mrpotterscience.weebly.com · web viewlt 2.1 i can explain how changes in genes can lead to changes...

Potter Name: _________________________________________ Date: ______________________________ Hour: ______________ Biology

Unit 2: Natural Selection and EvolutionLT 2.1 I can explain how changes in genes can lead to changes in physical traits that lead to natural selection.

Yes I can:

1. Can you explain why a genotype is related to a phenotype?

2. Can you explain how phenotypes could help or hurt an organism’s chance of survival?

3. Can you explain how mutations can cause a change in your genotype?

LT 2.2 I can explain how natural selection works on individuals and how that can cause populations to evolve.

Yes I can:

1. Can you explain what “natural selection works on individuals” means?

2. Can you explain how eliminating organisms with deleterious (bad) phenotypes could lead to a change in the population?

3. Can you explain how natural selection can cause changes in the gene pool of a population?

LT 2.3 I can use and interpret phylogenetic trees to show relationships between different organisms.

Yes I can:

1. Can you explain what the branches of a phylogenetic tree mean?

2. Can you identify how closely related two organisms are by their relative locations on a phylogenetic tree?

LT 2.4 I can recognize and interpret evidence for evolution, including biochemical, DNA, and structural differences between organisms.

Yes I can:

1. Can you explain how we use these three pieces of evidence to support the theory of evolution?

2. Can you explain why structural differences are not enough evidence and DNA and biochemical evidence is so powerful?

LT 2.5 I can use vertebrates and their differences as a model for speciation. Yes I can:

1. Can explain what speciation is?

2. Can describe how two closely related vertebrates have gone through a speciation event to become different species?

#


NOTES: NATURAL SELECTIONLT 2.1 I can explain how changes in genes can lead to changes in physical traits that lead to natural selection.

Natural Selection- the process whereby organisms better adapted to their environment tend to survive and produce more offspring.

Conditions Needed for Natural Selection: VISTA

1. __________________________a. There are a variety of forms of traits or phenotypes.

2. __________________________a. Only traits that are determined by an organism’s genes will

be passed to the next generation.

3. __________________________a. Individuals compete for limited resources, such as food, shelter, and mates. b. Individuals with traits best adapted for the environment are able to out compete other individuals for

resources, allowing them to survive and reproduce more. (Think about our frogs) c. Survival of the Fittest

1. Evolutionary fitness isn’t a measure of physical fitness but of reproductive fitness.2. Fitness- Relative ability to survive and produce offspring in an environment

4. __________________________a. Evolution occurs over generations.

5. __________________________a. - an inherited characteristic that increases an

organism’s chance of surviving and reproducing

b. Over time, natural selections causes adaptations to become more common in a population.

Natural selection acts on individual (good phenotypes live, bad die), which causes population to evolve.

Evolution- changes in the characteristics of groups of organisms over time

Scientific Theory- an idea that is strongly supported by evidence. It is generally accepted and used to explain many observations.

#


Wrapping up Frog WarsLT 2.1 I can explain how changes in genes can lead to changes in physical traits that lead to natural selection.

1. There were 5 conditions for Natural selection (VISTA). What were they:a.b.c.d.e.

2. Did we meet all of these during Frog Wars?

3. What were the changes in frogs’ genes? Especially by the end of “Attack of the Birds”?

4. Did this lead to a change in any physical traits? Especially by the end of “Attack of the Birds”?

5. Was natural selection happening here?

6. What does Natural selection act on, individuals or the whole population?

#


Just like Nature, Ideas Change over TimeJean-Baptiste Lamarck - French Naturalist - August 1, 1744 to December 18, 1829

1. What is the role of the environment in Lamarck’s explanation for change in organisms?

2. What was Lamarck’s explanation for why snakes have no legs and some birds have webbed feet?

3. Was Lamarck’s explanation scientific? Why or why not?

4. According to Lamarck, what would happen if you never used your pinky toe?

Alfred Russel Wallace - English Naturalist – January 8, 1823 to November 7, 19131. Wallace’s statement that “The life of wild animals is a struggle for existence” implies his outlook on nature. What

do you think his outlook is?

2. How is Wallace’s view scientific? Explain.

3. Wallace claims “useful variations will tend to increase; unuseful or hurtful variations tend to diminish.” What do we call these “variations”? What is the process occurring because of these variations?

4. How does Wallace’s explanation differ from Lamarck’s hypotheses?

5. What do you think of Wallace’s critique of Lamarck’s hypotheses? Don’t just say that you agree or disagree, please explain why you think this.

Charles Darwin - English Naturalist - February 12, 1809 to April 19, 18821. What led Darwin to formulate his ideas about the origin of species?

2. What did Darwin base his ideas on?

3. What did Darwin propose as the origin of all animals living today?

4. Was Darwin’s explanation scientific? Why or why not?

5. How did Darwin explain the incomplete nature of his ideas?

Summary1. What common idea do all three scientists share?

#


2. Which of these scientists is credited with our modern day theory of evolution? Why? What is the name of this process?


Levels of Relation1.Go into the back, and determine the order of the animals by which are closest related.

(example: you, dad, grandma , third cousin, guy that lives down the street)

2.Which two animals are the closest related?

3.There are two other animals in the Genus Panthera. Name them.

4.Which two animals are the most removed (least related)?

5.What is the trend that we notice as we become less and less related?

6.What does the level of relation tell us?

7.What is special about the species when they list it? (How must it be written?)

8.How did you figure out which animals were most closely related?

9.Why do we use the classification system?

10. Now these were fairly easy to figure out because we had the classification written down already. How do scientists figure these out?

#


Understanding phylogeniesUnderstanding a phylogeny is a lot like reading a family tree. The root of the tree represents the ancestral lineage, and the tips of the branches represent the descendants of that ancestor. As you move from the root to the tips, you are moving forward in time.

When a lineage splits (speciation), it is represented as branching on a phylogeny. When a speciation event occurs, a single ancestral lineage gives rise to two or more daughter lineages.

Phylogenies trace patterns of shared ancestry between lineages. Each lineage has a part of its history that is unique to it alone and parts that are shared with other lineages.

Similarly, each lineage has ancestors that are unique to that lineage and ancestors that are shared with other lineages — common ancestors.

#

Potter Name: _________________________________________ Date: ______________________________ Hour: ______________ BiologyTrees, not ladders

It's easy to misinterpret phylogenies as implying that some organisms are more "advanced" than others; however, phylogenies don't imply this at all.

In this highly simplified phylogeny, a speciation event occurred resulting in two lineages. One led to the mosses of today; the other led to the fern, pine, and rose. Since that speciation event, both lineages have had an equal amount of time to evolve. So, although mosses branch off early on the tree of life and share many features with the ancestor of all land plants, living moss species are not ancestral to other land plants. Nor are they more primitive. Mosses are the cousins of other land plants.

So when reading a phylogeny, it is important to keep three things in mind:

Evolution produces a pattern of relationships among lineages that is tree-like, not ladder-like.

Just because we tend to read phylogenies from left to right, there is no correlation with level of "advancement."

For any speciation event on a phylogeny, the choice of which lineage goes to the right and which goes to the left is arbitrary. The following phylogenies are equivalent:

Misconceptions about humansThe points described above cause the most problems when it comes to human evolution. The phylogeny of living species most closely related to us looks like this:

It is important to remember that:

1. Humans did not evolve from chimpanzees. Humans and chimpanzees are evolutionary cousins and share a recent common ancestor that was neither chimpanzee nor human.

2. Humans are not "higher" or "more evolved" than other living lineages. Since our lineages split, humans and chimpanzees have each evolved traits unique to their own lineages.

#


The Tree RoomPhylogenetic trees are used to show relationships. You will need to be able to read and make these trees. We are going to go to this website (The Tree Room) to learn how to do it. Search “The tree room” or go to this website now: http://evolution.berkeley.edu/evolibrary/article/0_0_0/evotrees_intro

1. Click on Primer. Click on How to Read Trees. Press play and read.

a. What letter is most closely related to D?

b. Is C more closely related to D or B?

c. Is A more closely related to C or D?

2. After answering this question, click on the bottom right button called “Understanding Evolutionary Trees”. Answer the two questions here and check to see if you are right.

a. Is the oval or the triangle most closely related to the star?

b. Why?

3. Go back to the page called “Primer” and click on “Trees are Hypotheses”. Read the section. a. What are the pieces of evidence that scientists use to make these trees?

b. Why do trees change?

4. Return to the very first page of The Tree Room. Click on the link called “Field Guide to Trees. You will see many types of trees. They all show the same information (sort of). Click on the first two trees and click on the question marks on them.

a. Yesterday, we looked at some animals, including lions, tigers, and coyotes. Make a squarish corner tree (the first one) of those three animals.

b. Make a diagonal tree (second one) of these three animals.

#

http://evolution.berkeley.edu/evolibrary/article/0_0_0/evotrees_intro


Vertebrate Phylogenetic TreeToday we are going to research a few different classes of vertebrates and see how everything is related.

We are going to look at a few different features of each of the classes and see if we can determine what the phylogenetic tree for vertebrates looks like.

Complete the following research for each class: Mammal Bird Dinosaur Reptile Amphibian Fish

Distinguishing FeatureBreathe with?(gills/lungs/skin)Internal or external fertilizationType of birth(soft eggs, hard eggs, live birth)Warm or cold bloodedOpen or closed circulatory systemOne or two loop circulatory systemNumber of chambers in heartMain Organs of digestive systemCellular Waste removing organForm of cellular waste

Urea Uric Acid ? Uric Acid Urea Ammonia

Any sense that is unique to this class of animal

Now that you are all done with the research, you know all you need to know about these animals to make your first phylogenetic tree. Using the research, what do you think the oldest class of animal is (what is most “primative”)? Start with that and see if you can figure out where the other classes branched off. Remember that the vertical axis represents time, and we all must come from a common ancestor.

1. Draw your second phylogenetic tree. Include mammals, birds, fish, reptiles, dinosaurs, and amphibians.2. How many branches do you have?3. Do all of the branches reach the top (current time)?4. Why or why not?

#


Vertebrate Phylogenetic Tree#1


Blood Analysis of VertebratesWe looked at structures the other day, and determined that it is really hard to figure out how the vertebrates are related when you just look at their physical traits and structures. What could we do to get a better idea?

We know that depending on how similar an organism’s DNA sequence is to another organism’s, we can tell a lot more about how these vertebrates are related. Let’s check it out using their blood! We have antibodies and blood to test. The blood is red and the antibodies are yellow. Do not touch the blood. If you do, wash it off your hand immediately. In this lab, the blood is red (no kidding!) and the antibodies are yellow. The following symbols will be used:

Mammals (M), Reptiles (R), Birds (B), Amphibians (A), Fish (F) and Dinosaurs (D).

1. Anti-mammal antibody. What does the Anti-mammal antibody react with?

2. Anti-reptile antibody. What does the anti-reptile antibody react with?

3. Anti-bird antibody. What does the anti-bird antibody react with?

4. Anti-amphibian antibody. What does the anti-amphibian antibody react with?

5. Anti-fish antibody. What does the anti-fish antibody react with?

6. Anti-dinosaur antibody. What does the anti-dinosaur antibody react with?

7. Animals that are closely related will react to the same antibodies. Which animals are closely related?

8. Using this information, rewrite your phylogenetic tree for the vertebrates. 9. Do we know what animal is most closely related to frogs yet?

10. Why or why not?

#1


DNA Gel Electrophoresis Results of VertebratesYesterday, the blood analysis that we ran allowed us to create a phylogenetic tree that is definite for Fish and

Amphibians, but the rest of the vertebrates looked kinda confusing. DNA analysis will give us a better idea of what the relationship between the remaining four classes look like. Below are representations of the results of the Gel Electrophoresis that have been run from the DNA of each of the Vertebrates.

Degree of relation can be determined by comparing the DNA gels. The less difference there is between two classes, the more closely related they are; the larger the difference between the two classes, the further related they are.

1. Use the results of the DNA Gel electrophoresis above to create a phylogenetic tree. BE SURE TO INCLUDE THE FISH AND AMPHIBIAN LINES THAT WE FIGURED OUT YESTERDAY.

2. Of the four classes we are looking at today, which is the common ancestor?

3. Which two classes are most closely related?

4. Did all of the classes of animals survive to the present day?

5. Why did the DNA Gel Electrophoresis tell us more than the blood analysis did?

6. Below is a closer look at the DNA. Determine how many common bases each organism has to a sea lamprey.

7. Make a quick phylogenetic tree from this information. How does it compare to our previous trees?

Organism Genotype # of Bases in Common

Organism DNA Number of common

Sea Lampery(Ancestor)

GTAAGCCGTTTAGCGTTAACGTCCGTAGCTAAGGTCCGTAGC 42

Yellowfin tuna GTAAAATTTTTAGCGTTAATTCATGTAGCTAAGGTCCGTAGC

Coquifrog

GTAAAATTAAAAGCGTTAATTCATGTAGCTAAGGTCCGGCGC

Green seaturtle

GTATAATTAAAAGCGTTAATTCATGTAGCTTCCGTCCGGCGC

Albatross GTATAATTAAAAGCGTTCCTTCATGTAGC TTCCGTCCCCCGC

Hoary bat GTTTAATTAAAAGATTTCCTTCATGTAGCTTCCACGCGGCGC

Human GTTTAATTAAAAGATTTCCTTCATGTGGCTTCCACGCGGCGC

#1


Patterns of EvolutionTypes of Evolution Evolution over time can follow several different patterns. Factors such as environment and predation pressures can have different effects on the ways in which species exposed to them evolve. This diagram shows the three main types of evolution: divergent, convergent, and parallel evolution. When people hear the word "evolution," they most commonly think of divergent evolution, the evolutionary pattern in which two species gradually become increasingly different. This type of evolution often occurs when closely related species diversify to new habitats. On a large scale, divergent evolution is responsible for the creation of the current diversity of life on earth from the first living cells. On a smaller scale, it is responsible for the evolution of humans and apes from a common primate ancestor.

Structures with similar composition because they were developed from common ancestors = HOMOLOGOUS STRUCTURES

Vertebrate limb structure like in the diagram below:

Convergent Evolution Convergent evolution causes difficulties in fields of study such as comparative anatomy. Convergent evolution takes place when species of different ancestry begin to share analogous traits because of a shared environment or other selection pressure. For example, whales and fish have some similar characteristics since both had to evolve methods of moving through the same medium: water. Structures with a similar function = ANALOGOUS STRUCTURES

Insect wings, bird wings, bat wings Parallel Evolution Parallel evolution occurs when two species evolve independently of each other, maintaining the same level of similarity. Parallel evolution usually occurs between unrelated species that do not occupy the same or similar niches in a given habitat.

#1


Our Family Tree: Understanding Our Common AncestryCharacter Matrix

CharactersSpecies Type of

Eye Socket

Direction of Orbits

Lamboidal Crest

Foramen Magnum

Facial Elongation

Incisors Braincase Frontal Bone

Biped or Quadruped

Chimpanzee 1 2 1

Gorilla 0 0 0

Human 0 0 0

Baboon 0 0 0

Lemur 0 0 0

Tarsier 0 0 0

Squirrel Monkey 0 0 0

Loris 0 0 0

Cat (outgroup)Ancestral State

0 0 0 0 0 0 0 0 0

Adapted from lab from : BEACON Center for Study of Evolution in Action

#1


Phylogenetic Tree of Primates

Using your anatomical evidence from the lab and the previous chart, fill in where you think each species would go on the following phylogenetic tree:

Adapted from lab from : BEACON Center for Study of Evolution in Action

#1


Fossil Hominin LabPurpose: In this lab you will measure and analyze hominin skulls so you can see humans as the result of evolution. You will then take a new fossil hominin and try to figure out its place in our history.

Pre-lab Discussion Questions1. What were some traits that separate humans from the other primates?

2. Modern man is different from some of the fossils of earlier man. What traits do you think can be used to separate the different types of Hominins from one another?

3. We have a small problem. We don’t have all of the bones of early Hominins. Today, we only have skulls to work with. These skulls are casts (replicas) reconstructed from actual fossil remains.

a. What evidence do fossils provide about the original organism?

b. What skull traits can we use to separate the species?

Lab Activities At each skull station, complete two tasks:

1. Fill in the incomplete Hominin Trait Matrix.2. On the Hominin Timeline, record the range of time during which each species existed. Homo sapiens is

done for you.

Definitions:Brow ridge: Pronounced bony ledge above the eyes. Sagittal crest: Pointed ridge down the center of the top of the skull (from back to front)

Example A: Example B - Brow ridge present - Brow ridge not present

- Sagittal crest present - Sagittal crest not present

Nasal cavity width: Distance between widest parts of nose opening.Maxilla: Distance from front edge of the foramen magnum to the base (gumline) of the front central teeth in the

upper jaw.

Hominin Timeline (MYA)

#1

#1


5 4 3 2 1 present

H. sapiens

H. neanderthalensis

H. heidelbergensis

H. erectus

P. robustus

A. africanus

A. afarensis

Ardipithecus ramidus

Potter Name: _________________________________________ Date: ______________________________ Hour: ______________ BiologyLab Discussion Questions

1. What are some characteristics that separate the non-Homo hominins (Australopithecus and Paranthropus) from the Homo genus?

2. Look at your timeline and provide examples of …a. At least two species that overlapped in time.

b. At least two species that did not overlap in time.

c. What does this suggest about evolution?

3. Examine the Paranthropus skull. It looks very different from the other skulls from the same time period.a. List at least two differences:

b. Why do you think it is different?

4. It is easy to see the difference between a modern human skull and other primates. Why is harder to see the differences between the hominins?

5. What is wrong with the statement “Homo neanderthalis led to Homo sapiens”, based on your timeline?

6. How do you think scientists determine the sex of fossil?

7. Look at the slopes of the face. a. What is the trend that you see?

b. Why do you think this has happened?

8. OK, we’ve found a new fossil. It is fossil number 8, Ardipithecus ramidus (Ardi). Please examine the features of this fossil skull cast.

a. Fill in the missing information on the table below.b. Mark on your timeline where you think Ardi fits.c. Explain why you placed Ardi where you did on the timeline.

Qualitative Description

Gender of this specimen femaleAverage Height 1.2 mSag crest (absent/present) absentNasal cavity aperture widthBrow ridge (absent/present) present (but small)Cranial volume range 300-350 ccMaxillaSlope of Face

#1

mrpotterscience.weebly.com · web viewlt 2.1 i can explain how changes in genes can lead to changes...

Documents