Vol. 254, No. 21, Issue of November 10, pp, 10803-10810, 1979 Printed m U.S. A.

A Synthetic Tyrosine Suppressor tRNA Gene with an Altered Promoter Sequence ITS CLONING AND RELATIVE EXPRESSION IN VZVO*

(Received for publication, May 8, 1979)

Michael J. Ryan,+ Ramamoorthy Belagaje,g Eugene L. Brown,1 Hans-Joachim Fritz,11 and H. Gobind Khorana

From the Departments of Biology and Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

The total synthesis of a tyrosine suppressor tRNA gene with a modified promoter is described. The alter- ation involves the replacement of the four G:C base pairs immediately preceding the start point of tran- scription by A:T base pairs. The new sequence contains the recognition sequence for the Hi&III restriction endonuclease at the transcriptional start point, thus permitting fusion of the structural gene with promoters containing independent sequence modifications. The construction, cloning, and biological activity of several recombinant DNAs containing the tRNA gene with the modified promoter are described. The expression of this gene in uiuo is compared with that of both the unmodified synthetic suppressor gene and a naturally occurring tyr su3+ gene cloned onto a multicopy plas- mid.

The total synthesis of a tyrosine suppressor tRNA gene (Fig. 1) has been reported recently (1). The DNA contains 56 base pairs in the promoter region (a), 126 base pairs corre- sponding to the tyrosine tRNA precursor (3), and a 25nucleo- tide long duplex adjoining the C-C-A sequence, corresponding to the 3’ terminus of the tRNA (4). The last sequence contains a signal for the processing of the primary transcript of the synthetic tRNA gene. In order to insert this gene into suitable vectors for cloning purposes, the single-stranded sequence specific for the Eco RI restriction endonuclease was added at both termini. Suppression in uiuo of amber mutations, as well as accurate transcription in vitro of the synthetic gene were demonstrated (5, 6).

As depicted in Fig. 1, the methodology for the total synthesis

*This work has been supported bv Grant CA11981 from the National Cancer Institute, I%partm& of Health, Education, and Welfare. and bv Grant PCM73-06757 from the National Science Foundation, Washington, D.C. This is paper CLIV in the series “Studies on Polynucleotides.” The preceding paper is Ref. 5. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact.

$ Supported by National Institutes of Health Traineeship No. T32 CA09112. Present address, Microbiological Sciences, Schering Cor- poration, Bloomfield, N. J. 07003.

8 Present address, Lilly Research Laboratories, Bldg. 88, Room 408, Indianapolis, Ind. 46iOS.

ll Postdoctoral Fellow (1974 to 1976) of the National Institutes of Health (Fellowship CA01599). Present address, Syntex Research, 3401 Hillview Ave., Palo Alto, Calif. 94304.

11 Recipient of postdoctoral fellowships from NATO (1974 to 1975) and from Deutsche Forschungsgemeinschaft (1976). Present address, Institut fiir Genetik der Universitat Koln, Weyertal 121, 5 Ktiln 41, Federal Republic of Germany.

involved the chemical synthesis of short oligonucleotide seg- ments, corresponding to the total DNA, followed by polynu- cleotide ligase-catalyzed joining of a suitable number of seg- ments to form short duplexes. A total of six duplexes with appropriate single standed protruding ends (P and I-Vb in Fig. 1) were thus prepared and these were subsequently joined end to end to form the total DNA. The methodology offers unlimited opportunities for predetermined nucleotide altera- tions of any chosen length and at any given site for studies of structure-function relationships. The promoter region, the tRNA region, and the region adjoining the tRNA-terminal C-C-A sequence are three independently important regions each of which poses unanswered questions in regard to pro- tein-DNA interactions. These should now be amenable to attack by the synthetic approach.

Detailed understanding of the interaction of RNA polym- erase with the promoter region and the mechanism of initia- tion of transcription is lacking, despite a very large number of investigations (7, 8). The sequences of a relatively large num- ber of promoters are now known. These promoters vary greatly in their activity in vivo as well as in their interaction in vitro with E. coli RNA polymerase (e.g. Ref. 9). From such observations, the conclusion has been drawn that three dis- tinct regions within the total promoter sequence may have particular significance (7-10). One such region comprises the sequence around -25 to -35 (upstream from the point of initiation) which evidently has been conserved to a great extent. Although it seems to be located outside the region involved in the stable complex between the promoter and the RNA polymerase complex (ll), evidence indicates that con- tacts with the polymerase are made in this region (12, 13). Thus, this region may be important in the first recognition event. The second region is the so-called “Pribnow box”: this sequence, too, has been largely conserved and mutations within this region have marked influence on the promoter strength (8). The third region of importance may be the sequence immediately adjacent to the starting point of tran- scription which may influence the strength of association or the formation of the “open complex” via melting of the double helix at this site (14). The promoter in the SUZ+ gene (Fig. 1) is a very weak promoter in the sense that no stable binding between the polymerase and the promoter can be detected by the technique which has been successfully used in a compar- ative study of promoter strengths (9). Clearly, it would be highly interesting to introduce sequence alterations in the su3+ promoter in a step-by-step fashion and to assess their relative influence on the properties of the promoter. As a start of a synthetic program designed to bring about systematic modifications in different parts of the .sus+ promoter region, we wish to report on a modification which involves the re-

10803

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Synthetic tRNA Gene with an Altered Promoter

I-Yb 151 5’

3’

1 i-T 1

3’ GAAAGAGTTGCATTGTGAAATGTCGCCGCGCAGT, ‘T ,IIIIt//I,I/I/I!lI I,,,,, I/II,II/l

SAATTCTTTCTCAACGTAACACTTTACAGCGGCGCGTC

-56

FIG. 1. Synthetic tyrosine suppressor tRNA gene. Appropri- ate chemically synthesized single stranded deoxyribooligonucleotides were joined by using T4-polynucleotide ligase to give six duplexes whose sequences and positions in the gene are shown by the seg- mented parallel lines. These duplexes with the protruding single stranded ends were joined enzymatically at the sites indicated by the thick stripes to give the total gene. Duplex [P] contains the first 52 base pairs of the promoter region found in the natural suppressor tRNA gene.

placement of the four G:C base pairs immediately before the starting point of transcription by A:T base pairs (Fig. 2). This modification was chosen with three considerations in mind. 1) The change will reduce the high G:C content around the initiation region and this may facilitate the formation of the open complex (14) and perhaps allow a higher rate of tran- scription of the tRNA gene. 2) The present promoter possesses remarkable elements of 2-fold symmetry (Fig. 2) and the present modification would abolish the outer palindrome which contains five G:C base pairs. Thus, the consequence of the disappearance of this symmetry might be quite profound. 3) A further consideration in favor of the above change would be that it would introduce the complete recognition sequence

1 5’. . AAGCTT .3’ 3’. TTCGAA . .5

t

for the Hind111 restriction endonuclease. This should allow the promoter to be separated specifically from the structural gene and then to be joined to any other DNA fragment which has a HindIII-generated sticky end.

Total synthesis of the gene containing the above modifica- tion in the promoter region (Fig. 2) required two new deoxy- oligonucleotide segments, P-la and P-2a (Fig. 2C). Of these, the synthesis of P-la has already been reported (15). In this paper, we report on the chemical synthesis of the undecanu- cleotide (P-2a, Fig. 2C), the enzymatic assembly of the se- quence-modified promoter duplex [Pa] (Fig. 2C), and the joining of the latter to the duplexes [I], [II], and [III-IV-Vb] (Fig. 1) to form the modified gene. Further, in in uiuo work, the construction, cloning and biological activity of several recombinant DNAs containing the modified tRNA gene (ssu2)’ are described. The expression of this gene in uiuo is

’ The abbreviation ssu is proposed as a symbol to represent the synthetic tyrosine suppressor tRNA gene. The arabic number 1 following the s,vmbol indicates that the gene has the natural sequence; modified genes are numbered in the order they are prepared. Simi- larly, recombinant plasmids constructed from pMB9 and a synthetic

compared with that of both the unmodified synthetic sup- pressor gene and a naturally occurring tyr su3+ gene cloned onto a multicopy plasmid. A preliminary account of a portion of this work has been given (16).

EXPERIMENTAL PROCEDURES

Methods-The methods for the chemical synthesis of deoxyribo- oligonucleotides and their enzymatic joinings with T4-polynucleotide ligase to form bihelical DNAs have been described recently (17). The construction of recombinant genomes and transformation procedures have been described in the previous paper (5). DNA duplex [I], [II], [III-IV-Vb] (Fig. 1) and partial promoter duplex [P4.10] (Fig. 2B) were available from earlier work (1,2). The details of the synthesis of segment P-la (Fig. BC), d(G-G-A-A-G-C-T-T-A-A-C), have been given elsewhere (15).

Bacterial and Bacteriophage Strains-Most of the bacterial and bacteriophage strains have been described previously (5). The Esch- erichia coli strains MR161 (met+ fat+ rel+ trpR trpA (amber) his (amber)) and MR209 (met+ fuc’ rel’ trpR trpA (amber) his amber tyrT) were derived from LS340 (metE trpR trpA (amber) his (am- ber)). LS340, an ilv+ metE transductant of LS268 (18), was obtained from Dr. B. J. Bachmann, E. coli Genetic Stock Center, Yale Uni- versity.

Synthesis of Segment P-2a:d(T-G-A-T-G-C-G-T-T-A-A) (Fig. 2C)-An anhydrous pyridine solution (1 ml) of the protected hepta- nucleotide d[(MeOTr)T-ibG-bzA-T-ibG-anC-ibG] (6.8 pmol, 315 Ax+o) (19) was condensed with pyridinium salt of the tetranucleotide block, d[pT-T-bzA-bzA(Ac)] (85 pmol) in the presence of TPS (645 pmol) at room temperature for 5% h. After the usual workup and alkaline hydrolysis, the crude reaction mixture was purified by DEAE-cellu- lose column (1.7 x 50 cm) chromatography followed by high pressure liquid chromatography on a PBondapak Cl8 column (0.4 X 30 cm) using the described procedures (15). The fully protected undecanu- cleotide d[(MeOTr)T-ibG-bzA-T-ibG-anC-ibG-T-T-bzA-bzA] (0.52 pmol, 68 AZ& thus obtained was then completely deprotected by the general methods (17) and the product was analyzed by anion exchange chromatography in the presence of 7 M urea and high pressure liquid chromatography (Fig. 3A). This afforded 26 AZO units (0.2 pmol) of pure undecanucleotide, d(T-G-A-T-G-C-G-T-T-A-A), which was fully characterized by standard two-dimensional fingerprinting (20) (Fig. 3B).

Analysis of Chimeric Plasmids by Cleavage with Restriction Endonucleases-Digestions with Eco RI and Hind111 restriction endonucleases were carried out at 37°C in reaction mixtures contain- ing 50 rnM Tris-HCl (pH 7.6), 50 mM NaCl, and 10 mM MgC12 for 60 min, at which time the reaction mixtures were heated at 65°C for 10 min. The RNA polymerase inhibition of cleavage of pSSU2 by Hind111 endonuclease was carried out as follows. A reaction mixture (100 ~1) containing plasmid pSSU2 (11 pg, -3 pmol) and E. coli RNA polymerase holoenzyme (27 pmol) in 50 mM Tris-HCl (pH 7.6), 7 mM MgCb, 1 mM GTP, 0.26 mM CTP, 1.2 mM dithiothreitol, 10 mM NaCl, 30 mM KCl, 0.015 mM EDTA, 6 mM KPO, (pH 8), and 8% glycerol was preincubated at 37°C for 18 min. Hind111 or Eco RI endonuclease, or both, was (were) added and incubation was continued for an additional 60 min.

Ligase reactions, calcium-mediated transformations and transfec- tions, selection procedures, and media were as described previously (5).

RESULTS AND DISCUSSION

Synthesis of the Modified Promoter (Pa] (Fig. 2C)

The duplex [P4-1,J (Fig. 2s) was available from the previous synthesis of ssul. The addition of the remaining three seg- ments (P-la, P-2a, and P-3) was achieved by fist preparing the single stranded polynucleotide P-( la + 3) and then adding it along with segment P-2a to the duplex [P4-1,,]. The prepa- ration of oligonucleotide P-2a described under “Experimental Procedures” was analyzed by reverse-phase high pressure

gene are designated pSSU1, pSSU2, etc. When ColEl amp’ is used as the vector, plasmids with suppressor activity are named pSSU101, pSSU102, etc. The abbreviations for nucleosides, nucleotides, and oligonucleotides have been defined earlier (15).

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

+ Promoter

-59 -51 -------* *-------

A

(3’) T-F-A-~--F-T-~-A:4-C-A-~-A-G-?-?-~-~-~-T-T-G-T-G-~-~-~-~-~-T-~-F

* (5’) a-;;-~-t-~-~-t-~:t-t-~-c-CLa-a-c-t-t-a-~-~-~-~-t-t-t-~-~-~-~-~

f Structural 4+

I Gene

I

B.

,piP-smP-I (3’) ______ ---- _____ ---- ______ -------------_---------- -------

c. --__------- ------- (5’) ~P-lo~~“~~P-0

1 PI

Pal

FIG. 2. Natural and two synthetic promoters for the tyrosine suppressor tRNA gene. A, the natural nucleotide sequence in the promoter region of the tyrosine suppressor tRNA gene. The point of transcriptional initiation and the promoter’s orientation in the gene are shown. Elements of 2-fold symmetry in the sequence are shown in the boxes, their correspondence being indicated by arrows. B, the synthetic promoter duplex [P] which has been previously described (2) consists of 51 base pairs of the natural sequence and a single stranded sequence specific to the Eco RI restriction endonuclease. The regions between the carets indicate the segments synthesized chemically, the numbers being indicated within the brackets inserted into the horizontal lines. C, modified synthetic promoter [Pa] of the suppressor tRNA gene (ssu2). The sequence modification introduced involves four base pairs (sequence -1 to -4) indicated by the vertical dashed lines. This change necessitated the chemical synthesis of two modified segments, P-la and P-2a. The resulting promoter is now susceptible to the restriction endonuclease HindIII. The points of cleavage of this enzyme are indicated by vertical arrows.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Synthetic tRNA Gene with an Altered Promoter

Time (nudes) Cellulose Acetate Electrophorew

FIG. 3. A, analysis of high pressure liquid chromatography-puri- fied undecanucleotide, d(T-G-A-T-G-C-G-T-T-A-A). The mobile phase was 0.1 M aqueous triethylammonium acetate containing 12% acetonitrile. I?, a two-dimensional fingerprint of a partial snake venom phosphodiesterase digest of the above undecanucleotide. In this run, the amount of the expected mononucleotide, 5’-[32P]dT, was very low relative to the other intermediates. Hence, it is not visible on the fingerprint.

liquid chromatography (15) and by two-dimensional finger- printing procedure (20). The patterns shown in Fig. 3 indicated that it was pure.

Initial attempts to join segments P-la and P-3 in the pres- ence of P-2a by T4-polynucleotide ligase were unsuccessful. However, when unphosphorylated segment 1 (see inset in Fig. 4) was added to the reaction mixture, polynucleotide P-(la + 3) formed rapidly and in high yield (Fig. 4). The single stranded DNA was isolated by gel filtration in the presence of urea (Sephadex G-100) in 83% yield. For characterization, it was degraded to 5’nucleotides. All the radioactivity was found in pdG, as expected.

The joining of polynucleotide P-( la + 3) and segment P-2a to duplex [P4..ro] was carried out as described in Fig. 5. The reaction was rapid and virtually complete within the fist 2 h. After 24 h reaction, duplex [Pa] was isolated by preparative slab gel electrophoresis on a 15% polyacrylamide gel. To characterize the product, the synthesis was repeated on a small scale, as described in the legend of Fig. 5, except that segments P-(la + 3) and P-2a were phosphorylated with [v- “P]ATP of the same specific activity. On digestion to 3’- nucleotides, after phosphatase treatment, radioactivity was found in dAp (2450 cpm) and inorganic phosphate (2260 cpm) in a ratio close to l:l, as expected (Fig. 5). 5’-Mononucleotide analysis showed radioactivity in pdG (2690 cpm) and pdT (2370 cpm) in the expected ratio of 1:l. As a further proof that duplex [Pa] did not lack segment P-2a, the DNA was analyzed on a 40-cm long 15% polyacrylamide gel. Only one band was observed confirming that this preparation of duplex [Pa] contained the expected ten segments.

Synthesis of the Promoter-modified Suppressor tRNA Gene (ssu2)

Having completed the synthesis of duplex [Pa], it simply remained to join, end-to-end, the six constituent duplexes. The plan used for these joinings was identical to that used previously and described briefly in the legend to Fig. 1. It is noteworthy that in the present work in which high pressure liquid chromatography-purified segment 1 (1) was used for the preparation of duplex [I], the joining of duplex [I] to the modified promoter [Pa] proceeded rapidly (2 h) and in excel- lent yield. Thus, from 380 pmol of duplex [Pa], 310 pmol of [Pa-I] was obtained after preparative gel electrophoresis. This product was characterized by 3’- and 5’-mononucleotide anal- ysis. Thus, on degradation to 3’-mononucleotides after phos-

0 -BPS I I I I

5 IO 15 20 25 0 I 2 4 8 24 Time (hours) Time (hours)

FIG. 4. Synthesis of the single-stranded deoxyribopolynu- cleotide 5’-32P-labeled segment P-(la + 3). The reaction mixture (250 ~1) contained 1.41 nmol of 5’-32P-labeled segment P-la, 1.42 nmol of 5’-32P-labeled segment P-2a, 1.2 nmol of 5’-32P-labeled segment P- 3, 4.67 nmol of unphosphorylated segment 1, 12 nmol of ATP (final concentration, 50 PM), and T4-polynucleotide ligase (400 units/ml). Other components in the mixture were as previously described (17). Specific activity of the 5’-[3ZP]phosphate end group in segment P-la was 20 times higher than that on segments P-2a and P-3. The reaction was performed at 5’C for 24 h. Before the addition of ATP, enzyme, and dithiothreitol the segments were heated at 97°C for 2 min and then cooled to 18°C during 15 min. Kinetics (A) were determined by withdrawing aliquots (1 al) at the indicated times followed by their gel electrophoretic analysis (B) on a 24% polyacrylamide gel contain- ing 7 M urea.

m .c .c 60 1: z

40

I I I I I 1 63 5 IO 15 20 25 02 4 824

Time (hours) Time (hours)

FIG. 5. Synthesis of modified promoter duplex [Pa] (Fig. 2C). The ligase reaction mixture (200 ~1) contained 585 pmol of duplex [P4.10], prepared as described previously (2), 670 pmol of 5’-32P-labeled segment P-(la + 3), 1755 pmol of 5’-3ZP-labeled segment P-2a, ATP (50 PM), and T4-ligase (400 units/ml). Specific activity of the [32P]- phosphate group on segment P-(la + 3) was 20 times higher than that on segment P-2a. The reaction was performed at 5°C and 0.5~~1 aliquots were withdrawn at the indicated times. Electrophoretic sep- aration on a 15% polyacrylamide gel and the kinetics of formation of duplex [Pa] are shown in Panels B and A, respectively.

phatase treatment, radioactivity was found in dAp (2010 cpm), dGp (2340 cpm), and inorganic phosphate (2030 cpm) close to the expected ratio of 1:l:l. Degradation of [Pa-I] to 5’-mon- onucleotides gave only radioactive pdG, as expected.

Construction and Characterization of Recombinant Genomes Containing ssul, ssu2, and sua+ Genes

Charon 3A ssu2, pSSU2, andpSSU102-The general pro- cedures used are shown in Fig. 6 and are similar to those described previously in work with ssul (5). Transformed cells

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Synthetic tRNA Gene with an Altered Promoter lQ8Q7

3A Charan

su- Eta’, Viable - phage particles

TABLE I Cloning of the modified synthetic suppressor tRNA gene

Phosphorylation of the 5’ end of the synthetic DNA and the conditions for the T4-ligase-catalyzed joining of this DNA to the Eco RI-digested DNAs listed below, selection, and transformation proce- dures were as described (5). The host cell in each case was MR161 f his amber trx, amber).

ssu2 DNA Antibiotic- g.5 mm

8.3 20

Q

Experi- Vector DNA (0.07 resistant &!!L!! merit p.f.u./ml

Pm4 proto-

52 40 AD! - prototrophs trophs/ml

21 L/gase and

Col Et -Amp’

1 Charon 3A (3.2 pg) - 40 + 1.1 x lo8

FIG. 6. Relevant structural features of a bacteriophage vec- tor and plasmid used to prepare recombinant DNAs containing the chemically synthesized suppressor tRNA gene (~~242). The mutations in the bacteriophage vector, Charon 3A, (A-B-) as well as those in the su- host (his-trp-) are all amber mutations. The proce- dures used for the preparation of the recombinant DNAs are shown.

were readily selected on the basis of suppressor activity intro- duced from the synthetic gene (5). Thus, the bacteriophage cloning vehicle Charon 3A (21) has amber mutations in genes A and B which are required for capsid formation. Transfection of a nonsuppressing host bacterium with this vector containing the ssu2 gene was readily detected by the formation of viable, plaque-forming phage. As seen in Table I, Experiment 1, only cultures transfected with Charon 3A containing ssu2 produced a significant number of viable, plaque-forming phages. This recombinant phage has been designated Charon 3A ssu2. The two plasmid vectors colE1 amp’ (22) and pMB9 (23) code for resistance to ampicillin and tetracycline, respectively. After these were joined to ssu2, they were used to transform a strain of E. coli carrying two amber mutations in genes required for the biosynthesis of histidine and tryptophan (Fig. 6). In these experiments (Table I, Experiments 2 and 3) the desired trans- formants were selected as antibiotic-resistant prototrophs. These recombinant plasmids which have integrated the ssu2 gene have been designated pSSU2 and PSSU102 when the vectors used were, respectively, pMB9 and colE1 amp’.

Characterization of pSSU2 and pSSU102-As mentioned above, the modified synthetic suppressor gene contains the recognition sequence for the Hind111 restriction endonuclease. Therefore, the conservation of the modified sequence can be established by examining the sensitivity of the cloned syn- thetic gene to cleavage by HindIII. As seen in Fig. 7, both ssul and ssu2 genes could be excised from their vector chro- mosomes by Eco RI (Fig. 7, Lanes C, F, and G), but only the cloned ssu2 gene was cleaved by Hind111 to yield the 151 nucleotide long structural gene and the 56-nucleotide long promoter fragment (Fig. 7, Lanes B and D).

The presence of the Hind111 recognition sequence at the juncture between the promoter and the structural gene in ssu2 allowed an in vitro test of the ability of E. coli RNA polymerase to bind to the promoter region of the ssu2 gene cloned in pMB9. As seen in Lane D of Fig. 8, RNA polymerase inhibited the Hind111 digestion of the ssu2 gene. In addition, Fig. 8 shows that RNA polymerase also inhibited cleavage at the other Hind111 site on this plasmid which occurs within the promoter region of the gene coding for tetracycline resist- ance (25).

The data in Fig. 8 also reveal the orientation of the ssu2 gene within pSSU2. It has been reported that there are 350 nucleotides between the Hind111 and Eco RI recognition sites pMB9 (23). Therefore, the release of a 500nucleotide long fragment from pSSU2 by Hind111 digestion of pSSU2 shows that the orientation of ssu2 in pSSU2 must be as in Panel A of Fig. 8. This conclusion was confiied by cloning the 500-

2 pMB9 (6.8 pg) - 0 + 115

3 ColEI amp’ (1.0 pg) - 0 + 15

ABCDEFGA

l- 2-

3-

FIG. 7. Restriction endonuclease analysis of recombinant plasmids carrying either the ssul or ssu2 gene. After digestion with the appropriate endonuclease(s), each of the DNA samples was precipitated with ethanol, redissolved, and analyzed on a 10% poly- acrylamide gel. Lane A contains the molecular weight markers 1 (630 base pairs), 2 (520 base pairs) and 3 (205 base paris), all derived from plasmid pKB252 (24) by digestion with both Eco RI and Hind111 restriction endonucleases. Lane B contains products formed from pSSU102 with Eco RI and HindIII. Lane C contains the products of pSSU102 with Eco RI alone; Lane D, those of pSSU2 with Eco RI and HindIII. Lane E contains digests of pSSU1 with Eco RI and HindIII. Lane F contains pSSU2 digested with Eco RI. Lane G contains pSSU1 digested with Eco RI.

nucleotide long fragment into another plasmid vehicle and then digesting it simultaneously with Hind111 and Eco RI. The products of this reaction were the 350-nucleotide piece from the pMB9 plasmid itself and the 151-nucleotide long structural gene (data not shown).

Synthetic Genes ssul and ssu2 Have the Same Orientation in pSSU1 and pSSU2, Respectively-This was shown in the following way. Each of the synthetic genes has two recognition sites for Hae III, which are centered at nucleotides +21 and +59. Therefore, cleavage with this endonuclease generates three fragments which are 77, 38, and 92 base pairs long, the first fragment containing the promoter. On digestion with Hae III, the recombinant DNAs, pSSU1 and pSSU2, each gave 22 detectable fragments. Of these, two fragments, about 620 and 490 base pairs, were shown to carry the ends of the synthetic genes by additional cleavage with Eco RI endonuclease. Fur- ther, in the case of pSSU2, it was demonstrated that only the 490-basepair fragment released a small nucleotide fragment

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

10808 Synthetic tRNA Gene with an Altered Promoter

4 23456789 A pssu 2

&QRI

5400

a b c d

FIG. 8. RNA polymerase inhibition of cleavage of pSSU2 by IfindIlI endonklease. A, a partial map of pSSU2. Restriction fragments are designated by base pair content. B, RNA polymerase inhibition of cleavage of pSSU2 by Hind111 endonuclease. The reac- tions (see “Experimental Procedures”) were preincubated at 37°C for 18 min before adding the following restriction enzymes: a, HindIII; b, Eco RI; c and d, Hind111 and Eco RI. Only in Reaction d was RNA polymerase holoenzyme added prior to the preincubation step. The enzymes were destroyed by heating at 65°C for 10 min. The digested DNAs were precipitated with ethanol, redissolved, and analyzed on a 10% polyacrylamide gel followed by staining with ethidium bromide.

on digestion with Hind111 endonuclease. Thus, the 490-nu- cleotide fragment carried the promoter end of the ssu2 gene in pSSU2. Therefore, if the orientation of the synthetic genes in pSSU1 and pSSU2 is the same, then isolation of the 490 nucleotide fragment from both plasmids followed by digestion with Eco RI should give the same 77-base-pair fragment. On the other hand, if the orientation is opposite, then two differ- ent fragments, 77 and 92 base pairs long, should be produced. In fact, only the 77-nucleotide fragment was formed.

Incorporation of tyr tRNA Suppressor Genes into Bacte- riophage X-Both ssul and ssu2 genes were incorporated into a temperate bacteriophage h by crossing the recombinant phages Charon 3A ssul and Charon 3A ssu2 with X plac5 Sam7 CI857 and then selecting out those phages that could lysogenize and suppress amber mutation (5). Another sup- pressing derivative of X was constructed to serve as a control using the transducing phage @30su3+ as the source of a sup- pressor gene. Initially, an Eco RI digest of @Osu~+ was ligated with the corresponding digest of Charon 3A and plaque-form- ing phage were isolated. The recombinant Charon 3A sus+ had incorporated an Eco RI fragment of $30 psus+ of Mr = approximately 4.3 x lo6 (26) (Fig. 9, Lane 3), which is virtually indistinguishable from the M, = 4.35 x lo6 Eco RI fragment it replaced in the Charon 3A vector chromosome. However, when Charon 3A sus+ was next crossed with Xplac5 Sam7 CI857 (Fig. 9, Lane 4) the only new Eco RI fragment seen in the resulting recombinant phage (designated Asus+) was very small and consisted of approximately 1200 base pairs (Fig. 9, Lane 5). It should be noted that, as expected from previous work (5), the recombinational event between Charon 3A SW+ and Xplac5 Sam7 C1857 which led to hsu~+ resulted in the deletion of the M, = 4.35 X 10” Eco RI fragment of XpZac5 Sam7 C1857. The approximately 1200-base-pair fragment coded for suppressor activity was confinned in the following way. A mixture of Eco RI digests of hsus+ and pMB9 were ligated. Transfection of MR161 followed by selection for tet- racycline-resistant prototrophs demonstrated suppressor ac- tivity. Proof that the suppressor activity of this recombinant plasmid (designated pMR243) was due to its having incorpo- rated the 1200-base-pair fragment from Xsu3+ was obtained by digestion with Eco RI. As shown in Fig. 9 (Lane 6) two

FIG. 9. Eco RI endonuclease digestion patterns of recombi- nant DNAs carrying the naturally occurring SW+ gene. Each DNA sample was digested with Eco RI, and the fragments were precipitated with ethanol, redissolved, and electrophoresed on a hor- izontal 1% agarose gel followed by staining with ethidium bromide. The patterns shown correspond to: 1, $80 SW+; 2, Charon 3A; 3, Charon 3A SUM+; 4, hplac 5; 5, hsua+; 6, pMR243; 7, Charon 3A ssul; 8, Xssul; 9, hWC.

fragments corresponding to the parental pMB9 and the 1200- base-pair DNA were present. Identical results were found when this cloning was carried out with colE1 amp’ as the vector DNA (data not shown).

Relative Expression of Suppressor tRNA Genes

The expression of the cloned suppressor genes was com- pared by extracting total tRNA from bacteria and determining the amount of the chargeable tyrosine tRNA relative to the level of chargeable phenylalanine tRNA. These values were determined for situations in which there were approximately 20, 10, or 1 copy of the cloned suppressor gene/bacterial chromosome, depending on whether the vehicle was pMB9, colE1 amp’ or the bacteriophage X.

The relative levels of tyr tRNA in bacteria carrying these recombinant DNAs is shown in Table II. In Experiments 1 and 2 in which the synthetic tyr SUM+ tRNA genes were in multicopy plasmids, there was a very considerable increase in the intracellular levels of chargeable tyr tRNA. In parallel with these observations, it was seen that as the level of tyr tRNA increased, the growth rate decreased, indicating that the increase in tyr tRNA, presumably due to suppressor tRNA, was, in some way, having a deleterious effect on the host organism. Both pSSU1 and pSSU2 have been transcribed in vitro and the transcripts have been sequenced to show that these genes have, in all probability, maintained the amber suppressing anticodon.’ One possible explanation for the de- creased growth rate is that in these cells there is marked

‘As published (15,16), the in vitro transcript from plasmid pSSU1 has been isolated and characterized by digestion with T1-RNase and subsequent fingerprinting. The fragment with the characteristic an- ticodon sequence had the expected (6) two-dimensional mobility on a polyethyleneimine plate. The corresponding transcript from the sequence-altered gene (pSSU2) has also been isolated and shown to co-migrate with that from pSSU1 on a 10% polyacrylamide gel con- taining 7 M urea. Its T1-RNase fingerprint needs to be completed.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Synthetic tRNA Gene with an Altered Promoter 10809

Relative expression of cloned suppressor genes in vivo For each experiment the cultures were grown in M9 minimal

medium plus glucose to a turbidity of either 100 or 150 Klett units and then centrifuged and washed. The bulk tRNA was extracted with phenol and precipitated with ethanol. The redissolved material was charged with [“Hltyrosine and vH]phenylalanine using a crude E. coli extract as a source of synthetases. The growth temperature was 37°C for Experiments 1, 2, and 4; it was 30°C in Experiment 3 since each phage is thermoinducible. In Experiment 4, the medium was supplemented with alanine, arginine, asparagine, aspartic acid, glu- tamine, glutamic acid, glycine, lysine, phenylalanine, proline, serine, threonine, and tyrosine.

of pSSU2 allowing the synthetic su3+ gene, which it carries, to escape from the stringent response as has been seen previously in $30 suzr’-infected cells (27).

TABLE II

m +HNn I Experi-

malt Host strain Plasmid/phage Iv---- -- / Generation

time Ph@N* ratio

MR209 1 MRl61

MR161 MR209

2 MR161 MH161 MR209 MR161

3 MR161 MR161 MR209

4 MR161 MR161

pMB9 pssu1 pssu2 ColEl-Amp’ pSSUlO1 pssu102

hSU.j+

hSSU1 hssu2 pMB9 pssu2 pMR243

nun

60 93

101 71 70 84

120 118 115 123 62 81 95

0.84 3.52 4.87 0.89 1.20 1.65 0.75 1.12 1.03 1.13 0.77 4.64 0.86

suppression of normal, amber codons involved in translation termination. This would result in excessively long and proba- bly inactive “read through” polypeptides. The degree of in- crease of tyr tRNA levels also appeared to be related to the number of copies per bacterial chromosome; compare, for example, pMB9, which is expected to be present in about 20 copies/bacterial chromosome relative to the 10 copies seen with colE1 amp’ (22), and the single copy of a h lysogenic phage (Experiments 1, 2, and 3 in Table II). In the situations in which the transducing phage carrying the three suz+ genes were integrated into the bacterial chromosome, the increase in tyr tRNA levels was as expected for an increase from 3 to 4 tyrosine tRNA genes/bacterial chromosome.

Comparative Expression of pSSU1 and pSSU2

All the data in Table II reveal that the modified synthetic SZL~+ gene (ssu2) is expressed more efficiently in viuo than the unmodified gene in each of the vectors tested. This is appar- ently not the result of a difference in orientation within the vector genome since, at least, in the case of pSSU1 and pSSU2, both cloned synthetic genes have the same orienta- tion. The difference in the level of expression of these two genes is less than 2-fold, suggesting that, although the altera- tion of four base pairs does have some influence on the expression of this gene, the nucleotide change apparently does not play a critical role in the recognition of this nucleotide sequence by the E. coli RNA polymerase.

The largest increase in the tyrosine tRNA levels was seen with pSSU2 when excess L-valine was added to cultures of MR161 carrying this plasmid. Here, the ratio of tyrosine/ phenylalanine chargeable tRNA increased to 12, at which point about one-third of the tRNA in the cell would be expected to be tyr suof tRNA. This situation probably arose from a combination of two factors. An excess of L-valine inhibits protein synthesis by the feedback repression of isoleu- tine biosynthesis, thereby triggering the stringent response which would depress the synthesis of tRNA coded by the bacterial genes. At the same time, the inhibition of protein synthesis should cause an amplification in the copy number

Comparative Expression of Natural and Synthetic Suppressor Genes

In contrast with the significant increases seen with the cloned synthetic genes, the data available indicate that the naturally occurring su3+ gene contained in the 1200-base-pair Eco RI restriction fragment derived from $80 SU:~+ and even- tually cloned into pMB9 is apparently very poorly expressed (Table II, Experiment 4).” In this case, the increased genera- tion time is probably a result of a deficiency in the levels of suppressor tRNA in these cells. The reasons for the differences in the levels of expression of the natural and synthetic cloned suppressor genes are not clear. It is possible that the naturally occurring su:s+ gene might normally be expressed more effi- ciently than these synthetic genes in uivo. In this case, there would be a great deal of selective pressure for any mutation which could depress the level of expression of the naturally occurring SU:~+ gene when it was cloned on a multicopy plas- mid. A second possibility for the difference in the level of expression of the synthetic and the natural genes could be that the natural promoter contains upstream an additional regulatory sequence which is absent in the synthetic promoter. A third explanation could be in the long repeated sequences which occur after the natural suSf gene (28) but which is absent in the synthetic gene. The unique reiterated sequence, which has been conserved, could play an important role in the regulation or processing, or both, of the tyr tRNA precursor in u&o. On the other hand, the approximately 1200-base-pair long Eco RI fragment present in pMR243 probably has about 1.5 of the 3 to 14 tandem sequence repeat since an Eco RI recognition sequence was identified (28) within the second repeat, approximately 500 base pairs from the point of tran- scription initiation. This indicates that the 1200-base-pair sequence fragment includes the p-dependent transcription- termination site identified in vitro (29). Because this unique repeat sequence has been conserved despite the possibility of its being genetically unstable (30), it suggests that the entire structural repeat may be critical to the correct expression of this gene in uiuo. Therefore, in the case of the synthetic SU.~+ genes, the complete absence of these sequences may essen- tially exempt them from any control. Furthermore, in pMR243, the presence of the partial repeat may result in aberrant control and a consequent drastic reduction in the expression of the SU:~+ gene in it. For example, in this latter case a precursor molecule with an unusual structure could be produced that is nucleolytically destroyed before it can be correctly processed. Future in uiuo and in vitro transcription and processing studies will be required to resolve these pos- sibilities.

REFERENCES

1. Sekiya, T., Takeya, T., Brown, E. L., Belagaje, R., Contreras, R., Fritz, H.-J., Gait, M. J., Lees, R. G., Ryan, M. J., Khorana, H. G., and Norris, K. E. (1979) J. Biol. Chem. 254, 5787-5801

2. Sekiya, T., Brown, E. L., Belagaje, R., Fritz, H.-J., Gait, M. J., Lees, R. G., Ryan, M. J., Khorana, H. G., and Norris, K. E. (1979) J. Biol. Chem. 254.5781-5786

3. Khorana, H. G., Agarwal, K. L., Besmer, P., Buchi, H., Caruthers, M. H.. Cashion. P. J.. Fridkin. M.. Jav. E.. Kleune. K.. Kleuue. R., Kumar, A.,’ Loewen, P. C., Miller, R. C.,’ Minamoto,- K., Panet, A., RajBhandary, U. L., Hamamoorthy, B., Sekiya, T., Takeya, T., and van de Sande, J. H. (1976) J. Biol. Chem. 251,

’ A similar result was obtained by Dr. John Abelson, University of California at San Diego, using a cloned su.a+-containing fragment (private communication).

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

10810 Synthetic tRNA Gene with an Altered Promoter

565-570 and accompanying papers 17. Brown, E. L., Belagaje, R., Ryan, M. J., and Khorana, H. G. 4. Ramamoorthy, B., Lees, R. G., Kleid, D. G., and Khorana, H. G. (1979) Methods Enzymology, in press

(1976)J Biol. Chem. 251,676-694 18. Soll, L., and Berg, P. (1969) Proc. Natl. Acad. Sci. U. S. A. 63, 5. Rvan. M. J.. Brown. E. L.. Sekiva. T.. Kiinuer. H., and Khorana, 392-399

H. G. (1979) J. Blol. &em. 254; 5817-5826 6. Sekiya, T., Contreras, R., Takeya, T., and Khorana, H. G. (1979)

J. Biol. Chem. 254, 5802-5814 7. Reznikoff, W. S., and Abelson, J. (1978) in The Operon (Miller,

J.H., and Reznikoff, W. S., eds) pp. 221-243, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York

8. Gilbert, W. (1976) in RNA Polymerase (Losick, R., and Cham- berlin, M., eds) pp. 193-205, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York

9. Seeburg, P. H., Nusslein, C., and Schaller, H. (1977) Eur. J. Biochem. 74,107-113

10. Scherer, G. E. F., Walkinshaw, M. D., and Arnott, S. (1978) Nucleic Acids Res. 5, 3759-3773

11. Schaller, H., Gray, C., and Hermann, K. (1975) Proc. Natl. Acad. Sci. U. S. A. 72, 737-741

12. Johnsrud, L. (1978) Proc. Natl. Acad. Sci. U. S. A. 75,5314-5318 13. Schmitz, A., and Galas, D. J. (1979) Nucleic Acids Res. 6, lll-

137 14. Chamberlin, M. J. (1974) Annu. Rev. Biochem. 43,721-775 15. Fritz, H.-J., Belagaje, R., Brown, E. L., Fritz, R. H., Jones, R. A.,

Lees, R. G., and Khorana, H. G. (1978) Biochemistry 17, 1257- 1267

16. Ryan, M. J., Brown, E. L., Belagaje, R., Fritz, H.-J., and Khorana, H. G. (1979) in tRNA (Abelson, J., Schimmel, P., and Soil, D., eds) The Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, in press

19.

20.

21.

22.

23.

24.

25.

26.

27.

28. 29.

30.

Belagaje, R., Brown, E. L., Gait, M. J., Khorana, H. G., and Norris, K. E. (1979) J. Biol. Chem. 254, 5754-5764

Sanger, F., Donelson, J. E., Coulson, A. R., Kossel, H., and Fischer, D. (1974) J. Mol. Biol. 90,315-333

Blattner, F. R., Williams, B. G., Blechl, A. E., Denniston-Thomp- son, K., Faber, H. E., Furlong, L.-A., Gnmwald, D. J., Kieter, D. O., Moore, D. D., Schumm, J. W., Sheldon, E. L., and Smithies, 0. (1977) Science 196, 161-169

So, M., Gill, R., and Flakow, S. (1975) Mol. Gen. Genet. 142, 239- 249

Bolivar, F., Rodriguez, R. L., Betlach, M. C., and Boyer, H. W. (1977) Gene 2, 75-93

Backman, K., Ptashne, M., and Gilbert, W. (1976) Proc. Natl. Acad. Sci. U. S. A. 73,4174-4178

Boyer, H. W., Betlach, M., Bolivar, F., Rodriguez, R. L., Heyneker, H. L., Shine, J., and Goodman, H. M. (1977) in Recombinant Molecules: Impact on Science and Society (Beers, R. F., and Bassett, E. G., eds) pp. 9-20, Raven Press, New York

Hamer, D. H., Davoli, D., Thomas, C. A., and Fareed, G. C. (1977) J. Mol. Biol. 112, 155-182

Primakoff, P., and Berg, P. (1970) Cold Spring Harbor Symp. @ant. Biol. 35, 391-396

Eean. J.. and Landv. A. (1978) J. Biol. Chem. 253.3607-3622 K%pper,’ H., Sekiya,’ T., Rosenberg, M., Egan, J., ‘and Landy, A.

(1978) Nature 272,423 Rossi, J. J., and Landy, A. (1979) Cell 16, 523-534

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

M J Ryan, R Belagaje, E L Brown, H J Fritz and H G KhoranaIts cloning and relative expression in vivo.

A synthetic tyrosine suppressor tRNA gene with an altered promoter sequence.

1979, 254:10803-10810.J. Biol. Chem. 

  http://www.jbc.org/content/254/21/10803Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/254/21/10803.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from