUC18 plays an important

role in promoting the malignant progression of

many cancer types (Cavallaro and Christofori,

2004; Wu, 2005).



Homology

Human METCAM/MUC18 protein shares high

homology with the mouse METCAM/MUC18 (Wu

et al., 2001a; Yang et al., 2001) and other Ig-like

CAMs, especially the NCAMs (Lehmann et al.,

1987).

Mutations

Note

Several point mutations have been found in

huMETCAM/MUC18 protein from human cancers

(Wu et al., 2001a).

Implicated in

Various cancers

Note

The protein is overly expressed in most (67%)

malignant melanoma cells (Lehmann et al., 1987),

and in most (more than 80%) pre-malignant

prostate epithelial cells (PIN), high-grade prostatic

carcinoma cells, and metastatic lesions (Wu et al.,

2001b; Wu, 2004). HuMETCAM is also expressed

in other cancers, such as gestational trophoblastic

tumors, leiomyosarcoma, angiosarcoma,

haemangioma, Kaposi's sarcoma, schwannoma,

some lung squamous and small cell carcinomas,

some breast cancer, some neuroblastoma (Shih,

1999), and also nasopharyngeal carcinoma (Lin et

al., 2012) and ovarian cancer (Wu et al., 2012).

Breast cancer

Note

Over-expression of huMETCAM has been shown

to promote tumorigenesis of four breast cancer cell

lines in athymic nude mice and perhaps the

malignant progression of breast cancer cells (Zeng

et al., 2011; Zeng et al., 2012).

Prognosis

Over-expression of huMETCAM/MUC18 has been

implicated in a poor prognosis of breast cancer.

Prostate cancer

Note


to promote tumorigenesis and metastasis of human

prostate cancer LNCaP cells in athymic nude mice

(Wu et al., 2001a; Wu et al., 2001b; Wu, 2004; Wu

et al., 2004; Wu et al., 2011).

Disease

Human prostate cancer (Wu et al., 2001a; Wu et al.,

2001b; Wu, 2004; Wu et al., 2004; Wu et al., 2011)

and the TRAMP models (Wu et al., 2005).

Prognosis


implicated in a poor prognosis of prostate cancer

(Wu et al., 2001a; Wu et al., 2001b, Wu, 2004).

Oncogenesis

METCAM/MUC18 promotes the oncogenesis of

human prostate cancer cells (Wu et al., 2001a; Wu

et al., 2001b; Wu, 2004; Wu et al., 2004; Wu et al.,

2011).

Melanoma

Note


to promote metastasis, but not the tumorigenesis, of

human melanoma (Xie et al., 1997; Schlagbauer-

Wadl et al., 1999) and mouse melanoma cells

(Yang et al., 2001; Wu et al., 2008) in

immunodeficent nude mice.

Prognosis


implicated in a poor prognosis of melanoma

(Lehmann et al., 1987; Shih, 1999).

Oncogenesis

METCAM does not appear to promote the

oncogenesis of human and most melanoma cells

(Wu et al., 2008).

References Lehmann JM, Riethmüller G, Johnson JP. MUC18, a marker of tumor progression in human melanoma, shows sequence similarity to the neural cell adhesion molecules of the immunoglobulin superfamily. Proc Natl Acad Sci U S A. 1989 Dec;86(24):9891-5

Shih IM, Elder DE, Hsu MY, Herlyn M. Regulation of Mel-CAM/MUC18 expression on melanocytes of different stages of tumor progression by normal keratinocytes. Am J Pathol. 1994a Oct;145(4):837-45

Shih IM, Elder DE, Speicher D, Johnson JP, Herlyn M. Isolation and functional characterization of the A32 melanoma-associated antigen. Cancer Res. 1994b May 1;54(9):2514-20

Taira E, Nagino T, Taniura H, Takaha N, Kim CH, Kuo CH, Li BS, Higuchi H, Miki N. Expression and functional analysis of a novel isoform of gicerin, an immunoglobulin superfamily cell adhesion molecule. J Biol Chem. 1995 Dec 1;270(48):28681-7

Bardin N, George F, Mutin M, Brisson C, Horschowski N, Francés V, Lesaule G, Sampol J. S-Endo 1, a pan-endothelial monoclonal antibody recognizing a novel human endothelial antigen. Tissue Antigens. 1996 Nov;48(5):531-9

Xie S, Luca M, Huang S, Gutman M, Reich R, Johnson JP, Bar-Eli M. Expression of MCAM/MUC18 by human melanoma cells leads to increased tumor growth and metastasis. Cancer Res. 1997 Jun 1;57(11):2295-303

Schlagbauer-Wadl H, Jansen B, Müller M, Polterauer P, Wolff K, Eichler HG, Pehamberger H, Konak E, Johnson JP. Influence of MUC18/MCAM/CD146 expression on human melanoma growth and metastasis in SCID mice. Int J Cancer. 1999 Jun 11;81(6):951-5

Shih IM. The role of CD146 (Mel-CAM) in biology and pathology. J Pathol. 1999 Sep;189(1):4-11

Anfosso F, Bardin N, Vivier E, Sabatier F, Sampol J, Dignat-George F. Outside-in signaling pathway linked to CD146 engagement in human endothelial cells. J Biol Chem. 2001 Jan 12;276(2):1564-9



Wu GJ, Wu MW, Wang SW, Liu Z, Qu P, Peng Q, Yang H, Varma VA, Sun QC, Petros JA, Lim SD, Amin MB. Isolation and characterization of the major form of human MUC18 cDNA gene and correlation of MUC18 over-expression in prostate cancer cell lines and tissues with malignant progression. Gene. 2001a Nov 14;279(1):17-31

Wu GJ, Varma VA, Wu MW, Wang SW, Qu P, Yang H, Petros JA, Lim SD, Amin MB. Expression of a human cell adhesion molecule, MUC18, in prostate cancer cell lines and tissues. Prostate. 2001b Sep 15;48(4):305-15

Yang H, Wang S, Liu Z, Wu MH, McAlpine B, Ansel J, Armstrong C, Wu G. Isolation and characterization of mouse MUC18 cDNA gene, and correlation of MUC18 expression in mouse melanoma cell lines with metastatic ability. Gene. 2001 Mar 7;265(1-2):133-45

Chambers AF, Groom AC, MacDonald IC. Dissemination and growth of cancer cells in metastatic sites. Nat Rev Cancer. 2002 Aug;2(8):563-72

Cavallaro U, Christofori G. Cell adhesion and signalling by cadherins and Ig-CAMs in cancer. Nat Rev Cancer. 2004 Feb;4(2):118-32

Wu GJ.. The role of MUC18 in prostate carcinoma. Immunohistochemistry and in situ hybridization of human carcinoma. Vol 1. Molecular pathology, lung carcinoma, breast carcinoma, and prostate carcinoma. Hayat, M.A. (Ed.), Elsevier Science/Academic Press. 2004; Chapter 7:347-358.

Wu GJ, Peng Q, Fu P, Wang SW, Chiang CF, Dillehay DL, Wu MW.. Ectopical expression of human MUC18 increases metastasis of human prostate cancer cells. Gene. 2004 Mar 3;327(2):201-13.

Wu GJ.. METCAM/MUC18 expression and cancer metastasis. Current Genomics. 2005; 6:333-349. (REVIEW)

Wu GJ, Fu P, Chiang CF, Huss WJ, Greenberg NM, Wu MW.. Increased expression of MUC18 correlates with the metastatic progression of mouse prostate adenocarcinoma in the TRAMP model. J Urol. 2005 May;173(5):1778-83.

Wu GJ, Fu P, Wang SW, Wu MW.. Enforced expression of MCAM/MUC18 increases in vitro motility and invasiveness and in vivo metastasis of two mouse melanoma K1735 sublines in a syngeneic mouse model. Mol Cancer Res. 2008 Nov;6(11):1666-77.

Wu GJ.. METCAM/MUC18, a cell adhesion molecule, plays positive or negative roles in the progression of different cancers. Current topics in Genetics 2010; 4:79-93. (REVIEW)

Wu GJ, Wu MW, Wang C, Liu Y.. Enforced expression of METCAM/MUC18 increases tumorigenesis of human prostate cancer LNCaP cells in nude mice. J Urol. 2011 Apr;185(4):1504-12. Epub 2011 Feb 19.

Zeng GF, Cai SX, Wu GJ.. Up-regulation of METCAM/MUC18 promotes motility, invasion, and tumorigenesis of human breast cancer cells. BMC Cancer. 2011 Mar 30;11:113.

Lin JC, Chiang CF, Wang SW, Wang WY, Kwan PC, Wu GJ.. Decreased expression of METCAM/MUC18 correlates with the appearance of, but its increased expression with metastasis of nasopharyngeal carcinoma. 2012, (submitted).

Wu GJ.. Dual roles of METCAM in the progression of different cancers. J Oncology 2012; in press. (REVIEW)

Wu GJ, Son ES, Dickerson EB, McDonald JF, Cohen C, Sanjay L, Wu MWH.. METCAM/MUC18 over-expression in human ovarian cancer tissues and metastatic lesions is associated with clinical progression. 2012, (submitted).

Zeng G, Cai S, Liu Y, Wu GJ.. METCAM/MUC18 augments migration, invasion, and tumorigenicity of human breast cancer SK-BR-3 cells. Gene. 2012 Jan 15;492(1):229-38. Epub 2011 Oct 26.


Wu GJ. MCAM (melanoma cell adhesion molecule). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):475-478.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


MIR100 (microRNA 100) Katia Ramos Moreira Leite

Laboratory of Medical Research, Urology Department, LIM55, University of Sao Paulo Medical

School, Brazil (KRML)


Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR100ID51447ch11q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIR100ID51447ch11q24.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: hsa-mir-100, MIRN100, miR-100

HGNC (Hugo): MIR100

Location: 11q24.1

Local order

- microRNA 125b-1

- BH3-like motif containing, cell death inducer

- microRNA let-7a-2

- microRNA 100 - Glutamate-ammonia ligase (glutamine synthetase)

pseudogene 3

- Ubiquitin associated and SH3 domain containing

B

Note

Human chromosome 11 (HSA11), is one of the

most gene- and disease-rich chromosomes in

humans with a gene density of 11,6 genes per

megabase, including 1524 protein-coding, and 69

microRNAs. It represents approximately 4,4% of

the human genome. There are hundreds of disorders

currently attributed to the chromosome, including

cancer susceptibility loci.

miR-100 is part of the family miR-99, that

comprehends:

hsa-miR-100

(AACCCGUAGAUCCGAACUUGUG)

hsa-miR-99a

(AACCCGUAGAUCCGAUCUUGUG)

hsa-miR-99b

(CACCCGUAGAACCGACCUUGCG).

Their predicted targets are:

SMARCD1, SMARCA5, mTOR, PPFIA3 (Sun et

al., 2011; Nagaraja et al., 2010), PLK1 (Petrelli et

al., 2012; Peng et al., 2012; Feng et al., 2011; Ugras

et al., 2011; Li et al., 2011; Shi et al., 2010),

CTDSPL (RBSP3) (Zeng et al., 2012), β-tubulin

(Lobert et al., 2011), ATM (Ng et al., 2010),

PPP3CA (Sylvius et al., 2011), FGFR3 (Cato et al.,

2009).

MIR100 (microRNA 100) Leite KRM


DNA/RNA

RNA - stem-loop.

Description

DNA sequence: hsa-mir-100 MI0000102.

CCUGUUGCCACAAACCCGUAGAUCCGAAC

UUGUGGUAUUAGUCCGCACAAGCUUGUAU

CUAUAGGUAUGUGUCUGUUAGG.

Transcription

Mature sequence: 13 - aacccguagauccgaacuugug -

34.

Protein

Note

microRNAs are not translated into amino acids.

Mutations

Note

Gene mutations have not been described.

Implicated in

Prostate cancer

Disease

miR-100 is down-regulated during the prostate

cancer progression, from high grade prostate

intraepithelial neoplasia through metastasis (Leite et

al., 2011a; Leite et al., 2011b). The same result was

posteriorly confirmed by Sun D et al. (2011) that

found miR-100 down-expressed in C4-2B, an

advanced prostate cancer cell line in comparison

with LNCaP an androgen-dependent prostate cancer

cell line. Porkka KP et al. have previously related

down-expression of miR-100 with hormone-

refractory tumors (Porkka et al., 2007).

Prognosis

Contradictorily, lower levels of miR-100 was

related to lower rates of biochemical recurrence in

patients with localized adenocarcinoma treated with

radical prostatectomy in a mean follow up of 58,8

months (Leite et al., 2011c).

Hepatocellular carcinoma

Disease

miR-100 is involved with HCC carcinogenesis

being down-regulated early, since the pre-

neoplastic lesions. A paralleled increase in polo like



kinase 1 (PLK1) suggests this gene as a target of

this miR-100 (Petrelli et al., 2012).

Ovarian cancer

Disease

In a microarray study of 74 ovarian cancer tissue

and cell lines miR-100 was shown to be down-

regulated in cancer specimens against normal tissue

together with miR-199a, miR-140, miR-145, and

miR-125b1 (Iorio et al., 2007).

Prognosis

miR-100 is significantly down-expressed in

epithelial ovarian cancer and related to FIGO stage,

lymph node metastasis, higher CA125 serum levels

and shorter overall survival (Peng et al., 2012).

Experimental studies with clear cell type ovarian

cancer, an aggressive variant of the tumor showed

that over-expression of miR-100 enhanced

sensitivity to the rapamycin analog RAD001

(everolimus), confirming the key relationship

between mir-100 and the mTOR pathway (Nagaraja

et al., 2010).

Lung cancer

Note

Drug resistance - miR-100 was shown to be down-

regulated in docetaxel-resistant SPC-A1/DTX cells

compared with parenteral SPC-A1 cells.

The ectopic miR-100 re-sensitized tumor cells to

docetaxel by suppression of cell proliferation,

G2/M arrest and induction to apoptosis.

Similar effect was identified knocking down PLK1,

reinforcing this mRNA as a miR-100 target (Feng

et al., 2011).

Leukemia

Disease

In acute myeloid leukemia (AML) miR-100 was

found to promote cell proliferation of

promyelocytic blasts and arrest the differentiation

to granulocyte/monocyte lineages. RBSP3, a

phosphatase-like tumor suppressor, important in

cell differentiation is a target of miR-100. miR-100

regulates G1/S transition and blocks the terminal

differentiation of cells targeting RBSP3 which in

turn modulates pRB/E2F1 (Zeng et al., 2012).

Prognosis

Differently in acute lymphoblastic leukemia (ALL)

miR-100 is down-regulated when compared to

normal samples.

Also the down-expression is related to higher count

of white blood cells and hyperdiploid karyotypes.

Increase in miR-100 expression is related to

t(12;21), biological feature associated to better

outcome (de Oliveira et al., 2012).

On the other hand miR-100 over-expression has

been related to vincristine and daunorubicin

resistance (Schotte et al., 2011).

Thyroid cancer

Prognosis

miRNA profile was used to differentiate benign and

malignant thyroid tumors in specimens obtained by

fine-needle aspiration biopsy. Diagnostic accuracy

of differentially expressed genes was determined by

analyzing receiver operating characteristics (ROC).

miR-100 was overexpressed in malignant follicular

neoplasia and in Hurthle cell carcinomas (Vriens et

al., 2011).

Pancreatic cancer

Disease

miR-100 was shown to be over-expressed in

chronic pancreatitis when compared with normal

pancreas and also over-expressed in pancreatic

cancer versus pancreatitis (Bloomston et al., 2007).

Breast cancer

Note

Drug resistance - Taxanes bind to β subunit of the

tubulin heterodimer and reduce microtubule

dynamics leading to cell cycle arrest in G2/M. miR-

100 is involved in the regulation of the expression

of β-tubulin class II and V, and a down-expression

of miR-100 is related to increase in the expression

of these isoforms of β-tubulin conferring MCF7

breast cancer cell line resistance to paclitaxel

(Lobert et al., 2011).

Disease

miR-100 has been described as down-regulated in

breast cancer, including male breast cancer (Fassan

et al., 2011).

Bladder cancer

Disease

Down-regulation of miR-100 has been described in

urothelial carcinomas, having as a main target the

mRNA of FGFR3. FGFR3 mutation is

characteristics of low-grade, non-invasive urothelial

carcinoma, and another possible pathway for

bladder cancer development would be the loss of

regulation of FGFR3 by down-expression of miR-

100 (Dip et al., 2012 in press; Song et al., 2010;

Catto et al., 2009).

Head and neck squamous cell carcinoma

Note

Drug resistance - Down-regulation of miR-100

together with miR-130a and miR-197 was related to

resistance of UMSCC-1 and SQ20B cell lines to

cisplatin, 5-fluorouracil, paclitaxel, methotrexate,

and doxorubicin (Dai et al., 2010).

Glioma

Note

Radio resistance - Higher expression of miR-100



confers radio-sensitivy to M059J and M059K

human malignant glioma cells, targeting ATM (Ng

et al., 2010).

Uterine cervix squamous carcinoma

Disease

The miR-100 expression was shown to be

significantly and gradually reduced from low-grade

CIN, high-grade CIN to cervical cancer tissues. It

was also reduced in HPV positive cervical cancer

cell lines. miR-100 down-expression influenced cell

proliferation, cycle and apoptosis, and the probable

mechanism is the loss of control of PLK1 protein

(Li et al., 2011).

Laminin A/C - related muscular dystrophy

Note

Physiopathology - miR-100, toghether with miR-

192, and miR-335 participate in muscle

differentiation and proliferation and are probably

involved in the development of the disease. miR-

100 expression induces up-regulation of myogenin

and α-actin and down-regulates Ki-67 a protein

related to proliferation. Sylvius et al. (2011) show

that miR-100 is involved with muscle

differentiation by targeting PPP3CA the calcineurin

gene. Calcineurin is a component of the calcium-

dependent signaling pathways and has been shown

to be involved in the regulation of skeletal muscle

differentiation, hypertrophy, and fiber-type

specification.

Psoriasis

Note

Physiopathology - mir-100 has been described as

down-regulated in psoriasis skin. It is probably

involved in the disease by repressing mTOR and

inhibiting angiogenesis. In this context, miR-100

has been called as a anti-angiomiR (Calin et al.,

2011).

References Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, Liu CG, Bhatt D, Taccioli C, Croce CM. MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA. 2007 May 2;297(17):1901-8

Iorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Casalini P, Taccioli C, Volinia S, Liu CG, Alder H, Calin GA, Ménard S, Croce CM. MicroRNA signatures in human ovarian cancer. Cancer Res. 2007 Sep 15;67(18):8699-707

Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, Visakorpi T. MicroRNA expression profiling in prostate cancer. Cancer Res. 2007 Jul 1;67(13):6130-5

Catto JW, Miah S, Owen HC, Bryant H, Myers K, Dudziec E, Larré S, Milo M, Rehman I, Rosario DJ, Di Martino E, Knowles MA, Meuth M, Harris AL, Hamdy FC. Distinct microRNA alterations characterize high- and low-grade bladder cancer. Cancer Res. 2009 Nov 1;69(21):8472-81

Fassan M, Baffa R, Palazzo JP, Lloyd J, Crosariol M, Liu CG, Volinia S, Alder H, Rugge M, Croce CM, Rosenberg A. MicroRNA expression profiling of male breast cancer. Breast Cancer Res. 2009;11(4):R58

Dai Y, Xie CH, Neis JP, Fan CY, Vural E, Spring PM.. MicroRNA expression profiles of head and neck squamous cell carcinoma with docetaxel-induced multidrug resistance. Head Neck. 2010 Nov 29. [Epub ahead of print]

Nagaraja AK, Creighton CJ, Yu Z, Zhu H, Gunaratne PH, Reid JG, Olokpa E, Itamochi H, Ueno NT, Hawkins SM, Anderson ML, Matzuk MM.. A link between mir-100 and FRAP1/mTOR in clear cell ovarian cancer. Mol Endocrinol. 2010 Feb;24(2):447-63. Epub 2010 Jan 15.

Ng WL, Yan D, Zhang X, Mo YY, Wang Y.. Over-expression of miR-100 is responsible for the low-expression of ATM in the human glioma cell line: M059J. DNA Repair (Amst). 2010 Nov 10;9(11):1170-5.

Shi W, Alajez NM, Bastianutto C, Hui AB, Mocanu JD, Ito E, Busson P, Lo KW, Ng R, Waldron J, O'Sullivan B, Liu FF.. Significance of Plk1 regulation by miR-100 in human nasopharyngeal cancer. Int J Cancer. 2010 May 1;126(9):2036-48.

Song T, Xia W, Shao N, Zhang X, Wang C, Wu Y, Dong J, Cai W, Li H.. Differential miRNA expression profiles in bladder urothelial carcinomas. Asian Pac J Cancer Prev. 2010;11(4):905-11.

Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM.. Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome. Hum Mol Genet. 2011 Oct 15;20(20):4025-40. Epub 2011 Aug 1.

Leite KR, Sousa-Canavez JM, Reis ST, Tomiyama AH, Camara-Lopes LH, Sanudo A, Antunes AA, Srougi M.. Change in expression of miR-let7c, miR-100, and miR-218 from high grade localized prostate cancer to metastasis. Urol Oncol. 2011a May-Jun;29(3):265-9. Epub 2009 Apr 16.

Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sanudo A, Camara-Lopes LH, Srougi M.. MicroRNA expression profiles in the progression of prostate cancer-from high-grade prostate intraepithelial neoplasia to metastasis. Urol Oncol. 2011b Aug 29. [Epub ahead of print]

Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sanudo A, Dall'Oglio MF, Camara-Lopes LH, Srougi M.. MicroRNA-100 expression is independently related to biochemical recurrence of prostate cancer. J Urol. 2011c Mar;185(3):1118-22. Epub 2011 Jan 21.

Li BH, Zhou JS, Ye F, Cheng XD, Zhou CY, Lu WG, Xie X.. Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein. Eur J Cancer. 2011 Sep;47(14):2166-74. Epub 2011 Jun 1.

Lobert S, Jefferson B, Morris K.. Regulation of beta-tubulin isotypes by micro-RNA 100 in MCF7 breast cancer cells. Cytoskeleton (Hoboken). 2011 Jun;68(6):355-62. doi: 10.1002/cm.20517. Epub 2011 Jun 14.

Schotte D, De Menezes RX, Moqadam FA, Khankahdani LM, Lange-Turenhout E, Chen C, Pieters R, Den Boer ML.. MicroRNA characterize genetic diversity and drug resistance in pediatric acute lymphoblastic leukemia. Haematologica. 2011 May;96(5):703-11. Epub 2011 Jan 17.

Sun D, Lee YS, Malhotra A, Kim HK, Matecic M, Evans C, Jensen RV, Moskaluk CA, Dutta A.. miR-99 family of MicroRNAs suppresses the expression of prostate-specific



antigen and prostate cancer cell proliferation. Cancer Res. 2011 Feb 15;71(4):1313-24. Epub 2011 Jan 6.

Sylvius N, Bonne G, Straatman K, Reddy T, Gant TW, Shackleton S.. MicroRNA expression profiling in patients with lamin A/C-associated muscular dystrophy. FASEB J. 2011 Nov;25(11):3966-78. Epub 2011 Aug 12.

Ugras S, Brill E, Jacobsen A, Hafner M, Socci ND, Decarolis PL, Khanin R, O'Connor R, Mihailovic A, Taylor BS, Sheridan R, Gimble JM, Viale A, Crago A, Antonescu CR, Sander C, Tuschl T, Singer S.. Small RNA sequencing and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma. Cancer Res. 2011 Sep 1;71(17):5659-69. Epub 2011 Jun 21.

Vriens MR, Weng J, Suh I, Huynh N, Guerrero MA, Shen WT, Duh QY, Clark OH, Kebebew E.. MicroRNA expression profiling is a potential diagnostic tool for thyroid cancer. Cancer. 2011 Oct 17. doi: 10.1002/cncr.26587. [Epub ahead of print]

de Oliveira JC, Scrideli CA, Brassesco MS, Morales AG, Pezuk JA, Queiroz Rde P, Yunes JA, Brandalise SR, Tone LG.. Differential miRNA expression in childhood acute lymphoblastic leukemia and association with clinical and biological features. Leuk Res. 2012 Mar;36(3):293-8. Epub 2011 Nov 17.

Dip N, Reis ST, Timozczuk LS, Abe DK, Dall'Oglio M, Srougi M, Leite K.. Under-expression of miR-100 may be a new Carcinogenic pathway for low-grade pTa Bladder Urothelial Carcinomas. J Mole Biomark Diag. 2012 in press.

Feng B, Wang R, Chen LB.. MiR-100 resensitizes docetaxel-resistant human lung adenocarcinoma cells (SPC-A1) to docetaxel by targeting Plk1. Cancer Lett. 2012 Apr 28;317(2):184-91. Epub 2011 Nov 25.

Peng DX, Luo M, Qiu LW, He YL, Wang XF.. Prognostic implications of microRNA-100 and its functional roles in human epithelial ovarian cancer. Oncol Rep. 2012 Apr;27(4):1238-44. doi: 10.3892/or.2012.1625. Epub 2012 Jan 11.

Petrelli A, Perra A, Schernhuber K, Cargnelutti M, Salvi A, Migliore C, Ghiso E, Benetti A, Barlati S, Ledda-Columbano GM, Portolani N, De Petro G, Columbano A, Giordano S.. Sequential analysis of multistage hepatocarcinogenesis reveals that miR-100 and PLK1 dysregulation is an early event maintained along tumor progression. Oncogene. 2012 Jan 16. doi: 10.1038/onc.2011.631. [Epub ahead of print]

Zheng YS, Zhang H, Zhang XJ, Feng DD, Luo XQ, Zeng CW, Lin KY, Zhou H, Qu LH, Zhang P, Chen YQ.. MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia. Oncogene. 2012 Jan 5;31(1):80-92. doi: 10.1038/onc.2011.208. Epub 2011 Jun 6.


Leite KRM. MIR100 (microRNA 100). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):479-483.

Gene Section Short Communication


INIST-CNRS

OPEN ACCESS JOURNAL


MIR145 (microRNA 145) Mohit Sachdeva, Yin Yuan Mo

Department of Radiation Oncology, Duke University Medical center, Durham, North Carolina-27710,

USA (MS), Department of Medical Microbiology, Immunology and Cell Biology, Southern Illinois

University School of Medicine, Springfield, IL 62794, USA (YYM)


Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR145ID50927ch5q32.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIR145ID50927ch5q32.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Other names: MIRN145, miR-145, miRNA145

HGNC (Hugo): MIR145

Location: 5q32

DNA/RNA Description

miR-145 is located on chromosome 5 (5q32-33)

within a 4.09 kb region (miRBase).

The pri-microRNA structure of miR-145 has not

been identified, yet it is suggested that it co-

transcribed with miR-143.

This gene has been implicated as both tumor and

metastasis suppressor in multiple tumor types

(Sachdeva and Mo, 2010a).

Transcription miR-145 is transcribed by RNA pol-II into pri-

miRNA sequence, which is first processed to pre-

miRNA (~88 bp long) involving RNA cutting and

exporting, and finally to mature miR-145. miR-145

is a p53-regulated gene.

Several reports suggest that miR-145 can be

induced transcriptionally by p53 in response to

stress such as serum starvation or anticancer drugs

(Sachdeva et al., 2009; Spizzo et al., 2010).

Interestingly, another report showed a novel

mechanism of posttranscriptional regulation of

miR-145 that occurs via p53-mediated RNA

processing (Suzuki et al., 2009).

Recently, a study demonstrates that activated Ras

can suppress miR-143/145 cluster through Ras-

responsive element-binding protein (RREB1),

which represses the miR-143/145 promoter (Kent et

al., 2010).

Pseudogene

There is no pseudogene reported for this gene.

Figure 1: A) Genomic localization of miR-145 gene on chromosome 5q32. B) Stem-loop structure of miR-145 (Red: mature miR-145 sequence).

http://www.mirbase.org/

MIR145 (microRNA 145) Sachdeva M, Mo YY


Protein

Note

Non-coding RNA.

Mutations

Note

No mutations have been found in mature miR-145

sequence; however, a study suggests that OVCAR8

(ovary) and NCI-H727 (lung) cells harbor

mutations in pri-miR-145, i.e., C-133A/pri-

microRNA/homozygous and G-5R (G/A)/pri-

microRNA/heterozygous, respectively. Yet, these

mutations do not have any effect on microRNA

processing (Diederichs and Haber, 2006).

Implicated in

Cancer

Note

Downregulation of miR-145 has been found in

cancers of many tissue types including colon,

breast, prostate, pancreas, etc. (Sachdeva et al.,

2009; Bandres et al., 2006; Michael et al., 2003).

For example, in situ hybridization detected

accumulation of miR-145 in normal colon epithelia

with no signal from adenocarcinomas cells. Loss of

miR-145 in various tumors suggests its role as a

tumor suppressor. In fact, miR-145 has been well

documented as a tumor suppressor gene in multiple

tumor types because of its anti-proliferative and

pro-apoptotic effects. It is shown that miR-145 can

negatively regulate multiple oncogenes such as

MYC, Kras, IRS-1, ERK5, etc. involved in cell

proliferation and survival (Sachdeva et al., 2009;

Kent et al., 2010; Shi et al., 2007; Ibrahim et al.,

2011).

Metastasis

Note

Several reports suggest that miR-145 is a

suppressor of metastasis. For example, mir-145

negatively regulates MUC1 and suppresses

invasion and metastasis of the breast cancer cells

(Sachdeva and Mo, 2010b). Similar findings in

prostate cancer and in gliomas have further

confirmed the role of miR-145 as a metastasis

suppressor by targeting genes including FASCN1

and SOX2, respectively (Fang et al., 2011;

Watahiki et al., 2011; Leite et al., 2011).

Stem cells and differentiation

Note

A study has shown that miR-145 is induced during

differentiation, and it directly silences the stem cell

self renewal and pluripotency program by

suppressing multiple pluripotent genes such as

OCT4, SOX2 and KLF4 (Xu et al., 2009).

Vascular smooth muscle cells

Note

The role of miR-145 in differentiation of vascular

smooth muscle cell (VSMC) has been recently

investigated. A report demonstrated that miR-145 is

the most enriched microRNA in arteries and its

expression is significantly downregulated in

vascular walls with neointimal lesions (Chen et al.,

2004). Similarly, another group, using transgenic

mouse model with miR-145 promoter fused to β-

galactosidase gene, found that miR-145 is cardiac-

specific and smooth-muscle specific microRNA

regulated by serum response factor, myocardin and

Nkx2-5 (NK2 transcription factor related, locus 5)

(Cordes et al., 2009). Further evidence from the

miR-43/miR-145 KO rats suggests that this

microRNA cluster is expressed mostly in the SMC

compartment in vessels and SMC-containing

organs and their loss induces an incomplete

differentiation of VSMCs (Elia et al., 2009).

5q syndrome

Note

A comprehensive study using clinical samples

combined with mouse models have found that

deletion of chromosome 5q correlates with loss of

two miRNAs that are abundant in hematopoietic

stem/progenitor cells (HSPCs), miR-145 and miR-

146a. In addition, they observed that miR-145 is

highly expressed in primitive lin- (mouse) and

CD34+ (human) bone marrow cells than committed

cells and stable knockdown of miR-145 in these

cells in mouse marrow results in 5-q syndrome

(Starczynowski et al., 2010). Similar work from

another group in patients with del (5q) have

decreased expression of miR-145 and increased

expression of Fli-1 (Kumar et al., 2011). They

found that miR-145 functions through repression of

Fli-1, a megakaryocyte and erythroid regulatory

transcription factor and thus, cells lacking miR-145

have impaired megakaryocyte and erythroid

differentiation.

References Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res. 2003 Oct;1(12):882-91

Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004 Jan 2;303(5654):83-6

Bandrés E, Cubedo E, Agirre X, Malumbres R, Zárate R, Ramirez N, Abajo A, Navarro A, Moreno I, Monzó M, García-Foncillas J. Identification by Real-time PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues. Mol Cancer. 2006 Jul 19;5:29

Diederichs S, Haber DA. Sequence variations of microRNAs in human cancer: alterations in predicted

MIR145 (microRNA 145) Sachdeva M, Mo YY


secondary structure do not affect processing. Cancer Res. 2006 Jun 15;66(12):6097-104

Shi B, Sepp-Lorenzino L, Prisco M, Linsley P, deAngelis T, Baserga R. Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90

Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, Lee TH, Miano JM, Ivey KN, Srivastava D. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. Nature. 2009 Aug 6;460(7256):705-10

Elia L, Quintavalle M, Zhang J, Contu R, Cossu L, Latronico MV, Peterson KL, Indolfi C, Catalucci D, Chen J, Courtneidge SA, Condorelli G. The knockout of miR-143 and -145 alters smooth muscle cell maintenance and vascular homeostasis in mice: correlates with human disease. Cell Death Differ. 2009 Dec;16(12):1590-8

Sachdeva M, Zhu S, Wu F, Wu H, Walia V, Kumar S, Elble R, Watabe K, Mo YY. p53 represses c-Myc through induction of the tumor suppressor miR-145. Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3207-12

Suzuki HI, Yamagata K, Sugimoto K, Iwamoto T, Kato S, Miyazono K. Modulation of microRNA processing by p53. Nature. 2009 Jul 23;460(7254):529-33

Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik KS. MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58

Kent OA, Chivukula RR, Mullendore M, Wentzel EA, Feldmann G, Lee KH, Liu S, Leach SD, Maitra A, Mendell JT. Repression of the miR-143/145 cluster by oncogenic Ras initiates a tumor-promoting feed-forward pathway. Genes Dev. 2010 Dec 15;24(24):2754-9

Sachdeva M, Mo YY. miR-145-mediated suppression of cell growth, invasion and metastasis. Am J Transl Res. 2010a Mar 25;2(2):170-80

Sachdeva M, Mo YY. MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1. Cancer Res. 2010b Jan 1;70(1):378-87

Spizzo R, Nicoloso MS, Lupini L, Lu Y, Fogarty J, Rossi S, Zagatti B, Fabbri M, Veronese A, Liu X, Davuluri R, Croce CM, Mills G, Negrini M, Calin GA. miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-alpha in human breast cancer cells. Cell Death Differ. 2010 Feb;17(2):246-54

Starczynowski DT, Kuchenbauer F, Argiropoulos B, Sung S, Morin R, Muranyi A, Hirst M, Hogge D, Marra M, Wells RA, Buckstein R, Lam W, Humphries RK, Karsan A. Identification of miR-145 and miR-146a as mediators of the 5q- syndrome phenotype. Nat Med. 2010 Jan;16(1):49-58

Fang X, Yoon JG, Li L, Yu W, Shao J, Hua D, Zheng S, Hood L, Goodlett DR, Foltz G, Lin B. The SOX2 response program in glioblastoma multiforme: an integrated ChIP-seq, expression microarray, and microRNA analysis. BMC Genomics. 2011 Jan 6;12:11

Ibrahim AF, Weirauch U, Thomas M, Grünweller A, Hartmann RK, Aigner A. MicroRNA replacement therapy for miR-145 and miR-33a is efficacious in a model of colon carcinoma. Cancer Res. 2011 Aug 1;71(15):5214-24

Kumar MS, Narla A, Nonami A, Mullally A, Dimitrova N, Ball B, McAuley JR, Poveromo L, Kutok JL, Galili N, Raza A, Attar E, Gilliland DG, Jacks T, Ebert BL. Coordinate loss of a microRNA and protein-coding gene cooperate in the pathogenesis of 5q- syndrome. Blood. 2011 Oct 27;118(17):4666-73

Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sañudo A, Camara-Lopes LH, Srougi M. MicroRNA expression profiles in the progression of prostate cancer-from high-grade prostate intraepithelial neoplasia to metastasis. Urol Oncol. 2011 Aug 29;

Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y. MicroRNAs associated with metastatic prostate cancer. PLoS One. 2011;6(9):e24950


Sachdeva M, Mo YY. MIR145 (microRNA 145). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):484-486.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)) Tiangang Zhuang, Mayumi Higashi, Venkatadri Kolla, Garrett M Brodeur

Children's Hospital of Philadelphia, Oncology Research, CTRB Rm 3018, 3501 Civic Center Blvd,

Philadelphia, PA 19104, USA (TZ, MH, VK, GMB)


Online updated version : http://AtlasGeneticsOncology.org/Genes/NMYC112.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI NMYC112.txt This article is an update of : Huret JL. MYCN (myc myelocytomatosis viral related oncogene, neuroblastoma derived). Atlas Genet Cytogenet Oncol Haematol 1998;2(2) This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names: bHLHe37, N-myc, MODED, ODED

HGNC (Hugo): MYCN

Location: 2p24.3

Local order: Centromeric to DDX1.

DNA/RNA

Description

3 exons.

Fluorescence in-situ hybridization of MYCN probe to metaphase and interphase nuclei of a primary neuroblastoma with MYCN amplification (Courtesy Garrett M. Brodeur, Children's Hospital of Philadelphia).

MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian))

Zhuang T, et al.


MYCN (2p24). Fluorescence in-situ hybridization of MYCN probe to metaphase spread (Courtesy Mariano Rocchi, Resources for Molecular Cytogenetics).

Protein

Description

464 amino acids; contains a phosphorylation site,

an acidic domain, an HLH motif, and a leucine

zipper in C-term; forms heterodimers with MAX

and binds to an E-box DNA recognition sequence.

The consensus sequence for the E-box element is

CANNTG, with a palindromic canonical sequence

of CACGTG.

Expression

MYCN is expressed in brain, eye, heart, kidney,

lung, muscle, ovary, placenta and thymus.

It is also expressed highly in several tumors:

glioma, lung tumor, primitive neuroectodermal

tumor, retinoblastoma (EST Profile).

Localisation

Nuclear.

Function

Probable transcription factor; possible role during

tissue differentiation.

Homology

With members of the myc family of helix-loop-

helix transcription factors.

Mutations

Somatic

Amplification, either in extrachromosomal double

minutes (DMs) or in homogeneously staining

regions within chromosomes (there is amplification

when, for example, 10 to 1000 copies of a gene are

present in a cell); found amplified in a variety of

human tumors, in particular in neuroblastoma and

also in retinoblastoma, small cell lung carcinoma,

astrocytoma; level of amplification related to the

tumor progression; transgenic mice that

overexpress MYCN in neuroectodermal cells

develop neuroblastoma.

Implicated in

Neuroblastoma

Note

Neuroblastoma karyotypes frequently reveal the

cytogenetic hallmarks of gene amplification,

namely DMs or HSRs. Schwab (Schwab et al.,

1983) and Kohl (Kohl et al., 1983) originally

identified the MYC-related oncogene MYCN as the

target of this amplification event.

MYCN is located on the distal short arm of

chromosome 2 (2p24), but in cells with MYCN

amplification, the extra copies reside within these

DMs or HSRs (Schwab et al., 1984).

Additional genes may be coamplified with MYCN

in a subset of cases (DDX1, NAG, ALK), but

MYCN is the only gene that is consistently

amplified from this locus. The magnitude of

MYCN amplification varies, but it averages 100-

200 copies per cell (range 5-500+ copies).The

overall prevalence of MYCN amplification is 18-

20%. Amplification of MYCN is associated with

advanced stages of disease, unfavorable biological

features, and a poor outcome (Brodeur et al., 1984;

Seeger et al., 1985), but it is also associated with

poor outcome in otherwise favorable patient groups

(such as infants, and patients with lower stages of

disease), underscoring its biological importance

(Seeger et al., 1985; Look et al., 1991; Tonini et al.,

1997; Katzenstein et al., 1998; Bagatell et al., 2005;

George et al., 2005; Schneiderman et al., 2008).

Therefore, the status of the MYCN gene is

routinely determined from neuroblastoma samples

obtained at diagnosis to assist in therapy planning

(Look et al., 1991; Schwab et al., 2004).

http://www.biologia.uniba.it/rmc/TUMORS/project.html

http://www.biologia.uniba.it/rmc/

http://www.biologia.uniba.it/rmc/

http://www.ncbi.nlm.nih.gov/UniGene/ESTProfileViewer.cgi?uglist=Hs.25960


Zhuang T, et al.


Indeed, because of the dramatic degree of MYCN

amplification and consequent overexpression in a

subset of aggressive neuroblastomas, it should be

an attractive therapeutic target (Pession and Tonelli,

2005; Bell et al., 2010).

Weiss and colleagues (Weiss et al., 1997) created a

transgenic mouse model of neuroblastoma, with

MYCN expression driven in adrenergic cells by the

tyrosine hydroxylase promoter (TH-MYCN

mouse). Genomic changes in neuroblastomas

arising in TH-MYCN mice closely parallel the

genomic changes found characteristically in human

tumors (Hackett et al., 2003). Thus, the TH-MYCN

mouse model appears to be a tractable model to

study neuroblastoma development, progression and

therapy (Chessler and Weiss, 2011).

Medulloblastoma

Note

MYCN amplification is less common in

medulloblastoma, a neural brain tumor of

childhood, but it is also associated with a worse

clinical outcome (Pfister et al., 2009). However,

recent evidence suggests that MYCN

overexpression is much more common in

medulloblastomas, compared to normal cerebellum

(Swartling et al., 2010), and it may drive the

initiation or progression of medulloblastomas

independent of the sonic hedgehog (SHH) pathway.

Indeed, MYCN amplification is found in both

SHH-driven and non-SHH-driven

medulloblastomas, but each subtype is associated

with other genetic features, suggesting they

represent genetically distinct subtypes with

different prognoses (Korshunov et al., 2011).

Rhabdomyosarcoma (RMS)

Note

MYCN amplification also occurs in a subset of

RMS, the most common pediatric soft tissue

sarcoma, although it tends to be at a lower level (4-

20 fold) than is found in neuroblastomas.

Amplification is found predominantly in the

alveolar subsest of RMS, and it is rarely found in

the more common form, called embryonal RMS

(Driman et al., 1994). However, MYCN expression

is found in the vast majority of RMS tumors,

regardless of histology, at least in primary tumors

(Toffolatti et al., 2002). For this reason,

Morgenstern and Anderson have suggested that it

would be an attractive therapeutic target for this

disease (Morgenstern and Anderson, 2006).

Wilms tumor

Note

Wilms tumor may occasionally show amplification

of the MYCN protooncogene (Schaub et al., 2007).

MYCN amplification is consistently associated

with overexpression, at least at the mRNA level.

Initially, MYCN amplification was associated

almost exclusively with the unfavorable, anaplastic

subset of Wilms tumors. However, Williams and

colleagues (Williams et al., 2011) found focal gain

of MYCN in a substantial number of both

anaplastic and favorable histologies in a survey of

over 400 tumors, suggesting that other genomic

changes may account for differences in clinical

behavior.

Other tumors (retinoblastoma, small cell lung cancer, glioblastoma multiforme)

Note

About 3-5% of primary retinoblastomas have

MYCN amplification, whereas it is much more

common (27%) in established retinoblastoma cell

lines (Bowles et al., 2007; Kim et al., 2008).

MYCN is amplified in 15-25% of small cell lung

cancers, and it may be more common in tumors at

relapse (Johnson et al., 1987; Johnson et al., 1992).

MYCN amplification rarely occurs in other lung

cancer histologies (Yokota et al., 1988). MYCN

amplification occurs in a substantial number of

glioblastoma multiformes (Hui et al., 2001;

Hodgson et al., 2008), but it is rarely found in lower

grade gliomas and astrocytomas.

References Kohl NE, Kanda N, Schreck RR, Bruns G, Latt SA, Gilbert F, Alt FW. Transposition and amplification of oncogene-related sequences in human neuroblastomas. Cell. 1983 Dec;35(2 Pt 1):359-67

Schwab M, Alitalo K, Klempnauer KH, Varmus HE, Bishop JM, Gilbert F, Brodeur G, Goldstein M, Trent J. Amplified DNA with limited homology to myc cellular oncogene is shared by human neuroblastoma cell lines and a neuroblastoma tumour. Nature. 1983 Sep 15-21;305(5931):245-8

Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science. 1984 Jun 8;224(4653):1121-4

Seeger RC, Brodeur GM, Sather H, Dalton A, Siegel SE, Wong KY, Hammond D. Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med. 1985 Oct 31;313(18):1111-6

Johnson BE, Ihde DC, Makuch RW, Gazdar AF, Carney DN, Oie H, Russell E, Nau MM, Minna JD. myc family oncogene amplification in tumor cell lines established from small cell lung cancer patients and its relationship to clinical status and course. J Clin Invest. 1987 Jun;79(6):1629-34

Yokota J, Wada M, Yoshida T, Noguchi M, Terasaki T, Shimosato Y, Sugimura T, Terada M. Heterogeneity of lung cancer cells with respect to the amplification and rearrangement of myc family oncogenes. Oncogene. 1988 Jun;2(6):607-11

Look AT, Hayes FA, Shuster JJ, Douglass EC, Castleberry RP, Bowman LC, Smith EI, Brodeur GM. Clinical relevance of tumor cell ploidy and N-myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol. 1991 Apr;9(4):581-91


Zhuang T, et al.


Johnson BE, Brennan JF, Ihde DC, Gazdar AF. myc family DNA amplification in tumors and tumor cell lines from patients with small-cell lung cancer. J Natl Cancer Inst Monogr. 1992;(13):39-43

Driman D, Thorner PS, Greenberg ML, Chilton-MacNeill S, Squire J. MYCN gene amplification in rhabdomyosarcoma. Cancer. 1994 Apr 15;73(8):2231-7

Tonini GP, Boni L, Pession A, Rogers D, Iolascon A, Basso G, Cordero di Montezemolo L, Casale F, Pession A, Perri P, Mazzocco K, Scaruffi P, Lo Cunsolo C, Marchese N, Milanaccio C, Conte M, Bruzzi P, De Bernardi B. MYCN oncogene amplification in neuroblastoma is associated with worse prognosis, except in stage 4s: the Italian experience with 295 children. J Clin Oncol. 1997 Jan;15(1):85-93

Weiss WA, Aldape K, Mohapatra G, Feuerstein BG, Bishop JM. Targeted expression of MYCN causes neuroblastoma in transgenic mice. EMBO J. 1997 Jun 2;16(11):2985-95

Katzenstein HM, Bowman LC, Brodeur GM, Thorner PS, Joshi VV, Smith EI, Look AT, Rowe ST, Nash MB, Holbrook T, Alvarado C, Rao PV, Castleberry RP, Cohn SL. Prognostic significance of age, MYCN oncogene amplification, tumor cell ploidy, and histology in 110 infants with stage D(S) neuroblastoma: the pediatric oncology group experience--a pediatric oncology group study. J Clin Oncol. 1998 Jun;16(6):2007-17

Hui AB, Lo KW, Yin XL, Poon WS, Ng HK. Detection of multiple gene amplifications in glioblastoma multiforme using array-based comparative genomic hybridization. Lab Invest. 2001 May;81(5):717-23

Toffolatti L, Frascella E, Ninfo V, Gambini C, Forni M, Carli M, Rosolen A. MYCN expression in human rhabdomyosarcoma cell lines and tumour samples. J Pathol. 2002 Apr;196(4):450-8

Hackett CS, Hodgson JG, Law ME, Fridlyand J, Osoegawa K, de Jong PJ, Nowak NJ, Pinkel D, Albertson DG, Jain A, Jenkins R, Gray JW, Weiss WA. Genome-wide array CGH analysis of murine neuroblastoma reveals distinct genomic aberrations which parallel those in human tumors. Cancer Res. 2003 Sep 1;63(17):5266-73

Schwab M. MYCN in neuronal tumours. Cancer Lett. 2004 Feb 20;204(2):179-87

Bagatell R, Rumcheva P, London WB, Cohn SL, Look AT, Brodeur GM, Frantz C, Joshi V, Thorner P, Rao PV, Castleberry R, Bowman LC. Outcomes of children with intermediate-risk neuroblastoma after treatment stratified by MYCN status and tumor cell ploidy. J Clin Oncol. 2005 Dec 1;23(34):8819-27

George RE, London WB, Cohn SL, Maris JM, Kretschmar C, Diller L, Brodeur GM, Castleberry RP, Look AT. Hyperdiploidy plus nonamplified MYCN confers a favorable prognosis in children 12 to 18 months old with disseminated neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol. 2005 Sep 20;23(27):6466-73

Pession A, Tonelli R. The MYCN oncogene as a specific and selective drug target for peripheral and central nervous system tumors. Curr Cancer Drug Targets. 2005 Jun;5(4):273-83

Morgenstern DA, Anderson J. MYCN deregulation as a potential target for novel therapies in rhabdomyosarcoma. Expert Rev Anticancer Ther. 2006 Feb;6(2):217-24

Bowles E, Corson TW, Bayani J, Squire JA, Wong N, Lai PB, Gallie BL. Profiling genomic copy number changes in

retinoblastoma beyond loss of RB1. Genes Chromosomes Cancer. 2007 Feb;46(2):118-29

Schaub R, Burger A, Bausch D, Niggli FK, Schäfer BW, Betts DR. Array comparative genomic hybridization reveals unbalanced gain of the MYCN region in Wilms tumors. Cancer Genet Cytogenet. 2007 Jan 1;172(1):61-5

Kim JH, Choi JM, Yu YS, Kim DH, Kim JH, Kim KW. N-myc amplification was rarely detected by fluorescence in situ hybridization in retinoblastoma. Hum Pathol. 2008 Aug;39(8):1172-5

Schneiderman J, London WB, Brodeur GM, Castleberry RP, Look AT, Cohn SL. Clinical significance of MYCN amplification and ploidy in favorable-stage neuroblastoma: a report from the Children's Oncology Group. J Clin Oncol. 2008 Feb 20;26(6):913-8

Hodgson JG, Yeh RF, Ray A, Wang NJ, Smirnov I, Yu M, Hariono S, Silber J, Feiler HS, Gray JW, Spellman PT, Vandenberg SR, Berger MS, James CD. Comparative analyses of gene copy number and mRNA expression in glioblastoma multiforme tumors and xenografts. Neuro Oncol. 2009 Oct;11(5):477-87

Pfister S, Remke M, Benner A, Mendrzyk F, Toedt G, Felsberg J, Wittmann A, Devens F, Gerber NU, Joos S, Kulozik A, Reifenberger G, Rutkowski S, Wiestler OD, Radlwimmer B, Scheurlen W, Lichter P, Korshunov A. Outcome prediction in pediatric medulloblastoma based on DNA copy-number aberrations of chromosomes 6q and 17q and the MYC and MYCN loci. J Clin Oncol. 2009 Apr 1;27(10):1627-36

Bell E, Chen L, Liu T, Marshall GM, Lunec J, Tweddle DA. MYCN oncoprotein targets and their therapeutic potential. Cancer Lett. 2010 Jul 28;293(2):144-57

Swartling FJ, Grimmer MR, Hackett CS, Northcott PA, Fan QW, Goldenberg DD, Lau J, Masic S, Nguyen K, Yakovenko S, Zhe XN, Gilmer HC, Collins R, Nagaoka M, Phillips JJ, Jenkins RB, Tihan T, Vandenberg SR, James CD, Tanaka K, Taylor MD, Weiss WA, Chesler L. Pleiotropic role for MYCN in medulloblastoma. Genes Dev. 2010 May 15;24(10):1059-72

Chesler L, Weiss WA. Genetically engineered murine models--contribution to our understanding of the genetics, molecular pathology and therapeutic targeting of neuroblastoma. Semin Cancer Biol. 2011 Oct;21(4):245-55

Williams RD, Al-Saadi R, Natrajan R, Mackay A, Chagtai T, Little S, Hing SN, Fenwick K, Ashworth A, Grundy P, Anderson JR, Dome JS, Perlman EJ, Jones C, Pritchard-Jones K. Molecular profiling reveals frequent gain of MYCN and anaplasia-specific loss of 4q and 14q in Wilms tumor. Genes Chromosomes Cancer. 2011 Dec;50(12):982-95

Korshunov A, Remke M, Kool M, Hielscher T, Northcott PA, Williamson D, Pfaff E, Witt H, Jones DT, Ryzhova M, Cho YJ, Wittmann A, Benner A, Weiss WA, von Deimling A, Scheurlen W, Kulozik AE, Clifford SC, Peter Collins V, Westermann F, Taylor MD, Lichter P, Pfister SM. Biological and clinical heterogeneity of MYCN-amplified medulloblastoma. Acta Neuropathol. 2012 Apr;123(4):515-27


Zhuang T, Higashi M, Kolla V, Brodeur GM. MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):487-490.

Gene Section Review


INIST-CNRS

OPEN ACCESS JOURNAL


PTBP1 (polypyrimidine tract binding protein 1) Laura Fontana

Department of Medicine, Surgery and Dentistry, Medical Genetics, Universita degli Studi di Milano,

Italy (LF)


Online updated version : http://AtlasGeneticsOncology.org/Genes/PTBP1ID46504ch19p13.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI PTBP1ID46504ch19p13.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Other names: HNRNP-I, HNRNPI, HNRPI, PTB,

PTB-1, PTB-T, PTB2, PTB3, PTB4, pPTB

HGNC (Hugo): PTBP1

Location: 19p13.3

DNA/RNA

Description

The PTBP1 locus spans 14936 bases on the short

arm of chromosome 19 and is composed of 14

exons.

Transcription

PTBP1 results from skipping of exon 9 (3203 bp

mRNA and 531 amino acid protein). Three

additional isoforms are generated by alternative

splicing: PTBP2 (3260 bp mRNA and 550 amino

acid protein) and PTBP4 (3281 mRNA protein and

557 amino acid protein) derive from exon 9

inclusion using two alternative 3' splice sites, while

PTB-T has been reported to result from alternative

splicing of exons 2-10 (Sawicka et al., 2004).

Pseudogene

PTBP1P (polypyrimidine tract binding protein 1

pseudogene), chromosome location 14q23.3, starts

at 65745938 and ends at 65748375 bp from pter

(according to hg19-Feb_2009).

Protein

Description

57 kDa protein belonging to the heterogeneous

nuclear ribonucleoprotein family (hnRNP). PTBP1

has four RNA recognition motifs (RRMs) and a

conserved N-terminal domain that harbors both

nuclear localisation and export signals (NLS and

NES).

Through the RRMs, PTBP1 binds to the transcript

at multiple sites within large pyrimidine tracts

leading to conformational changes suitable for

functional mRNA processing (Sawicka et al.,

2004).

Shematic representation of PTB mRNA alternative splicing. Alternative splicing of PTB mRNA, as described below, originates four isoforms. Green boxes represent exons and thin black lines represent introns (not to scale).

PTBP1 (polypyrimidine tract binding protein 1) Fontana L


Schematic representation of PTBP1 protein structure. Each RNA recognition motif (RRM) has different binding affinity for pyrimidine-rich sequences on mRNA. The N-terminal domain encloses partially overlapping nuclear localisation (NLS) and export

signals (NES). Blue boxes representing RRMs are not drawn to scale.

Expression

PTBP1 is ubiquitously expressed in human tissues

emerging as a pleiotropic splicing regulator. PTBP1

expression levels have been associated with

myoblast and neural precursor differentiation

through specific modulation of the splicing pattern

(Clower et al., 2010). In the brain, in particular, the

switch from PTBP1 to nPTB expression drives the

differentiation towards the neuronal lineage:

PTBP1 is expressed in neural precursors and glial

cells, while post-mitotic neurons express only

nPTB (Boutz et al., 2007). Recently a strong

PTBP1 expression has been found in embryonic

stem cells, particularly those in the brain cortex and

subventricular zone, where PTBP1 appears

essential for cell division after implantation

(Shibayama et al., 2009; Suckale et al., 2011).

Localisation

PTBP1 shuttles between the nucleus and the

cytoplasm. Cytoplasmic localisation is mainly

achieved by PKA-mediated phosphorylation of a

specific serine residue (Ser-16) within the nuclear

localisation signal. Cytoplasmic accumulation of

PTB occurs during cell stress (Sawicka et al.,

2008). PTBP1 has also been identified as a key

component in maintaining the integrity of the

perinucleolar compartment, a sub-nuclear structure

predominantly found in transformed cells (Wang et

al., 2003).

Function

PTB was originally identified as a regulator of

alternative splicing (Garcia-Blanco et al., 1989) but

other roles in mRNA processing have been

described (Sawicka et al., 2008).

Alternative splicing regulation: PTBP1

commonly acts as repressor of alternative splicing

favouring skipping of alternative exons. Different

models of PTBP1 activity have been proposed

(Spellman and Smith, 2006): 1) binding

competition with the splicing factor U2AF65 at the

3' splice site of alternative exons; 2) polymerization

of PTBP1 molecules on the alternative exon

masking splicing enhancer sequences; and 3)

looping out of alternative exon by PTBP1 binding

of flanking intronic sequences. Targets of PTBP1-

mediated repression of exon inclusion comprise α-

tropomiosin, α-actinin, GABAAγ2 (gamma-

aminobutyric acid Aγ2), c-src and FGFR2

(fibroblast growth factor receptor 2) (Li et al., 2007;

Spellman et al., 2005). Recent evidences indicate

that PTBP1 may also favour exon inclusion

depending on the position of its binding sites

relative to the target exon. Upon binding to the

upstream intron and/or within the exon, PTBP1

represses exon inclusion, while by binding to the

downstream intron, it activates exon inclusion. The

PTBP1 position-dependent activity relies on the

splice site features: in particular included exons

show weaker 5' splice sites, whereas skipped exons

have longer polypyrimidine tracts (Llorian et al.,

2010).

PTBP1 pre-mRNA undergoes PTBP1-mediated

alternative splicing too, as part of an autoregulatory

feedback loop: high levels of PTBP1 induce

skipping of exon 11 and hence mRNA degradation

via the nonsense-mediated mRNA decay (Spellman

et al., 2005).

3'-end processing: PTBP1 both promotes and

inhibits the mRNA 3'-end cleavage required for

polyadenylation. PTBP1 may prevent mRNA

polyadenylation through competition with the

cleavage stimulating factor (CstF), or stimulate

polyadenylation by binding to pyrimidine-rich

upstream elements (USEs).

mRNA transport: evidences for a role of PTBP1

in mRNA transport come from experiments in

Xenopus, where the PTBP1 homologue (VgRBP60)

is involved in the localisation of the Vg1 mRNA. In

vertebrates PKA-activated PTBP1 is involved in α-

actin mRNA localisation at neurite terminals.

mRNA stability: PTBP1 increases the stability of

specific transcript by binding to the untranslated

regions of mRNA and consequently competing with

factors involved in mRNA degradation. Transcripts

with PTB-mediated increased stability include

those of insulin, VEGF (vascular endothelial

growth factor), CD154 (cluster of differentiation

154) and iNOS (inducible nitric oxide synthase).

Viral translation and replication: PTBP1 acts as

an ITAF (IRES -internal ribosomal entry site- trans-

acting factor) for mRNA translation of virus

belonging to the Picornaviridae family and lacking

cap structure. PTBP1 seems to have a role as a viral

RNA chaperone that stabilizes or alters IRES



structure to direct ribosomes to the correct start

codon.

IRES-mediated translation: PTBP1 favours cap-

independent translation of few cellular RNAs under

cell stress, apoptosis or infection through ribosome

recruitment to IRES. In this case, PTBP1

cytoplasmic relocalisation is required.

Homology

PTBP1 shares 70-80% homology with two other

proteins: nPTB (neural PTB), expressed in adult

brain, muscle and testis, and ROD1 (regulator of

differentiation 1) only expressed in hematopoietic

cells. PTB also regulates alternative splicing of its

homologues, in particular the nonsense-mediated

decay of nPTB transcripts and the non-productive

splicing of ROD1 (Sawicka et al., 2008).

Mutations

Somatic

Three synonymous mutations have been reported in

cancer samples: c.510C>T (p.A170A) in kidney

carcinoma (Dalgliesh et al., 2010), c.1416C>T

(p.F472F) in melanoma (Wei et al., 2011) and

c.501G>A (p.S167S) in squamous cell carcinoma

of the mouth (Stransky et al., 2011). Moreover five

missense mutations have been identified in other

cancer samples: c.932C>T (p.A311V) in ovarian

carcinoma (Cancer Genome Atlas Research

Network, 2011), c.413C>T (p.T138I) in skin

squamous cell carcinoma (Durinck et al., 2011),

c.212C>T (p.T71M), c.666C>G (p.F222L) and

c.928G>A (p.G310R) in squamous cell carcinomas

of the mouth and larynx (Durinck et al., 2011;

Stransky et al., 2011).

Implicated in

Glioma

Note

PTBP1 is aberrantly overexpressed in glioma with

expression levels correlated with glial cell

transformation. The increased expression of PTBP1

contributes to gliomagenesis by deregulating the

alternative splicing of genes involved in cell

proliferation and migration (McCutcheon et al.,

2004; Cheung et al., 2006; Cheung et al., 2009).

FGFR-1 (fibroblast growth factor receptor-1):

PTBP1 overexpression increases FGFR-1 α-exon

skipping and hence the synthesis of a receptor with

higher affinity for fibroblast growth factor,

favouring transformed cell growth (Jin et al., 2000).

PKM (pyruvate kinase): PTBP1 overexpression

leads to the re-expression of the embryonic

pyruvate kinase isoform, PKM2, in transformed

glial cells. The switch from PKM1, normally

expressed in terminally differentiated cells, to

PKM2 is achieved through the PTBP1-mediated

inclusion in the PKM mRNA of exon 10, instead of

exon 9. In transformed cells PKM2 promotes

aerobic glycolysis and proliferation. Recently c-

Myc overexpression has been demonstrated to

upregulate PTBP1 transcription in transformed glial

cells (David et al., 2010).

USP5 (ubiquitin specific peptidase 5): PTBP1

overexpression in GBM forces the expression of

USP5 isoform 2, a protein involved in

ubiquitination. USP5 isoform 2 has a low activity

and favours cell growth and migration (Izaguirre et

al., 2011).

Ovarian tumour

Note

PTBP1 is overexpressed in the majority of

epithelial ovarian tumours and deregulates cell

proliferation, anchorage-dependent growth and

invasiveness. PTBP1 targets in ovarian transformed

cells have not yet been identified (He et al., 2007).

Alzheimer's disease (AD)

Note

Recent evidences delineate PTBP1 as a regulator of

the amyloid precursor protein (APP) in neurons. In

particular, PTBP1 altered expression in neuronal

cells, likely mediated by miR-124, enhances the

expression of APP isoforms including exon 7

and/or 8. These isoforms have been found enriched

in AD patients and associated with β-amyloid

production (Smith et al., 2011).

References García-Blanco MA, Jamison SF, Sharp PA. Identification and purification of a 62,000-dalton protein that binds specifically to the polypyrimidine tract of introns. Genes Dev. 1989 Dec;3(12A):1874-86

Jin W, McCutcheon IE, Fuller GN, Huang ES, Cote GJ. Fibroblast growth factor receptor-1 alpha-exon exclusion and polypyrimidine tract-binding protein in glioblastoma multiforme tumors. Cancer Res. 2000 Mar 1;60(5):1221-4

Wang C, Politz JC, Pederson T, Huang S. RNA polymerase III transcripts and the PTB protein are essential for the integrity of the perinucleolar compartment. Mol Biol Cell. 2003 Jun;14(6):2425-35

McCutcheon IE, Hentschel SJ, Fuller GN, Jin W, Cote GJ. Expression of the splicing regulator polypyrimidine tract-binding protein in normal and neoplastic brain. Neuro Oncol. 2004 Jan;6(1):9-14

Spellman R, Rideau A, Matlin A, Gooding C, Robinson F, McGlincy N, Grellscheid SN, Southby J, Wollerton M, Smith CW. Regulation of alternative splicing by PTB and associated factors. Biochem Soc Trans. 2005 Jun;33(Pt 3):457-60

Cheung HC, Corley LJ, Fuller GN, McCutcheon IE, Cote GJ. Polypyrimidine tract binding protein and Notch1 are independently re-expressed in glioma. Mod Pathol. 2006 Aug;19(8):1034-41

Spellman R, Smith CW. Novel modes of splicing repression by PTB. Trends Biochem Sci. 2006 Feb;31(2):73-6

Boutz PL, Stoilov P, Li Q, Lin CH, Chawla G, Ostrow K, Shiue L, Ares M Jr, Black DL. A post-transcriptional



regulatory switch in polypyrimidine tract-binding proteins reprograms alternative splicing in developing neurons. Genes Dev. 2007 Jul 1;21(13):1636-52

He X, Pool M, Darcy KM, Lim SB, Auersperg N, Coon JS, Beck WT. Knockdown of polypyrimidine tract-binding protein suppresses ovarian tumor cell growth and invasiveness in vitro. Oncogene. 2007 Jul 26;26(34):4961-8

Li Q, Lee JA, Black DL. Neuronal regulation of alternative pre-mRNA splicing. Nat Rev Neurosci. 2007 Nov;8(11):819-31

Sawicka K, Bushell M, Spriggs KA, Willis AE. Polypyrimidine-tract-binding protein: a multifunctional RNA-binding protein. Biochem Soc Trans. 2008 Aug;36(Pt 4):641-7

Cheung HC, Hai T, Zhu W, Baggerly KA, Tsavachidis S, Krahe R, Cote GJ. Splicing factors PTBP1 and PTBP2 promote proliferation and migration of glioma cell lines. Brain. 2009 Aug;132(Pt 8):2277-88

Shibayama M, Ohno S, Osaka T, Sakamoto R, Tokunaga A, Nakatake Y, Sato M, Yoshida N. Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation. FEBS J. 2009 Nov;276(22):6658-68

Clower CV, Chatterjee D, Wang Z, Cantley LC, Vander Heiden MG, Krainer AR. The alternative splicing repressors hnRNP A1/A2 and PTB influence pyruvate kinase isoform expression and cell metabolism. Proc Natl Acad Sci U S A. 2010 Feb 2;107(5):1894-9

David CJ, Chen M, Assanah M, Canoll P, Manley JL. HnRNP proteins controlled by c-Myc deregulate pyruvate kinase mRNA splicing in cancer. Nature. 2010 Jan 21;463(7279):364-8

Llorian M, Schwartz S, Clark TA, Hollander D, Tan LY, Spellman R, Gordon A, Schweitzer AC, de la Grange P, Ast G, Smith CW. Position-dependent alternative splicing activity revealed by global profiling of alternative splicing events regulated by PTB. Nat Struct Mol Biol. 2010 Sep;17(9):1114-23

. Integrated genomic analyses of ovarian carcinoma. Nature. 2011 Jun 29;474(7353):609-15

Durinck S, Ho C, Wang NJ, Liao W, Jakkula LR, Collisson EA, Pons J, Chan SW, Lam ET, Chu C, Park K, Hong SW, Hur JS, Huh N, Neuhaus IM, Yu SS, Grekin RC, Mauro TM, Cleaver JE, Kwok PY, Leboit PE, Getz G, Cibulskis K, Aster JC, Huang H, Purdom E, Li J, Bolund L, Arron ST, Gray JW, Spellman PT, Cho RJ. Temporal Dissection of Tumorigenesis in Primary Cancers. Cancer Discov. 2011 Jul;1(2):137-143

Izaguirre DI, Zhu W, Hai T, Cheung HC, Krahe R, Cote GJ. PTBP1-dependent regulation of USP5 alternative RNA splicing plays a role in glioblastoma tumorigenesis. Mol Carcinog. 2011 Oct 4;

Smith P, Al Hashimi A, Girard J, Delay C, Hébert SS. In vivo regulation of amyloid precursor protein neuronal splicing by microRNAs. J Neurochem. 2011 Jan;116(2):240-7

Stransky N, Egloff AM, Tward AD, Kostic AD, Cibulskis K, Sivachenko A, Kryukov GV, Lawrence MS, Sougnez C, McKenna A, Shefler E, Ramos AH, Stojanov P, Carter SL, Voet D, Cortés ML, Auclair D, Berger MF, Saksena G, Guiducci C, Onofrio RC, Parkin M, Romkes M, Weissfeld JL, Seethala RR, Wang L, Rangel-Escareño C, Fernandez-Lopez JC, Hidalgo-Miranda A, Melendez-Zajgla J, Winckler W, Ardlie K, Gabriel SB, Meyerson M, Lander ES, Getz G, Golub TR, Garraway LA, Grandis JR. The mutational landscape of head and neck squamous cell carcinoma. Science. 2011 Aug 26;333(6046):1157-60

Suckale J, Wendling O, Masjkur J, Jäger M, Münster C, Anastassiadis K, Stewart AF, Solimena M. PTBP1 is required for embryonic development before gastrulation. PLoS One. 2011 Feb 17;6(2):e16992


Fontana L. PTBP1 (polypyrimidine tract binding protein 1). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):491-494.

Gene Section Short Communication


INIST-CNRS

OPEN ACCESS JOURNAL


SOCS3 (suppressor of cytokine signaling 3) Zoran Culig

Experimental Urology, Department of Urology, Innsbruck Medical University, Anichstrasse 35, A-

6020 Innsbruck, Austria (ZC)


Online updated version : http://AtlasGeneticsOncology.org/Genes/SOCS3ID44124ch17q25.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI SOCS3ID44124ch17q25.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Other names: ATOD4, CIS3, Cish3, MGC71791,

SOCS-3, SSI-3, SSI3

HGNC (Hugo): SOCS3

Location: 17q25.3

DNA/RNA

Description

Size: 3300 bases.

Transcription

2 introns.

Transcription generates 3 different mRNAs, 2

spliced variants and 1 unspliced form.

Protein

Description

225 amino acids, 24770 Da.

Expression

Widely expressed in normal and tumor tissues.

Expression in tumors is variable due to its different

functions.

Localisation

Cytoplasm.

Function

SOCS is a negative regulator of cytokines that

signal through the JAK/STAT pathway. It binds to

tyrosine kinase receptors such as gp130 subunit of

receptors.

It interacts with cytokine receptors or JAK kinases

and interaction with growth factor receptors

(insulin-like growth factor-I, insulin, fibroblast

growth factor). It inhibits JAK2 kinase activity.

Part of the ubiquitin-protein ligase complex which

contains elongin, RNF7, and CUL5.

Binding to leptin.

Tumor promoting or tumor suppressive functions.

Antagonizing cAMP-antiproliferative effects.

SOCS3 suppresses erythropoietin in fetal liver and

IL-6 signaling in vivo.

Mutations

Note

Mutations not detected.

KIR = kinase inhibitory region.

SOCS3 (suppressor of cytokine signaling 3) Culig Z


Implicated in Lung cancer

Note

SOCS-3 acts as a tumor suppressor and is

frequently lost in the disease. Its transient

transfection in lung cancer cell lines leads to a

decrease in proliferation.

Liver cancer

Note

SOCS-3 is silenced by methylation. SOCS-3 is a

tumor suppressor in this malignancy. It is

implicated in regulation of migration of cancer

cells. SOCS-3 deletion enhances JAK/STAT and

FAK signaling.

Barret's adenocarcinoma

Note

SOCS-3 is methylated. It is considered as a tumor

suppressor.

Glioblastoma multiforme

Note

SOCS-3 expression is lost through promoter

methylation.

Head and neck squamous cell cancer

Note

SOCS-3 is frequently down-regulated as a result of

promoter methylation. It causes a growth inhibition.

Hematological malignancies

Note

SOCS-3 inhibits megakaryocytic growth,

overexpression of SOCS-3 is associated with a

decreased survival of patients with follicular

lymphoma.

Melanoma

Note

SOCS-3 is a tumor promoter in melanoma and is

constitutively expressed in several cell lines.

Prostate cancer

Note

SOCS-3 stimulates proliferation and inhibits

apoptosis in prostate cancer cells which do not

express the androgen receptor.

It may also antagonize the effects of fibroblasts

growth factor and mitogen-activated protein

kinases.

In androgen-sensitive prostate cancer cells, SOCS-3

is induced by androgen and may inhibit androgen-

stimulated proliferation and secretion.

Diabetes

Note

SOCS-3 may antagonize function of insulin-like

growth factors.

Various cancers

Prognosis

Loss of protein expression and promoter

hypermethylation occur in lung, liver cancer, head

and neck squamous cell cancer. Overexpression

occurs in melanoma and prostate cancer.

References Brender C, Nielsen M, Kaltoft K, Mikkelsen G, Zhang Q, Wasik M, Billestrup N, Odum N. STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma. Blood. 2001 Feb 15;97(4):1056-62

He B, You L, Uematsu K, Zang K, Xu Z, Lee AY, Costello JF, McCormick F, Jablons DM. SOCS-3 is frequently silenced by hypermethylation and suppresses cell growth in human lung cancer. Proc Natl Acad Sci U S A. 2003 Nov 25;100(24):14133-8

Niwa Y, Kanda H, Shikauchi Y, Saiura A, Matsubara K, Kitagawa T, Yamamoto J, Kubo T, Yoshikawa H. Methylation silencing of SOCS-3 promotes cell growth and migration by enhancing JAK/STAT and FAK signalings in human hepatocellular carcinoma. Oncogene. 2005 Sep 22;24(42):6406-17

Weber A, Hengge UR, Bardenheuer W, Tischoff I, Sommerer F, Markwarth A, Dietz A, Wittekind C, Tannapfel A. SOCS-3 is frequently methylated in head and neck squamous cell carcinoma and its precursor lesions and causes growth inhibition. Oncogene. 2005 Oct 6;24(44):6699-708

Bellezza I, Neuwirt H, Nemes C, Cavarretta IT, Puhr M, Steiner H, Minelli A, Bartsch G, Offner F, Hobisch A, Doppler W, Culig Z. Suppressor of cytokine signaling-3 antagonizes cAMP effects on proliferation and apoptosis and is expressed in human prostate cancer. Am J Pathol. 2006 Dec;169(6):2199-208

Komyod W, Böhm M, Metze D, Heinrich PC, Behrmann I. Constitutive suppressor of cytokine signaling 3 expression confers a growth advantage to a human melanoma cell line. Mol Cancer Res. 2007 Mar;5(3):271-81

O'Connor JC, Sherry CL, Guest CB, Freund GG. Type 2 diabetes impairs insulin receptor substrate-2-mediated phosphatidylinositol 3-kinase activity in primary macrophages to induce a state of cytokine resistance to IL-4 in association with overexpression of suppressor of cytokine signaling-3. J Immunol. 2007 Jun 1;178(11):6886-93

Capello D, Deambrogi C, Rossi D, Lischetti T, Piranda D, Cerri M, Spina V, Rasi S, Gaidano G, Lunghi M. Epigenetic inactivation of suppressors of cytokine signalling in Philadelphia-negative chronic myeloproliferative disorders. Br J Haematol. 2008 May;141(4):504-11

Martini M, Pallini R, Luongo G, Cenci T, Lucantoni C, Larocca LM. Prognostic relevance of SOCS3 hypermethylation in patients with glioblastoma multiforme. Int J Cancer. 2008 Dec 15;123(12):2955-60

Puhr M, Santer FR, Neuwirt H, Susani M, Nemeth JA, Hobisch A, Kenner L, Culig Z. Down-regulation of suppressor of cytokine signaling-3 causes prostate cancer cell death through activation of the extrinsic and intrinsic apoptosis pathways. Cancer Res. 2009 Sep 15;69(18):7375-84


Culig Z. SOCS3 (suppressor of cytokine signaling 3). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):495-496.

Leukaemia Section Short Communication


INIST-CNRS

OPEN ACCESS JOURNAL


i(17q) solely in myeloid malignancies Vladimir Lj Lazarevic

Department of Hematology, Skane University Hospital, Lund University, 22185, Lund, Sweden

(VLjL)


Online updated version : http://AtlasGeneticsOncology.org/Anomalies/i17qID1038.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI i17qID1038.txt This article is an update of : Bilhou-Nabera C. i(17q) in myeloid malignancies. Atlas Genet Cytogenet Oncol Haematol 2000;4(1) This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Note

An isochromosome 17 results in a loss of the short

arm (17p) and duplication of the long arm (17q)

leading to a single copy of 17p and three copies of

17q.

An i(17q), usually observed in a complex

karyotype, has been reported in solid tumors and in

various types of hematological diseases: acute

myeloid leukemias and chronic myeloid leukemias,

myelodysplastic syndromes and myeloproliferative

neoplasms, acute lymphoid leukemias and chronic

lymphoid leukemias, and Hodgkin and non-

Hodgkin lymphomas.

In chronic myeloid leukemia, i(17q) is a frequent

and well known secondary anomaly, either solely in

10% of cases, or with other additional anomalies ,

in at least another 10% of cases, in particular with

+8.

It is believed that i(17q) as a sole abnormality is a

distinctive clinicopathological entity with a high

risk to a leukemic progression; a subset may present

as de novo AML. These neoplasms have distinctive

morphologic features, including multilineage

dysplasia and concurrent myeloproliferative

features. Isochromosome 17q usually occurs at time

of blast transformation and heralds an aggressive

clinical course. In the 2008 World Health

Organization (WHO) classification system, myeloid

neoplasms with isochromosome 17q are only

briefly mentioned within the MDS/MPN category.

Clinics and pathology

Disease

Myeloproliferative neoplasm/myelodysplastic

syndrome (MPN/MDS)

Phenotype/cell stem origin

Previous studies on isolated i(17q) have suggested

this aberration was associated with chronic myeloid

abnormalities with a high rate of progression to

AML; a new clinico-pathological entity in which

i(17q) is the sole abnormality has been reported in a

mixed myeloproliferative disorder /

myelodysplastic syndrome with an aggressive

course.

Etiology

i(17q) as sole cytogenetic aberration represents only

1% of cases in myeloid malignancies.

Clinics

Isolated isochromosome 17q cases can be divided

into 2 distinct subgroups based on the presentation:

de novo AML and MDS/MPN.

All de novo AML fit into the WHO classification of

AML with myelodysplasia-related changes (with

the exception of 1 mixed phenotype acute

leukemia), and showed features of both

myelodysplasia (pseudo-Pelger-Huet-like

neutrophils, micromegakaryocytes) and

myeloproliferation (splenomegaly, hypercellularity,

reticulin fibrosis, osteosclerosis).

i(17q) solely in myeloid malignancies Lazarevic VLj


i(17q) G- banding (left) - Courtesy Jean-Luc Lai (top) and Diane H. Norback, Eric B. Johnson, and Sara Morrison-Delap, UW Cytogenetic Services (middle and bottom); and R- banding (right) - top: Editor, bottom: Courtesy Jacques Boyer

Cytology

A severe hyposegmentation of neutrophil nuclei

(pseudo-Pelger Huet neutrophils (PHH)) and a

prominence of the monocyte/macrophage lineage

has been noted; other studies have identified an

association between hyposegmented neutrophils

and loss of 17p (called 17p- syndrome), always

included in complex karyotypes; the i(17q)

appeared to be a part of the malignant clone as

demonstrated in cases available for a FISH

analysis: all myeloid cell lines observed contained

the abnormal i(17q), whereas none of the

lymphocytes were affected. Morphologically, all

showed myelodysplastic and myeloproliferative

features, including pseudo-Pelger-Huet-like

neutrophils, micromegakaryocytic hyperplasia,

hypercellularity, fibrosis, and osteosclerosis.

Pathology

We recommend that for cases with morphologic

features suggestive of isochromosome 17q, such as

pseudo-Pelger-Huet-like neutrophils or

micromegakaryocytes, a complete workup with

ancillary studies should be performed to explore

features of both myelodysplasia and

myeloproliferation to better classify the disease

process, including stains for reticulum and collagen,

immunostains using CD61 to reveal

micromegakaryocytes, CD34 and CD117 to

quantify the blasts on the core biopsy, iron stain to

assess storage iron and ring sideroblasts, butyrate

esterase stain to quantify monocytes, and

myeloperoxidase stain to determine percentage and

lineage of the blasts, as well as flow cytometry

immunophenotyping of the blasts, cytogenetic

analysis for the detection of isochromosome 17q,

and mutational studies of common molecular

markers seen in myeloid neoplasms.

Review of the peripheral blood smear and clinical

records with special attention to the presence of

splenomegaly may also be helpful.

Evolution

Mutational analyses showed rare mutations in

NRAS (3 of 10), FLT3 (2 of 16), and JAK2 (1 of

18), and no mutations in NPM1 (0 of 15), KIT (0 of

4), and CEBPA (0 of 4).

Mutations of JAK2, FLT3, RAS, NPM1, KIT, and

CEBPA are rare and appear to not play a critical

role in the pathogenesis of isochromosome 17q

leukemia.

Prognosis

Log-rank test, and univariate and multivariate Cox

proportional hazards regression analyses to evaluate

prognostic values of patients' characteristics,

including age >65 years, sex, leukocytosis, anemia,

thrombocytopenia, absolute monocytosis, elevated

lactate dehydrogenase, elevated β2-microglobulin,

splenomegaly, megakaryocytic hyperplasia,

dysgranulocytes, dyserythrocytes,

dysmegakaryocytes, increased blasts, bone

thickness, cytogenetic evidence of clonal evolution,

mutations of JAK2 V617F, FLT3, or NRAS, and

stem cell transplantation. In the univariate analysis,

log-rank test suggested that OS was significantly

associated with stem cell transplantation and

absolute monocytosis.

Patients with stem cell transplantation had a longer

survival (P = 0,042), and absolute monocytosis was

associated with a shorter survival (P = 0,016).



Kaplan-Meier curve of overall survival (OS) of patients with myeloid neoplasms and isolated isochromosome 17q is shown. The median OS of de novo acute myeloid leukemia (AML) and of myelodysplastic/myeloproliferative neoplasm (MDS/MPN) was 14,5

months and 11,0 months, respectively.

Cytogenetics

Cytogenetics molecular

DNA sequencing of exons 2-11 of the TP53 gene,

representing the entire coding region. No mutation

was detected in all 14 cases assessed. None of the

13 cases tested had bcr-abl1 fusion transcripts. It

has been proposed that TP53 deletion/mutation

might be responsible for the unique

clinicopathologic features of myeloid neoplasms

associated with isochromosome 17q. We can

conclude that DNA sequencing showed no mutation

in the involved TP53 allele.

Genes involved and proteins

Note

The underlying molecular defect that produces the

isolated i(17q) is unknown: breakage of the

proximal p arm (17p11.2) with rejoining of both

centromere-containing chromatids and subsequent

inactivation of one centromere; breakpoints could

involve important genetic material whose

disruption could result in oncogene or tumor

suppression gene deregulation.

In understanding the specific i(17q) phenotype, loss

of genes localized on 17p were suggested as p53

(17p13.1); a direct correlation between p53 loss and

PHH neutrophils was found in a series of MDS and

ANLL with 17p- syndrome. However, Fioretos et

al. assessed TP53 mutations in 5 Philadelphia

negative myeloid neoplasms with isolated

isochromosome.

17q by sequencing, and found no mutation in all 5

cases. Similarly, none of the 14 cases assessed in

another series of patients demonstrated TP53

mutation. These results suggest that there is no

association between isochromosome 17q and TP53

mutations, and that another oncogene(s) at 17q

and/or tumor suppressor gene(s) at 17p may play an

important role in the pathogenesis of

isochromosome 17q-associated myeloid neoplasms.

The presence of a moderate apoptotic rate also

suggests that the cytogenetically uninvolved TP53

allele is functional.

References Borgström GH, Vuopio P, de la Chapelle A. Abnormalities of chromosome No. 17 in myeloproliferative disorders. Cancer Genet Cytogenet. 1982 Feb;5(2):123-35

Testa JR, Cohen BC. Dicentric chromosome 17 in patients with leukemia. Cancer Genet Cytogenet. 1986 Sep;23(1):47-52

Becher R, Carbonell F, Bartram CR. Isochromosome 17q in Ph1-negative leukemia: a clinical, cytogenetic, and molecular study. Blood. 1990 Apr 15;75(8):1679-83

Lai JL, Preudhomme C, Zandecki M, Flactif M, Vanrumbeke M, Lepelley P, Wattel E, Fenaux P. Myelodysplastic syndromes and acute myeloid leukemia with 17p deletion. An entity characterized by specific dysgranulopoïesis and a high incidence of P53 mutations. Leukemia. 1995 Mar;9(3):370-81

Fugazza G, Bruzzone R, Puppo L, Sessarego M. Granulocytes with segmented nucleus retain normal chromosomes 17 in Philadelphia chromosome-positive



chronic myeloid leukemia with i(17q) and pseudo-Pelger anomaly. A case report studied with fluorescence in situ hybridization. Cancer Genet Cytogenet. 1996 Sep;90(2):166-70

Jary L, Mossafa H, Fourcade C, Genet P, Pulik M, Flandrin G. The 17p-syndrome: a distinct myelodysplastic syndrome entity? Leuk Lymphoma. 1997 Mar;25(1-2):163-8

Fioretos T, Strömbeck B, Sandberg T, Johansson B, Billström R, Borg A, Nilsson PG, Van Den Berghe H, Hagemeijer A, Mitelman F, Höglund M. Isochromosome 17q in blast crisis of chronic myeloid leukemia and in other hematologic malignancies is the result of clustered breakpoints in 17p11 and is not associated with coding TP53 mutations. Blood. 1999 Jul 1;94(1):225-32

Lazarević V, Djordjević V, Magić Z, Marisavljevic D, Colović M. Refractory anemia with ring sideroblasts associated with i(17q) and mutation of the TP53 gene. Cancer Genet Cytogenet. 2002 Jul 1;136(1):86-9

Kanagal-Shamanna R, Bueso-Ramos CE, Barkoh B, Lu G, Wang S, Garcia-Manero G, Vadhan-Raj S, Hoehn D, Medeiros LJ, Yin CC. Myeloid neoplasms with isolated isochromosome 17q represent a clinicopathologic entity associated with myelodysplastic/myeloproliferative features, a high risk of leukemic transformation, and wild-type TP53. Cancer. 2012 Jun 1;118(11):2879-88


Lazarevic VLj. i(17q) solely in myeloid malignancies. Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):497-500.



INIST-CNRS

OPEN ACCESS JOURNAL


inv(11)(q13q23) Adrian Mansini, Claus Meyer, Marta Susana Gallego, Jorge Rossi, Patricia Rubio, Adriana

Medina, Rolf Marschalek, Maria Felice, Cristina Alonso

Dept. Hematology and Oncology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina; Agencia

Nacional de Promocion Cientifica y Tecnologica, MINCyT, Argentina (AM), Inst. Pharm Biology,

Goethe-University, Biocenter/DCAL, Max-von-Laue-Str. 9, D-60438 Frankfurt/Main, Germany

(CM), Dept. Genetics, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (MSG), Dept.

Immunology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (JR), Dept. Hematology and

Oncology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (PR, AM, MF, CA), Inst. Pharm

Biology, Goethe-University, Biocenter/DCAL, Max-von-Laue-Str. 9, D-60438 Frankfurt/Main,

Germany (RM)

Published in Atlas Database: March 2012

Online updated version : http://AtlasGeneticsOncology.org/Anomalies/inv11q13q23ID1585.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI inv11q13q23ID1585.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology


Disease

Infant acute lymphoblastic leukemia (ALL)

Epidemiology

Poorly defined, only one case described to date, a 9-

months-old boy with Pro-B ALL (FAB L1) (Alonso

et al., 2010).

Evolution

Patient achieved complete remission on day 33 of

treatment and 5 months since diagnosis presented a

bone marrow relapse.

The patient had no available compatible donor and

he did not receive a second line treatment and

palliative care was administered.

He died due to progressive disease.

Prognosis

Infant-ALL with 11q23 abnormality/MLL gene

rearrangement has been defined as a type of

leukemia with poor prognosis (Pieters et al., 2007).

The patient relapsed at +5 months and died due to

progressive disease.

Genetics

Note

Fusion gene MLL-BTBD18 (Alonso et al., 2010)

was detected by LDI-PCR, as described (Meyer et

al., 2005).

Partial G-banded karyogram for the inv(11)(q13q23), showing both chromosomes 11.

inv(11)(q13q23) Mansini A, et al.


Split-FISH: The hybridization pattern for the chromosome with the MLL-BTBD18 rearrangement is one red/one green signal, while the yellow signal represents the germline MLL allele.

Cytogenetics

Cytogenetics morphological

46,XY,inv(11)(q13q23) as sole abnormality.


Split-FISH analysis revealed two signals

corresponding to the 3' and the 5' probes, both on

the long arm of chromosome 11 (Alonso et al.,

2010).

Probes

MLL Dual Color Break Apart Rearrangement

Probe.


MLL

Location

11q23

DNA/RNA

The Mixed-Lineage Leukemia gene consists of at

least 37 exons, encoding a 3969 amino-acid nuclear

protein with a molecular weight of nearly 431 kDa.

Schematic diagram of the exon/intron structure of the MLL gene (Nilson et al., 1996).



Fusion sequence of the MLL-BTBD18 fusion transcript.

Schematic diagram of the structure of the predicted MLL-BTBD18 fusion protein.

Protein

431 kDa; contains two DNA binding motifs (a AT

hook and Zinc fingers), and a DNA methyl

transferase motif; wide expression; nuclear

localisation; transcriptional regulatory factor.

BTBD18

Location

11q12.1

Protein

712 amino acids; 78 kDa.

Result of the chromosomal anomaly

Hybrid gene

Description

In frame fusion between the truncated MLL exon

10 and the truncated BTBD18 exon 3.

Transcript

MLL-BTBD18.

Detection

RT-PCR (van Dongen et al., 1999; Alonso et al.,

2010).

Fusion protein

Description

Fusion protein of 1989 amino acids containing

1374 codons from the amino-terminal region of

MLL and 614 codons from the carboxy terminal

portion of the BTBD18 protein, plus "fusion codon"

consisting of two nucleotides derived from the

MLL gene sequence and one from BTBD18 gene

sequence. The chimeric protein of 1989 amino

acids retains a major portion of MLL, including

those domains known to be essential for leukemic

transformation: the AT-hooks and the DNA

methyltransferase domain (DNMT). The C-terminal

sequences are derived from the BTBD18 protein, a

new fusion partner. The fusion occurred with in the

BTB/POZdomain of BTBD18 (Alonso et al., 2010).

To be noted

Note

Additional cases are needed to delineate the

epidemiology and prognosis of this entity, even

when MLL abnormalities are associated with poor

prognosis, especially when they are identified in

infant leukemias (Pieters et al., 2007).

References Nilson I, Löchner K, Siegler G, Greil J, Beck JD, Fey GH, Marschalek R. Exon/intron structure of the human ALL-1 (MLL) gene involved in translocations to chromosomal region 11q23 and acute leukaemias. Br J Haematol. 1996 Jun;93(4):966-72

van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F, Parreira A, Gameiro P, Diáz MG, Malec M, Langerak AW, San Miguel JF, Biondi A. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia. 1999 Dec;13(12):1901-28

Meyer C, Schneider B, Reichel M, Angermueller S, Strehl S, Schnittger S, Schoch C, Jansen MW, van Dongen JJ, Pieters R, Haas OA, Dingermann T, Klingebiel T, Marschalek R. Diagnostic tool for the identification of MLL rearrangements including unknown partner genes. Proc Natl Acad Sci U S A. 2005 Jan 11;102(2):449-54



Stogios PJ, Downs GS, Jauhal JJ, Nandra SK, Privé GG. Sequence and structural analysis of BTB domain proteins. Genome Biol. 2005;6(10):R82

Pieters R, Schrappe M, De Lorenzo P, Hann I, De Rossi G, Felice M, Hovi L, LeBlanc T, Szczepanski T, Ferster A, Janka G, Rubnitz J, Silverman L, Stary J, Campbell M, Li CK, Mann G, Suppiah R, Biondi A, Vora A, Valsecchi MG. A treatment protocol for infants younger than 1 year with acute lymphoblastic leukaemia (Interfant-99): an observational study and a multicentre randomised trial. Lancet. 2007 Jul 21;370(9583):240-50

Alonso CN, Meyer C, Gallego MS, Rossi JG, Mansini AP, Rubio PL, Medina A, Marschalek R, Felice MS. BTBD18: A novel MLL partner gene in an infant with acute lymphoblastic leukemia and inv(11)(q13;q23). Leuk Res. 2010 Nov;34(11):e294-6


Mansini A, Meyer C, Gallego MS, Rossi J, Rubio P, Medina A, Marschalek R, Felice M, Alonso C. inv(11)(q13q23). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):501-504.



INIST-CNRS

OPEN ACCESS JOURNAL


t(2;9)(q37;q34) Purvi M Kakadia, Stefan K Bohlander

Center for Human genetics, Philipps University Marburg, Baldingerstrasse, Marburg, Germany (PMK,

SKB)

Published in Atlas Database: March 2012

Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0209q37q34ID1577.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t0209q37q34ID1577.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names

INPP5D/ABL1 fusion

SHIP1/ABL1 fusion


Disease

c-ALL

Epidemiology

Only one case known to date, a 18-year-old female

patient.

Clinics

Immature lymphoid blast population CD19+,

CD10+, with no co-expression of myeloid markers.

Treatment

Treated with Imatinib; a complete remission (CR)

was obtained. Continued CR after bone marrow

transplantation (Follow-up: 15 months).

Cytogenetics

Cytogenetics morphological

Normal karyotype. This translocation would be

hard to detect using conventional cytogenetics.

Figure 1: FISH analysis: (I) Interphase nuclei showing four FISH signals for ABL1 (orange) with a commercial BCR/ABL-DCDF probe. (II) Schematic diagram showing the position of the BAC clones corresponding to the 3' and 5' portions of the SHIP1 and

ABL1 genes, with the color scheme used for the fluorescent labelling of the SHIP1/ABL1 DCDF probes. The BAC clones for SHIP1 were labelled with FITC and those for ABL1 were labelled with Texas Red. (SHIP1 clones: A: RP13-497I2 and B: RP13-916J2; ABL1 BAC clones: C: RP11-57C19 and D: RP11-835J22). (III-V) Interphase FISH demonstrating the presence of three

fusion signals using the SHIP1-ABL1-DCDF probes (III), two SHIP1-ABL1 fusion signals, when SHIP1-ABL1 fusion specific probes were used (IV) and presence of one reciprocal ABL1/SHIP1 fusion using the ABL1-SHIP1 fusion specific FISH probe (V)

in the patient sample. With all three probe combinations one normal copy of each the SHIP1 and ABL1 locus was also confirmed. The probes used for the hybridization are indicated below each image. The fusion signals (yellow) are indicated by

arrows.

t(2;9)(q37;q34) Kakadia PM, Bohlander SK



ABL1 rearrangement observed in interphase cells

but not on metaphase chromosomes by FISH using

commercial BCR-ABL-DCDF probes (Abbott).

FISH using SHIP-ABL-DCDF FISH probes

showed two fusion signals indicating the SHIP1-

ABL1 fusion and one fusion signal for the

reciprocal fusion on interphase cells. The

rearrangement was not observed on the metaphase

chromosomes, possibly because the malignant cells

did not go into mitosis.


INPP5D

Location

2q37.1

Note

Other names: SHIP, SHIP1, SIP-145, hp51CN.

DNA/RNA

Transcript variant 1: NM_001017915.1; 26 exons,

4928 bp mRNA.

Transcript variant 2: NM_005541.3; 26 exons, 4925

bp mRNA.

There is also an INPP5D transcript variant

described with 29 exons in the Ensembl database

(INPP5D-201 ENST00000359570).

Protein

Proteins: Variant 1 contains 1189 aa and Variant 2

contains 1188 aa.

Domains: An N-terminal SH2 domain, an inositol

phosphatase domain and two C-terminal protein

interaction domains (Figure 3, upper box).

Expression: The expression of SHIP1 is restricted

to hematopoietic cells.

Localization: Cytosol and plasma membrane; the

localization of SHIP1 (cytosol vs. plasma

membrane) is regulated by its SH2 domain which

mediates interaction with tyrosine phosphorylated

receptors.

Function: SHIP1 is a phosphatase, which

hydrolyzes the 5-phosphates from

phosphatidylinositol (3,4,5)-trisphosphate

(Ptdins(3,4,5)P3; PIP3) and inositol-1,3,4,5

tetrakisphosphate (Ins(1,3,4,5)P4; PIP4) (Damen et

al., 1996), thereby negatively regulating the PI3K

(phosphoinositide 3-kinase) pathway.

The PI3K pathway is part of many important

signalling pathways and regulates key cellular

functions such as survival, proliferation, cell

activation and cell migration (Krystal, 2000; Ward

and Cantrell, 2001; Ward, 2006).

SHIP1 regulates these important cellular functions

by controlling PIP3 levels and Ras activity

following cytokine stimulation (Batty et al., 1985;

Damen et al., 1996).

Homology: Belongs to the inositol-1,4,5-

trisphosphate 5-phosphatase family.

Contains an SH2 domain.

ABL1

Location

9q34

Figure 2: Partial sequence of the PCR product showing an in-frame fusion of SHIP1 with ABL1.

t(2;9)(q37;q34) Kakadia PM, Bohlander SK


Figure 3: The upper two diagrams show the SHIP1 and the ABL1 proteins and the lower diagram depicts the SHIP1/ABL1 fusion protein. The arrows indicate the breakpoints in the individual proteins; numbers indicate amino acid positions. SH2: Src homology-2 domain; SH3: Src homology-3 domain; 5-ptase: Inositol 5-phosphatase domain; INPNY and ENPLY: Target

sequences for the phospho tyrosine binding domains of other proteins; TK: Tyrosine kinase domain; DB: DNA binding domain; AD: Actin-binding domain.


Hybrid gene

Transcript

Only SHIP1-ABL1 fusion transcript was detected.

The reciprocal ABL1-SHIP1 fusion transcript was

not detected.

Detection

The SHIP1-ABL1 fusion transcript can be detected

by 5' SHIP1 forward primer (bp 997-1015): 5'-

TTGCTGCACGAGGGTCCTG-3' and 3' ABL1

reverse primer (bp 1474-1454): 5'-

TCTCCAGACTGTTGACTGGCG-3' resulting in

477 bp PCR product.

Fusion protein

Description

The fusion protein leads to the constitutive

activation of the ABL1 tyrosine kinase facilitated

by the homo-di- and homo-heteromerization of the

fusion protein via the dimerization domain within

the N-terminal SHIP1 portion contained in the

fusion protein.

Oncogenesis

Constitutive activation of ABL1 tyrosine kinase

activity and possibly inactivation of the putative

tumor suppressor function of SHIP1.

References Batty IR, Nahorski SR, Irvine RF. Rapid formation of inositol 1,3,4,5-tetrakisphosphate following muscarinic receptor stimulation of rat cerebral cortical slices. Biochem J. 1985 Nov 15;232(1):211-5

Damen JE, Liu L, Rosten P, Humphries RK, Jefferson AB, Majerus PW, Krystal G. The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate 5-phosphatase. Proc Natl Acad Sci U S A. 1996 Feb 20;93(4):1689-93

Krystal G. Lipid phosphatases in the immune system. Semin Immunol. 2000 Aug;12(4):397-403

Ward SG, Cantrell DA. Phosphoinositide 3-kinases in T lymphocyte activation. Curr Opin Immunol. 2001 Jun;13(3):332-8

Ward SG. T lymphocytes on the move: chemokines, PI 3-kinase and beyond. Trends Immunol. 2006 Feb;27(2):80-7

Kakadia PM, Tizazu B, Mellert G, Harbott J, Röttgers S, Quentmeier H, Spiekermann K, Bohlander SK. A novel ABL1 fusion to the SH2 containing inositol phosphatase-1 (SHIP1) in acute lymphoblastic leukemia (ALL). Leukemia. 2011 Oct;25(10):1645-9


Kakadia PM, Bohlander SK. t(2;9)(q37;q34). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):505-507.

Solid Tumour Section Short Communication


INIST-CNRS

OPEN ACCESS JOURNAL


Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24) Karolin H Nord

Department of Clinical Genetics, University and Regional Laboratories, Skane University Hospital,

Lund University, Lund, Sweden (KHN)


Online updated version : http://AtlasGeneticsOncology.org/Tumors/t0110p22q24MyoInfFibSID6369.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t0110p22q24MyoInfFibSID6369.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

Other names

MIFS was originally described as acral MIFS

(Meis-Kindblom and Kindblom, 1998).

Note

MIFS is an intermediate malignant soft tissue tumor

usually located in the subcutaneous tissue of distal

extremities (Kindblom et al., 2002).

Distant metastases are rare but the tumor has a

propensity for multiple local recurrences. An

identical t(1;10)(p22;q24) has been found in MIFS

and hemosiderotic fibrolipomatous tumor (HFLT)

(Hallor et al., 2009; Antonescu et al., 2011). HFLT

is an intermediate malignant tumor of uncertain

differentiation, morphologically distinct from

MIFS.

In similarity with MIFS, HFLT has a predilection

for superficial soft tissue of distal extremities and

present frequent local recurrences.

Despite their usually distinct morphology, there are

tumors with mixed HFLT/MIFS histology (Elco et

al., 2010).

These tumors also show a t(1;10) and suggest that

there are either different morphological variants or

different levels of tumor progression of a sole

biological entity (Antonescu et al., 2011).

Classification

Note

MIFS is an intermediate malignant

fibroblastic/myofibroblastic soft tissue tumor.


Disease

Myxoinflammatory fibroblastic sarcoma (MIFS)

Phenotype / cell stem origin

The origin of the tumor cells is unknown. Their

fibroblastic/myofibroblastic differentiation

indicates that they derive from a mesenchymal

precursor.

Etiology

Unknown.

Epidemiology

MIFS is a rare soft tissue tumor which primarily

affects adults without any gender predilection.

Clinics

MIFS is an intermediate malignant tumor that

usually presents as a slowly-growing, poorly-

delineated mass of the superficial soft tissue of

distal extremities (Kindblom et al., 2002). It is

sometimes associated with pain and decreased

mobility. In many cases the growth has been noted

for a relatively long period of time before

diagnosis. MIFS may be confused with

inflammatory or post-traumatic lesions, benign or

other malignant soft tissue tumors. Local

recurrences are common but distant metastases are

very rare.

Pathology

MIFS show a poorly delineated, multinodular

Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24)

Nord KH


growth pattern with alternating myxoid and cellular

areas (Kindblom et al., 1998). There is a prominent

inflammatory infiltrate that may obscure the

neoplastic cells and cause misdiagnoses of a

reactive or inflammatory process. Tumor cells,

including large polygonal and bizarre ganglion-like

cells with prominent inclusion-like nucleoli and

variably sized, multivacuolated lipoblast-like cells,

may be scattered singly or form coherent clusters.

Treatment

The treatment for MIFS is surgical excision.

Prognosis

Local recurrences are common and their incidence

may depend on primary surgical treatment; multiple

local recurrences may require eventual amputation

(Kindblom et al., 2002). Distant metastases are,

however, exceedingly rare.

Genetics

Note

MIFS, HFLT and tumors with mixed MIFS/HFLT

histology share the same genetic aberrations;

t(1;10) and amplification of a region in proximal

chromosome arm 3p (Antonescu et al., 2011).

Cytogenetics

Cytogenetics Morphological

The majority of cytogenetically analyzed MIFS

present a t(1;10)(p22;q24), or variants thereof

(Mitelman Database of Chromosome Aberrations in

Cancer 2012).

Ring and/or giant marker chromosomes as well as

aberrations involving chromosome 3 are also

associated with this disease.

Cytogenetics Molecular

Fluorescence in situ hybridization analyses, using

probes flanking the genes TGFBR3 in chromosome

1 and MGEA5 in chromosome 10, can be used as a

diagnostic molecular test for MIFS and HFLT

(Antonescu et al., 2011).

Amplification of material from chromosome arm 3p

can be detected by fluorescence in situ

hybridization analyses and/or array-based genomic

copy number analyses (Hallor et al., 2009).

Partial karyotype with a t(1;10)(p22;q24) and rearrangement of 3p.

Fluorescence in situ hybridization, using probes flanking the TGFBR3 and MGEA5 genes, respectively, can be used to detect the t(1;10)(p22;q24). A normal chromosome 10 show signals from probes located on either side of MGEA5 (labeled in red and

yellow). On the der(10)t(1;10) the proximal probe (yellow) is detected while the more distal probe (red) is deleted.


Nord KH


DNA copy number analysis of a MIFS using array comparative genomic hybridization. A genome-wide copy number profile displays tumor/reference log2 ratios across the genome (top). Individual chromosomes are separated by vertical bars and chromosome 3 is labeled in yellow. The profile shows amplification of material from chromosome 3 and a few additional

aberrations. Enlarged view of chromosome 3 shows two separate amplicons, the more proximal of these contains the VGLL3 gene (bottom).


Note

The breaks in chromosomes 1 and 10 seem to occur

in, or close to, the genes TGFBR3 and MGEA5,

respectively, and the translocation juxtaposes FGF8

in chromosome 10 with TGFBR3 in chromosome 1

(Hallor et al., 2009).

FGF8 is highly expressed, likely as a result of the

rearrangement, in tumors affected by the

translocation. Ring and giant marker

chromosomes in MIFS contain amplified material

from chromosome 3.

The core amplicon harbors the gene VGLL3, which

is also highly expressed in affected tumors (Hallor

et al., 2009).

This abnormality is, however, not specific for

MIFS/HFLT and have been found in additional

sarcomas as well as other malignancies (Hélias-

Rodzewicz et al., 2010).

VGLL3

Location

3p12


Nord KH


Fluorescence in situ hybridization analyses suggest that TGFBR3 is translocated from chromosome 1 and positioned in opposite direction next to the MGEA5 gene on the der(10)t(1;10) (Hallor et al., 2009).

Note

Amplification and high expression of VGLL3 in

chromosome 3 is found in MIFS and HFLT as well

as other sarcomas.

DNA / RNA

VGLL3 is a protein coding gene located at position

86987119-87040269 in chromosome 3

(http://www.ensembl.org; human assembly

GRCh37). There are three transcript variants of this

gene. The most extensive variant (transcript variant

1) comprises 10400 base pairs and consists of 4

coding exons.

Protein

VGLL3 encodes the protein vestigial like 3

(Drosophila). Translation of VGLL3 transcript

variant 1 results in a 326 amino acid protein. There

is not much known about the function of this

protein. However, it is believed that mammlian

vestigal like proteins could be involved in

regulating members of the TEAD transcription

factor family (Vaudin et al., 1999; Maeda et al.,

2002).

FGF8

Location

10q24

Note

The translocation between chromosomes 1 and 10

juxtaposes FGF8 in chromosome 10 with TGFBR3

in chromosome 1. In tumors affected by the

translocation, FGF8 is highly expressed.

DNA / RNA

FGF8 is a highly conserved gene located at position

103530081-103535827 in chromosome 10

(http://www.ensembl.org; human assembly

GRCh37). There are six transcript variants of this

gene and the alternating splicing results in products

of 4-6 exons, which in turn encode proteins of 204-

244 amino acids. The expression of FGF8 is

controlled by several regulatory sequences located

both upstream and downstream of the gene

(Beermann et al., 2006; Inoue et al., 2006).

Protein

Fibroblast growth factor 8 belongs to the large

family of fibroblast growth factors. Members of this

family are secreted molecules which by activating

their receptors are involved in a variety of

biological processes (Thisse and Thisse et al.,

2005). FGF8 is transcriptionally silent in most

normal adult tissues. However, upregulation of this

gene has been associated with tumor growth and

has been identified in carcinomas of the breast,

prostate, and ovary, as well as in synovial sarcoma

(Tanaka et al., 1998; Ishibe et al., 2005; Mattila et

al., 2007).


Hybrid Gene

Note

The t(1;10) juxtaposes FGF8 in chromosome 10

with TGFBR3 in chromosome 1 and the

rearrangement is associated with high expression of

FGF8 (Hallor et al., 2009).

Description

The translocation does not result in a conventional

fusion gene. The functional outcome of the

recurrent aberration seems to be high expression of

the gene FGF8 (Hallor et al., 2009). The consistent

involvement of TGFBR3, but lack of fusion

transcripts, suggest that regulatory sequences in

TGFBR3 are crucial for malignant transformation.

Transcript

Rearrangements of TGFBR3 and MGEA5.

Detection

Fluorescence in situ hybridization analysis using

probes flanking the TGFBR3 and MGEA5 genes

can be applied as a molecular test for detecting

rearrangements of the genes (Antonescu et al.,

2011).

References Meis-Kindblom JM, Kindblom LG. Acral myxoinflammatory fibroblastic sarcoma: a low-grade tumor of the hands and feet. Am J Surg Pathol. 1998 Aug;22(8):911-24

Tanaka A, Furuya A, Yamasaki M, Hanai N, Kuriki K, Kamiakito T, Kobayashi Y, Yoshida H, Koike M, Fukayama M. High frequency of fibroblast growth factor (FGF) 8 expression in clinical prostate cancers and breast tissues, immunohistochemically demonstrated by a newly established neutralizing monoclonal antibody against FGF 8. Cancer Res. 1998 May 15;58(10):2053-6

Vaudin P, Delanoue R, Davidson I, Silber J, Zider A. TONDU (TDU), a novel human protein related to the


Nord KH


product of vestigial (vg) gene of Drosophila melanogaster interacts with vertebrate TEF factors and substitutes for Vg function in wing formation. Development. 1999 Nov;126(21):4807-16

Kindblom LG, Meis-Kindblom JM.. Myxoinflammatory fibroblastic sarcoma. In Fletcher CDM, Unni KK, Mertens F (Eds.). World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of Soft Tissue and Bone. Lyon: IARC Press, 2002.

Maeda T, Chapman DL, Stewart AF.. Mammalian vestigial-like 2, a cofactor of TEF-1 and MEF2 transcription factors that promotes skeletal muscle differentiation. J Biol Chem. 2002 Dec 13;277(50):48889-98. Epub 2002 Oct 9.

Ishibe T, Nakayama T, Okamoto T, Aoyama T, Nishijo K, Shibata KR, Shima Y, Nagayama S, Katagiri T, Nakamura Y, Nakamura T, Toguchida J.. Disruption of fibroblast growth factor signal pathway inhibits the growth of synovial sarcomas: potential application of signal inhibitors to molecular target therapy. Clin Cancer Res. 2005 Apr 1;11(7):2702-12.

Thisse B, Thisse C.. Functions and regulations of fibroblast growth factor signaling during embryonic development. Dev Biol. 2005 Nov 15;287(2):390-402. Epub 2005 Oct 10. (REVIEW)

Beermann F, Kaloulis K, Hofmann D, Murisier F, Bucher P, Trumpp A.. Identification of evolutionarily conserved regulatory elements in the mouse Fgf8 locus. Genesis. 2006 Jan;44(1):1-6.

Inoue F, Nagayoshi S, Ota S, Islam ME, Tonou-Fujimori N, Odaira Y, Kawakami K, Yamasu K.. Genomic organization, alternative splicing, and multiple regulatory regions of the zebrafish fgf8 gene. Dev Growth Differ. 2006 Sep;48(7):447-62.

Mattila MM, Harkonen PL.. Role of fibroblast growth factor 8 in growth and progression of hormonal cancer. Cytokine

Growth Factor Rev. 2007 Jun-Aug;18(3-4):257-66. Epub 2007 May 23. (REVIEW)

Hallor KH, Sciot R, Staaf J, Heidenblad M, Rydholm A, Bauer HC, Astrom K, Domanski HA, Meis JM, Kindblom LG, Panagopoulos I, Mandahl N, Mertens F.. Two genetic pathways, t(1;10) and amplification of 3p11-12, in myxoinflammatory fibroblastic sarcoma, haemosiderotic fibrolipomatous tumour, and morphologically similar lesions. J Pathol. 2009 Apr;217(5):716-27.

Elco CP, Marino-Enriquez A, Abraham JA, Dal Cin P, Hornick JL.. Hybrid myxoinflammatory fibroblastic sarcoma/hemosiderotic fibrolipomatous tumor: report of a case providing further evidence for a pathogenetic link. Am J Surg Pathol. 2010 Nov;34(11):1723-7.

Helias-Rodzewicz Z, Perot G, Chibon F, Ferreira C, Lagarde P, Terrier P, Coindre JM, Aurias A.. YAP1 and VGLL3, encoding two cofactors of TEAD transcription factors, are amplified and overexpressed in a subset of soft tissue sarcomas. Genes Chromosomes Cancer. 2010 Dec;49(12):1161-71.

Antonescu CR, Zhang L, Nielsen GP, Rosenberg AE, Dal Cin P, Fletcher CD.. Consistent t(1;10) with rearrangements of TGFBR3 and MGEA5 in both myxoinflammatory fibroblastic sarcoma and hemosiderotic fibrolipomatous tumor. Genes Chromosomes Cancer. 2011 Oct;50(10):757-64. doi: 10.1002/gcc.20897. Epub 2011 Jun 29.

Mitelman F, Johansson B, Mertens F.. Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer. Mitelman F, Johansson B and Mertens F (Eds.), 2012. http://cgap.nci.nih.gov/Chromosomes/Mitelman


Nord KH. Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):508-512.

Case Report Section Paper co-edited with the European LeukemiaNet


INIST-CNRS

OPEN ACCESS JOURNAL


t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia Helena Podgornik, Peter Cernelc

University medical center Ljubljana, Department of Haematology, Zaloska 7, 1000 Ljubljana,

Slovenia (HP, PC)


Online updated version : http://AtlasGeneticsOncology.org/Reports/t1721q11q22PodgornikID100063.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t1721q11q22PodgornikID100063.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics

Age and sex

87 years old male patient.

Previous history

No preleukemia, no previous malignancy, no inborn

condition of note.

Organomegaly

No hepatomegaly, nosplenomegaly, no enlarged

lymph nodes, no central nervous system

involvement.

Blood

WBC: 30,6 X 109/l

HB: 99 g/dl

Platelets: 71 X 109/l

Blasts: 3%

Bone marrow: 28% (of blasts) (Hypercellular;

28% of blasts; 20% of monocytic lineage,

dispoiesis in megakariocytic lineage and

diserithropoiesis).

Cyto-Pathology Classification

Cytology

Acute myelomonocytic leukemia

Immunophenotype

CD4-

/CD11c+/CD13+/CD14+/CD15+/CD33+/CD34+↓/

CD45+/ CD64+/CD65+/MPO+↓

Rearranged Ig Tcr: -

Pathology: Not done

Electron microscopy: Not done

Diagnosis: Acute myelomonocytic leukemia

Survival

Date of diagnosis: 04-2011

Treatment: Symptomatic (antibiotics)

Complete remission: no

Treatment related death: no

Relapse : no

Status: Death

Last follow up: 04-2011

Survival: 1 month

Karyotype

Sample: Bone marrow

Culture time: 24h

Banding: GTG

Results

46,XY,t(17;21)(q11.2;q22)[19]/46,XY[1]

Other molecular cytogenetics technics

FISH; LSI RUNX1/RUNX1T1, LSI MLL (Abbott);

WC 17, 21 (Kreatech)

Other molecular cytogenetics results

nuc ish(RUNX1T1x2,RUNX1x3)[130/200]; ish

t(17;21)(WCP17+,WCP21+;WCP17+,WCP21+)

Other Molecular Studies

Technics: PCR

Results: FLT3-ITD - negative; NPM1 mutation -

negative.

t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia

Podgornik H, Cernelc P


Figure 1. Partial Karyograme with a balanced translocation t(17;21)(q11.2;q22).

Figure 2. GTG banded metaphase chromosomes.

Figure 3. FISH on previously GTG banded chromosomes (Fig. 2). WC 17 (aqua) and WC 21 (red) (Kreatech).

t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia

Podgornik H, Cernelc P


Figure 4. Metaphase FISH by LSI AML1(RUNX1)/ETO(RUNX1T1) DNA probe (Abbott) with split signal for RUNX1 (green). On GTG banded metaphase normal 21 with the strong RUNX1 signal and both derivatives with split RUNX1 signals are indicated.

Comments We report the first case of t(17;21)(q11.2;q22) as

the sole anomaly in AML. This rare recurrent

abnormality has been linked to treatment related

leukemia or MDS although it has been also found

in de novo leukemia (Roulston et al., 1998; Nadal

et al., 2008). Our patient had no previous history of

cancer or preleukemia. Cytomorphology of bone

marrow cells was, however consistent with

dysplastic changes typical for s-AML. FISH

analysis with probe specific for RUNX1 has been

done in two previous cases with

t(17;21)(q11.2;q22). While in one patient RUNX1

has been lost (Nadal et al., 2008) our result

corresponds to the case of Roulston et al. (Roulston

et al., 1998) where signals from RUNX1 were split

by the translocation. Due to his age and poor

physical condition our patient was not treated by

intensive chemotherapy and he died within a month

from diagnosis.

References Roulston D, Espinosa R 3rd, Nucifora G, Larson RA, Le Beau MM, Rowley JD. CBFA2(AML1) translocations with novel partner chromosomes in myeloid leukemias: association with prior therapy. Blood. 1998 Oct 15;92(8):2879-85

Kobzev YN, Martinez-Climent J, Lee S, Chen J, Rowley JD. Analysis of translocations that involve the NUP98 gene in patients with 11p15 chromosomal rearrangements. Genes Chromosomes Cancer. 2004 Dec;41(4):339-52

Nadal N, Stephan JL, Cornillon J, Guyotat D, Flandrin P, Campos L. RUNX1 rearrangements in acute myeloblastic leukemia relapsing after hematopoietic stem cell transplantation. Cancer Genet Cytogenet. 2008 Jan 15;180(2):168-9


Podgornik H, Cernelc P. t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia. Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):513-515.

INIST-CNRS

OPEN ACCESS JOURNAL


Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas.

Iconography is most welcome: there is no space restriction.

The Atlas publishes "cards", "deep insights", "case reports", and "educational items".

Cards are structured review articles. Detailed instructions for these structured reviews can be found at:

http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes,

http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias,

http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours,

http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases.

According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews"

(between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by

bibliographic databases.

Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length

restriction.

Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in

leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in

at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings,

and 4- with iconography of chromosomes.

It is mandatory to use the specific "Submission form for Case reports":

see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html.

Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French,

German, Italian, and Spanish are welcome.

Subscription: The Atlas is FREE!

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to

editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members

must disclose any potential conflict.

Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If

complete anonymity is difficult to achieve, informed consent should be obtained.

Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the

cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may,

nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further

the content of their papers published in the Atlas, provided that the source is cited.

Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general

distribution. All rights are reserved. The information presented is protected under international conventions and under

national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the

Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with

commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as

the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver

convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or

otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions

of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web

site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty,

express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal

liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever

for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose,

and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to

persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein.

See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical

Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

© ATLAS - ISSN 1768-3262

http://atlasgeneticsoncology.org/Forms/Gene_Form.html

http://atlasgeneticsoncology.org/Forms/Leukemia_Form.html

http://atlasgeneticsoncology.org/Forms/SolidTumor_Form.html

http://atlasgeneticsoncology.org/Forms/CancerProne_Form.html


http://www.icmje.org/

http://www.atlasgeneticsoncology.org/

INIST-CNRS

OPEN ACCESS JOURNAL


volume 16 - number 7 volume 1 - number 1 may - september

Documents