THE JOURNM. OF Blomlcu. C H E M I ~ Y 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc

VOl. No. 31, Iasue of November 5, PP. 23399-23408,1993 Printed in U.S.A.

A Different Combination of Transcription Factors Modulates the Expression of the Human Transferrin Promoter in Liver and Sertoli Cells*

(Received for publication, February 22, 1993, and in revised form, June 16, 1993)

Evelyne Schaeffer$g, Florian Guilloun, Dominique Part*, and Mario M. ZakinS From the $Unit6 &Expression d e s GPnes Eucaryotes, Znstitut Pasteur, 75724 Paris Cedex 15 and the lllnstitut National de la Recherche Agronomique, Station de Physiologie de la Reproduction, 37380 Nouzilly, France

We have previously identified the functional regions involved in the regulation of human transferrin (Tf) gene expression in the liver and in Sertoli cells of the testis. Here, we show that a different cellular distribu- tion of transcription factors, interacting with the same proximal promoter regions (PRI and PRII), modulates cell type-specific transcription. In the liver, hepatocyte nuclear factor 4 (HNF-4) and the chicken ovalbumin up- stream promoter transcription factor (COUP-TF) act at the PRI site, while CCAAT/enhancer-binding proteins (CEBPs) act at the PRII site. In the testis, distinct com- binations of Sertoli proteins SP-A and SP-D and COW-TF bind to the PRI site, while SP-a and SP-p bind to the PRII site.

Cotransfection experiments in Hep3B cells revealed that mostly HNF-4, C/EBP-a, C/EBP-8, and, to a lesser extent, COUP-TF stimulated transcription driven by the -126/+39 region. In Sertoli cells, HNF-4 and COUP-TF appeared to repress, while the C/EBP factors were able to stimulate transcription driven by the -100/+39 region. However, the specific activating combination remains to be defined among the Sertoli proteins. In the non-Tf- expressing HeLa cells, the Tf promoter could be acti- vated by C/EBP-8.

Our data revealed functional antagonism between HNF-4 and COUP-TF, binding to PRI, as well as cross- coupling interactions between HNF-4 and C/EBP, bind- ing to adjacent sites. Thus, cell type-specific DNA-pro- tein interactions, together with protein-protein interactions, may explain the transcriptional regulation of the Tf gene in different cell types.

The molecular mechanisms that generate a diverse pattern of tissue specificity and diverse levels of expression of the same gene in several tissues are not yet fully elucidated. Our model is the human transferrin (TO‘ gene (Schaeffer et al., 1987), which is expressed at a high level in the liver and at a low level

entifique Grants URA 1129 and URA 1291 and Institut National de la * This work was supported by Centre National de la Recherche Sci-

Recherche Agronomique Contrat RBgulations Intragonadiques 92/4860. The costs of publication of this article were defrayed in part by the

“advertisement” in accordance with 18 U.S.C. Section 1734 solely to payment of page charges. This article must therefore be hereby marked

indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted

to the GenBankTMIEMBL Data Bank with accession numberfs) X04600. 8 Present address: Unit4 INSERM 338, Centre de Neurochimie, 5 rue

Blaise Pascal, 67084 Strasbourg Cedex, France. ‘The abbreviations used are: Tf, transferrin; C/EBP, CCAAT/en-

hancer-binding protein; PR, proximal region; CR, central region; DR, distal region; HNF-4, hepatocyte nuclear factor 4; COUP-TF, chicken ovalbumin upstream promoter transcription factor; MSV, murine sar- coma vim; CAT, chloramphenicol acetyltransferase; LAP, liver-en-

in the testis. Transferrin secreted by hepatocytes into the se- rum functions as the iron transport protein and as a growth factor for a variety of cells. Sertoli cells of the testis synthesize and secrete transferrin, one of the essential components for the maturation of germinal cells (Skinner and Griswold, 1980).

In our previous studies, we have analyzed the regulatory function of sequences extending over 4 kilobases of the 5’- flanking region of the Tf gene. We mapped the cis- and trans- acting elements involved in the transcriptional regulation of the Tf gene in liver (Brunel et al., 1988; Schaeffer et al., 1989) and in Sertoli cells (Guillou et al., 1991). A comparison of the elements governing liver- and testis-specific transcription re- vealed a major difference in the -36001-3300 region; this ele- ment functioned as an enhancer in hepatoma cells (Boissier et al., 1991) and was unable to increase transcription in Sertoli cells. Moreover, in the proximal promoter region, different com- binations of cis-acting elements appeared to control tissue-spe- cific expression. Liver-specific transcription was described to be mediated by the binding of a factor called Tf liver factor 1 and a C/EBP-related factor to their respective proximal regions (PRI and PRII). In contrast, in Sertoli cells, the TATA box region was sufficient to activate a basal level of transcription; optimal transcriptional activation was achieved by the combi- nation of the PRI element with either the upstream PRII ele- ment or the downstream TATA box element. As a preliminary approach, the interactions of nuclear bind-

ing proteins with the proximal promoter sequences were char- acterized by DNA footprinting and mobility shift experiments. However, the question whether the nuclear factors binding to the proximal sequences are identical or not in the liver and testis remained unanswered.

In this report, we have characterized the nuclear factors binding to the proximal promoter PRI and PRII elements. Among them, we have identified hepatocyte nuclear factor 4 (HNF-41, the chicken ovalbumin upstream promoter transcrip- tion factor (COUP-TF), and the C/EBP family and studied their involvement in regulating Tf gene transcription in the liver and in Sertoli cells.

MATERIALS AND METHODS Plasmid Constructions-Most of the vectors used were described pre-

viously by Schaeffer et al. (1989) and Guillou et al. (1991). To construct 4 PRI-CAT2 and 4 PRII-CAT2, the synthetic oligonucleotide PRI or PRII was multimerized with T4 DNA ligase; the oligomers containing four copies were inserted in the SmaI site of pUClS-CAT2. All the inserts were in sense orientation. The control MSV vector was con- structed by digestion of MSV-C/EBP-a (Cao et al., 1991) with EcoRI and BamHI, filling in, and religation of the vector on itself with T4 DNA ligase.

riched transcriptional activator protein; LP, liver protein; SP, Sertoli protein.

23399

23400 Panscriptional Regulation of the Pansferrin Gene

A

TATA wt -38 CCGGGAATGGAATAAAGGGACGCGGG - 13 mut CCGGGAATGGGGGAAAGGGACGCGGG

PR I wt -74 CACGGGAGGTCAAAGATTGCGCCCA - 50 mut CACGGGAGGTTAACTATTGCGCCCA

PR II wt -108 GGAGAGGGGCGATTGGGCAACCCGG -84 mut a GGAGAGGGGCCCTAGGGCAACCCGG mut ab GGGGCCCTAGGCATGCCCGGCTGCA

CR wt -198 CATTTCTGTGCTGGACTCCTTCCAC - 174 mut CATTTCTGTGCGCGCCTCCTTCCAC

DR I wt -476 TGTCTTTGACCTTGAGCCCAGCTTG - 452 mut a TGTCTTTGACCTTTAAACCAGCTTG mutb CTGAGTCTGTAGTTAACCTTGAGCC mutab CTGAGTCTGTAGTTAACCTTTAAAC

DR II wt -662 CCCAGCTTGAGGGCGGGAAGTTTTC -598 rnut CCCAGCTTGACTGCAGGAAGTTTTC

Mutated site I DR II DR I a DR I b DR I ab CR PRll a PRll ab PRI TATA

2 Hep3B I 92 166 141 99 87 35 31 16 49 c

- 0 ,- Sertoli 99 98 ND 97 96 63 50 77 72 < 0 s

B EXTRACT LIVER TESTIS LIVER TEms

PR I Im I Im PR II Ilm II Ilm " "

rs

m

i

FIG. 1. Contribution of each site to -620/+39 Tf promoter activity as revealed by site-direded mutagenesis of protein-binding sites. A: top, schematic drawing of the -620/+39 Tf-CAT construct. The black boxes are the protein-binding sites identified by DNase I footprinting analysis in our previous study (Brunel et al., 1988; Guillou et al., 1991). The wild-type ( w t ) and mutant h u t ) sequences of the synthetic

nanscriptional Regulation of the Dunsferrin Gene 23401 Site-directed Mutagenesis-To create mutations in the TATA, PRI,

PRII, CR, DRI, and DRII sites, we used synthetic oligonucleotides con- taining the desired point mutations (Fig. 1) and followed the described procedure using the Muta-Gene phagemid in vitro mutagenesis kit (Bio-Rad). The introduction of the desired mutations was verified by DNA sequencing.

Cell Culture, Zhnsfections, and CAT Assays-Sertoli cells were iso- lated from 17-20-day-old rat testis. Sertoli cells and human hepatoma Hep3B cells were cultured and transfected as described by Guillou et al. (1991). Human HeLa cells were cultured and transfected as described by Schaeffer et al. (1989). Cell extracts were used for CAT assays as described by Guillou et (11. (1991).

In cotransfection experiments, 0.5 pmol of the reporter CAT con- struct and 0.5 pmol of the expression vector, in a final volume of 330 pl, were introduced into the cells plated in a 6-cm dish using the calcium phosphate precipitation method (Graham and Van Der Eb, 1973). The same DNA preparations were used for all cell types.

The HNF-4 expression vector (pLEN45) was a gift of F. M. Sladek and J. E. Darnell. The COUP-TF expression vector was a gifi of S. Y. Tsai. The vectors MSV-C/EBP-a, MSV-CIEBP-P, and MSV-CIEBP-8 were a gift of S. McKnight.

DNA-Protein Mobility Shift Assay-Nuclear extracts of rat liver were prepared as described by Brunel et al. (1988); nuclear extracts of rat testis or isolated Sertoli cells were isolated as described by Guillou et al. (1991). The standard assay was performed as described by Guillou et al. (1991). To perform the assays with specific antisera, 1 p1 of the antise- rum diluted 10-fold in a saline solution was added to 10 pl of the shiR reaction containing 5 pg of protein extract, 1 pg of poly(dI-dC), 50 ng of sonicated salmon sperm DNA, 10 mM MgC12, 25 m~ KCl, 1 m~ dithio- threitol, 12.5 m~ HEPES, pH 7.8, 10% glycerol, 0.05% Nonidet P-40. After overnight incubation at 4 “C, 1 ng of 32P-labeled oligonucleotide was added, and the mixture was further incubated for 15 min. Protein- bound DNA complexes were separated by electrophoresis on a 6% poly- acrylamide gel in 0.25 x TBE (1 x TBE = 89 m~ Tris, 89 m~ boric acid, 2 mM EDTA).

HNF-4 antiserum was a gift of F. M. Sladek and J. E. Darnell; the antibodies are directed against amino acids 445455 of the rat HNF-4 protein. COUP-TF polyclonal antiserum was a gift of S. Y. Tsai. CIEBP-a antiserum was a gift of S. McKnight. LAP (CIEBP-P) antise- rum was a gift of P. Descombes and U. Schibler. The sequence of the APFl oligonucleotide was 5‘-CAG GGC GCT GGG CAA AGG

Methylation Interference-Each oligonucleotide was 5’-end-labeled, annealed with the nonlabeled complementary oligonucleotide, and par- tially methylated at guanine residues using dimethyl sulfate. The meth- ylated probe (10 ng) was incubated with the nuclear protein extract (150 pg) under the conditions described above for the mobility shiR assay. The complexes were analyzed on a preparative 6% mobility shift gel. The gel was exposed for 1 h; the complexed and free oligonucleotides were excised from the gel, eluted, and ethanol-precipitated (Maxam and Gilbert, 1980). The samples were treated with 1 M piperidine and elec- trophoresed on a urea-25% polyacrylamide sequencing gel.

TCA CCT GCT GAC-3’.

RESULTS

Importance of Proximal Promoter Sites for Liver- and nstis- specific Danscription-We have analyzed previously the inter- actions of liver and testis nuclear factors with the -620/+39 promoter region by DNase I footprinting and mobility shiR experiments (Brunel et al. 1988; Guillou et al., 1991). Liver proteins interact with the proximal regions (PRI and PRII), the central region (CR), and the distal regions (DRI and DRII); nuclear proteins of the testis as well as of Sertoli cells interact with the same sites and in addition with the TATA box region and the distal region DRO. These sites are depicted on the schematic drawing on Fig. 1.

Here, we investigated the contribution of each binding site to the activity of the Tf promoter in transient expression assays.

Nucleotide changes were introduced individually in each of the promoter sites using site-directed mutagenesis. The wild-type and mutant oligonucleotides are presented in Fig. U. We con- trolled by gel shiR assays, that the mutant oligonucleotides were unable to bind any testis or liver nuclear protein; the results are shown for oligonucleotides PRI and PRII in Fig. 1B. Each mutant -620/+39 Tf-CAT vector was transfected either in hepatoma Hep3B cells or in primary cultured rat Sertoli cells. The resulting CAT activities, presented in Fig. L4 (table), are expressed relative to the 100% value of the wild-type -620/+39 Tf-CAT vector in each cell type. In both cell types, the results clearly demonstrate the importance of the proximal sites since the mutation of the central and distal sites (CR, DRI, and DRII) did not lead to any decrease in CAT activity. The mutation of any of the proximal sites (TATA, PRI, and PRII) produced a decrease in CAT activity. However, there was a significant dif- ference between the two cell types.

In Hep3B cells, the mutation of the PRI or PRII site resulted in a dramatic reduction in CAT expression since the remaining CAT activity was 16 and 35%, respectively. In Sertoli cells, these mutations produced only a small reduction in CAT ex- pression since the remaining activity was 77 and 63% for the PRI and PRII sites, respectively. The PRIIab mutation, con- taining seven mutant nucleotides, led to a remaining CAT ac- tivity of 31 and 50% in Hep3B and Sertoli cells, respectively.

The transcriptional activity of the proximal promoter region located downstream of position -125 was further examined by transient expression studies of 5”deleted Tf-CAT vectors (Fig. 2 B ) . The level of CAT activity reached by the -620/+39 Tf-CAT vector was defined as 100% in each cell type. Our previous results with the vectors containing inserts ending at position -125, -82, -52 already indicated a difference between the two cell types. Here, the -100/+39 and -93/+39 Tf-CAT vectors allowed us to map more precisely the proximal regions (Fig. 2A) .

In Hep3B cells, the CAT activity was maximum with the deletion ending at position -125 and then dropped at position -100 and was reduced to zero at position -93. The deletion of half of the PRII site in -93/+39 Tf-CAT was sufficient to reduce the CAT activity to zero. In Sertoli cells, CAT activity was maximum at position -100; the successive 5’-deletions of the PRII and PRI sites resulted in a progressive decrease in activ- ity that did not drop to zero. The TATA box was still sufficient for a basal level of transcription, which was half of the level measured with the -620/+39 Tf-CAT vector (Fig. 2C).

Different Liver and Testis Nuclear Factors Bind to Proximal Promoter PRI and PRII Sites-The interactions of liver and testis nuclear factors with the proximal sites were previously analyzed by mobility shift experiments. Each oligonucleotide (PRI and PRII) gave two specific retarded DNA-protein com- plexes, the lower complex C1 and the upper complex C2 (see Fig. 5) (Guillou et al., 1991). The question remained whether the proteins present in each complex were the same or not in the liver and testis. As a first approach, methylation interfer- ence analyses were performed to locate the guanine residues of the PRI and PRII sequences that interact with the liver or testis nuclear proteins within the C1 and C2 complexes,

The pattern obtained with the PRII oligonucleotide is shown in Fig. 3. Complexes C1 and C2 gave a strikingly different

oligonucleotide corresponding to each binding site are shown. The boldface letters represent the mutant nucleotide. Bottom, each construct was transfected in duplicate in at least five separate experiments into Hep3B and Sertoli cells. Protein extracts from the transfected ceHs were analyzed for CAT activity. aansfection and CAT experiments were performed as described under “Material and Methods.” The table shows the percentage CAT activity of each mutant -620/+39 Tf-CAT vector relative to the 100% value of the wild-type construct. E , mobility shift assays with 1 ng of S2P-labeled wild-type and mutant PRI and PRII oligonucleotides. The two specific DNA-protein complexes Cl and C2 are indicated; NS corresponds to nonspecific complexes. The autoradiograms were overexposed to detect any residual DNA binding activity with PRIm and PRIIm.

23402 Danscriptional Regulation of the Dansferrin Gene

-620 -{ CAT I . c m -"L"

-1 25 -1 00

-93 -82

-52 - C

+39 +39 +39 +39 - 1 +30

0 Sertoli

I Hep3B

-620 -125 -1 00 -93 -82 -52 pUC CAT

FIG. 2. 'hmsferrin promoter requires 125 and 100 base pairs in hepatoma and Sertoli cells for maximal activity, respectively. A, DNA sequence of the proximal promoter region. The lines above and below the sequence represent protected regions as previously deter- mined by DNase I footprinting (Brunel et al., 1988; Guillou et al., 1991). The solid and dashed lines correspond to the binding sites observed with liver and testis nuclear extracts, respectively. B, schematic repre- sentation of the Tf-CAT plasmids containing progressive 5"deletions of the promoter region. The 5'- and 3'-end points of the deletions are in base pairs. C, histogram showing transient CAT expression in Hep3B and Sertoli cells transfected with the Tf-CAT plasmids described for B. Activities were determined as described under "Materials and Meth- ods." Values are expressed as percentage of -620/+39 Tf-CAT activity in each cell type. They are the means * S.E. for a t least three independent transfections with two DNA preparations; the standard deviation did not exceed 20% of the measured value. Some values have been pre- sented previously (Guillou et al., 1991).

methylation interference pattern. Moreover, within each com- plex, liver and testis proteins interacted with different guanine residues. For example, the interference of binding with the liver protein in the C2 complex was observed only on the lower strand, at residues -88 and -91, whereas a weak interference of binding with the testis proteins was observed only on the upper strand at residues -100, -101, -102, -103, and -105. The results obtained clearly show that the liver and testis proteins interacting with PRII either in the C1 or C2 complex are distinct.

The methylation interference pattern with the PRI oligo- nucleotide (Fig. 3) appeared to be identical for the C1 and C2

4 1 1 1 , . c

k :-

-58 D m -. "

strand: mf coding I 3 coding

L S - . 2 F

L S

.e5 n

94- " rr

coding

FIG. 3. Methylation interference patterns of C1 and C2 DNA- protein complexes obtained with PRI and PRII and liver or testis extracts. The PRI or PRII oligonucleotide was labeled a t the B'-end of one strand. Guanine residues were partially methylated with dimethyl sulfate. The oligonucleotide was used in a gel shiR assay with liver (L) or Sertoli (S) nuclear extracts. The DNA-protein complexes C1 and C2 (see Fig. 5) were separated from free DNA by electrophoresis on a 6% acrylamide gel, localized by autoradiography, eluted, and cleaved a t methylated guanine residues with piperidine. The protein-bound DNA (+ lanes) was compared to free DNA (- lanes) on a sequencing gel. Guanine residues that interfere with binding are indicated by inverted triangles and squares for liver and testis proteins, respectively; closed and open symbols indicate strong and weak interference of binding, respectively. Top, pattern obtained with the PRII oligonucleotide; bot- tom, summary of the data obtained with the PRII and PRI sequences.

complexes formed with testis proteins. With liver proteins, strong methylation interferences were evident in the C1 com- plex, whereas weaker interferences were observed in the C2 complex. In each complex, the contact points were similar with liver and testis proteins; however, a clear difference appeared in the strength of the methylation interference. This may fur- ther suggest a difference in the nature of the liver and testis proteins interacting with the PRI sequence.

The proteins present in liver or testis nuclear extracts and interacting with the PRI sequences were analyzed aRer frac- tionation on a heparin-Sepharose column. Fig. 4 shows the elution profile of the column with increasing KC1 concentra- tions. The activity of each fraction was tested by gel mobility assays using the PRI oligonucleotide as a probe. At least six complexes (fractions A-F) could be detected (Fig. 4, right panel). Concerning the liver proteins, fraction A (eluting at 50 nm KCl) and fraction F (eluting a t 0.5 M KCl) gave rise to a complex presenting the same mobility as the lower complex C1. Fraction B (eluting a t 0.2 M KC11 gave rise to a complex of lower mobility; this complex corresponds to the interaction of the previously purified pyrimidine-rich binding protein with the lower single strzind of the PRI oligonucleotide (Brunel et al., 1991). Fractions C-E (eluting between 0.3 and 0.5 M KC11 gave rise to a complex presenting the same mobility as the upper complex C2. Competition experiments with the homologous competitor PRI or the heterologous competitor APFl were per- formed. APFl is the binding site of transcription factor HNF-4 in the promoter of the apoC-I11 gene (Sladek et al. 1990). A

Danscriptional Regulation of the Dansferrin Gene 23403

1 I -20 0

c u

- . - - $10

?

0 0 10 10 30 4 0 5 0 6 0 7 0

f r a c t i o n s

1 I

t I 1 0 0

c2

cl

TESTIS Extract

*.

FIG. 4. Analysis of proteins present in liver or testis nuclear extracts able to bind to PRI sequence after heparin-Sepharose fractionation. 40 mg of liver or 20 mg of testis nuclear proteins were loaded on a heparin-Sepharose column and eluted with increasing KC1 concentrations. Left panel, protein elution profile with either liver ( top) or testis (bottom) proteins. Each fraction was tested for binding to the PRI-labeled oligonucleotide in a gel shift assay. Active fractions are labeled A-F. Right panel, retarded DNA-protein complexes present in the crude extract and in each active fraction. The two specific complexes C1 and C2 formed with crude extracts are indicated. Lanes 1, homologous competition with 100 ng of PRI; lanes 2, heterologous competition with 100 ng of APF1.

10-fold excess of the PRI or APFl oligonucleotide was able to compete for the complex formed with fractions A and F. The complexes formed with fractions D and E were competed for with a 100-fold excess of APFl and only weakly competed for with a 100-fold excess of the homologous PRI oligonucleotide (Fig. 4).

With the testis proteins, fraction A (eluting between 0.1 and 0.2 M KC11 corresponds to the C1 complex; fraction E (eluting at 0.5 M KC11 corresponds to the C2 complex (Fig. 4). Competition experiments showed that the complex formed with fraction A was competed for with a 10-fold excess of the homologous PRI oligonucleotide and could not be competed for with a 100-fold excess of the heterologous APFl oligonucleotide (Fig. 4). The proteins giving rise to the upper complex C2 (fraction E) eluted a t a different KC1 molarity than those present in liver fractions C-E (Fig. 4). These results suggest that the nuclear factors giving rise to both complexes C1 and C2 are different in the liver and testis.

Identification of Some Nuclear Factors Interacting with PRI and PRII Sites-'Ib identify the proteins binding to the PRI site, the shift reactions with crude liver or testis nuclear ex- trads were incubated with antisera raised against several transcription factors (Fig. 5, right panel 1. The antiserum raised against a synthetic peptide derived from the carboxyl terminus of the HNF-4 protein (Sladek et al., 1990) retarded the mobility of the major complex C1 formed with the liver extract (Fig. 5, lane 6) and did not affect the complexes formed with the testis extract (lane 13). All the liver and testis fractions (A-F) eluted from the heparin-Sepharose column were tested; only liver fraction F eluting a t 0.5 M KC1 was retarded (lane 8).

When the shift assay was performed in the presence of an- tiserum raised against COUP-TF (Wang et al., 19891, the testis C2 complex was almost completely retarded (Fig. 5, lane 14), whereas only part of the liver C1 complex was affected (lane 3) . Analyses with the purified fractions showed that the complexes

formed with liver fraction F and testis fraction E, both eluting a t 0.5 M KCl, were partially retarded with the COUP-"F anti- serum (lanes 10 and 17). This partial shift may be explained by the presence of other more abundant PRI-binding factors, such as HNF-4 present in liver fraction F.

Therefore, it appeared that the major liver C1 complex con- tains a large amount of HNF-4 and a small amount of COUP- TF, both present in fraction F and the PRI-binding protein present in fraction A, called liver protein A (LP-A). The testis C2 complex is formed, among others, by COUP-TF, present in fraction E. The proteins present in testis fractions A and D were not identified and are called Sertoli proteins SP-A and SP-D.

We observe that COUP-TF is present in the C2 complex formed with testis extracts and in the C1 complex formed with liver extracts. In fact, multiple forms of COUP-TF have been isolated. Wang et al. (1991) reported that there are two classes of COUP-TF defined by their molecular size. It is therefore likely that the COUP-TF species present in the liver and testis belong to the low and high molecular weight species, respec- tively.

We have shown previously that pure C/EBP-a is able to pro- tect the PRII site from DNase I digestion in footprinting ex- periments (Brunel et al., 1988). The proteins binding to the PRII probe were examined by using polyclonal antisera di- rected specifically against C/EBP-a (Landschulz et al., 1988) or C/EBP-P (LAP) (Descombes et al., 1990). Crude nuclear ex- tracts were heated for 5 min at 80 "C, and the supernatants containing the heat-resistant proteins were used for shift as- says (Fig. 5, left panel). With liver proteins, the major complex C2 was almost completely retarded with the anti-C/EBP-a se- rum (lane 3 ) and was present in a decreased amount with the anti-C/EBP-P serum, relative to the unaffected C1 complex (lane 7) . The protein present in the C1 complex is called liver protein I1 (LP-11). With testis proteins, neither the minor com- plex C2 nor the major complex C1 was affected by any antise-

FIG. 5. Comparison of HNF-4, COUP-'I", CIEBP-a, and CIEBP-fl binding activities in liver and testis. Shown are mobility shift assays with 1 ng of 32P-labeled PRI probe (right panel) or PRII probe (left panel). Reactions contained 10 pg of liver or testis nuclear extract and 2 pg of poly(dI-dC) with 200 ng of either nonspecific (- lanes) or specific (+ lanes) oligonucleotide as competitor. The two specific DNA-protein complexes

(see Fig. 4); Epanel, lanes 16 and 17 correspond to 10 p1 of testis fraction E (see Fig. 4). Antisera to HNF-4, COUP-TF, CIEBP-a, and LAP (CEBP-p) C1 and C2 are indicated. Fpanels, lanes 7-10 with PRI correspond to 2 pl of liver fraction F eluted a t 500 mM KC1 on the heparin-Sepharose column

were added to the protein extract and incubated at 4 "C overnight prior addition of the labeled probe (see "Materials and Methods"). Lanes NI correspond to the addition of preimmune serum.

Hep 38 T

Reporter 4 PRI - CAT2 1 4 PRll - CAT2 I FIG. 6. Relative CAT activities of constructs containing either

PRI or PRII sequence in presence of various expression vectors in Hep3B and Sertoli cells. Cotransfection assays were performed in Hep3B and Sertoli cells with 0.5 pmol of the indicated expression and reporter vectors. M is the control vector that contains no inserted cDNA. 4 PRI-CAT2 and 4 PRII-CAT2 contain four copies of either the PRI or PRII sequence in front of the SV40 promoter and the CAT gene. The bar graphs present the CAT activity in each cell type relative to that of the reporter in the presence of the control M vector. Values represent the mean of at least three independent transfections with two DNA prepa- rations.

rum (lunes 9 and IO). The proteins forming the C1 and C2 complexes are called Sertoli proteins SP-a and SP-p, respec- tively.

HNF-4 and, to a Lesser Extent, COUP-TF Activate Tf Gene Danscriptwn in Hep3B Cells and Repress Dunscription in Ser- toli Cells-The functional consequences of HNF-4 and COUP-TF on transferrin gene transcription were analyzed by transient expression experiments in Hep3B and Sertoli cells. First, we showed that the effects of HNF-4 and COUP-TF are mediated by the PRI site; increasing amounts of the HNF-4 or COUP-TF expression vector were cotransfected with 0.5 pmol of the reporter construct 4 PRI-CAT2, containing four copies of the PRI oligonucleotide in front of the SV40 promoter and the CAT gene. A maximum transcriptional effect was detected with equal amounts (0.5 pmol) of the expression vector and the re- porter construct (Fig. 6).

Similar effects were observed when the HNF-4 or COUP-TF expression vector was cotransfected with the reporter construct

containing the proximal promoter region that gave the highest CAT activity, -1251+39 Tf-CAT in Hep3B cells or -1001+39 Tf- CAT in Sertoli cells. As shown on Fig. 7, HNF-4 and COUP-TF had opposite effects in the two cell types. In Hep3B cells, HNF-4 and, to a lesser extent, COUP-TF functioned as positive modulators of transcription since they activated transcription 6- and 2-fold, respectively. In Sertoli cells, HNF-4 as well as COUP-TF functioned as negative regulators of transcription since they reduced the basal promoter activity by half.

It was shown previously that COUP-TF antagonizes trans- activation of the apoC-I11 gene promoter by HNF-4 in HepG2 and Caco2 cells (Mietus-Snyder et al., 1992). COUP-TF is also able to repress the activation mediated by the retinoid X recep- tor (Kliewer et al., 1992). To test the effect of the combination of both proteins, we performed cotransfection assays in Hep3B cells with equal amounts of the HNF-4 and COUP-TF expres- sion vectors together with -1251+39 Tf-CAT (Fig. 7). In the context of the Tfpromoter, the presence of both factors resulted in a complete lack of transcriptional activation, indicating an- tagonistic effects between HNF-4 and COUP-TF.

CIEBP-a, CIEBP-p, and CIEBP-6 Activate Tf Gene Dan- scription in Hep3B and Sertoli Cells-We first showed that the family of C/EBPs (Johnson et al., 1987; Cao et al., 1991) is able to modulate transcription of the Tf gene by acting on the PRII site. Cotransfection experiments were performed with various concentrations of the C/EBP-a, CIEBP-0, and CEBP-6 expres- sion vectors together with the reporter construct 4 PRII-CAT2, containing four copies of the PRII oligonucleotide in front of the SV40 promoter and the CAT gene. Fig. 6 shows the results obtained with 0.5 pmol of each reporter and expression vector. In Hep3B cells, a maximum effect was observed with C/EBP-6 and C/EBP-a, which stimulated transcription 10- and 7-fold, respectively. CIEBP-P had no effect. Similar results, shown on Fig. 7, were obtained with the reporter construct containing the Tf minimal promoter. The -1251+39 proximal promoter was fully responsive to transactivation by C/EBP-a and C/EBPd, which stimulated transcription 12- and 17-fold, respectively. CIEBP-P was less active since transcription was stimulated only 2-fold.

In Sertoli cells, transcription of the 4 PRII-CAT2 vector was activated -&fold in the presence of C/EBP-a and C/EBP-P and

Danscriptional Regulation of the Dansferrin Gene 23405

r 4 Hep 38

.i n

.

? T i

i

HeLa

T

+ (-125. +39) Tf-CAT

(-100. 40) Tf-CAT

(-125. +39) TI-CAT

FIG. 7. Different patterns of activation and repression in Hep3B, Sertoli, and HeLa cells by HNF-4, COUP-'I", CIEBP-a, C/EBP-/3, and CIEBP-6. Cotransfection assays were performed in Hep3B and HeLa cells with -125/+39 Tf-CAT and in Sertoli cells with the -100/+39 Tf-CAT reporter construct together with the indicated expression vector. 0.5 pmol of each vector was used. M is the control vector that contains no inserted cDNA. Leftpanels, the bar graphs present the CAT activity expressed relatively to the reporter CAT construct in the presence of 0.5 pmol of control M DNA in each cell type. They are the mean values of at least three independent transfections done in duplicate. Right panel, autoradiograms of one typical CAT assay in each cell type.

6-fold in the presence of CD3BP-6 (Fig. 6). The -100/+39 proxi- scription from the Tf promoter in Hep3B cells. Surprisingly, mal promoter was activated %fold in the presence of C/EBP-a when cotransfection assays were performed with equal and 2-fold in the presence of CIEBP-P or C/EBP-6 (Fig. 7). amounts (0.5 pmol) of the HNF-4 and C/EBP-a, CIEBP-P, or

It was interesting to test whether the addition of HNF-4, C/EBP-6 expression vectors, the expression of the -125/+39 acting on the PRI site, and any of the C/EBP family members, Tf-CAT activity was reduced compared to the CAT level ob- acting on the PRII site, would synergistically activate tran- served with each expression vector alone (Fig. 7). This implies

23406 Danscriptional Regulation of the Dansferrin Gene an antagonistic effect between the transcription factors inter- acting with the adjacent PRI and PRII sites.

CIEBP-6 IS Able to Activate Tf Gene Danscription in HeLa Cells-The human HeLa cell line does not express the Tf gene. We showed previously that no Tf-CAT construct could be ex- pressed in this cell line (Schaeffer et al., 1989). One hypothesis was that these cells lack the transcription factors able to bind to the PRI and PRII sites. It was interesting to test whether any one of the proteins HNF-4, COUP-TF, C/EBP-a, C/EBP-p, and C/EBP-6 or a combination of them, active in Hep3B cells, could promote transcription of the Tf gene in HeLa cells. Co- transfection experiments were performed with each of the ex- pression vectors and the -125/+39 Tf-CAT reporter construct. As shown in Fig. 7, any one of the HNF-4, COUP-TF, C/EBP-a, and C/EBP-p factors appeared to be a very poor transactivator. Interestingly, C/EBP-6 was a very potent transactivator of the Tf promoter since it was able by itself to activate the CAT gene to a level similar to that observed in Hep3B cells. Cotransfec- tion of equal amounts of the HNF-4 and UEBP-6 expression vectors resulted in a decrease in the -125/+39 Tf-CAT activity compared to the C/EBP-&induced activity (Fig. 7). This effect, already observed in Hep3B cells, suggests antagonistic inter- actions between the two transcription factors binding to the adjacent sites.

DISCUSSION

Functional Importance of Promoter Elements Required for Liver- and Ikstis-specific Danscription of Tf Gene-Our previ- ous 5"deletion analysis in transient expression experiments already revealed the importance of the -125/+39 proximal pro- moter region (Schaeffer et al., 1989). Here, we have examined the transcriptional contribution of each of the multiple binding sites in the -620/+39 Tf promoter (Fig. 1). The site-directed mutagenesis data confirm that the central and distal binding sites are not essential for the transcriptional activation of the Tf gene. These data stress the importance of the proximal pro- moter sites. In hepatoma cells, mutations in either the PRI or PRII site are able to cause a dramatic reduction in Tftranscrip- tion. A 3-nucleotide mutation in the PRI site is able to almost abolish transcription. This reduction occurs in the presence of at least four other binding sites, which confirms that especially the PRI site, but also the PRII site are an absolute requirement for Tf liver-specific transcription.

In Sertoli cells, mutations in each of the TATA, PRI, and PRII sites display only a small reduction in Tf expression; this result confirms our previous data that showed that liver- and testis- specific Tf transcription is mediated by a distinct combination of proximal promoter elements. In Sertoli cells, transcriptional activation is the result of the interaction of DNA-binding pro- teins with the PRI-TATA box couple or the PRI-PRII couple (Guillou et al., 1991). Here, the mutation of the PRI site, which affects transcription only slightly, suggests that the presence of the TATA box or the TATA box-PRII couple together with the upstream sites is sufficient to promote transcription. Thus, the same point mutations in the proximal sites affect transcription differently in hepatoma and Sertoli cells; this result already suggests that different trans-acting factors promote transcrip- tion in the two cell types.

The fine mapping of the proximal promoter by the 5'-deletion analysis of the -125/+39 region confirms the data of the site- directed mutagenesis (Fig. 2). As shown previously, in Hep3B cells, the presence of both PRI and PRII is necessary and suf- ficient for transcription since the transcriptional activity is maximum with the -125/+39 region and is reduced to zero with the -93/+30 region. In Sertoli cells, the TATA box region is sufficient for low basal transcriptional activity. The PRI-TATA box couple, in the -82/-1 region, increases the efficiency of

transcription. The importance of the -93/+30 and -100/+39 regions, which contain the TATA box, the PRI site, and part of the PRII site, is revealed by this study. The maximum activity of the - 100/+39 region corresponds to a 5-fold increase over the whole -620/+39 promoter region. It is interesting to note that in Hep3B cells, the maximum activity is conferred by the -125/ +39 region and by the -100/+39 region in Sertoli cells. This again suggests that the DNA-binding factors are different in the two cell types. Moreover, the increased transcription in Sertoli cells in the -100/+39 construct could be explained by the removal of a negative-acting protein. According to the methyl- ation interference data, a nuclear testis protein is interacting with the -1OW-100 region. Whether this factor plays a nega- tive regulatory role needs to be explored in future work.

Analysis of Danscription Factors Binding to Proximal Re- gion PRI in Liver and Ikstis-With crude liver nuclear extracts, the PRI-binding factor that gave rise to the major complex C1 was previously called Tf-LF1 (Ochoa et al., 1989). In fact, when crude liver and testis nuclear proteins were fractionated on a heparin-Sepharose column, mobility shift assays revealed mul- tiple PRI binding activities.

Our present data show that at least three different liver PRI-binding proteins are involved in the formation of the major complex C1. According to the antibody reactivity, the major liver protein species binding to the PRI site is identical to HNF-4 (Sladek et al., 1990). A minor species corresponds to COUP-TF (Wang et al., 1989); both proteins are eluted in frac- tion F. The PRI-binding protein LP-A, eluted in fraction A, remains to be characterized. The minor DNA-protein complex C2 is also formed by a mixture of several factors detected in fractions C-E. However, in competition experiments, these pro- teins appeared more specific for the heterologous APFl se- quence than for the homologous PRI sequence. Methylation interference data indicated that in complexes C2 and C1, the same guanine residues are involved in the DNA-protein con- tact; however, weaker methylation interferences were detected in the C2 complex compared to the C1 complex. Moreover, the proteins of the C2 complex appeared to be different from HNF-4 and COUP-TF according to the lack of interaction between the different heparin-Sepharose fractions and the specific antibod- ies (Fig. 5) (data not shown).

Concerning testis nuclear proteins, antiserum reactivity data showed that one of the PRI-binding factors present in the C2 complex and eluted in fraction E is COUP-TF. The HNF-4 protein could not be detected with the specific antibodies.

At least two other PRI-binding factors remain to be further characterized. The first is the testis protein eluted in fraction A, which gives rise to the C1 complex; this protein, called SP-A, binds specifically to the PRI site and is different from the liver factor LP-A, which binds to both PRI and APFl oligonucleo- tides. The testis protein present in fraction D, called SP-D, remains also to be characterized. Interestingly, all the testis PRI-binding proteins in complexes C 1 and C2 present a similar methylation interference pattern, suggesting that these pro- teins may belong to the same family. However, the fact that some guanine residues interfere more weakly with the liver proteins compared to the testis proteins suggests that the PRI- binding factors are different in the liver and testis.

Analysis of Danscription Factors Binding to Proximal Re- gion PRII in Liver and Ikstis-We could identify some liver proteins binding to the PRII site. According to the antibody reactivity, mostly C/EBP-a (Landschulz et al., 1988) and, to a lesser extent, C/EBP-P (LAP) (Descombes et al., 1990) are in- volved in the formation of the major DNA-protein complex C2. The protein LP-11, forming the minor complex C1, presents a different methylation interference pattern; most probably, it does not belong to the C/EBP family.

D-anscriptional Regulation of the Dansferrin Gene 23407

The testis proteins binding to the PRII site remain to be identified. Antisera directed against CIEBP-a (Landschulz et al., 1988) or against CA3BP-p (Descombes et al., 1990) did not interfere with the formation of complexes C1 and C2. This result correlates with data reporting the absence of these fac- tors in the testis (Birkenmeier et al., 1989). The methylation interference data clearly indicate that the Sertoli PRII-binding proteins called SP-a and SP-0, present in complexes C 1 and C2, respectively, are different from the liver proteins CIEBP and LP-11.

Model of Tissue-specific Expression of Tf Gene-Our data support the general thesis that cell-specific transcription is governed in different tissues by a distinct combination of tran- scription factors. Interestingly, in the case of the Tf gene, the factors interact with identical cis-acting proximal promoter el- ements.

Liver-specific transcription of the Tf gene is the result of a distinct combination of multiple transcription factors, among which we could identify HNF-4 and COUP-TF acting on the PRI site and the CIEBP-related proteins acting on the PRII site. HNF-4 is a member of the steroid, thyroid, and retinoic acid receptor superfamily (Sladek et al., 1990; Ladias et al., 1992). It is implicated in the expression of a series of hepato- cyte-specific genes, such as transthyretin, al-antitrypsin (Costa et al., 1988, 1989; Xanthopoulos et al., 19911, and apo- lipoproteins B, AII, and CIII (Ladias et al., 1992). The HNF-4 protein was shown to activate transcription of the apoC-I11 gene in HepG2 and Caco2 cells (Mietus-Snyder et al., 1992). The HNF-4 mRNA is present in rat liver, kidney, and intestine. COUP-TF is also a member of the steroid receptor family; it was originally shown to activate transcription from the chicken ovalbumin gene (Sagami et al., 1986); however, it represses transcription of the apoC-I11 gene in HepG2 and Caco2 cells (Mietus-Snyder et al., 1992). It may therefore function either as a positive or a negative modulator of transcription.

Our cotransfection data indicate that in Hep3B cells, HNF"4 and COUP-TF function separately as transcriptional activators of the Tf gene. The major activating species is HNF-4 since COUP-TF displays a weak positive activity. Addition of both expression vectors in cotransfection experiments revealed an- tagonistic interactions between the two proteins binding to the same site. The fact that HNF-4-induced activation was abol- ished by equimolar amounts of COUP-TF suggests that tran- scription of the "f gene depends on the balance of the two factors. Competition for DNA binding was described for various members of the steroid receptor superfamily. Opposing tran- scriptional effects were reported for HNF-4- and COUP-TF- induced expression of the apoC-I11 gene in liver and intestinal cells (Mietus-Snyder et al., 1992). The retinoid X receptor and COUP-TF also displayed antagonistic action, such that retinoid X receptor-mediated activation was fully repressed by COUP-TF (Kliewer et al., 1992); various retinoic acid receptors compete for binding to their common responsive site (Hussman et al., 1991). The authors suggest a model in which the two proteins either compete for binding to the same site or form a transcriptionally inactive heterodimer. In the case of the Tf gene, the formation of inactive heterodimers would better ac- count for the inhibition phenomenon.

The CIEBP transcription factors are members of the leucine zipper family (Busch and Sassone-Corsi, 1990; Lamb and McK- night, 1991); they facilitate the coordinated expression of pro- teins required by a number of different tissue types. CIEBP-a is capable of transactivating several adipose-specific proteins as well as the albumin gene (Friedman et al., 1989). Its mRNAwas found at abundant levels in the liver and fat and at very low levels in the testis (Birkenmeier et al., 1989). CIEBP-p was variously termed NF-IL6 (Akira et al., 1990), LAP (Descombes

et al., 1990), IL6-DBP (Poli et al., 19901, and AGP/EBP (Chang et al., 1990); its mRNA was detected in all tissues, with the exception of the brain and testis. C/EBP-8 mRNA was found to be abundant in the lung and intestinal and adipose tissues and to be absent in the liver and testis (Cao et al., 1991). All three C/EBP isoforms were able to transactivate the promoter of the albumin gene (Cao et al., 1991; Williams et al., 1991).

Our cotransfection data show that in Hep3B cells, C/EBP-a and CIEBP-6 are able to function as strong positive modulators, whereas CIEBP-P appears to be a very weak activator of the Tf promoter. According to our mobility shift results, C/EBP-a is the major species binding to the PRII site, with CIEBP-P being a minor species interacting with this site. Since CIEBP-8 was reported to be absent in mouse liver, CIEBP-a appears to be the major activating species acting on the PRII site in the liver.

Interestingly, our cotransfection data reveal antagonistic ef- fects between HNF-4 and the CIEBP isoforms, binding to the adjacent PRI and PRII sites, respectively. The HNF-4- and CIEBP-a- or CIEBP-&mediated activation is partially re- pressed by equimolar amounts of the factor binding to the adjacent site.

Such an intriguing mutual inhibition between leucine zipper proteins and zinc finger proteins was described by several au- thors. Protein-protein interactions between the glucocorticoid receptor and the AP-1 factor were suggested as explanations for the functional antagonism between the two members of distinct classes of transcription factors (Schule et al., 1990; Yang-Yen et al., 1990). The retinoid acid receptor was shown to inhibit Jun- Fos activation of the collagenase promoter (Schule et al., 1991). Moreover, repression of the estrogen receptor was shown to be mediated by the Jun or Fos protein (Doucas et al., 1991). It has been suggested that mutual repression is mediated by protein- protein interaction between the leucine zipper region of the AP-1 factor and the zinc finger protein. This phenomenon, re- ferred to as cross-coupling, involves an interaction between a steroid hormone or retinoic acid receptor and the Jun leucine zipper protein (Miner and Yamamoto, 1991; Schule and Evans, 1991). The formation of a heterodimer would prevent either protein from binding to target DNA. Our data show that not only AP-1, but also the CIEBP family of leucine zipper proteins is able to repress the transcriptional activation mediated by the HNF-4 zinc finger protein. The interaction between the two classes of transcription factors reveals the complexity of the transcriptional modulation of a gene. In the case of the Tf gene, such interactions would allow either protein, HNF-4 or CIEBP-a, to regulate the activity of the Tf gene without the need of binding directly to the target sequences.

Sertoli-specific transcription of the Tfgene is achieved by the use of the same proximal promoter sequences as those used in the liver. However, since HNF-4 and CIEBPs present in the liver are not available in the testis, Tf gene expression occurs in this tissue through a different combination of transcription factors. The only identified factor is COUP-TI?, which acts on the PRI site. Our cotransfection data show that in Sertoli cells, COUP-TF is a strong negative modulator of Tf transcription. However, a squelching phenomenon could explain this negative transcriptional effect (Ptashne, 1988). Since COUP-TF func- tions as a weak positive activator in Hep3B cells, these results suggest that this factor is able to function differently in various cell types as well as in different promoter context. Our cotrans- fection data indicate that the CIEBP isoforms would function as weak activators of Tf transcription if they were present in Sertoli cells. Taken together, our data indicate that the tran- scriptional activators remain to be further characterized in Sertoli cells. The candidates are SP-A and SP-D, acting on the PRI site, and SP-a and SP-p, acting on the PRII site.

These data demonstrate that the tissue-specific expression of

23408 Danscriptional Regulation of the Dansferrin Gene

LIVER

SERTOLI

factors that regulate transcription of transferrin gene in liver FIG. 8. Schematic representation of promoter elements and

and in Sertoli cells. The identified nuclear factors are HNF-4, COUP- TF, CIEBP, and transcription factor IID (TFZZD). The liver proteins LP-I1 and LP-A and the Sertoli proteins SP-a, SP-p, SP-A, and SP-D remain to be further characterized.

the Tf gene is regulated by the differential cellular distribution of transcription factors binding to the same cis-acting elements. Fig. 8 presents a schematic model describing the interactions of the various factors with the proximal promoter sites of the Tf gene. In Hep3B cells, the dominant factors regulating the ex- pression of the Tf promoter are HNF-4 and C/EBP-a; factors of lower importance are C/EBP-P and C0UF"TF as well as the liver proteins LP-A and LP-11. In Sertoli cells, except the nega- tive modulator COUP-TF, the factors binding to the proximal sites that we termed SP-A, SP-D, SP-a, and SP-P remain to be further characterized.

It was interesting to test whether in non-Tf-expressing cells, transcription of the Tf gene could be activated by the efficient combination of the liver factors HNF-4 and C/EBP-a. Surpris- ingly, our cotransfection data show that in HeLa cells, only C/EBP-S is sufficient by itself to activate transcription from the Tf promoter to a level comparable to that measured in Hep3B cells. In contrast to the result obtained in Hep3B cells, C/EBP-a and HNF-4 function as poor transcriptional activators. How- ever, the same functional antagonism between the two distinct classes of transcription factors observed in Hep3B cells exists in HeLa cells: simultaneous addition of the HNF-4 and C/EBP-S expression vectors decreases the C/EBP-&mediated activation.

Taken altogether, the data obtained in Hep3B, Sertoli, and HeLa cells reveal a higher level of complexity in the cell type- specific transcription of the Tf gene. Transcriptional activation depends not only on the concentration and affinity of the DNA- binding factors present in each cell type, but also on the whole cellular context. In addition to the DNA-protein interactions of the transcription factors with their target site, multiple cell- specific protein-protein interactions yet to be discovered create an additional regulatory network that contributes to modulate and govern the cell-specific transcription of a eukaryotic gene.

Acknowledgments-We thank F. M. Sladek and J. E. Darnell for the generous gift of the HNF-4 expression vector and HNF-4 antiserum; S. Y. %ai for the generous gift of the COUP-TF expression vector and antiserum; S. McKnight for the generous gift of the MSV-CIEBP-a, MSV-CBBP-p, and MSV-CIEBP-S expression vectors and CIEBP-a an- tiserum; and P. Descombes and U. Schibler for the generous gift of LAP

antiserum. We thank Elisabeth Croullebois for expert help in the prepa- ration of this manuscript.

REFERENCES

Akira, S. , Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T.,

Birkenmeier, E. H., Gwynn, B., Howard, S., Jerry, J., Gordon, J. I., Landschulz, W.

Boissier, F., Aug6-Gouillou, C., Schaeffer, E., and Zakin, M. M. (1991) J. Bwl.

Brunel, F., Oehoa, A., Schaeffer, E., Boissier, F., Guillou, Y., Cereghini, S. , Cohen,

Brunel, F.,Alzari, P. M., Ferrara, P., and Zakin, M. M. (1991) Nucleic Acids Res. 19,

Busch, S . J., and Sassone-Corsi, P. (1990) llknds Genet. 6,3640 Cao, Z., Umek, R. M., and McKnight, S . L. (1991) Genes & Deu. 5, 1538-1552 Chang, C. J., Chen, T. T., Lei, H. Y., Chen, D. S . , and Lee, S . C. (1990) Mol. Cell.

Costa, R. H., Grayson, D. R., Xanthopoulos, K. G., and Damell, J. E., Jr. (1988)

Costa, R. H., Grayson, D. R., and Damell, J. E., Jr. (1989) Mol. Cell. Bwl. 9,

Descombes, P., Chojkier, M., Lichtsteiner, S. , Falvey, E., and Schibler, U. (1990)

Doucas, V., Spyrou, G., and Yaniv, M. (1991) EMBO J. 8,2237-2245 Friedman, A. D., Landsehulz, W. H., and McKnight, S . L. (1989) Genes & Deu. 3,

Graham, F. L., and Van Der Eb, A. J. (1973) Emlogy 52,456467 Guillou, F., Zakin, M. M., Part, D., Boissier, F., and Schaeffer, E. (1991) J. Bid .

Hussman, M., Lehmann, J., Hofiinann, B., Hermann, T., Tzukerman, M., and Chem. 266,9876-9884

Johnson, P. F., Landschulz, W. H., Graves, B. J., and McKnight, S . L. (1987) Gems Pfahl, M. (1991) Mol. Cell. Biol. 11,40974103

& Deu. 1, 133-146 Kliewer, S . A., Umesono, K., Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., and

Ladias, J. A. A,, Hadzopoulou-Cladaras, M., Kardassis, D., Cardot, P., Cheng, J., Evans, R. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 144S1452

Lamb, P., and McKnight, S . L. (1991) llknds Biochem. Sei. 16,417422 Zannis, V., and Cladaras, C. (1992) J. Biol. Chern. 267, 15849-15860

Landschulz, W. H., Johnson, P. F., Adashi, E. Y., Graves, B. J., and McKnight, S . L.

Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 66,499-560 Mietus-Snyder, M., Sladek, F. M., Ginsburg, G. S. , Kuo, C. F., Ladias, J. A. A.,

Miner, J. N., and Yamamoto, K. R. (1991) llknds Biochem. Sei. 16,423-425 Darnell, J. E., Jr., and Karathanasis, S . K. (1992) Mol. Cell. Biol. 12,170S1718

Ochoa, A., Brunel, F., Mendelzon, D., Cohen, G. N., and Zakin, M. M. (1989) Nucleic

Poli, V., Mancini, F. P., and Cortese, R. (1990) Cell 63, 64-53 Ptashne, M. (1988) Nature 336,683-689 Sagami, I., T s a i , S . Y., Wang, H., Tsai, M.J., and O'Malley, B. W. (1986) Mol. Cell.

Schaeffer, E., Lucero, M. A,, Jeltsch, J.-M., Py, M.-C., Levin M. J., Chambon, P.,

Sehaeffer, E., Boissier, F., P y , M.-C., Cohen, G. N., and Zakin, M. M. (1989) J. Biol.

Schiile, R., and Evans, R. M. (1991) llknds Genet. 7,377381 Schiile, R., Rangarajan, P., Kliewer, S. , Ransone, L. J., Bolado, J., Yang, N., Verma,

Schiile, R., Rangarajan, P., Yang, N., Kliewer, S . , Ransone, L. J., Bolado, J., Verma, I. M., and Evans, R. M. (1990) Cell 62,1217-1226

Skinner, M. K., and Griswold, M. D. (1980) J. Biol. Chem. 256,952%9525 I. M., and Evans, R. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,6092-6096

Sladek, F. M., Zhong, W., Lai, E., and Darnell, J. E., Jr. (1990) Genes & Deu. 4,

Wang, L. H., %ai, S . Y., Cook, R. G., Beattie, W. G., Tsai, M. J., and O'Malley, B. W.

Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897-1906

H., and McKnight, S . L. (1989) Genes & Deu. 3, 1146-1156

Chem. 266,9822-9828

G. N., and Zakin M. M. (1988) J. Biol. Chem. 263,1018&10185

5237-5245

Bwl. 10,6642-6653

P m . Natl. Acad. Sci. U. S. A. 85, 3840-3844

1415-1425

Genes & Deu. 4, 1541-1551

1314-1322

(1988) Genes & Deu. 2,78€-800

Acids Res. 17, 11S133

Biol. 6, 425%267

Cohen, G. N., and Zakin, M. M. (1987) Gene (Amst.) 66,109-116

Chem. 264,7153-7160

2353-2365

Wang, L. H., Ing, N. H., Tsai, S . Y., O'Malley, B. W., and %ai, M.J. (1991) Gem

Williams, S . C., Cantwell, C. A,, and Johnson, P. F. (1991) Genes & Deu. 6, 1553-

(1989) MOL Cell. B ~ O L 12,170am8

Expr. 1,207-216

Xanthopoulos, K. G., Prezioso, V. R., Chen, W. S., Sladek, F. M., Cortese, R., and

Yang-Yen, H. F., Chambard, J.-C., Sun, Y.-L., Smeal, T., Schmidt, T. J., Drouin, J.,

1567

Darnell, J. E., Jr. (1991) P m . Natl. Acad. Sci. U. S. A. 88,3807-3811

and Karin, M. (1990) Cell 62,1205-1215