variation in sorghum starch synthesis genes associated with differences in starch phenotype

Food Chemistry 131 (2012) 175–183

Contents lists available at SciVerse ScienceDirect

Food Chemistry

journal homepage: www.elsevier .com/locate / foodchem

Variation in sorghum starch synthesis genes associated with differencesin starch phenotype

Helen Hill a,c,⇑, L. Slade Lee a,c, Robert J. Henry b,c

a Southern Cross Plant Science, Southern Cross University, Lismore, NSW 2480, Australiab Queensland Alliance for Agriculture and Food Innovation, University of Queensland, QLD 4072, Australiac Grain Food CRC Ltd., P.O. Box 520, North Ryde, NSW 1670, Australia

a r t i c l e i n f o

Article history:Received 29 March 2011Received in revised form 2 August 2011Accepted 22 August 2011Available online 31 August 2011

Keywords:SorghumStarchProteinFibreAssociationsRVA

0308-8146/$ - see front matter � 2011 Elsevier Ltd. Adoi:10.1016/j.foodchem.2011.08.057

Abbreviations: RVA, Rapid Visco Analyser; TKW, tpolymerase chain reaction; SS, soluble starch syntenzyme; GBSS, granule bound starch synthase; RVU,nucleotide polymorphism.⇑ Corresponding author at: Southern Cross Pla

University, Lismore, NSW 2480, Australia. Tel.: +61 22080.

E-mail address: [email protected] (H. Hill).

a b s t r a c t

The properties of sorghum starch may influence digestibility and nutritional value in animal and humandiets and the processing performance of starch in industrial applications. The variation in grain compo-sition and starch physiochemical properties was evaluated. The DNA sequence of three starch synthesisgenes was surveyed and an association approach used to investigate the genetic basis of phenotypic dif-ferences in sorghum. Single nucleotide polymorphisms (SNPs) in SSIIa distinguish three haplotypes thatwere associated with significant differences in gelatinisation temperature and thousand-kernel weight.SSIIa haplotype (H1) accessions had a significantly lower mean gelatinisation temperature of 80.5 �Ccompared to 87.6 �C and 91.5 �C for H2 and H3, respectively. Polymorphisms in SBEIIb were associatedwith a 12 �C difference in gelatinisation temperature and GBSSI polymorphisms with total starch content.The SNPs identified provide a genetic explanation for variation in starch properties in sorghum.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

Grain sorghum [Sorghum bicolor (L.) Moench] is the fifth mostimportant cereal crop in the world and feeds millions of peopleon a daily basis in the developing countries, providing dietarystarch, dietary protein and some vitamins and minerals. In theWest, it is predominantly used as an animal feed and is increas-ingly important as a modified starch and biomass source for etha-nol production.

The high starch (�70%) and protein (10–15%) content of sor-ghum grain is important for human and animal nutrition. The grainis composed of starch, protein, lipid and fibre, which are complexquantitative traits controlled by many genes. Starch is composedof two kinds of glucose polymers amylopectin and amylose andtheir synthesis is a complex process controlled by at least five dif-ferent enzymes: ADP glucose pyrophosphorylase (EC 2.7.7.27),which has two subunits, Shrunken 2 (Sh2) and Brittle 2 (Bt2) that

ll rights reserved.

housand-kernel weight; PCR,hase; SBE, starch branchingrapid visco units; SNP, single

nt Science, Southern Cross6620 3466; fax: +61 2 66 22

encode the large and small subunits, respectively, starch synthase(SS) (EC 2.4.1.21), granule-bound starch synthase I (GBSSI) (EC2.4.1.11), starch branching enzyme (SBE) (EC 2.4.1.18), and debran-ching enzyme (DBE) (EC 2.4.1.41), which have been the subject ofseveral reviews (Ball et al., 1996; Slattery, Kavakli, & Okita, 2000;Smith, 2001).

GBSSI, encoded by the waxy gene is responsible for the synthe-sis of amylose, whilst amylopectin synthesis is more complex, withthe combined action of the enzymes SS, SBE and DBE all playing arole in its synthesis. Starch synthesis is made more complicateddue to these enzymes having multiple isoforms and each havingpleiotropic effects on the other enzymes within the starch synthe-sis pathway.

The ratio of amylose to amylopectin, together with the chainlength and degree of branching of amylopectin, as well as the pro-tein, lipid and mineral components determines the physiochemicaland ultimately the end-use properties of the flour. Amylose con-tent affects the gelling, solubility and texture of starch (Janeet al., 1999) and loaf volume in bread making, whilst amylopectinis primarily responsible for granule swelling and gelatinisationproperties.

Rapid Visco Analyser (RVA) methodology has been used as atool to evaluate the eating, cooking and processing properties ofcereals. Researchers have investigated the effect of the relativeamounts of amylose and amylopectin on RVA parameters in wheat

http://dx.doi.org/10.1016/j.foodchem.2011.08.057

mailto:[email protected]


http://www.sciencedirect.com/science/journal/03088146

http://www.elsevier.com/locate/foodchem

176 H. Hill et al. / Food Chemistry 131 (2012) 175–183

(Ral, Cavanagh, Larroque, Regina, & Morell, 2008), rice (Wang et al.,2007), barley (Clarke et al., 2008; Morell et al., 2003) and sorghum(Sang, Bean, Seib, Pedersen, & Shi, 2008; Singh, Sodhi, & Singh,2010). Similarly, proteins (Xie, Chen, Duan, Zhu, & Liao, 2008)and lipids (Tang & Copeland, 2007) have an effect on functionalproperties in cereals. Most findings have been reported in wheat,rice and barley with a recent report of genotype associations forgrain quality in sorghum (de Alencar Figueiredo et al., 2010).

Association genetics based on linkage disequilibrium is emerg-ing as a powerful method that aims to associate polymorphisms orquantitative trait loci (QTLs) responsible for phenotypic variationof traits that are often complex characters controlled by a suiteof genes. Population-based methods for mapping complex traitshave been used in human genetics, and are now being applied toplant species, including maize (Yu & Buckler, 2006a) and wheat(Breseghello & Sorrells, 2006).

In this study, we surveyed the variation in DNA sequence inthree important starch biosynthesis genes; SSIIa, GBSSI and SBEIIbin 55 accessions and tested for associations with grain quality andfunctional traits, to determine whether variation in the sequencesof these genes are associated with different starch phenotypes insorghum. This information may facilitate the development of SNPmarkers useful for the breeding and selection of suitable germ-plasm for different end uses in food, animal feeding and industrialapplications.

2. Experimental

2.1. Plant material

Seed material specifically selected for variation in endospermcolour and matrix type was obtained for 55 Plant Introductions(PI’s) from the USDA-ARS sorghum collection Southern RegionalPlant Introduction Station, Griffin (http://www.ars-grin.gov). Cata-logue information on each accession appears in Table 1. Of the 55accessions, 30 originated from Northeast Africa, 14 from West Afri-ca, four from China, three from India, two from Russia, one fromLebanon and one from the United States.

2.2. DNA extraction

Seed from each accession was germinated and grown for two tothree weeks. Leaf material from an individual plant was used foreach accession for genomic DNA extraction using the Qiagen 96-well mag-attract kit on the MWG Theonyx™ robotic platform.

2.3. Primer design

Primer pairs for both the PCR amplification and sequencing reac-tions were designed to amplify both coding and non-coding regions(Table 2). The sorghum sequence accessions used for primer designwere BAC clone (Genbank AF488412), GBSSI waxy gene (GenbankAF079258) and starch branching enzyme (SBEIIb) gene (GenbankAY304539.1 and AY304540.1). Rice sequence (AF419099) was usedto design soluble starch synthase IIa (SSIIa) gene primers. PrimerPremier (Version 3) software was used for primer design.

2.4. PCR amplification

PCR was performed in a 15-lL volume and contained 10 ng DNAtemplate, 0.2 mM each of dNTP, 1.5 mM MgCl2, 0.2 lM of each for-ward and reverse primer, 0.5 units Platinum� Taq DNA polymerase(Gibco BRL, Invitrogen, Carlsbad, CA) and 1X Gibco� reaction buffer(minus MgCl2). To improve specificity and efficiency of amplifica-tion, touchdown temperature cycles were designed according to

Don, Cox, Wainwright, Baker, and Mattick (1991). PCR cycling con-ditions were 94 �C for 3 min, 35 cycles of 94 �C for 30 s; annealingtemperatures ranged from 56–65 �C for 45 s, and 72 �C for 45 s anda final extension at 72 �C for 7 min (Table 2). All amplified productswere visualised on a 1.5% agarose gel with ethidium bromide.Amplified PCR products were purified before sequencing usingExoSAP-IT� (USB Corp., Cleveland, OH).

2.5. Sequencing and sequence alignment

Sequencing reactions were carried out using the ABI Big Dye Ter-minator v3.1 kit (Applied Biosystems, Foster City, CA) in both for-ward and reverse directions for each gene segment using 2–5 lL ofpurified product, 3.2 pmol primer, 1� Big Dye sequencing bufferand 0.5 Units Big Dye enzyme. Sequencing reactions used an initialdenaturation step of 96 �C for 2 min, followed by 30 cycles of 96 �Cfor 10 s, 50 �C for 5 s and 60 �C for 4 min. Purification of sequencedsamples was performed using a standard sodium acetate/ethanolprecipitation protocol. Sample sequencing was performed on anABI PRISM 3730 DNA sequencer (www.appliedbiosystems.com). Se-quences were edited and aligned using SEQUENCHER™ 4.5 Software(Gene Codes Corporation, Ann Arbor, MI).

2.6. Phenotypic analyses

2.6.1. Seed materialSeed from each accession was germinated and increased by

self-pollination under bags at SCU field plot in Lismore over the2005/2006 growing season. Several panicles/plant were bagged be-fore anthesis to prevent outcrossing; seeds were hand-harvestedon reaching maturity, threshed, and the grain stored at 4 �C priorto phenotypic analyses.

The measurements of thousand-kernel weight (TKW), seedlength and width, and milling yield appear in AppendixTable A.2. The sizes of sorghum grains were measured using2312 Grain Check (Foss Tecator, Denmark). The dimensions ofgrains were averaged over more than 100 measurements.

2.6.2. RVA analysesFlour gelatinisation properties were measured for 36 of 55

accessions using a Rapid Visco Analyser (Model RVA, Newport Sci-entific, Warriewood, Australia). A mixture of 4.0 g of flour and25 mL of deionised water was heated at 50 �C for 1 min, raised to95 �C in 3.7 min, held for 2.5 min, cooled to 50 �C in 3.8 min, andheld for 2 min. Stirring speed was 960 rpm for 10 s and 160 rpmfor the remainder of the test period. The RVA parameters measuredwere as follows. Peak viscosity – the highest viscosity during heat-ing; peak time – time taken to reach peak viscosity; holdingstrength – the lowest viscosity after cooling started; breakdown– peak viscosity minus holding strength; final viscosity – maxi-mum viscosity after the temperature had returned to 50 �C; set-back – final viscosity minus lowest viscosity; gelatinisationtemperature – temperature at which starch granules began toswell and gelatinise due to water uptake.

2.6.3. Chemical compositionThe composition of the sorghum grain was investigated in 36 of

55 accessions for total starch, protein, fat and dietary fibre content.Total starch was based on AACC International Approved Method76-13.01, fibre was measured based on the (enzymatic–gravimet-ric) AACC Method 32-21.01, crude protein content by AACCMethod 46-12.01-Kjeldahl and crude fat according to AACC Meth-od 30-10.01. The ratio of amylose/amylopectin was determined for54 of 55 accessions using the commercial Megazyme Kit(Megazyme International Ireland Ltd., Bray, Ireland) following themanufacturer’s instructions.

http://www.ars-grin.gov

http://www.appliedbiosystems.com

Table 1Catalogue information for 55 Plant Introductions (PI), local name, country of origin, kernel colour, pericarp colour, endosperm colour, endosperm matrix and endosperm type(GRIN database) and endosperm type (author’s iodine stain result).

Sorghumaccession

Plant ID Country oforigin

Kernelcolour

Pericarp colour Endospermcolour

Endospermmatrix

Endosperm type GRINdatabase

Endosperm typeiodine staina

PI 152611 Budy Kenya Yellow White Yellow Partly corneous Non-waxy Non-waxyPI 152853 Popping Corn Sudan Yellow White White Partly corneous Waxy Non-waxyPI 152904 Ndola Kenya White White Yellow Almost

corneousNon-waxy Non-waxy

PI 217683 Shidadia Sudan Red White White Partly corneous Non-waxy Non-waxyPI 221666 Bonkum

MumunaNigeria Red/

WhiteMixed/Lemonyellow

White Partly corneous Non-waxy Non-waxy

PI 250583 MN 4125 Egypt White Mixed/Lemonyellow

White Partly corneous Non-waxy Non-waxy

PI 266965 na Russia Brown Red White Almost starchy Non-waxy Non-waxyPI 267115 K-34 Russia Brown Red White Almost starchy Non-waxy Non-waxyPI 267431 IS 2748 India Brown Red White Completely


PI 267432 IS 2749 India Brown Red White Completelycorneous

Non-waxy Non-waxy

PI 452826 ETS 2174 Ethiopia Yellow White Yellow Almost starchy Non-waxy Non-waxyPI 453123 ETS 2318 Ethiopia Brown Red White Partly corneous Non-waxy Non-waxyPI 454889 ETS 3285 Ethiopia Brown Red White Partly corneous Non-waxy Non-waxyPI 454982 ETS 3334 Ethiopia Yellow Lemon yellow White Almost


PI 456597 ETS 4234 Ethiopia Yellow Lemon yellow White Almostcorneous

Non-waxy Non-waxy

PI 457363 ETS 4638 Ethiopia White White White Completelystarchy

Non-waxy Non-waxy

PI 457697 ETS 4813 Ethiopia White White Yellow Almost starchy Non-waxy Non-waxyPI 457725 ETS 4828 Ethiopia White White Yellow Almost


PI 457901 ETS 4934 Ethiopia Yellow Lemon yellow White Completelycorneous

Non-waxy Non-waxy

PI 513945 Sg. 4018 Benin Buff Lemon yellow White Partly corneous Waxy Non-waxyPI 525695 Kinto Oule Mali Yellow White White Completely


PI 562758 Basuto Red UnitedStates

Red Red White Partly corneous Waxy Waxy

PI 563576 LV 129 China White White White Completelycorneous

Waxy Waxy

PI 563656 L 1791B China Yellow Lemon yellow White Almostcorneous

Non-waxy Non-waxy

PI 563672 LR 2409 China White Red White Partly corneous Waxy Non-waxyPI 568293 SU 2477 Sudan White White White Partly corneous Waxy Non-waxyPI 568512 SU 2900 Sudan Yellow White Yellow Almost starchy Non-waxy Non-waxyPI 568772 MRV-192 Cameroon Yellow Lemon yellow White Completely

starchyNon-waxy Non-waxy

PI 569076 IS 19052 Sudan White White White Completelycorneous

Waxy Waxy

PI 569083 IS 19059 Sudan White White White Almost starchy Waxy WaxyPI 569119 IS 19095 Sudan White White White Almost starchy Waxy WaxyPI 569120 IS 19096 Sudan Yellow White White Partly corneous Waxy WaxyPI 569130 IS 19106 Sudan Yellow Lemon yellow White Almost starchy Waxy Non-waxyPI 569341 IS 19319 Sudan White White White Completely


PI 569385 IS 19364 Sudan White White White Partly corneous Waxy WaxyPI 569531 IS 19598 Sudan White White White Completely


PI 569697 Local Mugud Sudan Red Red White Partly corneous Waxy WaxyPI 569706 IS 21733 Sudan Yellow Lemon yellow White Almost

corneousWaxy Waxy

PI 570266 IS 23046 Sudan White Lemon yellow White Completelystarchy

Non-waxy Non-waxy

PI 585296 IS 24373 India White White White Partly corneous Non-waxy Non-waxyPI 585362 IS 24590 LebaNon White Lemon yellow White Completely


PI 585391 Yala Nigeria White White White Partly corneous Non-waxy Non-waxyPI 585422 Kaura Nigeria White White White Partly corneous Non-waxy Non-waxyPI 585507 IS 25199 Ethiopia White White White/Yellow Completely


PI 585740 Sobene Mali White White Yellow Completelycorneous

Non-waxy Non-waxy

PI 586115 IS 27305 Burkina Faso White White White Partly corneous Non-waxy Non-waxyPI 586406 Niki Sierra Leone White White White Completely

corneousWaxy Non-waxy

PI 586430 Sereketeh Sierra Leone White White White Completelycorneous

Non-waxy Non-waxy

(continued on next page)

H. Hill et al. / Food Chemistry 131 (2012) 175–183 177

Table 1 (continued)

Sorghumaccession

Plant ID Country oforigin

Kernelcolour

Pericarp colour Endospermcolour

Endospermmatrix

Endosperm type GRINdatabase

Endosperm typeiodine staina

PI 586532 IS 27938 China White White White Completelycorneous

Waxy Mixed

PI 608869 Djimbiri Mali White White White Completelycorneous

Non-waxy Non-waxy

PI 608998 Lakahiri Mali White White White Completelystarchy

Non-waxy Non-waxy

PI 609056 Doronko Mali White White White/Yellow Completelycorneous

Non-waxy Non-waxy

PI 609265 Cirad 29 Mali White White Lemonyellow

Almostcorneous

Non-waxy Non-waxy

PI 609733 Sota Mali White Lemon yellow White Almostcorneous

Non-waxy Non-waxy

PI 610134 Bimbiri Mali White White White Partly corneous Non-waxy Non-waxy

a Endosperm type iodine stain – in bold used for association test.

Table 2List of primer names, primer sequence, primer Tm, Genbank accession, amplicon position and PCR amplification conditions.

Primername

Primer sequence 50–30 Primerlength (bp)

PrimerTm (�C)

Genbank accession andamplicon position (bp)

PCR 1st stepa cycle No./annealing temp. (�C)

PCR 2nd step cycle No./annealing temp. (�C)

SSIIaF1 GGGTGGGTGGGGTTCCTCG 18 58 AF419099 (2250–2636) and na 32 cycles/55SSIIaR1 GTCAAGGCCAAGTACCAATGGTG 24 55 EU620718 (1813–2197)SSIIaF8 CATCATACGGGAGAACGACTGG 22 68 AF419099 (1880–2620) and 8 cycles 65–58 35 cycles/58SSIIaR9 GGTCTCTTCACCATTGGTACTTGG 24 72 EU620718 (1453–2189)GBSS1F CCCGCTACGACCAGTACAA 19 60 SBU23945 (1359–2144) and na 35 cycles/60GBSS1R GCAGACGAACACGACATCC 19 60 EF 89851.5 (1746–2531)GBSS15F GTGTGTTCATTGCACCACCCGCTGTT 26 66 SBU23945 (1584–2878) and 5 cycles/65–60 30 cycles/60GBSS17R GAGGCAAAGGCACTGAACAAGGAGG 25 63 EF 89851.5 (1971–3265)SBE1F CCGGATTTTGCTCGC 15 48 AY304539.1 (2805–3293)

and6 cycles/56–50 30 cycles/50

SBE2R GCAGGGAAGGGATGAGTG 18 58 EF089953.1 (300–788)SBE9F GACCTGCAACTCCTACCAT 19 58 AY304540.1 (1852–3065) 6 cycles/65–59 30 cycles/59SBE10R GTAGTGAAGTGCTCTGCTGC 20 62 EU388244 (1–784)

Tm – temperature of melting.a A two step PCR was used; the first step is a touchdown where the annealing temperature decreases by 1 �C per cycle in that range, followed by the second step at a

constant annealing temperature for that given range.


2.6.4. Iodine stainingThe presence or absence of amylose was determined for all 55

accessions by a simple iodine staining technique (Pedersen, Bean,Funnell, & Graybosch, 2004) and results appear in Table 1. Controlsfor waxy (S. bicolor cv. Basuto Red) and non-waxy (S. bicolor cv.LR2409) endosperm (Pedersen et al., 2004) were used.

2.6.5. Statistical analysesThe general linear model (GLM) was used in the analysis of

associations between SNP data and phenotypic data collected fromdifferent sources in the statistical software programme TASSELversion 2.0 (Yu et al., 2006b).

3. Results

3.1. Sequence variation

3.1.1. SSIIaA region of exon 8 of the SSIIa gene in rice is reportedly respon-

sible for low and high gelatinisation temperature in rice (Waters,Henry, Reinke, & Fitzgerald, 2006). In this study, the orthologousregion of exon 8 in sorghum was targeted to investigate associa-tions between SNPs and gelatinisation temperature in sorghum.Two primer pairs were used. The first, SSIIaF1/R1, amplified a321 base pair (bp) region of exon 8 in 51 of 55 accessions corre-sponding to positions 1939–2260 of Genbank accessionEU620718 (sorghum) and positions 2250–2636 of AF419099 (rice).This region had three polymorphic sites; all of which were synon-

ymous substitutions and resulted in three haplotypes. The haplo-type composition for each sorghum accession appears inAppendix Table A.1, whilst DNA polymorphisms for each SSIIa hap-lotype are reported in Appendix Table A.3a.

Primer pair SSIIaF8/R8 amplified a longer 754 bp product, corre-sponding to positions 1498–2252 of EU620718 and 1880–2643 ofAF419099. This primer pair incorporates the same 321 bp regionamplified by the SSIIaF1/R1 primers and an additional 433 bp of se-quence, however, since the primers were designed from rice se-quence, the genotype data is available for only 12 of 55accessions. Two additional SNP’s were found in this upstream re-gion (Appendix Table A.3b). At position 1610 of EU620718, a C/TSNP results in a threonine to isoleucine amino acid residue substi-tution at position 527 of protein sequence ACC86844.1. This altersthe amino acid hydropathy index from –0.7 to 4.5, changing from apolar to a non-polar residue in the active site of the enzyme.

A second C/T SNP, at position 2099 of EU620718 results in analanine to a valine amino acid substitution at residue position690 of translated protein sequence ACC86844.1. There was achange in the hydropathy index from 1.8 to 4.2, but no change inthe side chain properties of these residues which are both non-po-lar neutral. This SNP was found only in accession PI 586406, whichhad no phenotypic data, so was not useful for the associationanalysis.

3.1.2. SBEIIbFor SBEIIb, more than 2.8 kb were sequenced using two primer

pairs, SBE1F/2R and SBE9F/10R (Table 2), which correspond to Ae1


segment A and B, the equivalent gene regions of SBEIIb investi-gated by de Alencar Figueiredo et al. (2010) that were found tobe significantly associated with peak viscosity and other gelatinisa-tion properties. The first region amplified by primer pair SBE1F/2R,corresponds to Genbank EF89953 (positions 2804 to 3294), and in-cludes the 50UTR, exon 1 to intron 2. This region was highly vari-able with 20 polymorphic sites and results in 8 haplotypes(Appendix Tables A.1 and A.3c).

In total, there were 20 SNPs; with five SNPs and three indels lo-cated within non-coding and 15 SNPs in coding regions of SBEIIb,respectively. Of these 15 SNPs, seven caused synonymous aminoacid changes at positions 168, 309, 323, 329, 332, 383 and 386,whilst 8 were replacement substitutions at positions 120, 161,331, 336, 339, 373, 381 and 388. SNPs and amino acid substitutionsfor the gene segment amplified by primer SBE1F/2R are summa-rised in Appendix Table A.3c and A.3d, respectively.

The second SBEIIb gene region was amplified by primer pair SBE9F/10R, corresponding to positions 1–784 of Genbank accessionEU388244 including intron 19, exon 20 and intron 20. This784 bp region was highly variable with 60 polymorphic sites,including 33 SNPs, 11 indels and resulted in four haplotypes(Appendix Tables A.1 and A.3e). The majority of SNPs; 31 of 33,were found to be in the intronic regions. Two SNPs were withinthe coding region. The first SNP; A/C SNP 206 results in a putativealtered amino acid for H3; however, this is a heterozygous base,present in a single accession and, hence, is not useful for associa-tion analysis. The second SNP, A/C SNP 420, is a synonymous SNPwith no change in amino acid; however, it does explain a signifi-cant amount of the variation in fibre content, pericarp colour andamylose ratio.

3.1.3. GBSSIFor the GBSSI gene, primer pair GBSS15F/17R amplified a region

corresponding to 1584–2878 of SBU23945 and is of interest forelucidating starch phenotype association in the waxy gene. This re-gion was polymorphic with 15 SNPs, two indels (8 bp and 2 bp,respectively) and results in four main haplotypes and some hetero-zygous bases resulting in a total of seven haplotypes (Appendix Ta-bles A.1 and A.3f). Of the 15 SNPs 12 SNPs were within introns andthree SNPs were in exons, however, all were synonymous SNPswith no change in amino acids.

3.2. Physiochemical properties

The seed composition and physical parameters appear inAppendix Table A.2 and the range and mean in Table 3. Therewas a wide range of variation for all parameters measured andall have a normal distribution. Total starch content ranged from59% to 72.5% with a mean of 65.7%. For six of the nine waxy acces-sions, amylose content ranged from 16.1% to 19%, and the remain-ing three have higher measurements of 24.7%, 31% and 34%amylose, respectively. For the non-waxy accessions, 44 of 45 had

Table 3Range, mean and standard deviation in seed composition and physical parameters.

Trait Range Average SD

Amylose (%) 16.1–55.8 31.4 6.6Total starch (%) 59–72.5 65.7 3.5Protein (%) 10.4–19.3 14.3 1.9Fat (%) 1.4–4.6 2.7 0.6Crude fibre (%) 0.5–1.7 0.8 0.3TKW (g) 11.68–48.9 28.7 9.5Length (mm) 2.39–3.89 3.2 0.4Width (mm) 3.5–4.95 4.3 0.4Milling yield (%) 16.0–40.5 24.2 4.6

a range of 25.7% to 39.1% amylose, with only one having a highermeasurement of 55.8% amylose. Protein content varied from10.4% to 19.3%, with a mean of 14.3%. The fat content varied from1.4% to 4.6% with a mean of 2.7%. The fibre content varied from0.5% to 2.7%. The mean fibre content was 0.77% and only 2 acces-sions (PI 221666 and PI 266965) had greater than 1.5% fibre.TKW measured from 11.7 g to 48.9 g. In physical parameters, thelength and the width ranged from 2.39 mm to 3.92 mm and from3.5 mm to 4.95 mm, respectively. There was a strong positive cor-relation between the dimensions of the seed and TKW.

3.3. RVA properties

RVA viscosities and gelatinisation temperatures were highlyvariable amongst the sorghum accessions, reported in AppendixTable A.2 and the range and mean in Table 4. This included peakviscosity (257–523 RVU), final viscosity (205–641 RVU), setback(48–398 RVU), holding strength (157–261 RVU), breakdown(66.8–307 RVU), peak time (3.6–6.0 min) and gelatinisation tem-perature (71.9–93.6 �C). There were some significant differencesin RVA parameters between waxy and non-waxy sorghumstarches. Waxy accessions had the lowest average gelatinisationtemperature (77.3 �C) compared to the non-waxy accessions thatranged from 83–93.6 �C. Waxy starches had the lowest average fi-nal viscosity, 239 RVU, followed by non-waxy, 451 RVU, and highamylose, 621 RVU. The average setback for waxy starch was 68RVU, which is significantly lower compared to a range between231 and 276 RVU for non-waxy accessions. The average peak timewas lower in waxy accessions at 4.1 min compared to a range of 5.2to 5.77 min in non-waxy accessions.

Significant differences were found between some haplotypes ofthe starch genes in relation to gelatinisation temperature and allRVA measurements are reported in more detail in the associationtests section and Appendix Tables A.4a–4d.

3.4. Association tests

3.4.1. SSIIaThe exonic region investigated in SSIIaF1/R1 included three

polymorphisms (A/C SNP 21, A/G SNP 252 and A/T SNP 300) thatwere highly significantly associated with gelatinisation tempera-ture (p = 0.00025) and several other viscosity properties such assetback (p = 0.0016), peak time (p = 0.003), final viscosity(p = 0.0059) and breakdown (p = 0.015) (Table 5).

For A/G SNP 252 accessions possessing an ‘A’ base the averagegelatinisation temperature was 80.5 �C, whilst ones with a ‘G’ havea significantly higher average temperature of 89.5 �C. This A/G SNP252 alone accounts for 34% of the variation for this trait. For thegelatinisation properties, including setback, peak time, final viscos-ity and breakdown, the A/G SNP 252 explained more than 90% oftotal variation (Table 5).

These three SNPs classify the three haplotypes into high andlow gelatinisation temperature accessions. The low gelatinisation

Table 4Range, mean and standard deviation of viscosity traits.

Trait Range Average SD

Gelatinisation temp. (�C) 71.8–93.6 82 6.1Peak viscosity (RVU) 257–523 374 69.1Final viscosity (RVU) 205–641 395 117Breakdown (RVU) 66.8–307 167 56.2Holding strength (RVU) 157–261 207 30.3Setback (RVU) 48–398 188 97.3Peak time (min) 3.6–6.0 4.9 0.6

RVU – rapid viscosity unit.

Table 5Significant associations reported for each gene using the general linear model (GLM) in TASSEL.

Trait Gene/Primers Locus SNP p Value r2 Distinguishes Trait

Gelatinisation temperature SSIIa/F1/R1 252 A/G 0.00025 0.338 H2 and H3 High GTSetback SSIIa/F1/R1 252 A/G 0.0016 0.263 H2 and H3Peak time SSIIa/F1/R1 252 A/G 0.003 0.234 H2 and H3Final viscosity SSIIa/F1/R1 252 A/G 0.0059 0.208 H2 and H3TKW SSIIa/F1/R1 252 A/G 0.0129 0.168 H2 and H3 Decreased TKWBreakdown SSIIa/F1/R1 252 A/G 0.015 0.164 H2 and H3Gelatinisation temperature SSIIa/F1/R1 300 A/T 0.00093 0.286 H2 and H3Setback SSIIa/F1/R1 300 A/T 0.0023 0.249 H2 and H3Final viscosity SSIIa/F1/R1 300 A/T 0.0055 0.211 H2 and H3Peak time SSIIa/F1/R1 300 A/T 0.0088 0.19 H2 and H3TKW SSIIa/F1/R1 300 A/T 0.0088 0.185 H2 and H3Fibre content SBEIIb/1F/2R 388 A/G 0.004 0.2185 H5 and H7 High fibre contentFibre content SBEIIb/1F/2R 28a Hb 0.0173 0.1555 H6 High fibre contentGelatinisation temperature SBEIIb/1F/2R 28a Hb 0.0431 0.1182 H6Peak time SBEIIb/1F/2R 28a Hb 0.0437 0.1176 H6Setback SBEIIb/1F/2R 28a Hb 0.045 0.1163 H6Gelatinisation temperature SBEIIb/9F/10R 433 T/A 0.0026 0.2579 H4 High GT, high fat content, decreased TKWSetback SBEIIb/9F/10R 433 T/A 0.0157 0.174 H4Peak time SBEIIb/9F/10R 433 T/A 0.0252 0.1515 H4Final viscosity SBEIIb/9F/10R 433 T/A 0.0302 0.1427 H4Pericarp colour SBEIIb/9F/10R 420 A/C 0.005 0.158 H3 High fibre contentKernel colour SBEIIb/9F/10R 420 A/C 0.013 0.139 H3Fibre content SBEIIb/9F/10R 420 A/C 0.0245 0.1527 H3Amylose ratio SBEIIb/9F/10R 420 A/C 0.0276 0.1471 H3Total starch content GBSS/15F/17R 2425 A/G 0.0112 0.2591 H3 Higher total starch

TKW – thousand kernel weight.a Includes seven linked SNPs T/C 28, C/A 168, C/T 272, C/G 329, C/T 332, T/C 373 and G/T 381 that are associated with gelatinisation temperature and other viscosity traits.b Signifies a haplotype, where several SNPs are in linkage disequilibrium.


temperature sorghum had an average gelatinisation temperatureof 80.5 ± 4.3 �C and consisted of H1 (allele A/A/A; 39 accessions).The high gelatinisation temperature sorghum consisted of H2 (al-lele A/G/T; 10 accessions) with an average of 87.6 ± 7.4 �C and H3(allele C/G/T; three accessions) with an average of 91.5 ± 2.3 �C.

There was a significant difference in the relative grain composi-tion between the low and high gelatinisation temperature haplo-types. The high gelatinisation temperature haplotypes had anincreased amylose and fat content and a decrease in total starchcontent. The total seed weight of the high gelatinisation tempera-ture haplotypes was significantly reduced, being 18.9 g and 24 gfor H2 and H3 respectively, compared to 30.4 g for H1, the low gel-atinisation temperature haplotype (Appendix Table A.4a).

In regard to gelatinisation properties, SSIIa accessions belongingto H3 had the highest final viscosity, setback, holding strength andgelatinisation temperature. Conversely, H3 accessions had the low-est peak viscosity and very low breakdown (Appendix Table A.4a).

3.4.2. SBEIIbThe region amplified by SBE1F/2R was the most polymorphic

marker resulting in eight haplotypes. There were eight non-synon-ymous SNPs (Appendix Table A.3d), which have the potential to af-fect the phenotype, as seen in the seed composition andphysiochemical properties of the starch. In this 427 bp region ofexon 2 investigated, we found two linked polymorphisms (C/TSNP 383 and G/A SNP 388), which were significantly associatedwith fibre content (p = 0.004) accounting for 22% of variance in thistrait (Table 5) and which distinguish H5 and H7, which have ahigher mean fibre content of 0.95% and 1.05%, respectively.

G/A SNP 388 resulted in an amino acid change from a glycineresidue to aspartic acid residue at position 70 of protein sequenceAAP72267. This alternate amino acid residue changes from a non-polar neutral to a polar acidic residue with a change in hydropathyindex from –0.4 to –3.5 that may have an effect on the activity ofthe enzyme.

In this same region, seven linked SNPs at positions 28, 168, 272,329, 332, 373 and 381 were significantly associated with fibre con-tent (p = 0.0173), gelatinisation temperature (p = 0.043), peak time

(p = 0.044) and setback (p = 0.045) (Table 5). These SNPs define ahaplotype (H6), which was present in two accessions (PI 266965and PI 586115) that have a higher average fibre content of 1.2%compared to an average of 0.8% for the remaining accessions.Two of the six linked SNPs, T/C SNP 373 and G/T SNP 381 resultin two altered amino acids, valine to alanine and alanine to serineat amino acid positions 65 and 68 of the SBEIIb protein AAP72267,respectively.

For SBE9F/10R there was a significant association between T/ASNP 433 and gelatinisation temperature (p = 0.0026) and this SNPalone accounted for 26% of variance in this trait (Table 5). This T/A SNP 433 alone, distinguishes H4 accessions from the remainingaccessions. H4 accessions that possess an ‘A’ base (n = 5) have asubstantially higher average gelatinisation temperature of 91 �C,compared to accessions possessing a ‘T’ base (n = 34; haplotypes1–3) having a significantly lower average gelatinisation tempera-ture of 79 �C. This T/A SNP 433 is also associated with other gela-tinisation properties; setback (p = 0.016), r2 = 0.17; peak time(p = 0.025), r2 = 0.15; and final viscosity (p = 0.030), r2 = 0.14 asshown in Table 5.

The relative seed composition in H4 accessions, the high gela-tinisation temperature haplotype, differs significantly from theremaining accessions. The phenotype of H4 has an increased meanfat content of 3.4%, compared to 2.6% for H1–3 and is accompaniedby a decrease in average TKW of 23.5 g for H4 accessions, com-pared to an average of 30 g for H1–3, and a decrease in seed lengthof 2.95 mm for H4 accessions compared to an average of 3.28 mmfor the remaining haplotypes. However, there is no significantchange in the total starch content (Appendix A.4c).

Secondly, two linked polymorphisms, A/C SNP 420 and T/C SNP747, were significantly associated with pericarp colour (p = 0.005),kernel colour (p = 0.013), fibre content (p = 0.018) and amylose/amylopectin ratio (p = 0.027) (Table 5). These two linked SNPs dis-tinguish H3, which has a higher average fibre content of 0.94%,compared to an average of 0.70%, 0.72% and 0.75% for the remain-ing haplotypes (Appendix Table A.4c). H3 has an A/G SNP 206,which results in a putative amino acid change from a polar gluta-mine to a non-polar proline residue in the protein that may explain


the change in phenotype. However, this SNP was present in oneindividual only and is not useful in the association tests.

3.4.3. GBSSIThe region amplified by primers GBSS15F/17R was polymorphic

with 15 SNPs and two indels identified (Appendix Table A.4f).There was a significant association between A/G SNP 2425 and to-tal starch content (p = 0.0112) that alone accounts for 26% of thevariance in this trait. Accessions with the ‘A’ base (n = 22) had alower average total starch content of 64.5%, compared to 68% forthe accessions possessing the ‘G’ base (n = 3), which distinguishesH3 accessions. H3 accessions had an increase in total starch con-tent, a decreased protein content of 12.9% compared to 14.75% inthe remaining accessions, and slightly decreased amylose content(Appendix Table A.4d). This A/G SNP 2425 was in a non-coding re-gion of the GBSSI gene; however, it may be in linkage equilibriumwith some unidentified SNP that could result in an altered aminoacid that in turn explains the altered phenotype.

4. Discussion

The understanding of starch synthesis genes and starch accu-mulation in grain is of importance in cereal crop research and willhelp in the quest for bioengineering the desired starch propertiesfor specific end-use functions.

In this study, we found a wider range of gelatinisation temper-atures than previously reported in sorghum, varying from 71.9 �Cto 93.6 �C. This trait has enormous potential for various commer-cial uses. Gelatinisation temperature was similar, but more diverse,compared to 15 Indian sorghum cultivars that ranged from 77.0 �Cto 80.9 �C (Singh et al., 2010) and the lower temperatures of 69–70 �C reported for Zimbabwean sorghums (Beta, Corke, Rooney, &Taylor, 2001).

In this study, we report regions in two starch synthesis genes(SSIIa and SBEIIb) that were linked to significant differences in gel-atinisation temperature, grain weight and several viscosity traits(final viscosity, peak time and setback) in sorghum. In SSIIa, highand low gelatinisation temperature accessions differed by 8 �C,whilst in SBEIIb, primers SBE9F/10R could discriminate accessionsthat had a 12 �C difference in gelatinisation temperature and a re-gion of GBSSI is associated with differences in total starch content– all potential markers for quality traits.

Our results are consistent with previous association studies inmaize where Wilson, Whitt, Ibanez, Rocheford, and Goodman(2004) evaluated six candidate genes involved in maize kernelcomposition and found SBEIIb or Amylose extender (Ae1) andShrunken 2 (Sh2) to have significant association for starch pastingproperties and amylose content.

In sorghum, de Alencar Figueiredo et al. (2010) investigated fivegenes involved in starch synthesis and the Opaque 2 (O2) gene in-volved in protein storage. Significant associations were found inSh2, Bt2, Ae1, Wx and O2 with total kernel weight. Their Ae1 Aand B gene segments correspond to our SBE1F/2R and SBE9F/10Rprimer pairs; that investigated exon 1–2 and exon 20–22, respec-tively, studied in this report and their Ae1 loci (s241, s244 ands246) reported to have significant associations with peak gelatini-sation temperature (PGT) after correction for population structurecorrespond to SNPs (383, 386 and 388) reported in this study to beassociated with gelatinisation temperature. Hence, although thisstudy has used a general linear model, and not Model 2 (which cor-rected for population structure) or Model 3 (correcting for bothpopulation structure and kinship matrix), it supports our associa-tions in SBEIIb with grain quality traits.

The de Alencar Figueiredo et al. (2010) study did not evaluatethe SSIIa gene, shown by Umemoto et al. (2004) to be responsible

for variation in amylopectin chain length and gelatinisation tem-perature in rice. Umemoto et al. (2004) reported four haplotypesof the SSIIa gene, based on three functional SNPs; however, theseSNPs did not fully explain all of the variation in amylopectin chainlength and gelatinisation temperature. Subsequently, Waters et al.(2006), reported three SNPs in exon 8 of the SSIIa gene which cat-egorise the rice varieties into either high or low gelatinisation tem-perature types that differed by 8 �C.

Furthermore, previous studies have reported partial or com-plete knock-out of SSIIa activity, which results in SSIIa starch mu-tants in wheat with a high amylose content of 31–37% (Yamamori,Fujita, Hayakawa, Matsuki, & Yasui, 2000) and in barley with >70%amylose content (Morell et al., 2003). The starch granules hadabnormal morphology and altered crystallinity, with an increasein the proportion of amylopectin short chains with degree of poly-merisation (DP) 6–10 and a decrease in DP 11–25 chains (Yama-mori et al., 2000) and reduced gelatinisation temperature(Yamamori, Kato, Yui, & Kawasaki, 2006). These studies found thathigh amylose wheat contains 2.8% to 3.6% resistant starch (RS) andis of interest because RS provides positive impacts on bowel health,has glycaemic index lowering capacity and manages type II diabe-tes with potential health benefits (Regina et al., 2006).

Similarly for sorghum, there may be a partial knockout of SSIIaactivity that results in increased amylose and reduced amylopectinsynthesis, which is accompanied with a decrease in seed weight.The three SNPs reported were all synonymous substitutions, hencethere is no altered protein that could explain or underpin the traitassociations. However, in the longer SSIIaF8 region there is an up-stream C/T SNP 1610, which results in a threonine to isoleucineamino acid residue substitution of SSIIa enzyme. This alterationfrom a polar to a non-polar amino acid residue in the active siteof the SSIIa enzyme is an even more extreme change to that foundby Waters et al. (2006), underpinning the difference in gelatinisa-tion temperature in rice and suggests this highly functional regionin both rice and sorghum has occurred independently by humanselection. Due to limited sequence data, for only 12 of 55 acces-sions, we could not ascertain whether this SNP or some otherSNP in linkage disequilibrium may explain the association withgelatinisation temperature.

The high gelatinisation temperature phenotypes found in bothSSIIa (H3) and SBE9F/10R (H4) had subtle differences in their seedcomposition. However, both haplotypes had an increased amylosecontent, a decrease in total seed weight and both had the highestfinal viscosity, highest setback, and conversely had the lowest peakviscosity and low breakdown, which is consistent with that re-ported in high amylose mutant barley (Morell et al., 2003). In con-trast to that found in wheat and barley, our results show that thegelatinisation temperature of high amylose sorghums is increased,not reduced as found in barley and wheat.

A knock-out of SBEIIb activity results in high amylose (>70%)phenotypes in maize, which are reported to have higher gelatinisa-tion temperatures, due to longer amylopectin chain length thatdeveloped into larger, more crystalline regions, which requiredhigher temperatures to gelatinise (Song & Jane, 2000).

This suggests that in sorghum and maize, cereals with simplestarch granule morphology, knock-outs of both SSIIa and SBEIIb re-sult in an increased amylose content and increased gelatinisationtemperature; whereas in rice, wheat and barley, cereals possessingcomplex starch granule morphology, knockouts of SSIIa result inincreased amylose and decreased gelatinisation temperatures.

The SBE1F/2R region was highly diverse with eight amino acidchanges and two of these were significantly linked to differencesin fibre content. The possibility that the association of SBE9F/10Rwith pericarp and kernel colour is co-linked with an associationwith phenolics, flavonoid content and antioxidant activity is sup-ported by a recent report in rice (Shao et al., 2011).


The GBSSI gene surveyed found associations between SNPs andtotal starch content; however, it was not able to discriminate be-tween waxy and non-waxy accessions. Previously, two phenotypicclasses of waxy alleles were identified in sorghum characterised bythe absence (wxa) or presence (wxb) of the GBSSI protein in theendosperm (Pedersen, Bean, Graybosh, Park, & Tilley, 2005). Ham-blin, Salas Fernandez, Tuinstra, Rooney, and Kresovich (2007) pro-posed a G/T SNP in exon 8 of the GBSSI gene results in a changefrom glutamine to histidine at amino acid 268 of the GBSSI proteinas a candidate for the causative mutation underlying the waxyphenotype. Sattler et al. (2009) further investigated the waxy gene,proposing wxa had a large insertion in exon 3, whilst wxb had themissense mutation resulting in the glutamine to histidine. Ourstudy surveyed both waxy and non-waxy sorghum accessions,and all the accessions had a G in exon 8 at the position responsiblefor wxb, but sequence data from exon 3, which would confirm wxa

accessions, was unavailable.The 55 accessions were grouped into three categories: waxy,

non-waxy and high amylose, according to the author’s iodinestaining result, as well as the amylose content determination andcertain viscosity traits. Waxy sorghum had the lowest gelatinisa-tion temperature and highest peak viscosity, compared tonon-waxy and high amylose starch. Our results confirm previouslypublished reports from studies in wheat (Wickramasinghe, Miura,Yamauchi, & Noda, 2003) and sorghum (Sang et al., 2008), thatthere is a positive correlation found between amylose contentand final viscosity, peak time, setback and holding strength.Conversely, RVA peak viscosity and breakdown were negativelycorrelated with amylose content.

Our measurement of amylose content for waxy accessions ishigher than previously reported. Amylose content is measured bythe absorbance of amylose–iodine complex and has been the sub-ject of extensive investigation since it was first developed byMcCready and Hassid (1943). There have been several adaptationsof the iodine absorbance methods and other techniques, includingconcanavalin A, near infrared, differential scanning calorimetryand size-exclusion chromatography, have also been developed. Arecent review of some of these methodologies concluded thatamylose measurements were not consistent between methodolo-gies (Zhu, Jackson, Wehling, & Bhima, 2008) and that repeatabilitybetween laboratories was high, but reproducibility between labo-ratories was poor; all reported different amylose contents for thesame cultivars (Fitzgerald et al., 2009). For instance, two waxysamples ranged from 0–14% amylose and another sample 4–40%,highlighting the variation and some problems in measuringamylose contents (Fitzgerald et al., 2009).

In this study, 16 accessions were reported to be waxy accordingto catalogue data from the GRIN database (Table 1). Previously,classification was based on the subjective visual assessment ofendosperm fracture patterns. More recently, simple staining tech-niques have been developed to distinguish between waxy and non-waxy pollen and grain (Pedersen et al., 2004). Our results from theiodine staining suggest that nine of the 16 tested positive, stainingblue, and one was mixed for the presence of amylose (Table 1).When these misclassified accessions were reassigned from thewaxy endosperm type to the non-waxy type and the averageRVA parameters re-examined, the reclassified waxy sorghumshad lower peak viscosity, lower final viscosity, setback and holdingstrength than the original ‘‘waxy’’ accessions and better supportpreviously published findings.

5. Conclusions

The starches isolated from the diverse germplasm showed bothsubtle and significant differences in their chemical composition

and gelatinisation properties, indicating that they may beexploited for different food and industrial applications. The 12 �Cdifference found between the high and low gelatinisation temper-ature sorghum in particular has wide implications. In sorghum,selecting for the low gelatinisation temperature varieties, whichare potentially more digestible and thus provide more energy willhave an impact in the animal feed industries. In the biofuel indus-try, selecting low gelatinisation temperature sorghum varietieswill allow enzymatic hydrolysis processing at lower temperatures.

The high amylose starches identified have a high dietary fibrecontent and resistant starch, which are known to have potentialhealth benefits. High amylose starches having the property ofstrong gelling, are used in confectioneries, as thickeners, and formthick films that are flexible, transparent and are water resistant.Waxy sorghums have a lower final viscosity; form softer gels, havereduced retrogradation, improved freeze–thaw ability and are usedin the adhesives and paper industries (Slattery et al., 2000).

The starch industry mainly uses specialised high-amylose andwaxy maize for many industrial uses (Burrell, 2003). At presentthere are no waxy or high-amylose sorghum starches utilised, thusan opportunity exists to substitute sorghum, as a good alternativeto maize for industrial starch supply.

Sequence polymorphisms were found in all the starch genessurveyed and several SNPs in exonic regions were shown to be sig-nificantly associated with various grain quality traits. These SNPscould be developed into a multiplex or allele specific assay to pre-dict sorghum phenotype. This information has the potential to beapplied in plant breeding and varietal identification of sorghumfor food, animal feeding and industrial use.

Acknowledgements

This study was carried out as part of a PhD research projectfunded by Grain Foods CRC Ltd., Sydney, Australia. We thank DrHon Yun from BRI Australia Pty. Ltd., for the phenotypic analyses.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.foodchem.2011.08.057.

References

American Association of Cereal Chemists International. Approved Methods ofAnalysis, 11th Ed.

Ball, S., Guan, H. P., James, M., Myers, A., Keeling, P., Mouille, G., et al. (1996). Fromglycogen to amylopectin: A model for the biogenesis of the plant starch granule.Cell, 86(3), 349–352.

Beta, T., Corke, H., Rooney, L. W., & Taylor, J. R. (2001). Starch properties as affectedby sorghum grain chemistry. Journal of the Science of Food and Agriculture, 81(2),245–251.

Breseghello, F., & Sorrells, M. E. (2006). Association mapping of kernel size andmilling quality in wheat (Triticum aestivum L.) cultivars. Genetics, 172,1165–1177.

Burrell, M. M. (2003). Starch: The need for improved quality or quantity-anoverview. Journal of Experimental Botany, 54(382), 451–456.

Clarke, B., Liang, R., Morell, M., Bird, A., Jenkins, C., & Li, Z. (2008). Gene expression ina starch synthase IIa mutant of barley: Changes in the level of genetranscription and grain composition. Functional & Integrative Genomics, 8(3),211–221.

de Alencar Figueiredo, L., Sine, B., Chantereau, J., Mestres, C., Fliedel, G., Rami, J. F.,et al. (2010). Variability of grain quality in sorghum: association withpolymorphism in Sh2, Bt2, SssI, Ae1, Wx and O2. Theoretical and AppliedGenetics, 121(6), 1171–1185.

Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., & Mattick, J. S. (1991). ‘Touchdown’PCR to circumvent spurious priming during gene amplification. Nucleic AcidsResearch, 19(14), 4008.

Fitzgerald, M. A., Bergman, C. J., Resurreccion, A. P., Möller, J., Jimenez, R., Reinke, R.F., et al. (2009). Addressing the dilemmas of measuring amylose in rice. CerealChemistry, 86(5), 492–498.

Hamblin, M. T., Salas Fernandez, M. G., Tuinstra, M. R., Rooney, W. L., & Kresovich, S.(2007). Sequence variation at candidate loci in the starch metabolism pathway



in sorghum: Prospects for linkage disequilibrium mapping. Crop Science, 47,S125–S134.

Jane, J., Chen, Y. Y., Lee, L. F., McPherson, A. E., Wong, K. S., Radosavljevic, M., et al.(1999). Effects of amylopectin branch chain length and amylose content on thegelatinization and pasting properties of starch. The American Association ofCereal Chemists, 76(5), 629–637.

McCready, R. M., & Hassid, W. Z. (1943). The separation and quantitative estimationof amylose and amylopectin in potato starch. Journal of the American ChemicalSociety, 65(6), 1154–1157.

Morell, M. K., Kosar-Hashemi, B., Cmiel, M., Samuel, M. S., Chandler, P., Rahman, S.,et al. (2003). Barley sex 6 mutants lack starch synthase IIa activity and contain astarch with novel properties. The Plant Journal, 34(2), 173–185.

Pedersen, J. F., Bean, S. R., Funnell, D. L., & Graybosch, R. A. (2004). Rapid iodinestaining techniques for identifying the waxy phenotype in sorghum grain andwaxy genotype in sorghum pollen. Crop Science, 44(3), 764–767.

Pedersen, J. F., Bean, S. R., Graybosh, R. A., Park, S. H., & Tilley, M. (2005).Characterization of waxy grain sorghum lines in relation to granule-boundstarch synthase. Euphytica, 144, 151–156.

Ral, J. P., Cavanagh, C. R., Larroque, O., Regina, A., & Morell, M. K. (2008). Structuraland molecular basis of starch viscosity in hexaploid wheat. Journal ofAgricultural and Food Chemistry, 56(11), 4188–4197.

Regina, A., Bird, A., Topping, D., Bowden, S., Freeman, J., Barsby, T., et al. (2006).High-amylose wheat generated by RNA interference improves indices of large-bowel health in rats. Proceedings of the National Academy of Sciences of the UnitedStates of America, 103(10), 3546–3551.

Sang, Y., Bean, S., Seib, P. A., Pedersen, J., & Shi, Y.-C. (2008). Structure and functionalproperties of sorghum starches differing in amylose content. Journal ofAgricultural and Food Chemistry, 56(15), 6680–6685.

Sattler, S., Singh, J., Haas, E., Guo, L., Sarath, G., & Pedersen, J. (2009). Two distinctwaxy alleles impact the granule-bound starch synthase in sorghum. MolecularBreeding, 24(4), 349–359.

Shao, Y., Jin, L., Zhang, G., Lu, Y., Shen, Y., & Bao, J. (2011). Association mapping ofgrain color, phenolic content, flavonoid content and antioxidant capacity indehulled rice. Theoretical and Applied Genetics, 122(5), 1005–1016.

Singh, H., Sodhi, N. S., & Singh, N. (2010). Characterisation of starches separatedfrom sorghum cultivars grown in India. Food Chemistry, 119(1), 95–100.

Slattery, C. J., Kavakli, I. H., & Okita, T. W. (2000). Engineering starch for increasedquantity and quality. Trends in Plant Science, 5(7), 291–298.

Smith, A. (2001). The biosynthesis of starch granules. Biomacromolecules, 2,335–341.

Song, Y., & Jane, J. (2000). Characterization of barley starches of waxy, normal, andhigh amylose varieties. Carbohydrate Polymers, 41(4), 365–377.

Tang, M. C., & Copeland, L. (2007). Analysis of complexes between lipids and wheatstarch. Carbohydrate Polymers, 67(1), 80–85.

Umemoto, T., Aoki, N., Lin, H. X., Nakamura, Y., Inouchi, N., Sato, Y., et al. (2004).Natural variation in rice starch synthase IIa affects enzyme and starchproperties. Functional Plant Biology, 31(7), 671–684.

Wang, L., Liu, W., Xu, Y., He, Y., Luo, L., Xing, Y., et al. (2007). Genetic basis of 17traits and viscosity parameters characterizing the eating and cooking quality ofrice grain. Theoretical and Applied Genetics, 115(4), 463–476.

Waters, D. L. E., Henry, R. J., Reinke, R. F., & Fitzgerald, M. A. (2006). Gelatinizationtemperature of rice explained by polymorphisms in starch synthase. PlantBiotechnology Journal, 4(1), 115–122.

Wickramasinghe, H. A. M., Miura, H., Yamauchi, H., & Noda, T. (2003). Properties ofstarches from near-isogenic wheat lines with different wx protein deficiencies.Cereal Chemistry, 80(6), 662–666.

Wilson, L. M., Whitt, S. R., Ibanez, A. M., Rocheford, T. R., & Goodman, M. M. (2004).Dissection of maize kernel composition and starch production by candidategene association. The Plant Cell, 16, 2719–2733.

Xie, L., Chen, N., Duan, B., Zhu, Z., & Liao, X. (2008). Impact of proteins on pasting andcooking properties of waxy and non-waxy rice. Journal of Cereal Science, 47(2),372–379.

Yamamori, M., Fujita, S., Hayakawa, K., Matsuki, J., & Yasui, T. (2000). Geneticelimination of a starch granule protein, SGP-1, of wheat generates an alteredstarch with apparent high amylose. Theoretical and Applied Genetics, 101, 21–29.

Yamamori, M., Kato, M., Yui, M., & Kawasaki, M. (2006). Resistant starch and starchpasting properties of a starch synthase IIa-deficient wheat with apparent highamylose. Australian Journal of Agricultural Research, 57(5), 531–535.

Yu, J., & Buckler, a. E. S. (2006a). Genetic association mapping and genomeorganization of maize. Current Opinion in Biotechnology, 17, 155–160.

Yu, J., Pressoir, G., Briggs, W. H., Vroh Bi, I., Yamasaki, M., Doebley, J. F., et al. (2006b).A unified mixed-model method for association mapping that accounts formultiple levels of relatedness. Nature Genetics, 38(2), 203–208.

Zhu, T., Jackson, D. S., Wehling, R. L., & Bhima, G. (2008). Comparison of amylosedetermination methods and the development of a dual wavelength iodinebinding technique. Cereal Chemistry, 85(1), 51–58.

variation in sorghum starch synthesis genes associated with differences in starch phenotype

Documents