R

Com

Ea

b

Sc

a

ARRA

KHOCPP

0d

Veterinary Immunology and Immunopathology 146 (2012) 113– 124

Contents lists available at SciVerse ScienceDirect

Veterinary Immunology and Immunopathology

j ourna l ho me pag e: www.elsev ier .com/ locate /vet imm

esearch paper

ytokine production and proliferation upon in vitroligodeoxyribonucleotide stimulation of equine peripheral bloodononuclear cells

va Wattranga,∗, Anna-Karin Palmb,1, Bettina Wagnerc

Department of Virology, Immunobiology and Parasitology, National Veterinary Institute, SE-751 89 Uppsala, SwedenSection of Immunology, Department of Biomedical Sciences and Veterinary Public Health, Swedish University of Agricultural Sciences, SE-751 23 Uppsala,

wedenDepartment of Population Medicine and Diagnostic Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA

r t i c l e i n f o

rticle history:eceived 4 May 2011eceived in revised form 1 February 2012ccepted 9 February 2012

eywords:orseligodeoxyribonucleotidesytokinesroliferationBMC

a b s t r a c t

Synthetic oligodeoxyribonucleotides (ODN) may prove useful immune modulators inequine medicine. It is however important to assess the effects of each specific ODN in thespecies it is intended to be used in. The present study therefore aimed to evaluate someODN for induction of cytokine production; i.e. type I interferons (IFN), IFN-�, tumor necro-sis factor-� (TNF-�) and transforming growth factor-� (TGF-�), and proliferation of equineperipheral blood mononuclear cells (PBMC). A panel of four ODN containing unmethylatedcytosine-guanosine sequences (CpG) was used: ODN 1 and ODN 8 representing A-class;ODN 2006 representing B-class and ODN 2395 representing C-class-ODN. In addition, twoODN where CpG-motifs were reversed to GpC were included; ODN 2137 otherwise identicalto ODN 2006 and ODN 5328 otherwise identical to ODN 2395. Cytokine concentrations weremeasured in cell culture supernatants after 24 h of induction and proliferation was deter-mined after 72 h of induction. Each ODN was tested with PBMC from at least 5 individualhorses with and without the addition of lipofectin to cell cultures.

Type I IFN, IFN-� and TNF-� production was readily induced by ODN 1, ODN 2006 andODN 2395 both in the presence and absence of lipofectin and all three types of ODN inducedsimilar levels of cytokines. Proliferation of PBMC was clearly induced by ODN 2006 and ODN2395 while ODN 1 only induced low-level proliferation. The levels of proliferation inducedwere not influenced by the presence of lipofectin. TGF-� production was not induced by anyof the tested ODN. ODN 8, ODN 2137 and ODN 5328 were largely inactive in all assays. Thus,responses seemed dependent on or increased by CpG-motifs but presence of CpG-motifs

did not necessarily confer activity since ODN 8 was inactive despite its CpG-motifs.

Taken together, with equine PBMC distinctions in induction of different leukocyte func-tions between A-, B-, and C-class ODN were less obvious than what has been observedfor human cells. These observations further stress the presence of species differences inODN-induced responses.

© 2012 Elsevier B.V. All rights reserved.

Abbreviations: CI, confidence intervals; CpG, unmethylated cytosine–guanosine sequence; G, guanosine; MDBK, Madin–Darby bovine kidney; ODN,oligodeoxyribonucleotides; pDC, plasmacytoid dendritic cells; TLR, toll-like receptor; VSV, vesicular stomatitis virus.∗ Corresponding author. Tel.: +46 0 18674034; fax: +46 0 18674304.

E-mail address: eva.wattrang@sva.se (E. Wattrang).1 Present address: Molecular Immunology, Department of Cell and Molecular Biology, Uppsala University, SE-751 23 Uppsala, Sweden.

165-2427/$ – see front matter © 2012 Elsevier B.V. All rights reserved.oi:10.1016/j.vetimm.2012.02.004

ogy and

114 E. Wattrang et al. / Veterinary Immunol

1. Introduction

Taking advantage of the innate immune recognitionof DNA using short synthetic oligodeoxyribonucleotides(ODN) in order to evoke immune activation is nowadays awell-known concept. Indeed, ODN are being tested for useas e.g. vaccine adjuvants and as infection, cancer and allergytherapeutics (Agrawal and Kandimalla, 2007; Klinman,2004; Krieg, 2006). Hence, there are several areas in equinemedicine that could benefit from ODN induced immunestimulation. The optimal ODN for an application is depen-dent on a number of factors important for the responseselicited upon ODN stimulation.

The presence of an unmethylated cytosine followed by aguanosine (CpG) in the nucleotide sequence and the flank-ing bases of the CpG, i.e. the usually hexameric “CpG-motif”were early on pointed out as prime mediator of immuneactivating effects of DNA, and ligand of the DNA recep-tor toll-like receptor 9 (TLR9; Krieg, 2002, 2006). However,numerous reports of non-CpG mediated effects of bothphosphodiester and phosphorothioate ODN exist (Bartzet al., 2004; Bernard and Phipps, 2007; Elias et al., 2003;Haas et al., 2008; Magnusson et al., 2001; Roberts et al.,2005; Vollmer et al., 2004b). Moreover, non-CpG medi-ated immune cell activation by ODN has been observed asTLR9-dependent as well as TLR9-independent (Bernard andPhipps, 2007; Chiu et al., 2009; Roberts et al., 2005; Takaokaet al., 2007; Unterholzner et al., 2010; Vollmer et al.,2004b). It has also been proposed that CpG-dependencyis restricted to ODN with phosphorothioate backbones andnot valid for ODN with phosphodiester backbones and thatfor the latter ODN the 2′deoxyribose sugar of the DNAbackbone is responsible for TLR9 activation (Haas et al.,2008). Nonetheless, CpG-dependency has been observedfor some phosphodiester ODN e.g. upon stimulation ofhuman (Magnusson et al., 2001), porcine (Domeika et al.,2004) and equine cells (Wattrang et al., 2005). Thus, the roleof CpG in TLR9 activation is still not completely elucidatedbut in the majority of cases responses to ODN are increasedby, if not dependent on, the presence of CpG-motifs.

Nucleotide backbone is likewise of importance forODN stimulation, where phosphodiester is the naturallyoccurring form and is sensitive to degradation while phos-phorothioate is nuclease resistant and so far most oftenused for clinical applications (Agrawal and Kandimalla,2007). Moreover, the combination of the complete ODNnucleotide sequence, backbone chemistry and its capac-ity to form intra- and/or inter molecular structure maydetermine its immune activity. Using mainly human cells,three different classes of ODN have been identified withrespect to general delineation and responses elicited (e.g.reviewed in Bauer et al., 2008; Blasius and Beutler, 2010;Ishii and Akira, 2006; Klinman, 2004; Krieg, 2006). A-classODN (also called type D) consist of a central phosphodiesterpalindrome sequence containing one or more CpG-motifswith 5′ and 3′ poly-guanosine (G) sequences (≥4 G) withphosphorothioate backbone. The palindrome and poly-G

sequences makes these ODN prone to higher order struc-tures, e.g. via G-tetrad and duplex formation. A-class ODNare considered strong activators of plasmacytoid dendriticcells (pDC), resulting e.g. in high production of type I

Immunopathology 146 (2012) 113– 124

interferons (IFNs), while they are poor activators of B-cells. B-class ODN (also called type K) consist of a completephosphorothioate backbone of a linear single stranded con-formation usually with multiple CpG-motifs. These ODNare mainly considered strong activators of B-cells and driv-ing the maturation of DC but have also been reported toactivate NK-cells. C-class ODN have a complete phospho-rothioate backbone with 5′ CpG-motif(s) and 3′ palindromesequences. The palindrome sequences make these ODNprone to inter- and intra-molecular duplex formation. TheC-class ODN are able to both induce high type I IFN pro-duction in pDC and activate B-cells. Explanations of thedifferences in activities between ODN classes have been putforward, e.g. it has been proposed that the ability to formsecondary structures is crucial for type I IFN induction byA-and C-class ODN (Guiducci et al., 2006; Kerkmann et al.,2005; Wikström et al., 2007). It has further been shown thatthese physical forms of A- and C-class ODN confer localiza-tion to, and/or retention in, early endosomes of pDC thatin turn has been hypothesized as the key to high type I IFNproduction (Guiducci et al., 2006; Honda et al., 2005).

In addition to general effects of ODN sequences andchemistry, species differences in ODN induced responsesare also apparent (Bauer et al., 2001; Rankin et al., 2001).Thus, choosing ODN for clinical applications not onlyinvolves consideration of optimal activating properties butalso demands evaluation in the intended animal species. Inthe horse, there are still only a limited number of reportson ODN induced immune activation. It has been shownthat a number of mainly B-class ODN induced prolifera-tion of equine PBMC (Rankin et al., 2001). B-class ODN2135 induced increased IFN-� and IL-12p40 mRNA expres-sion in monocyte-derived DC from adult horses (Flaminioet al., 2007). In foal PBMC, B-class ODN 2135 and ODN2142 and C-class ODN 2395 induced increased IFN-�, IL-6 and IL-12p35/p40 mRNA expression (Liu et al., 2009b)and in foal neutrophils these two B-class ODN, but not theC-class ODN, induced IL-8, IFN-�, IL-6 and IL-12p35/p40mRNA expression (Liu et al., 2009a). In cultures of equinebronchoalveolar lavage cells A-class ODN 2216 was con-sidered the most active inducer of IFN-�, IL-4 and IL-10compared to several B- and C-class ODN (Klier et al., 2011).Horse keratinocytes were however not activated by a C-class ODN (Leise et al., 2010). Addition of B-class ODN 2007to a commercial killed vaccine against equine influenzavirus enhanced antibody responses in vaccinated horsescompared to those vaccinated with the original vaccine(Lopez et al., 2006). We have earlier evaluated a panel ofODN including three different A-class ODN for inductionof type I IFN and IL-6 in PBMC (Wattrang et al., 2005). Asexpected these A-class ODN induced production of bothcytokines but high levels of cytokine activity required treat-ment of ODN with the cationic lipid transfection agentlipofectin which is contrary to findings in other species,e.g. pigs, where lipofectin treatment did no affect the lev-els of IFN-� induced by these ODN (Domeika et al., 2004;Wikström et al., 2007). Hence, the present study was under-taken in order to broaden the knowledge on ODN activity

on horse cells by evaluating cytokine production, i.e. type IIFN, IFN-�, TNF-� and TGF-�, and proliferation by culturedequine PBMC. Four different stimulatory ODN were used;

E. Wattrang et al. / Veterinary Immunology and Immunopathology 146 (2012) 113– 124 115

Table 1Nucleotide sequences and the change in Gibbs energy (�G) for predicteda double-stranded conformations of ODN used in the present study.

ODN Sequence 5′–3′ Comment �G for spontaneous double-strandedconformations (kcal/mol)b

Self-dimer formation Hairpin formation

11 TCGATCGACGTTGAGGGGGG A-class like −15.00 −1.0881 GGAGTCGTACGTCAGGGGGG A-class like −10.87 1.0820062,3 tcgtcgttttgtcgttttgtcgtt B-class −3.61 −0.3221373 tgctgcttttgtgcttttgtgctt Control to ODN 2006 −3.14 −0.5823954 tcgtcgttttcggcgcgcgccg C-class −36.75 −4.5453284 tgctgcttttcggcgcgcgccg Control to ODN 2395 −36.75 −4.54

Phosphodiester nucleotides are indicated in upper case letters and phosphorothioate nucleotides in lower case. CpG motifs and their modifications areunderlined. ODN 2006 is also known as CPG/ODN 7909 or PF-3512676 (Krieg, 2006). Selected references for the ODNs are indicated in superscript numbersand are 1He et al. (2003), 2Hartmann et al. (2000), 3Rankin et al. (2001) and 4Vollmer et al. (2004a).

a Double-stranded conformations were predicted using IDT SciTools OligoAnalyzer 3.1 (Integrated DNA Technologies Inc., Coralville, IA, USA) and �Gf

the seco

O1bfpspKrAT22cOsOu

2

2

ffmmwS1b

uMpDams1a

or conformations with the lowest �G are given in all cases.b Larger negative values indicate that more energy is required to break

DN 1, ODN 8, ODN 2006 and ODN 2395 (Table 1). ODN and ODN 8 (He et al., 2003) have a phosphodiester back-one, palindrome and 3′ poly-G sequences and thus almostulfil the structural criteria for A-class ODN. However, com-lete phosphodiester versions of A-class ODN have beenhown to have similar activities as their counterparts withhosphorothioate poly-G sequences (Domeika et al., 2004;amstrup et al., 2001; Wattrang et al., 2005) and someeports state that only 3′ poly-G sequences are required for-class ODN (Blasius and Beutler, 2010; Klinman, 2004).herefore we refer to these two ODN as “A-class like”. ODN006 (Hartmann et al., 2000) and ODN 2395 (Vollmer et al.,004a) are well-characterized representatives of B- and C-lass ODN, respectively. Moreover, both for ODN 2006 andDN 2395 their activating CpG-motifs were altered to GpC

equences resulting in ODN 2137 (Rankin et al., 2001) andDN 5328 (Vollmer et al., 2004a), respectively, which weresed as controls for CpG-mediated effects.

. Materials and methods

.1. Animals, blood sampling and purification of PBMC

In the present study (approved by the Ethical Committeeor Animal Experiments, Uppsala, Sweden) blood samplesrom ten clinically healthy horses between 3 to approxi-

ately 20 years of age were used. The horses included 6ares and 4 geldings of the following breeds: 4 Swedisharmbloods, 1 Connemara pony, 1 Connemara pony –

wedish warmblood cross, 1 Dutch Warmblood (KWPN), Arabian, 1 Thoroughbred and 1 pony of unknownreed.

Blood was collected by jugular venipuncture into evac-ated glass tubes with 143 USP heparin (BD Vacutainer,eylan, France). PBMC were purified from leukocyte rich

lasma by centrifugation on Lymphoprep (Axis-Shield,undee, UK), washed in phosphate buffered saline (PBS)nd re-suspended in growth medium, i.e., RPMI 1640

edium (National Veterinary Institute, Uppsala, Sweden)

upplemented with 2 mM l-glutamine, 60 �g/ml penicillin,00 �g/ml streptomycin, 5 × 10−5 M 2-mercaptoethanolnd 10% FCS (Gibco, Paisley, UK).

ndary structure.

2.2. Induction of cytokine production and proliferation

Triplicate cultures of purified PBMC were set up withthe indicated inducers or in growth medium alone at106 cells in 200 �l/well in round-bottomed 96-well plates(Nunc, Roskilde, Denmark). As inducers different ODN(Table 1) or concanavalin A (Con A; Sigma) at a concentra-tion of 2.5 �g/ml, phytohemagglutinine A (PHA; Wellcome,Dartford, UK) at a concentration of 2 �g/ml or phorbol 12-myristate 13-acetate (PMA; Sigma) at a concentration of20 ng/ml, were used. All ODN used were purchased fromCybergene (Huddinge, Sweden), reversed-phase cartridgepurified, and dissolved in water with 20% acetronile by themanufacturer. Each ODN was tested at final concentrationsof 3 �g/ml and 25 �g/ml, with and without prior treatmentwith Lipofectin Reagent (Invitrogen, USA), at 5 �g/ml aspreviously described (Magnusson et al., 2001; Wattranget al., 2005). Cultures were incubated at 37 ◦C and 5% CO2in air in a humid atmosphere for 24 h when 150 �l super-natant was collected from each well, triplicates pooled, andstored at −20 ◦C until cytokine analysis. The wells weresubsequently topped up with 150 �l growth medium/welland the plates were incubated for a further 48 h. The last24 h of incubation cell cultures were pulsed with 0.5 �Ci3H-thymidine (Amersham Biosciences) before the plateswere frozen and stored at −20 ◦C until harvest. Prior to har-vest, plates were thawed and the cells were harvested usinga 96-well plate system (LKB Wallac, Turku, Finland) and theuptake of 3H-thymidine was measured in a liquid scintil-lation �-counter (LKB Wallac). Proliferation was expressedas mean counts per minute (cpm) values for triplicate wellsfor each individual horse.

2.3. IFN bioassay

Interferon activity in cell culture supernatants wasdetected with a vesicular stomatitis virus (VSV) cytopathiceffect inhibition bioassay on Madin-Darby bovine kid-

ney (MDBK) cells performed as previously described forequine type I IFNs (Jensen-Waern et al., 1998; Wattranget al., 2005). In brief, confluent monolayers of MDBK cellsin flat-bottomed microtiter plates were incubated with

ogy and

116 E. Wattrang et al. / Veterinary Immunol

supernatant samples, in duplicate, titrated by two-foldserial dilutions for 24 h at 37 ◦C, 5% CO2, where after thesamples were replaced by live VSV in an amount causingcomplete destruction of unprotected cells over 24 h. Aftera further 24 h incubation, residual cells were stained withcrystal violet and the IFN-activity in the samples was cal-culated by defining 1 unit (U) IFN as the amount protecting50% of the cells in one well from VSV cytopathic effect. Lab-oratory standards of equine leukocyte IFN (Wagner et al.,2008) and human IFN-� were included on every test plateto ensure the correct sensitivity of the assay. This assaydetects anti-viral activity of equine type I IFNs and equineIFN-� (Nicolson et al., 2001; Wagner et al., 2005, 2008).However, the bioactivity of equine IFN-� was 70 timeslower than equine IFN-� in this assay (Wagner et al., 2008)making it very un-sensitive for IFN-� mediated anti-viralactivity.

2.4. ELISAs for IFN-� , TNF- ̨ and TGF-ˇ

Cell culture supernatants were tested for IFN-�, TNF-� and TGF-� content, respectively, using three differentELISAs. The IFN-� ELISA was set up using a mouse-antibovine IFN-� monoclonal antibody (clone CC302, Serotec,Oxford, UK) at 2 �g/ml for coating and biotin conjugatedpolyclonal goat-anti canine IFN-� antibodies (R&D Sys-tems Europe Ltd., Abingdon, UK) at 1 �g/ml as tracers.Both these antibodies have previously been shown to crossreact with the equine protein (Wagner et al., 2005). PBSwith 4% bovine serum albumin (BSA, Sigma) was used forblocking and as sample diluent and horseradish peroxidaseconjugated avidin (DakoCytomation, Glostrup, Denmark)was used for detection of antibody binding. The IFN-�concentration in the samples was calculated by linearregression from serial dilutions of a recombinant equineIFN-�/IgG1fusion protein (Wagner et al., 2005) and theELISA’s linear range of detection was between 17 and 4 �gfusion protein/ml.

The TNF-� ELISA was set up using polyclonal rabbit-anti equine TNF-� antibodies (code: PETNFAI; Endogen,Pierce, Rockford. IL, USA) at 5 �g/ml for coating and biotinconjugated polyclonal rabbit-anti equine TNF-� antibodies(code: PETNFABI; Endogen) at 1 �g/ml as tracers. PBS with4% BSA, and 20% sucrose was used for blocking, PBS with4% BSA was used as sample diluent and horseradish per-oxidase conjugated avidin (DakoCytomation) was used fordetection of antibody binding. The TNF-� concentration inthe samples was calculated by linear regression from serialdilutions of a recombinant equine TNF-� standard (Endo-gen) and the ELISA’s linear range of detection was between500 and 30 pg recombinant protein/ml.

The TGF-� ELISA was set up using the DuoSet ELISAdevelopment system for human TGF-�1 (R&D SystemsEurope Ltd., Abingdon, UK) according to the manufactur-ers protocol. This ELISA has previously been validated fordetection of equine TGF-� by Desjardins et al. (2004).Latent TGF-� was activated to the immunoreactive form in

the samples according to the ELISA-kit protocol for cell cul-ture supernatants. In brief, 10 �l 1 M HCl was added to 50 �lsample volumes, incubated for 10 min at room tempera-ture where after 10 �l 1.2 M NaOH/0.5 M HEPES was added

Immunopathology 146 (2012) 113– 124

and the samples subsequently used in the ELISA. The TGF-� concentration in the samples was calculated by linearregression from serial dilutions of a recombinant humanTGF-� standard included in the kit and the ELISA’s linearrange of detection was between 1000 and 30 pg recombi-nant protein/ml.

All ELISAs were performed in flat-bottomed 96-wellplates (MaxiSorp, Nunc, Roskilde, Denmark) and through-out PBS with 0.05% Tween 20 (Sigma) was used as washbuffer and an in house substrate buffer (1 mM 3,5,3′,5′-tetramethylbenzidine in 0.1 M potassium citrate, pH 4.2,with 0.007% H2O2) was used for visualization of antibodybinding. This reaction was stopped at a time point stan-dardized for each ELISA with 2 M H2SO4 and the A450 wasmeasured in an ELISA reader. All samples were tested atdifferent dilutions ranging from 1:4 to 1:10 in order toascertain values within the linear range of detection foreach ELISA and all sample dilutions were tested in dupli-cate. Standard curves, no-sample controls, and for TGF-�controls with RPMI with 5% FCS, were included in everyplate.

2.5. Data presentation

For all parameters recorded large variation betweenindividuals were observed. This was expected consideringthe use of non-inbred animals and the nature of the param-eters studied, and hence each ODN was tested with PBMCfrom at least 5 individuals in order to obtain a representa-tive sample. Moreover, as we have observed before for typeI IFN induction (Wattrang et al., 2005) individual horseswere identified as, consistent “high” or “low” respondersirrespective of inducer. In the present study the same pat-tern with “high” and “low” responders was also observedfor IFN-� and TNF-� production. To reduce impact of thisvariation between individuals an inducer that consistentlyinduced the highest levels of cytokine production in all ormost individuals was identified for type I IFN, IFN-� andTNF-� production, respectively, and the responses to thatinducer were set to 100% for each individual. Responses tothe other inducers were then for each individual expressedrelative to their 100% response and arithmetic mean valuesfor each inducer were subsequently calculated.

However, due to the large individual variation, no stan-dard statistical model is likely to be applicable on any of thedata from the present study. Therefore data were presentedas arithmetic mean values with 95% confidence intervals(CI), and values with non-overlapping confidence intervalswere interpreted as being statistically different. Becauseconfidence intervals of proportions, i.e. type I IFN, IFN-�and TNF-� data, were asymmetrical and thus non-normallydistributed, the arithmetic means and confidence intervalsof these parameters were estimated based on a square-roottransformation according to the method of Land (1974).

3. Results

3.1. Induction of type I IFN activity

The present panel of ODN (Table 1) was evaluatedfor ability to induce type I IFN production in cultures of

E. Wattrang et al. / Veterinary Immunology and Immunopathology 146 (2012) 113– 124 117

Fig. 1. Type I IFN activity (arithmetic mean values ± 95% CI) in cell culture supernatants from equine PBMC cultured for 24 h in the presence of the indicatedinducers and lipofectin (lipo), expressed as proportions of the activity induced by ODN 2395 at 25 �g/ml. ODN were tested at 3 �g/ml with (striped whitebars) and without (white bars) lipofectin and at 25 �g/ml with (grey dotted bars) and without (grey bars) lipofectin. For each culture condition the numbero 2 U/ml)

( ces (not

pp2whmdtea

piicoutC2rrc

f donors that provided PBMC where type I IFN activity was detected (≥n) are given. Non-overlapping CI indicate statistically significant differen

urified equine PBMC (Fig. 1). Results were expressed asroportions of the IFN-activity induced by ODN 2395 at5 �g/ml (see Section 2.5) and high levels of IFN-activityere consistently recorded for PBMC from all testedorses under these conditions (range: 160–1280 U/ml;ean ± 95% CI: 615 ± 334 U/ml; n = 8). No IFN-activity was

etected in medium control cultures of PBMC from any ofhe horses and only PBMC from one horse showed low lev-ls, 4 U/ml, of IFN-activity when cultured with lipofectinlone.

When ODN 2395 or ODN 2006, both with a completehosphorothioate nucleotide backbone, were used for

nduction, type I IFN production was consistently observedn cultures of PBMC from all horses tested. No signifi-ant differences in the levels of IFN-activity induced werebserved if 3 or 25 �g/ml of these respective ODN weresed. Both ODN 2395 and ODN 2006 have a CpG-motifo which their activity has been attributed. Indeed, if thispG-sequence was altered to GpC, i.e. ODN 5328 and ODN

137, very low levels of IFN-activity were induced if PBMCesponded at all (ODN 5328 range 2–40 U/ml; ODN 2137ange 1–20 U/ml). When ODN 1 and ODN 8, both with aomplete phosphodiester nucleotide backbone and 5′-poly

in cell culture supernatants (pos.) and the total number of PBMC donorse that CI are non-symmetrical, for details see Section 2.5).

G-sequences, were used for induction, high levels of typeI IFN production was only observed in cultures stimulatedwith ODN 1. Upon stimulation with ODN 1, PBMC from alltested horses responded with type I IFN production underat least one of the culture conditions, i.e. 3 or 25 �g ODN/mlwith or without lipofectin, but no overall optimal induc-tion conditions could be identified. Upon stimulation withODN 8 only PBMC from five of the tested horses respondedwith type I IFN production under at least one of the cul-ture conditions and the levels of IFN-activity induced werevery low (range 2–32 U/ml). Lipofectin treatment did notsignificantly alter the levels of type I IFN-activity inducedby any of the tested ODN. Moreover, some of the super-natants from the present study were analyzed with anIFN-� ELISA and the results showed near 100% correlationwith the results obtained with the bioassay (Wagner et al.,2008). This confirms that the major part of anti-viral activ-ity detected in the bioassay was conferred by type I IFNand not by IFN-� and also indicates that IFN-� dominates

among the type I IFNs induced by ODN. Thus, ODN 2395and ODN 2006 were the most efficient type I IFN inducersin the present study and their activity was CpG-dependentbut not influenced by lipofectin treatment.

118 E. Wattrang et al. / Veterinary Immunology and Immunopathology 146 (2012) 113– 124

Fig. 2. IFN-� (arithmetic mean values ± 95% CI) in cell culture supernatants from equine PBMC cultured for 24 h in the presence of the indicated inducers andlipofectin (lipo), expressed as proportions of the activity induced by ODN 2395 at 3 �g/ml with lipofectin. ODN were tested at 3 �g/ml with (striped whitebars) and without (white bars) lipofectin. For each culture condition the number of donors that provided PBMC where IFN-� was detected (≥16 �g/ml) in

are giv

cell culture supernatants (pos.) and the total number of PBMC donors (n)that CI are non-symmetrical, for details see Section 2.5).

3.2. Induction of IFN-� production

Supernatants from some PBMC cultures stimulated withODN were tested for presence of IFN-� (Fig. 2). Due to short-age of sampling material only supernatants from culturesstimulated with 3 �g ODN/ml were used in this analy-sis. Results were expressed as proportions of IFN-� levelsinduced by ODN 2395 at 3 �g/ml in combination with lipo-fectin at 5 �g/ml (see Section 2.5) and high levels of IFN-�were consistently recorded for PBMC from all tested horsesunder these conditions (range: 11–148 �g/ml; mean ± 95%CI: 35.8 ± 38.4 �g/ml; n = 8). No IFN-� was detected inmedium control cultures from any of the horses but PBMCfrom three horses produced IFN-� (9 �g/ml for all three)when cultured with lipofectin alone.

PBMC from all tested horses showed pronounced IFN-�responses upon stimulation with ODN 2395, ODN 2006 orODN 1. The non-CpG ODN 2137 as well as CpG containing

ODN 8 only induced IFN-� responses in PBMC from someof the horses and these responses were of a low magni-tude. Lipofectin treatment did not significantly influenceIFN-� production upon stimulation with the potent IFN-�

en. Non-overlapping CI indicate statistically significant differences (note

inducing ODN 2395, ODN 2006 or ODN 1. Low IFN-� levelsinduced by ODN 2137 and ODN 8 tended to be higher whenthese ODN were combined with lipofectin and ODN5328only induced IFN-� in the presence of lipofectin. However,this potentially enhancing effect was indistinguishablefrom the IFN-� responses observed when PBMC were cul-tured with lipofectin alone. Thus, ODN 2395, ODN 2006 andODN 1 were consistent inducers of IFN-� production. Thisinduction was independent of lipofectin treatment but atleast for ODN 2395 and ODN 2006 it was influenced by thepresence of CpG-motifs.

3.3. Induction of TNF- ̨ production

Supernatants from some PBMC cultures stimulated withODN were tested for presence of TNF-� (Fig. 3). Due toshortage of sampling material only supernatants from cul-tures stimulated with 25 �g ODN/ml were used in this

analysis. Results were expressed as proportions of TNF-�levels induced by ODN 2006 at 25 �g/ml (see Section 2.5)and high levels of TNF-� were consistently recorded forPBMC from all tested horses under these conditions (range:

E. Wattrang et al. / Veterinary Immunology and Immunopathology 146 (2012) 113– 124 119

Fig. 3. TNF-� (arithmetic mean values ± 95% CI) in cell culture supernatants from equine PBMC cultured for 24 h in the presence of the indicated inducersand lipofectin (lipo), expressed as proportions of the activity induced by ODN 2006 at 25 �g/ml. ODN were tested at 25 �g/ml with (grey dotted bars) andwithout (grey bars) lipofectin. For each culture condition the number of donors that provided PBMC where TNF-� was detected (≥12 ng/ml) in cell cultures Non-oven

2MT(

itulf2csbt5L�2iOs

upernatants (pos.) and the total number of PBMC donors (n) are given.

on-symmetrical, for details see Section 2.5).

14–2432 ng/ml; mean ± 95% CI: 1012 ± 592 ng/ml; n = 9).oreover, PBMC from 8 out of 9 tested horses displayed

NF-� in supernatants from cells cultured in medium alonerange: 2–175 ng/ml; mean ± 95% CI: 54 ± 51 ng/ml; n = 9).

Stimulation with ODN 2395, ODN 2006 or ODN 1nduced production of TNF-� that was significantly higherhan that recorded in unstimulated cultures. However,pon culture with ODN 5328, ODN 2137 or ODN 8 TNF-�

evels in the supernatants were not significantly differentrom those of PBMC cultured in medium alone. For ODN006 a clear difference in TNF-� induction was observedompared to when its CpG-motifs were altered to GpC-equences, i.e. ODN 2137. The levels of TNF-� inducedy ODN 2395 were however not significantly differenthan those recorded in cultures stimulated with ODN328 where CpG-motifs were altered to GpC-sequences.ipofectin treatment did not significantly influence TNF-

production in any of the PBMC cultures. Thus, ODN

395, ODN 2006 and ODN 1 were all capable of induc-

ng TNF-� production above background levels and forDN 2006 a CpG-dependency for this induction was

hown.

rlapping CI indicate statistically significant differences (note that CI are

3.4. Induction of TGF- ̌ production

Supernatants from all PBMC cultures stimulated withODN were tested for presence of TGF–�. As expectedthe growth medium with 5% FCS contained bovine TGF-� that was detected in the ELISA (Danielpour, 1993;Danielpour et al., 1989) and this background (975 pg/ml)was subtracted from the data. When cultured, PBMCfrom all tested horses produced TGF-� under at leastsome culture conditions but the levels of TGF-� pro-duced varied inconsistently with PBMC donor as well aswith different culture conditions. In supernatants fromPBMC cultured in medium alone the TGF-� concentra-tion varied between 0 and 3005 pg/ml (mean ± 95% CI:968 ± 777 pg/ml; n = 8) and similar values were observedin supernatants from ODN stimulated cultures. More-over, stimulation with PMA alone (range: 868–3650 pg/ml;mean ± 95% CI: 1720 ± 1449 pg/ml; n = 5) or in combina-

tion with the lectin PHA (range: 0–2258 pg/ml; mean ± 95%CI: 841 ± 1062 pg/ml; n = 5), that were reported inducers ofTGF-� production in vitro, also failed to induce convincingTGF-� production by equine PBMC. Thus, the tested ODN

120 E. Wattrang et al. / Veterinary Immunology and Immunopathology 146 (2012) 113– 124

Fig. 4. Proliferation (mean values ± 95% CI) of equine PBMC cultured for 72 h in the presence of the indicated inducers and lipofectin (lipo). ODN werefectin anverlapp

tested at 3 �g/ml with (striped white bars) and without (white bars) lipoFor each culture condition the number of PBMC donors (n) is given. Non-o2.5).

did not induce TGF-� production in the present in vitrosystem.

3.5. Induction of PBMC proliferation

Proliferation was assessed after 72 h of incubation in allPBMC cultures stimulated with ODN (Fig. 4). In this analysisODN 2395 and ODN 2006 induced significant proliferationof PBMC at both ODN concentrations tested. When CpG-motifs of ODN 2395 where altered to GpC-sequences, i.e.ODN 5328, no proliferation above background level wasinduced at any of the ODN concentrations tested. However,ODN 2137 where CpG-motifs of ODN 2006 were altered toGpC-sequences, induced low-level but significant prolifer-ation when used at 25 �g ODN/ml. In mean, ODN 1 inducedincreased proliferation of the PBMC but as a consequence ofthe large individual variation in the levels of proliferationinduced by this ODN it was not significantly different frombackground proliferation. No proliferation was observedafter stimulation with ODN 8. Moreover, lipofectin treat-ment did not alter the proliferation induced by any of theODN. The levels of proliferation induced by ODN 2395 andODN 2006 were comparable to that induced by the mito-

genic lectin Con A. The PBMC were however capable ofhigher levels of proliferation as shown after stimulationwith PMA alone (not shown) or in combination with thelectin PHA. Thus, both ODN 2395 and ODN 2006 were able

d at 25 �g/ml with (grey dotted bars) and without (grey bars) lipofectin.ing CI indicate statistically significant differences (for details see Section

to induce proliferation of equine PBMC in a CpG-dependentmanner.

4. Discussion

The present study aimed to evaluate a small panel ofODN for their capacity to induce a number of equine leuko-cyte functions. The most striking finding was that ODN2006 and ODN 2395 were equally consistent inducers oftype I IFN, IFN-� and TNF-� production as well as equallypotent inducers of proliferation. Moreover, ODN 1 showedthe same pattern of cytokine induction as ODN 2006 andODN 2395 but was less potent as inducer of proliferation.

The ODN tested in the present study were chosenbecause of their documented activities in other speciesand they also represent different classes of ODN. Impor-tant hallmarks for definition of A-, B- and C-class ODNhave been their capacity to induce type I IFN productionand B-cell proliferation. What is more, these traits are con-sidered important for the potential therapeutic use of anODN for instance as a vaccine adjuvant when CTL acti-vation, through type I IFN, and/or antibody productionare desired for induction of protective immunity to a cer-

tain disease. Also other traits have been reported to differbetween ODN classes, e.g. IFN-� production and inductionof pro-inflammatory cytokines (Abel et al., 2005; Guzylack-Piriou et al., 2004; Vollmer et al., 2004a). In the present

gy and

sbOtpbtDiOticnJc2Ws3OeIvsc(ct2dearMsfeb

dins2haBatsc2mi2tef21

E. Wattrang et al. / Veterinary Immunolo

tudy it was evident that there was very little differenceetween the responses induced by ODN 1, ODN 2006 andDN 2395 representing A-, B- and C-class ODN, respec-

ively. Hence, with respect to type I IFN induction androliferation, the effects of ODN 1 and ODN 2395 coulde considered expected while the solid type I IFN induc-ion in equine PBMC by ODN 2006 was very surprising.efinitions of ODN classes have been performed primar-

ly in human and murine systems and according to thoseDN 2006 structurally and functionally clearly belongs to

he B-class (Krieg, 2006). Nevertheless, results from stud-es where type I IFN induction by ODN 2006 in humanells in fact has been assessed are diverging, some showo or very low IFN-� production (Hartmann et al., 2003;

arrossay et al., 2001; Krug et al., 2001) while others showonsistent low to moderate IFN-� production (Jurk et al.,004; Kerkmann et al., 2003, 2005; Vollmer et al., 2004a,b).hen comparisons with other ODN were made in these

tudies, the levels of IFN-� induced by ODN 2006 were–50 times lower than those induced by A- and/or C-classDN (Hartmann et al., 2003; Jurk et al., 2004; Kerkmannt al., 2003, 2005; Vollmer et al., 2004a). Moreover, type IFN receptor mediated up-regulation of IFN-inducible anti-iral protein genes has also been recorded upon ODN 2006timulation of human PBMC (Kato et al., 2003). In porcineells, ODN 2006 induced no or low type IFN I productionGuzylack-Piriou et al., 2004) while in ovine cells this ODNlearly induced IFN-� production albeit to lower levelshan A- and C-class ODN (Booth et al., 2007). Thus, ODN006 obviously has the capacity to induce type I IFN pro-uction and it was indeed originally described (Hartmannt al., 2000) due to its ability to activate both human B-cellsnd NK-cells, the latter trait usually considered an indi-ect effect e.g. through type I IFN induction (Krieg, 2002;arshall et al., 2006). Type I IFN induction by ODN 2006

hown in the present study was consequently not uniqueor equine PBMC but the comparatively high type I IFN lev-ls it induced were unusual in context with what so far haseen reported for other mammalian cells.

Considerable efforts have been made to understand andefine the exact requirements for ODN to induce desired

mmune activities. In addition to identification of activeucleotide sequences, e.g. CpG-motifs, it has also beenhown that nucleotide backbone chemistry (Bartz et al.,004; Wagner, 2008) and structural aspects of DNA e.g.,airpin formation, self-dimerization, 5′-end accessibilitynd G-tetrad formation (Agrawal and Kandimalla, 2007;artz et al., 2004; Kerkmann et al., 2005; Yu et al., 2008)re of importance for ODN activities. It should be stressedhat the present study was not designed to elucidatetructural aspects of ODN. However, it is noteworthy thatomparing the two active phosphorothioate ODNs, ODN395 was both theoretically prone (Table 1) and experi-entally proven (Yu et al., 2008) to form self inter- and

ntra-molecular double-stranded structures while ODN006 was more prone to single-stranded conformation,heoretically (Table 1) and experimentally shown (Costa

t al., 2004). Nevertheless, there was little or no dif-erence in the responses exerted by ODN 2395 or ODN006 on equine PBMC. Moreover, phosphodiester ODN

and ODN 8 were of a similar general outline, have

Immunopathology 146 (2012) 113– 124 121

similar theoretical predispositions for spontaneous sec-ondary structure formation and have the same number of3′ guanosine nucleotides available for potential G-tetradformation (Table 1). Nonetheless, these two ODN exertedvery different effects on the equine PBMC, i.e. ODN 1induced activity in most assays while ODN 8 was inactive.Thus, it seems that the differences in nucleotide sequencesbetween ODN 1 and ODN 8 were the most likely expla-nation for their divergent effects. Taken together, theseanalyses again stresses that the reactivity of a given ODNis hard to predict and must be tested in the species it isintended to be used.

Among receptors recognizing immunostimulatory DNA,TLR9 is by far the most studied although it has long beenevident that other receptors must also exist and indeedsome have recently been identified, e.g. DNA-dependentactivator of IFN regulatory factors, RNA polymerase IIIand interferon inducible protein 16 (Chiu et al., 2009;Takaoka et al., 2007; Unterholzner et al., 2010). Unmethy-lated CG-sequences have been identified as the primaryligand of TLR9 (Bauer et al., 2008), although it has beensuggested that CpG dependency is restricted to phospho-rothioate DNA (Haas et al., 2008). In the present studyCpG-controls (GpC-ODN) were included for ODN 2395 andODN 2006, i.e. ODN 5328 and ODN 2137, respectively.Indeed, for responses induced by ODN 2395 and ODN 2006CpG dependency or significantly higher responses com-pared to their corresponding GpC-ODN were observed.Hence, these responses were most likely mediated throughTLR9. However, non-CpG mediated responses to DNA werealso observed in the present study e.g. ODN 2137 inducedsignificant albeit low-level proliferation of PBMC. This is inanalogy with observations on e.g. human cells where PBMC(Bartz et al., 2004; Elias et al., 2003) and purified B-cells(Bernard and Phipps, 2007) were activated by ODN 2137. Ithas been reported that TLR9 may also be involved in recog-nition of non-CpG DNA (Bernard and Phipps, 2007; Robertset al., 2005; Vollmer et al., 2004b) but in the present case theinvolvement of other DNA-recognition receptors cannot beexcluded.

It is known that liposome based transfection methodssuch as lipofectin treatment may enhance the effects ofODN stimulation. The mechanisms by which cationic lipidsenhance DNA stimulation may involve protection againstendo-nuclease activity (Xu and Szoka, 1996), increaseduptake/delivery of DNA to endosomes (Honda et al., 2005)and/or to the cytosol (Takaoka et al., 2007; Unterholzneret al., 2010). Indeed, we have earlier shown that lipofectintreatment was required for activation of equine PBMCin vitro with plasmid DNA or “plain” phosphodiester CpG-ODNs (Wattrang et al., 2005). Moreover, in that study wealso found that the type I IFN levels induced by the testedA-class ODN (ODN 2216, ODN MM1, ODN D19 and ODND25) were at least 100-fold enhanced by lipofectin treat-ment. However, in the present study no clear enhancingeffects of lipofectin treatment of ODN were observed forany of the parameters measured. In the case of complete

phosphorothioate ODN 2395 and ODN 2006, this is perhapsless surprising due to the relative resistance of this back-bone chemistry to endo-nuclease activity (Agrawal et al.,1995). However, enhanced and/or altered activity also of

ogy and

122 E. Wattrang et al. / Veterinary Immunol

phosphorothioate ODN has been shown after treatmentwith cationic lipids (Bennett et al., 1992; Thierry andDritschilo, 1992), e.g. it has been shown that treatmentwith cationic lipids can confer IFN-� inducing ability to aB-class ODN that otherwise does not induce this cytokine(Haas et al., 2008; Honda et al., 2005). In view of the ear-lier observations (Wattrang et al., 2005) that the effects ofseveral A-class ODN on equine PBMC were enhanced bylipofectin treatment, the present results with ODN 1 werehowever more unexpected. Like the earlier tested A-classODN, the “A class-like” ODN 1 has 3′ poly-G sequences thatmay form higher order structures seemingly important forthe activity of these types of ODN (Kerkmann et al., 2005).Indeed, the presence of poly-G sequences has for some ODNproved critical for the ability to induce IFN-� production byporcine (Wikström et al., 2007), human (Kerkmann et al.,2005) and murine (Haas et al., 2008) cells without treat-ment with cationic lipids. Any difference between ODN 1and the earlier tested A-class ODN that would render it lessdependent on lipofectin treatment is however not obvi-ously striking. One explanation could be that the nucleotidesequence of ODN 1, e.g. CpG-motifs and other flankingsequences, simply were more stimulatory for equine cellsthan the previously tested A-class ODN.

The equine PBMC readily produced IFN-� upon stimula-tion with ODN 1, ODN 2395 and ODN 2006. ODN 2395 hasalso been shown to induce IFN-� mRNA in foal PBMC (Liuet al., 2009b). Induction of this cytokine by ODN has beenextensively studied in other species and either ascribedas a direct induction e.g. in murine classical DC (Lugo-Villarino et al., 2005) or more commonly as an indirectinduction in NK cells or T cells through activation by type IIFN, IL-12 and/or TNF-� (Krieg, 2002; Marshall et al., 2006;Rothenfusser et al., 2001). In the present study, the shorttime of induction, 24 h, makes a direct induction of IFN-�in the equine PBMC seem more likely. We did not attemptto identify the cellular source of IFN-� amid the equinePBMC and since a first characterization of equine TLR9expressing cells (Zhang et al., 2008) suggested that a major-ity of CD4 as well as CD8 expressing PBMC also expressTLR9 it is not possible to deduce a likely IFN-� producingcell type from the receptors they express. In the presentstudy the different types of ODN that were active inducedsimilar levels of IFN-� production in PBMC. In foal PBMCB-class ODN 2135 and 2142 induced higher levels of IFN-�mRNA than C-class ODN 2395 (Liu et al., 2009b) while inequine bronchoalveolar lavage cells (Klier et al., 2011) A-class ODN 2216 induced high levels of IFN-� compared to B-and C-class ODN, including ODN 2006 and ODN 2395, thatinduced similar levels as non-CpG ODN. In human PBMCA-, B- and C-class ODN induced similar levels of IFN-� (Jurket al., 2004), while A-class ODN induced higher levels ofIFN-� in murine spleenocytes compared to both B- andC-class ODN (Vollmer et al., 2004a).

Regarding TGF-�, there are divergent reports on theassociation between CpG-DNA stimulation and productionof this cytokine. It has for instance been shown that ODN

2006 induce TGF-� production by human tumor cells (Diet al., 2009). It has also been reported (Moseman et al.,2004) that purified human DC per se do not produce TGF-� upon stimulation with ODN 2006 but do promote the

Immunopathology 146 (2012) 113– 124

differentiation of naïve T-cell into regulatory T cells thatin turn readily produce TGF-�. On the other hand, thereare several reports that show down regulation of TGF-� by CpG-DNA, e.g. genes of the TGF-� pathway weredown regulated in murine macrophages upon stimulationwith B-class ODN (Crosby et al., 2010). Moreover, TGF-�mRNA expression induced by Plasmodium yoelii infectionwas absent when mice were treated with B-class ODN 1826prior to infection (Chen et al., 2009), and treatment of micewith B-class ODN prior to allergen challenge reduced TGF-� production in the airways in a murine model of asthma(Cho et al., 2004). In the present study neither induction nordown regulation of TGF-� was observed upon ODN stimu-lation of equine PBMC. However, TGF-� was still produced,in very varying levels, by the cultured PBMC. This was inanalogy with what has been observed for e.g. human PBMCthat produced TGF-� in medium control cultures (Di Paoloet al., 2002; Korpinen et al., 2001) also with a large indi-vidual variation (Korpinen et al., 2001). Furthermore, PMAand PHA were tried as inducers of TGF-� production bythe equine PBMC but no clear responses could be observed.PMA and PHA have been named as inducers of TGF-� (DiPaolo et al., 2002; Korpinen et al., 2001) but it has alsobeen shown that PBMC from less than 50% of individualsresponded with TGF-� production above baseline levelsupon PHA stimulation (Korpinen et al., 2001).

Taken together these results show that ODN inducesseveral important equine leukocyte functions clearly indi-cating a promising potential for the use of ODN in equinemedicine e.g. as vaccine adjuvants. It was also clear that theactivities of individual ODN need to be carefully evaluatedfor each species since predictions of ODN properties basedon e.g. criteria set up for human cells seem to be of limitedvalue for what really occurs in equine cells. In a widenedcontext these results may imply that the A, B, C-class defi-nition of ODN perhaps only is valid within a species. Speciesvariation in responses induced by ODN has long been evi-dent and some explanations for this e.g. differences in thesequence recognition of TLR9 (Bauer et al., 2001), have beenput forward. However, results from the present as wellas other studies show that these differences between ani-mal species not only involve differences in recognition ofhexameric CpG-motifs. Hence, it would be very interest-ing to further elucidate at what level/s in the recognitionof immune stimulatory DNA that animal species differ.

Conflict of interest statement

The authors declare no conflict of interests.

Acknowledgments

This project received financial support from Intervetresearch foundation (Sweden). The authors wish to thankLisbeth Fuxler for expert running of the IFN bioassay, Dr

David Morrison for encouragement and statistical exper-tise, Dr Anna Lundén for critical scrutiny of the manuscriptand owners of blood donor horses for their invaluable sup-port.

gy and

R

A

A

A

B

B

B

B

B

B

B

C

C

C

C

C

D

D

D

D

D

D

E. Wattrang et al. / Veterinary Immunolo

eferences

bel, K., Wang, Y., Fritts, L., Sanchez, E., Chung, E., Fitzgerald-Bocarsly, P.,Krieg, A.M., Miller, C.J., 2005. Deoxycytidyl-deoxyguanosine oligonu-cleotide classes A, B, and C induce distinct cytokine gene expressionpatterns in rhesus monkey peripheral blood mononuclear cells anddistinct alpha interferon responses in TLR9-expressing rhesus monkeyplasmacytoid dendritic cells. Clin Diagn Lab Immunol 12, 606–621.

grawal, S., Kandimalla, E.R., 2007. Synthetic agonists of Toll-like recep-tors 7, 8 and 9. Biochem Soc Trans 35, 1461–1467.

grawal, S., Temsamani, J., Galbraith, W., Tang, J., 1995. Pharmacokineticsof antisense oligonucleotides. Clin Pharmacokinet 28, 7–16.

artz, H., Mendoza, Y., Gebker, M., Fischborn, T., Heeg, K., Dalpke, A.,2004. Poly-guanosine strings improve cellular uptake and stimulatoryactivity of phosphodiester CpG oligonucleotides in human leukocytes.Vaccine 23, 148–155.

auer, S., Kirschning, C.J., Häcker, H., Redecke, V., Hausmann, S., Akira, S.,Wagner, H., Lipford, G.B., 2001. Human TLR9 confers responsivenessto bacterial DNA via species-specific CpG motif recognition. Proc NatlAcad Sci USA 98, 9237–9242.

auer, S., Pigisch, S., Hangel, D., Kaufmann, A., Hamm, S., 2008. Recognitionof nucleic acid and nucleic acid analogs by Toll-like receptors 7, 8 and9. Immunobiology 213, 315–328.

ennett, C.F., Chiang, M.Y., Chan, H., Shoemaker, J.E., Mirabelli, C.K., 1992.Cationic lipids enhance cellular uptake and activity of phosphoroth-ioate antisense oligonucleotides. Mol Pharmacol 41, 1023–1033.

ernard, M.P., Phipps, R.P., 2007. CpG oligodeoxynucleotides inducecyclooxygenase-2 in human B lymphocytes: implications for adjuvantactivity and antibody production. Clin Immunol 125, 138–148.

lasius, A.L., Beutler, B., 2010. Intracellular toll-like receptors. Immunity32, 305–315.

ooth, J.S., Nichani, A.K., Benjamin, P., Dar, A., Krieg, A.M., Babiuk, L.A.,Mutwiri, G.K., 2007. Innate immune responses induced by classes ofCpG oligodeoxynucleotides in ovine lymph node and blood mononu-clear cells. Vet Immunol Immunopathol 115, 24–34.

hen, J., Xu, W., Zhou, T., Ding, Y., Duan, J., Huang, F., 2009. Inhibitoryrole of toll-like receptors agonists in Plasmodium yoelii liver stagedevelopment. Parasite Immunol 31, 466–473.

hiu, Y.H., Macmillan, J.B., Chen, Z.J., 2009. RNA polymerase III detectscytosolic DNA and induces type I interferons through the RIG-I path-way. Cell 138, 576–591.

ho, J.Y., Miller, M., Baek, K.J., Han, J.W., Nayar, J., Rodriguez, M., Lee, S.Y.,McElwain, K., McElwain, S., Raz, E., Broide, D.H., 2004. Immunostimu-latory DNA inhibits transforming growth factor-beta expression andairway remodeling. Am J Respir Cell Mol Biol 30, 651–661.

osta, L.T., Kerkmann, M., Hartmann, G., Endres, S., Bisch, P.M., Heckl,W.M., Thalhammer, S., 2004. Structural studies of oligonucleotidescontaining G-quadruplex motifs using AFM. Biochem Biophys ResCommun 313, 1065–1072.

rosby, L., Casey, W., Morgan, K., Ni, H., Yoon, L., Easton, M., Misukonis, M.,Burleson, G., Ghosh, D.K., 2010. Murine J774 macrophages recognizeLPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences asimmunologically distinct. Nitric Oxide 22, 242–257.

anielpour, D., 1993. Improved sandwich enzyme-linked immunosorbentassays for transforming growth factor beta 1. J Immunol Methods 158,17–25.

anielpour, D., Kim, K.Y., Dart, L.L., Watanabe, S., Roberts, A.B., Sporn, M.B.,1989. Sandwich enzyme-linked immunosorbent assays (SELISAs)quantitate and distinguish two forms of transforming growth factor-beta (TGF-beta 1 and TGF-beta 2) in complex biological fluids. GrowthFactors 2, 61–71.

esjardins, I., Theoret, C., Joubert, P., Wagner, B., Lavoie, J.P., 2004. Com-parison of TGF-beta 1 concentrations in bronchoalveolar fluid ofhorses affected with heaves and of normal controls. Vet ImmunolImmunopathol 101, 133–141.

i, J.M., Pang, J., Pu, X.Y., Zhang, Y., Liu, X.P., Fang, Y.Q., Ruan, X.X., Gao,X., 2009. Toll-like receptor 9 agonists promote IL-8 and TGF-beta1production via activation of nuclear factor kappaB in PC-3 cells. CancerGenet Cytogenet 192, 60–67.

i Paolo, S., Schena, A., Stallone, G., Grandaliano, G., Soccio, M., Cerullo,G., Gesualdo, L., Paolo Schena, F., 2002. Captopril enhances trans-forming growth factor (TGF)-beta1 expression in peripheral bloodmononuclear cells: a mechanism independent from angiotensinconverting enzyme inhibition? A study in cyclosporine-treated

kidney-transplanted patients. Transplantation 74, 1710–1715.

omeika, K., Magnusson, M., Eloranta, M.L., Fuxler, L., Alm, G.V., Fossum, C.,2004. Characteristics of oligodeoxyribonucleotides that induce inter-feron (IFN)-alpha in the pig and the phenotype of the IFN-alphaproducing cells. Vet Immunol Immunopathol 101, 87–102.

Immunopathology 146 (2012) 113– 124 123

Elias, F., Flo, J., Lopez, R.A., Zorzopulos, J., Montaner, A., Rodriguez, J.M.,2003. Strong cytosine-guanosine-independent immunostimulation inhumans and other primates by synthetic oligodeoxynucleotides withPyNTTTTGT motifs. J Immunol 171, 3697–3704.

Flaminio, M.J., Borges, A.S., Nydam, D.V., Horohov, D.W., Hecker, R., Maty-chak, M.B., 2007. The effect of CpG-ODN on antigen presenting cellsof the foal. J Immune Based Ther Vaccines 5, 1.

Guiducci, C., Ott, G., Chan, J.H., Damon, E., Calacsan, C., Matray, T., Lee, K.D.,Coffman, R.L., Barrat, F.J., 2006. Properties regulating the nature of theplasmacytoid dendritic cell response to Toll-like receptor 9 activation.J Exp Med 203, 1999–2008.

Guzylack-Piriou, L., Balmelli, C., McCullough, K.C., Summerfield, A., 2004.Type-A CpG oligonucleotides activate exclusively porcine naturalinterferon-producing cells to secrete interferon-alpha, tumour necro-sis factor-alpha and interleukin-12. Immunology 112, 28–37.

Haas, T., Metzger, J., Schmitz, F., Heit, A., Muller, T., Latz, E., Wagner, H.,2008. The DNA sugar backbone 2′ deoxyribose determines toll-likereceptor 9 activation. Immunity 28, 315–323.

Hartmann, G., Battiany, J., Poeck, H., Wagner, M., Kerkmann, M., Lubenow,N., Rothenfusser, S., Endres, S., 2003. Rational design of new CpGoligonucleotides that combine B cell activation with high IFN-alpha induction in plasmacytoid dendritic cells. Eur J Immunol 33,1633–1641.

Hartmann, G., Weeratna, R.D., Ballas, Z.K., Payette, P., Blackwell, S.,Suparto, I., Rasmussen, W.L., Waldschmidt, M., Sajuthi, D., Purcell,R.H., Davis, H.L., Krieg, A.M., 2000. Delineation of a CpG phosphoroth-ioate oligodeoxynucleotide for activating primate immune responsesin vitro and in vivo. J Immunol 164, 1617–1624.

He, H., Crippen, T.L., Farnell, M.B., Kogut, M.H., 2003. Identification of CpGoligodeoxynucleotide motifs that stimulate nitric oxide and cytokineproduction in avian macrophage and peripheral blood mononuclearcells. Dev Comp Immunol 27, 621–627.

Honda, K., Ohba, Y., Yanai, H., Negishi, H., Mizutani, T., Takaoka, A., Taya,C., Taniguchi, T., 2005. Spatiotemporal regulation of MyD88-IRF-7 sig-nalling for robust type-I interferon induction. Nature 434, 1035–1040.

Ishii, K.J., Akira, S., 2006. Innate immune recognition of, and regulation by,DNA. Trends Immunol 27, 525–532.

Jarrossay, D., Napolitani, G., Colonna, M., Sallusto, F., Lanzavecchia, A.,2001. Specialization and complementarity in microbial moleculerecognition by human myeloid and plasmacytoid dendritic cells. EurJ Immunol 31, 3388–3393.

Jensen-Waern, M., Persson, S.G., Nordengrahn, A., Merza, M., Fossum,C., 1998. Temporary suppression of cell-mediated immunity in stan-dardbred horses with decreased athletic capacity. Acta Vet Scand 39,25–33.

Jurk, M., Schulte, B., Kritzler, A., Noll, B., Uhlmann, E., Wader, T., Schet-ter, C., Krieg, A.M., Vollmer, J., 2004. C-Class CpG ODN: sequencerequirements and characterization of immunostimulatory activitieson mRNA level. Immunobiology 209, 141–154.

Kamstrup, S., Verthelyi, D., Klinman, D.M., 2001. Response of porcineperipheral blood mononuclear cells to CpG-containing oligodeoxynu-cleotides. Vet Microbiol 78, 353–362.

Kato, A., Homma, T., Batchelor, J., Hashimoto, N., Imai, S., Wakiguchi,H., Saito, H., Matsumoto, K., 2003. Interferon-alpha/beta receptor-mediated selective induction of a gene cluster by CpG oligodeoxynu-cleotide 2006. BMC Immunol 4, 8.

Kerkmann, M., Costa, L.T., Richter, C., Rothenfusser, S., Battiany, J., Hor-nung, V., Johnson, J., Englert, S., Ketterer, T., Heckl, W., Thalhammer, S.,Endres, S., Hartmann, G., 2005. Spontaneous formation of nucleic acid-based nanoparticles is responsible for high interferon-alpha inductionby CpG-A in plasmacytoid dendritic cells. J Biol Chem 280, 8086–8093.

Kerkmann, M., Rothenfusser, S., Hornung, V., Towarowski, A., Wagner, M.,Sarris, A., Giese, T., Endres, S., Hartmann, G., 2003. Activation withCpG-A and CpG-B oligonucleotides reveals two distinct regulatorypathways of type I IFN synthesis in human plasmacytoid dendriticcells. J Immunol 170, 4465–4474.

Klier, J., May, A., Fuchs, S., Schillinger, U., Plank, C., Winter, G., Gehlen, H.,Coester, C., 2011. Immunostimulation of bronchoalveolar lavage cellsfrom recurrent airway obstruction-affected horses by different CpG-classes bound to gelatin nanoparticles. Vet Immunol Immunopathol144, 79–87.

Klinman, D.M., 2004. Immunotherapeutic uses of CpG oligodeoxynu-cleotides. Nat Rev Immunol 4, 249–258.

Korpinen, E., Groop, P.H., Fagerudd, J.A., Teppo, A.M., Åkerblom, H.K., Vaar-

ala, O., 2001. Increased secretion of TGF-beta1 by peripheral bloodmononuclear cells from patients with Type 1 diabetes mellitus withdiabetic nephropathy. Diabet Med 18, 121–125.

Krieg, A.M., 2002. CpG motifs in bacterial DNA and their immune effects.Annu Rev Immunol 20, 709–760.

ogy and

toll-like receptor 9 agonists on interferon alpha induction. Antimicrob

124 E. Wattrang et al. / Veterinary Immunol

Krieg, A.M., 2006. Therapeutic potential of Toll-like receptor 9 activation.Nat Rev Drug Discov 5, 471–484.

Krug, A., Rothenfusser, S., Hornung, V., Jahrsdorfer, B., Blackwell, S., Ballas,Z.K., Endres, S., Krieg, A.M., Hartmann, G., 2001. Identification of CpGoligonucleotide sequences with high induction of IFN-alpha/beta inplasmacytoid dendritic cells. Eur J Immunol 31, 2154–2163.

Land, C.E., 1974. Confidence interval estimation for means after data trans-formation to normality. J Am Stat Assoc 69, 795–802.

Leise, B.S., Yin, C., Pettigrew, A., Belknap, J.K., 2010. Proinflammatorycytokine responses of cultured equine keratinocytes to bacterialpathogen-associated molecular pattern motifs. Equine Vet J 42,294–303.

Liu, M., Liu, T., Bordin, A., Nerren, J., Cohen, N., 2009a. Activation offoal neutrophils at different ages by CpG oligodeoxynucleotides andRhodococcus equi. Cytokine 48, 280–289.

Liu, T., Nerren, J., Liu, M., Martens, R., Cohen, N., 2009b. Basal and stimulus-induced cytokine expression is selectively impaired in peripheralblood mononuclear cells of newborn foals. Vaccine 27, 674–683.

Lopez, A.M., Hecker, R., Mutwiri, G., van Drunen Littel-van den Hurk,S., Babiuk, L.A., Townsend, H.G., 2006. Formulation with CpG ODNenhances antibody responses to an equine influenza virus vaccine.Vet Immunol Immunopathol 114, 103–110.

Lugo-Villarino, G., Ito, S., Klinman, D.M., Glimcher, L.H., 2005. The adjuvantactivity of CpG DNA requires T-bet expression in dendritic cells. ProcNatl Acad Sci USA 102, 13248–13253.

Magnusson, M., Johansson, E., Berg, M., Eloranta, M.L., Fuxler, L., Fossum,C., 2001. The plasmid pcDNA3 differentially induces production ofinterferon-alpha and interleukin-6 in cultures of porcine leukocytes.Vet Immunol Immunopathol 78, 45–56.

Marshall, J.D., Heeke, D.S., Abbate, C., Yee, P., Van Nest, G., 2006. Inductionof interferon-gamma from natural killer cells by immunostimulatoryCpG DNA is mediated through plasmacytoid-dendritic-cell-producedinterferon-alpha and tumour necrosis factor-alpha. Immunology 117,38–46.

Moseman, E.A., Liang, X., Dawson, A.J., Panoskaltsis-Mortari, A., Krieg, A.M.,Liu, Y.J., Blazar, B.R., Chen, W., 2004. Human plasmacytoid dendriticcells activated by CpG oligodeoxynucleotides induce the generationof CD4 + CD25 + regulatory T cells. J Immunol 173, 4433–4442.

Nicolson, L., McMonagle, L., Taylor, S., Hopkins, C., Sanders, L., vanKuilekom, H., Scholtes, N., Argyle, D., Onions, D., Schijns, V., 2001.Equine cytokines and associated reagents. In: Lunn, D.P., Wade, J.F.(Eds.), Equine immunology in 2001. R & W Publications Limited, New-market, pp. 57–58.

Rankin, R., Pontarollo, R., Ioannou, X., Krieg, A.M., Hecker, R., Babiuk, L.A.,van Drunen Littel-van den Hurk, S., 2001. CpG motif identificationfor veterinary and laboratory species demonstrates that sequencerecognition is highly conserved. Antisense Nucleic Acid Drug Dev 11,333–340.

Roberts, T.L., Sweet, M.J., Hume, D.A., Stacey, K.J., 2005. Cutting

edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides. J Immunol 174,605–608.

Rothenfusser, S., Hornung, V., Krug, A., Towarowski, A., Krieg, A.M., Endres,S., Hartmann, G., 2001. Distinct CpG oligonucleotide sequences

Immunopathology 146 (2012) 113– 124

activate human gamma delta T cells via interferon-alpha/-beta. EurJ Immunol 31, 3525–3534.

Takaoka, A., Wang, Z., Choi, M.K., Yanai, H., Negishi, H., Ban, T., Lu, Y.,Miyagishi, M., Kodama, T., Honda, K., Ohba, Y., Taniguchi, T., 2007. DAI(DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innateimmune response. Nature 448, 501–505.

Thierry, A.R., Dritschilo, A., 1992. Intracellular availability ofunmodified, phosphorothioated and liposomally encapsulatedoligodeoxynucleotides for antisense activity. Nucleic Acids Res 20,5691–5698.

Unterholzner, L., Keating, S.E., Baran, M., Horan, K.A., Jensen, S.B., Sharma,S., Sirois, C.M., Jin, T., Latz, E., Xiao, T.S., Fitzgerald, K.A., Paludan, S.R.,Bowie, A.G., 2010. IFI16 is an innate immune sensor for intracellularDNA. Nat Immunol 11, 997–1004.

Wagner, B., Hillegas, J.M., Flaminio, M., Wattrang, E., 2008. Monoclonalantibodies to equine interferon-� (IFN-�): new tools to neutralize IFNactivity and to detect secreted IFN-�. Vet Immunol Immunopathol125, 315–325.

Wagner, B., Robeson, J., McCracken, M., Wattrang, E., Antczak, D.F., 2005.Horse cytokine/IgG fusion proteins—mammalian expression of bio-logically active cytokines and a system to verify antibody specificityto equine cytokines. Vet Immunol Immunopathol 105, 1–14.

Wagner, H., 2008. The sweetness of the DNA backbone drives Toll-likereceptor 9. Curr Opin Immunol 20, 396–400.

Wattrang, E., Berg, M., Magnusson, M., 2005. Immunostimulatory DNAactivates production of type I interferons and interleukin-6 inequine peripheral blood mononuclear cells in vitro. Vet ImmunolImmunopathol 107, 265–279.

Wikström, F.H., Meehan, B.M., Berg, M., Timmusk, S., Elving, J.,Fuxler, L., Magnusson, M., Allan, G.M., McNeilly, F., Fossum, C.,2007. Structure-dependent modulation of alpha interferon produc-tion by porcine circovirus 2 oligodeoxyribonucleotide and CpGDNAs in porcine peripheral blood mononuclear cells. J Virol 81,4919–4927.

Vollmer, J., Weeratna, R., Payette, P., Jurk, M., Schetter, C., Laucht, M.,Wader, T., Tluk, S., Liu, M., Davis, H.L., Krieg, A.M., 2004a. Charac-terization of three CpG oligodeoxynucleotide classes with distinctimmunostimulatory activities. Eur J Immunol 34, 251–262.

Vollmer, J., Weeratna, R.D., Jurk, M., Samulowitz, U., McCluskie, M.J.,Payette, P., Davis, H.L., Schetter, C., Krieg, A.M., 2004b. Oligodeoxynu-cleotides lacking CpG dinucleotides mediate Toll-like receptor 9dependent T helper type 2 biased immune stimulation. Immunology113, 212–223.

Xu, Y., Szoka Jr., F.C., 1996. Mechanism of DNA release from cationicliposome/DNA complexes used in cell transfection. Biochemistry 35,5616–5623.

Yu, D., Putta, M.R., Bhagat, L., Dai, M., Wang, D., Trombino, A.F., Sullivan, T.,Kandimalla, E.R., Agrawal, S., 2008. Impact of secondary structure of

Agents Chemother 52, 4320–4325.Zhang, Y.W., Davis, E.G., Blecha, F., Wilkerson, M.J., 2008. Molecular

cloning and characterization of equine Toll-like receptor 9. VetImmunol Immunopathol 124, 209–219.