upskills: research data management for the sciences
DESCRIPTION
A 2 hour introductory session presented to PhD students at the University of Melbourne, 13 September 2012. Given by Steve Bennett (VeRSI) and Jeff Christiansen (ANDS).TRANSCRIPT
![Page 1: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/1.jpg)
10/04/2023 1
Research Data Planning ...for the Sciences
MSGR UpSkills ProgramJeff Christiansen & Steve Bennett
13 September 2012
![Page 2: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/2.jpg)
210/04/2023
Why data management What data Where you store it Who owns it How you manage it
Bonus: start work on a data management plan!
![Page 3: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/3.jpg)
Intro – who we are
Dr Jeff Christiansen [email protected]
Australian National Data ServicePreviously researcher in molecular genetics
Steve Bennett: [email protected]
Victorian e-Research Strategic InitiativeHelps researchers with systems for digital data
310/04/2023
![Page 4: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/4.jpg)
410/04/2023
Why data management What data Where you store it Who owns it How you manage it
![Page 5: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/5.jpg)
Becoming aware of data management in research BSc (Hons)
510/04/2023
Experiment 1
Experiment 2
?
![Page 6: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/6.jpg)
Becoming aware of data management in research PhD
10/04/2023
![Page 7: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/7.jpg)
Becoming aware of data management in research PhD
710/04/2023
CCACGCGTCCGGTGTGAGCTCTCCTTCAGCTGCTGCAGGCATTACACTCAGCTCTGCTGT CCAAGCTGCTCATGTGATTGCCCTCTAATCCATTCAGGCAAAGTGAGCTAGACTTGTTTA AGCTGCAGGTCTTATTTTGATTGTAGCAGGCTAGTGAACAGTCACAGAAGTGGTTCAAGT ATTGTGCCCCTTGGAGCTGTTATCTTTGAAAATGTGGCCGTGGCTGGAAAAGGATGCATC TGCACCAATGGCACAGTGACCAGCCAGTTGCTTAGGGGCTTAGCTGGTGGATTTGGACCT GTCTTCTGCAACCTGGGGAAAGCATAATCTACTGTGTTATTTGATAATGGAAGCGCCGTG ATCAGATCCATCCCTCTGCTTTGAATTTTCAAACAAATAATCAAGAATTTGGCTCGTGTT AAAAAAAAAAAAAAAA
![Page 8: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/8.jpg)
Becoming aware of data management in research PhD
810/04/2023
![Page 9: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/9.jpg)
Becoming aware of data management in research PhD
910/04/2023
CCACGCGTCCGGTGTGAGCTCTCCTTCAGCTGCTGCAGGCATTACACTCAGCTCTGCTGT CCAAGCTGCTCATGTGATTGCCCTCTAATCCATTCAGGCAAAGTGAGCTAGACTTGTTTA AGCTGCAGGTCTTATTTTGATTGTAGCAGGCTAGTGAACAGTCACAGAAGTGGTTCAAGT ATTGTGCCCCTTGGAGCTGTTATCTTTGAAAATGTGGCCGTGGCTGGAAAAGGATGCATC TGCACCAATGGCACAGTGACCAGCCAGTTGCTTAGGGGCTTAGCTGGTGGATTTGGACCT GTCTTCTGCAACCTGGGGAAAGCATAATCTACTGTGTTATTTGATAATGGAAGCGCCGTG ATCAGATCCATCCCTCTGCTTTGAATTTTCAAACAAATAATCAAGAATTTGGCTCGTGTT AAAAAAAAAAAAAAAA
![Page 10: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/10.jpg)
Becoming aware of data management in research PhD
1010/04/2023
CCACGCGTCCGGTGTGAGCTCTCCTTCAGCTGCTGCAGGCATTACACTCAGCTCTGCTGT CCAAGCTGCTCATGTGATTGCCCTCTAATCCATTCAGGCAAAGTGAGCTAGACTTGTTTA AGCTGCAGGTCTTATTTTGATTGTAGCAGGCTAGTGAACAGTCACAGAAGTGGTTCAAGT ATTGTGCCCCTTGGAGCTGTTATCTTTGAAAATGTGGCCGTGGCTGGAAAAGGATGCATC TGCACCAATGGCACAGTGACCAGCCAGTTGCTTAGGGGCTTAGCTGGTGGATTTGGACCT GTCTTCTGCAACCTGGGGAAAGCATAATCTACTGTGTTATTTGATAATGGAAGCGCCGTG ATCAGATCCATCCCTCTGCTTTGAATTTTCAAACAAATAATCAAGAATTTGGCTCGTGTT AAAAAAAAAAAAAAAA
![Page 11: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/11.jpg)
Becoming aware of data management in research PhD
1110/04/2023
CCACGCGTCCGGTGTGAGCTCTCCTTCAGCTGCTGCAGGCATTACACTCAGCTCTGCTGT CCAAGCTGCTCATGTGATTGCCCTCTAATCCATTCAGGCAAAGTGAGCTAGACTTGTTTA AGCTGCAGGTCTTATTTTGATTGTAGCAGGCTAGTGAACAGTCACAGAAGTGGTTCAAGT ATTGTGCCCCTTGGAGCTGTTATCTTTGAAAATGTGGCCGTGGCTGGAAAAGGATGCATC TGCACCAATGGCACAGTGACCAGCCAGTTGCTTAGGGGCTTAGCTGGTGGATTTGGACCT GTCTTCTGCAACCTGGGGAAAGCATAATCTACTGTGTTATTTGATAATGGAAGCGCCGTG ATCAGATCCATCCCTCTGCTTTGAATTTTCAAACAAATAATCAAGAATTTGGCTCGTGTT AAAAAAAAAAAAAAAA
![Page 12: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/12.jpg)
Becoming aware of data management in research PhD
1210/04/2023
CCACGCGTCCGGTGTGAGCTCTCCTTCAGCTGCTGCAGGCATTACACTCAGCTCTGCTGT CCAAGCTGCTCATGTGATTGCCCTCTAATCCATTCAGGCAAAGTGAGCTAGACTTGTTTA AGCTGCAGGTCTTATTTTGATTGTAGCAGGCTAGTGAACAGTCACAGAAGTGGTTCAAGT ATTGTGCCCCTTGGAGCTGTTATCTTTGAAAATGTGGCCGTGGCTGGAAAAGGATGCATC TGCACCAATGGCACAGTGACCAGCCAGTTGCTTAGGGGCTTAGCTGGTGGATTTGGACCT GTCTTCTGCAACCTGGGGAAAGCATAATCTACTGTGTTATTTGATAATGGAAGCGCCGTG ATCAGATCCATCCCTCTGCTTTGAATTTTCAAACAAATAATCAAGAATTTGGCTCGTGTT AAAAAAAAAAAAAAAA
![Page 13: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/13.jpg)
Becoming aware of data management in research Postdoc
![Page 14: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/14.jpg)
Becoming aware of data management in research EMAGE Database Project Manager
![Page 15: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/15.jpg)
Becoming aware of data management in research EMAGE Database Project Manager
![Page 16: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/16.jpg)
Becoming aware of data management in research EMAGE Database Project Manager
![Page 17: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/17.jpg)
Becoming aware of data management in research EMAGE Database Project Manager
![Page 18: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/18.jpg)
Becoming aware of data management in research EMAGE Database Project Manager Cross DB queries need to use appropriate descriptors, not just free text E.g. Gene name identifiers
![Page 19: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/19.jpg)
Becoming aware of data management in research Being organised, having systems in place and adopting
community standards are all helpful in data management.
Think about what you will be required to do when publishing.
There are obligations for having data available for others post publication.
It’s useful to have your data organised so you can collaborate with others easily.
What will happen to your data when you leave the lab? Your supervisor would like to know what’s what/where.
![Page 20: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/20.jpg)
Data Planning & ManagingMotivators
#1 Meet your obligations legal, ethical, funding requirements; uni, department, group policies Find out now – avoid hassle later (ask [email protected])
#2 Make your life easier a data management system to make your research work a data management plan to save time keeping data, finding stuff again, labelling, security sharing & collaborating
#3 Helping your career being a professional researcher data – your assets and records – finding, understanding data in years to come contributing to global research community manage your data now, help your future self.
2010/04/2023
![Page 21: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/21.jpg)
2110/04/2023
Why data management
What data Where you store it Who owns it How you manage it
Ask: [email protected]
![Page 22: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/22.jpg)
What is data?
Observational data Sensor readings, telemetry (non-reproducible)
Experimental data Gene sequences, chromatograms (reproducible,
but expensive)
Simulation data Climate models (model the most important thing)
Derived/compiled data Compiled database (reproducible but expensive)
2210/04/2023
![Page 23: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/23.jpg)
What else is data?
Social sciencesSurveys, statistical data
HumanitiesCultural artefacts (video, photos, sound…)
Physical samplesSoil, biological, water, archeological…
Does anyone here not have data?
2310/04/2023
![Page 24: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/24.jpg)
2410/04/2023
The University’s definitions
Research Data laboratory notebooks; field notebooks; primary research data (hardcopy or
in computer); questionnaires; audiotapes; videotapes; models; photographs;films; test responses; slides; artefacts; specimens; samples
Research Records Includes correspondence (electronic mail and paper-based correspondence);
project files; grant applications; ethics applications; technical reports; researchreports; master lists; signed consent forms; and information sheets for researchparticipants
Administrative Records (Research Office, Central Records) Includes contracts and agreements, patents, licences, grants, intellectual property
and trademarks, policies, ethics, research project files, reports, publications
What is often included as “Research Data”:= data + records + copies (physical & digital)
= stuff you used and/or created
![Page 25: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/25.jpg)
Group activity (15 mins)
Form groups of similar discipline Earth sciences/forestry/botany/agriculture Health/medical biology/physio/social work Engineering/computer science/linguistics
Discuss: What kind of data do you collect? How do you get it?
Your data management checklist: Section 1.1
2510/04/2023
Discu
ss
![Page 26: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/26.jpg)
2610/04/2023
Why data management What data
Where you store it Who owns it How you manage it
![Page 27: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/27.jpg)
2710/04/2023
Research trends
Research Data is increasing in size Protein crystallography100 GB/experiment Gene sequencing 1,000 GB/day High-energy physics 10,000,000s GB/year Astronomy (SKA) 1,000,000,000 GB/day
Research Collaborations are increasing Human Genome project (1990-2003)
113 people, 20 orgs
Belle collaboration (1994-..) ~370 people, 60 inst., 14 countries
ATLAS collaboration @ LHC CERN (1994-2020+) ~2500 people, 169 inst., 37 countries
Research Data is increasingly digital Wonderful opportunities for reuse,
sharing, collaboration, analysis Data science (4th paradigm) “eResearch”!
![Page 28: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/28.jpg)
2810/04/2023
Research trends
Large scale data intensive science “A totally new way of doing research” New research methods, new skills,
therefore new training needed
New skills... Specialists – in both technology and
research Informatics – dealing with data from
collection through analysis Data Management and Planning –
collecting, maintaining, sharing dataEveryone!
![Page 29: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/29.jpg)
How big?
2910/04/2023
1mb(spreadsheets)
10 Gb(numerical, video)
1Tb(simulations, synchrotron) 1Pb
Limit of Google Drive, DropBox…
Easy?(Probably already solved)
AwkwardEasy!
![Page 30: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/30.jpg)
3010/04/2023
Where to keep it?
Possibilities:Research group storage
Ask!
Local computer Backups crucial. Sharing hard. Disaster looms.
Cloud (Dropbox, Google Drive) Check security, legals. How to archive?
![Page 31: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/31.jpg)
Sharing
3110/04/2023
![Page 32: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/32.jpg)
3210/04/2023
![Page 33: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/33.jpg)
Group activity #2 (15 mins)
DiscussHow much data will you have?Where will you store it?What data formats?
Data management checklistComplete section 2.3 & 2.4 If non-digital: 2.1, 2.2
3310/04/2023
Discu
ss
![Page 34: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/34.jpg)
3410/04/2023
Why data management What data Where you store it
Who owns it How you manage it
![Page 35: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/35.jpg)
In collaborations, get IP right early. Find out:
Does the University own your data?Can you still share it?Restrictions?Licences?
3510/04/2023
![Page 36: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/36.jpg)
IP – who claims to own it Copyright – who has legal backing
(not all data can be copyright)
Ethics – more rules you agreed toMust you keep the data private?Must you share it?
Privacy – can you de-identify the data?
3610/04/2023
![Page 37: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/37.jpg)
Group activity #3 (15 mins)
DiscussWho owns your data?What data can you share? With whom?How will you protect confidential information?
Data management checklistComplete section 1.3
3710/04/2023
Discu
ss
![Page 38: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/38.jpg)
3810/04/2023
Why data management What data Where you store it Who owns it
How you manage it
![Page 39: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/39.jpg)
University Code of Conduct for Research
3910/04/2023
![Page 40: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/40.jpg)
University Policy on Management of Research Data and Records
4010/04/2023
![Page 41: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/41.jpg)
Starting your system
Consider your goals – what do you want to get out of managing your data?
Figure out your criteria for keeping data Picture your data three years from now Consider the metadata you want to collect
to document your datasets
4110/04/2023
![Page 42: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/42.jpg)
Benefits
Find your data 3 years from now Get more papers out of your data Save time and stress – get organised Share with collaborators Some journals require data submission
4210/04/2023
![Page 43: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/43.jpg)
4310/04/2023
Not rocket science! Stop and think about what data you have, what you’re doing, what you should be doing
Some scary facts: Microfilm, non-acidic paper last 100+ years magnetic media lasts 10+ years optical media lasts 20+ years 2-10% of hard drives fail every year software & hardware can outdate quickly
Scary stories: US study 100’s charges “research misconduct”
40% avoided by better data management! UniMelb ~20 cases research misconduct 2008.
Most involved students. All needed good records! Climategate scandal, UK – FOI
Proper Planning & Management is needed!!!
Being more professional...
Burroughs 1977 – B 9495Magnetic Tape Subsystem
![Page 44: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/44.jpg)
High level view
Your data management system needs to cover:
4410/04/2023
Create,Capture,Describe
(Use, Transform, Update)
Store, Secure, Preserve
Keep,Transfer,Destroy
(National Archives)
![Page 45: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/45.jpg)
A simple Data Man. System Identify key data in your context, important stuff to keep (your Data Assets) Find secure places to keep physical & digital Records + Data (filing cabinet, department shared
drive) – backups are essential Where and when should there be checks on your data (sanity checks, quality control, standards) File your data and records into logical divisions, say activities, projects, or pieces of work
eg. folders /DeptShare/johnsmith/Records/ProteinABC Investigation Don’t break things down too much, makes things harder to find!
Have a consistent file naming convention: perhaps: ActivityOrContents-LocationOrPerson-CreateDate-Id-Description.ext eg. “ProteinABC-LJW-20100409-0001 Raw data from instrument.dat”
Keep good metadata (notes, records) on how you captured your data, particularly for physical records
Descriptions of collections or files – Structured text files good enough eg. FileOrCollectionName-metadata.txt
On other things, entities that are not files – Structured text files or spreadsheets Have a good labeling/ID/coding system Perhaps keep a registry (spreadsheet will do; IDs, names, location, basic metadata)
Find the right balance in digitising physical stuff (easy and quick) Digital is easy to keep/transfer/search if stored properly. However, digitising/scanning everything can be
time consuming and without good descriptions may not be useful. Link digital notes/metadata to physical stuff (IDs, names, labels, codes, location) Have some basic digital representations or notes of important physical stuff 45
![Page 46: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/46.jpg)
Free Tools jEdit – text file editor (private notes, metadata and records) local disk + file share + Cobian Backup (private project records, data) Google Desktop (file and email search) Zotero (reference material) (EndNote is Uni default) EVO & Skype & Google chat (video/tele/chat communication)
http://evo.arcs.org.au/
Sakai@Melbourne (project workspace) https://sakai.unimelb.edu.au/
Google docs + Sites (collaborative editing) Google groups (email list)
research data storage, a tricky one… use local storage in preference, ask around DropBox, Google Drive, Microsoft SkyDrive, box.com…
too many others to list, heaps on the web… See Digital Research Tools (DiRT) wiki for a huge list
http://digitalresearchtools.pbworks.com/ Check with your supervisor,
4610/04/2023
see Info Skills classeson EndNote,
UpSkills 29 June on VC
![Page 47: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/47.jpg)
4710/04/2023
Data Security 2 aspects to security
Safety from damage or loss How important is the data to you?
Safety from incorrect use What are the possible consequences?
Safety from damage or loss (unintended and intentional)… What’s acceptable loss (safety can cost, use up time) Backups (data, software, system)
How often (hourly, daily, weekly, monthly, manually, automated)? How many and where (onsite, offsite, both, multiple)? Departmental storage? Probably backed up already!
Disaster Recovery Quality hardware, multiple/spare servers, spare disk drives, Operating System and Applications image backups
(talk with someone technical, your local IT guys)
![Page 48: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/48.jpg)
4810/04/2023
Data Security
Safety from damage or loss (continued)… Make sure Backup is occurring
Essential data and records... “Your Archive” Frequency should depend on how often your data changes Incremental backups are essential. Replication IS NOT SAFE!!! Keep some copies (one?) offsite. Database backups should use database tools (mysqldump, pg_dump etc.)
Departmental storage is best... probably backed up already! Worst case... DIY, use external hard drives or remote storage Seek advice on software
for Windows I use... Cobian Backup, DriveImage XML for Linux I use... rsync (see http://rsync.samba.org/examples.html ) for Mac there is... Time Machine
(talk with someone technical, your local IT guys)
![Page 49: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/49.jpg)
4910/04/2023
Data Security Safety from incorrect use (unintended and malicious)…
PCI DSS - a recommendation (Payment Card Industry Data Security Standard) eg. google for: “nacubo.org payment card data security” 12 requirements that are good practice (first 10 are the basics)
10 IT basics… Firewall servers Do not use default usernames/password Physically protected stored data (lock up servers, disk, tape, source material) Use encrypted transmission over internet (VPN, SSL, SSH, GridFTP, S/MIME email) Update antivirus/antimalware software regularly Use secure and trusted applications Restrict access to sensitive data (tighter control, or put it somewhere else) Assign unique IDs for each user Record and monitor all access to data
Plus some good practice… Don’t retain sensitive data Or encrypt sensitive information
![Page 50: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/50.jpg)
Read up!
Google: research data toolkit http://researchdata.unimelb.edu.au ANDS guides To consider: identifiers, DOIs, archival,
security, licensing, metadata formats, ontologies, controlled vocabularies, definition of “collection”, data reuse, metadata stores…!
5010/04/2023
![Page 51: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/51.jpg)
Group activity #4 (15 mins)
Data management checklistComplete section 3.1
5110/04/2023
Discu
ss
![Page 52: UpSkills: Research Data Management for the Sciences](https://reader035.vdocuments.site/reader035/viewer/2022070304/54ba99444a79596b1b8b4690/html5/thumbnails/52.jpg)
5210/04/2023
Questions?
researchdata.unimelb.edu.au
Copyright (c) 2012, VeRSI Consortium, Lyle Winton , Steve Bennett, Jeff Christiansen