up-regulationofthesirtuin1(sirt1)andperoxisome proliferator … · 2014. 10. 10. · id2 and id4...

Up-regulation of the Sirtuin 1 (Sirt1) and PeroxisomeProliferator-activated Receptor � Coactivator-1� (PGC-1�)Genes in White Adipose Tissue of Id1 Protein-deficient MiceIMPLICATIONS IN THE PROTECTION AGAINST DIET AND AGE-INDUCED GLUCOSEINTOLERANCE*

Received for publication, April 7, 2014, and in revised form, August 20, 2014 Published, JBC Papers in Press, September 4, 2014, DOI 10.1074/jbc.M114.571679

Ying Zhao‡1, Flora Ling‡§1, Timothy M. Griffin¶�, Ting He**, Rheal Towner**, Hong Ruan‡‡, and Xiao-Hong Sun‡§2

From the ‡Program in Immunobiology and Cancer Research, ¶Program in Free Radical Biology and Aging, and **AdvancedMagnetic Resonance Center, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma 73104, §Department of CellBiology and �Department of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, Oklahoma City,Oklahoma 73104, and ‡‡Department of Physiology and Biophysics, Rutgers University, Piscataway, New Jersey 08854

Background: Id1 is involved in diet-induced obesity by unknown mechanisms.Results: We show that Id1 ablation or ET2 expression protects the mice from obesity and glucose intolerance and stimulatesSirtuin1 and PGC-1� expression.Conclusion: E proteins control obesity by regulating the expression of regulators of energy metabolism.Significance: Sirt1 expression is for the first time linked to Id and E protein activities.

Id1, a helix-loop-helix (HLH) protein that inhibits the func-tion of basic HLH E protein transcription factors in lymphoidcells, has been implicated in diet- and age-induced obesity byunknown mechanisms. Here we show that Id1-deficient miceare resistant to a high fat diet- and age-induced obesity, asrevealed by reduced weight gain and body fat, increased lipidoxidation, attenuated hepatosteatosis, lower levels of lipid drop-lets in brown adipose tissue, and smaller white adipocytes after ahigh fat diet feeding or in aged animals. Id1 deficiency improvesglucose tolerance, lowers serum insulin levels, and reducesTNF� gene expression in white adipose tissue. Id1 deficiencyalso increased expression of Sirtuin 1 and peroxisome prolifera-tor-activated receptor � coactivator 1�, regulators of mitochon-drial biogenesis and energy expenditure, in the white adiposetissue. This effect was accompanied by the elevation of severalgenes encoding proteins involved in oxidative phosphorylationand fatty acid oxidation, such as cytochrome c, medium-chainacyl-CoA dehydrogenase, and adipocyte protein 2. Moreover,the phenotype for Id1 deficiency was similar to that of miceexpressing an E protein dominant-positive construct, ET2, sug-gesting that the balance between Id and E proteins plays a role inregulating lipid metabolism and insulin sensitivity.

Increased energy consumption along with decreased energyexpenditure has made obesity and obesity-related diseases aglobal epidemic (1). Obesity has been linked to an increased risk

in diabetes, cardiovascular disease, and cancer (2). Although anumber of systemic factors in the body can result in obesity, thedifferentiation and function of brown and white adipocytesthemselves play major roles in the fat content of an individual.Although brown adipose tissue is characterized by its thermo-genic and energy-burning properties, white adipose tissue isthought to store lipids and secrete inflammatory cytokines thatare harmful to tissues including the pancreatic islets (3–5). Thebrowning effect refers to the phenomenon in which white adi-pocytes adopt characteristics of brown fat cells such asincreased energy consumption (6). This has the potential to beexploited in the fight against obesity by increasing the utiliza-tion of excess lipids in white fat cells (7, 8).

Peroxisome proliferator-activated receptor � (PPAR�)3 is amember of the PPAR subfamily of nuclear receptors that het-erodimerizes with retinoid X receptor (RXR) to bind to DNA (9,10). PPAR� plays an important role in the differentiation ofadipocytes as well as in energy metabolism (11). PPAR� coacti-vator 1� (PGC-1�), although originally discovered as a cold-inducible protein in brown adipose tissue, functions as a masterregulator of mitochondrial biogenesis in different tissuesincluding skeletal muscle and fat (12). When ectopically pro-duced in white adipocytes, it increases the number of mito-chondria and activates the expression of some brown fat-spe-cific genes (13, 14). Conversely, adipocyte-specific ablation ofthe PGC-1� gene renders the mice insulin-resistant accompa-nied by a reduction in the expression of genes involved in ther-mogenesis and mitochondrial biogenesis (15).

Acetylation of PGC-1� inhibits its transcriptional activity,and Sirt1 is a protein lysine deacetylase responsible for remov-ing acetyl groups from PGC-1�, thereby activating the protein

* This work was supported, in whole or in part, by National Institutes of HealthGrant AI56129 (to X.-H. S.). This work was also supported by the OklahomaCenter for Adult Stem Cell Research.

1 Both authors contributed equally to this work.2 Holds the Lew and Myra Ward Chair in Biomedical Research. To whom cor-

respondence should be addressed: Xiao-Hong Sun, Oklahoma MedicalResearch Foundation, 825 NE 13th Street, Oklahoma City, OK 73104. Tel.:405-271-7103; Fax: 405-271-7128; E-mail: [email protected].

3 The abbreviations used are: PPAR�, peroxisome proliferator-activated receptor�; PGC-1�, PPAR� coactivator 1�; HFD, high fat diet; RER, respiratory exchangeratio; Sirt1, sirtuin 1.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 42, pp. 29112–29122, October 17, 2014© 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

29112 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 42 • OCTOBER 17, 2014

by guest on January 5, 2021http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(16). Because Sirt1 functions in an NAD�-dependent manner,it acts as a sensor for the cellular redox balance of NAD� andNADH�, which closely correlates with metabolic fluxes (17,18). Therefore, the regulation of PGC-1� activity by Sirt1directly connects metabolic perturbations with transcriptionalevents that impact mitochondrial biogenesis. Moreover, thePGC-1� gene is known to be positively auto-regulated such thatSirt1-mediated posttranslational activation of PGC-1� couldlead to an elevation of PGC-1� transcription (19).

Additional transcription factors have also been implicated inthe regulation of energy metabolism. For example, the four Idproteins, which contain the helix-loop-helix motif and inhibitthe function of E protein transcription factors (20, 21), havebeen shown to be expressed in adipocytes and involved indiverse aspects of adipose development and function (22–25).Although Id proteins are typically thought to play an inhibitoryrole in differentiation, studies have interestingly suggested thatId2 and Id4 have a role in promoting adipogenesis. In vitroinduction of adipogenesis in preadipocytes with the standardadipogenic mixture of dexamethasone, 3-isobutyl-1-methyl-xanthine, and insulin rapidly but transiently induces theexpression of Id2 and Id4 (23, 25), and knocking down Id2 orId4 leads to a decrease in triglyceride accumulation as meas-ured by Oil Red O staining. This is accompanied by a reductionin PPAR� and adipocyte protein 2 expression and, in Id4�/�

mice, a significant reduction in fat mass compared with litter-mate controls (23, 25). Id3, on the other hand, has been shownto inhibit the transcription of the adiponectin gene, whichencodes an adipocyte specific hormone whose levels areinversely correlated with obesity and insulin resistance and hasprotective effects against metabolic disorders (26). Id3 also pro-motes adipose tissue growth by facilitating angiogenesisthrough VEGF factor A expression (27).

Id1�/� mice have also been shown to have decreased bodyweight and fat mass (22). These mice maintained insulin sensi-tivity after a high fat diet (HFD) treatment and had increasedoxygen consumption and expression of thermogenic markerssuch as UCP1 and PGC1� in brown fat (22). This suggests thatthe difference in fat mass was due to an increase in energyexpenditure and thermogenesis. Intriguingly, Akerfeldt andLaybutt (28) reported that Id1 deficiency resulted in augmentedinsulin secretion and protection against HFD-induced glucoseintolerance without observing any difference between wild typeand Id1�/� mice in weight gain due to a high fat diet. Onepossible explanation of the discrepancy between these tworeports is the mixed genetic background of Id1�/� mice used inboth studies, which could result in variations in different mousecolonies. We have now examined the role of Id1 in energymetabolism by using a different strain of Id1 deficient mice onC57/BL6 background. More importantly, we have investigatedthe underlying molecular mechanisms.

Here we report that Id1 deficiency renders the animals resis-tant to diet- and age-induced obesity and glucose intolerance.One of the remarkable phenotypes of the Id1�/� mice is thesmaller size of visceral white adipocytes compared with wildtype controls after feeding with a high fat diet. This was corre-lated with a significant difference in the expression of genesinvolved in energy metabolism such as Sirt1 and PGC-1�. Fur-

thermore, by expressing an E protein gain-of-function mutantin adipocytes, we obtained evidence to suggest that elevation ofE protein function in adipocytes due to loss of Id1 contributesto the resistance to diet-induced obesity.

MATERIALS AND METHODS

Mice—C57BL/6J mice were originally purchased from TheJackson Laboratory (Bar Harbor, ME). Generation of theenhanced GFP knockin Id1 knock-out mice (Id1�/�) andROSA26-ET2 mice and their backcrossing onto the C57BL/6Jbackground were previously described (29, 30). Fabp4-cre micewere originally generated by the laboratory of Dr. R. Evans (SalkInstitute) (31). Mice were handled and experiments were con-ducted in accordance with pre-approved protocols by the Insti-tutional Animal Care and Use Committee and maintained inthe Laboratory Animal Research Center at the Oklahoma Med-ical Research Foundation.

HFD and Monitoring Weight Gain—Mice were maintainedon standard chow diet (PicoLab Rodent Diet 20, Labdiet, St.Louis, MO). Mice placed on a high or low fat diet (60% kcal fat;D12492 or 10% kcal fat, D12450B, Research Diets, New Bruns-wick, NJ) were switched from a regular diet at 8 weeks of ageand maintained on that diet for up to 4 months for Id1�/� miceand 2 months for Fabp4/ET2 mice. Food was given ad libitumfor all mice, and weight was measured weekly.

BrdU Labeling—Mice were switched to a HFD at the age of 8weeks, and 2 weeks later their drinking water was replaced witha 0.5 mg/ml BrdU plus 1% sucrose solution in water. Whiteadipose tissue was collected after 6 weeks of BrdU labeling andfixed in 10% neutral buffered formalin. Tissues were embeddedin paraffin and sectioned at 8 �m. Sections were incubated withprimary mouse anti-BrdU antibody (BD Pharmingen) andsecondary peroxidase-conjugated goat anti-mouse IgG anti-body (Jackson ImmunoResearch) followed by developmentwith a DAB kit (Vector Laboratories) and counterstainedwith hematoxylin.

In Vitro Adipocyte Differentiation—Brown preadipocyteswere isolated from 1-day-old pups adapted from a protocol ofthe Kahn and co-workers (32, 33). Briefly, the interscapularbrown fat pad was dissected out and minced with a razor bladein 500 �l of sterile PBS. The tissue pieces were digested with 1.5mg of collagenase type I in 1 ml of isolation buffer (0.123 M

NaCl, 5 mM KCl, 1.3 mM CaCl2, 5 mM glucose, 100 mM HEPES,and 4% BSA) while shaking at 300 cycles/min at 37 °C and vor-texed for 10 s every 5 min for 30 min. The solution was filteredthrough an 80-�m nylon mesh to remove large undigested tis-sue, and the cells were washed with culture medium to removethe collagenase. Cells were cultured overnight at 500,000cells/ml in a 37 °C incubator with 5% CO2. The following daythe adherent cells were gently washed once with DMEM andcontinued to culture for an additional 2 days. The cells werethen trypsinized and plated at 200,000 cells/ml and allowed toreach 100% confluency. Cells were held at this state for 2 daysthen induced with the standard adipogenic differentiationmixture consisting of 5 �g/ml insulin, 0.25 mM dexametha-sone, and 0.5 mM 3-isobutyl-1-methylxanthine (IBMX) inculture medium. Two days later the differentiation mediumwas removed, and culture medium with 5 �g/ml insulin was

Id1 Deficiency Leads to Up-regulation of Sirt1 and PGC-1�

OCTOBER 17, 2014 • VOLUME 289 • NUMBER 42 JOURNAL OF BIOLOGICAL CHEMISTRY 29113


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

added. Cells were cultured for a total of 8 –10 days to allowcomplete differentiation. The cells were stained with Oil Red O.

Glucose Tolerance Test—Cohorts of wild type and Id1-defi-cient mice at different ages on chow or a high fat diet werefasted for 16 h and then weighed. Base-line blood glucose wasmeasured by tail vein bleeding using a OneTouch glucosemeter. A single dose of glucose (0.8 g/kg body weight) wasadministered intraperitoneally, which was followed by sam-pling blood at different time points to measure blood glucose.

Serum Insulin Measurement—Blood was collected fromcohorts of mice of different genotypes after a 16-h fasting. Insu-lin levels were measured using a rat/mouse insulin ELISA kit(catalogue #EZRMI-13K, Millipore, Billerica, MA) according tothe manufacturer’s instruction.

RT-PCR Analyses—Tissues were homogenized in TRIzol(Invitrogen), and cDNA was synthesized with the Moloneymurine leukemia virus reverse transcriptase (Invitrogen). RT-PCR was performed on the ABI Prism 7500 (Applied Biosys-tems). Relative mRNA expression was determined using the��CT method with �-actin as an internal control. Primersequences are shown in Table 1.

Dual-energy X-ray Absorptiometry Analysis—Mice wereweighed immediately before the scan, and total body fat contentwas measured under anesthesia using a dual-energy x-ray absorp-tiometry system (Lunar PIXImus2, GE Lunar Corp., Madison,WI). This system uses software that has been reported to requireadditional modification to improve the accuracy of fat contentquantification (20), which was included in the current analysis.Percent body fat was measured as body fat content, excluding thehead, divided by total body mass.

Indirect Calorimetry—Energy expenditure was measured byindirect calorimetry in WT and Id1�/� mice fed either a chowdiet or a HFD. Animals were acclimated to the testing cages andmetabolic cabinet for 48 h before data collection with ad libi-tum access to food and water. After acclimation, oxygen con-sumption and carbon dioxide production were measured usinga multiple animal respirometry system (MARS) (Sable Systems,Las Vegas, NV). 10-min/animal averages were collected hourlyover a continuous 20-h period. The respiratory exchange ratio

was calculated as the ratio of the average carbon dioxide pro-duced to oxygen consumed over this time period. Energyexpenditure was calculated as described by Tschöp et al. (34)using the caloric equivalent of oxygen. Data were initially sub-divided into the light or dark phase time periods to evaluatepotential differences in metabolic responses associated withdifferent activity levels. Light and dark phase values were thenaveraged to report results. Rates of energy expenditure werenormalized to either total body mass or lean body mass asdetermined by dual-energy x-ray absorptiometry analysis.

Magnetic Resonance Imaging—Magnetic resonance imageswere acquired on a 7-tesla, 30-cm horizontal bore USR Brukersystem equipped with an AVANCE I console. A quadrature coilof 150-mm inner diameter and 266 mm in length matched andtuned to 300 MHz was used for pulse transmission and signaldetection. A RARE (rapid acquisition with relaxation enhance-ment) image sequence was used with a repetition time of 1300ms, an echo time of 15 ms, 25 contiguous horizontal slices of 1mm thickness, a 70 � 40-mm field of view, and a 384 � 256image matrix. Scans were acquired yielding a water-suppressedimage that provided contrast between adipose tissue regions andregions having a typically low fat content as previously described(35). A Mathematica (Version 6.0; Wolfram Research, Cham-paign, IL) notebook was developed to calculate the percentbody fat/mouse body volume (35). Average values are pre-sented as the mean � S.D., and a Student’s t test (two-tail) wasused to establish significance if the p value was �0.05.

RESULTS

Id1 Deficiency Protects the Mice from HFD-induced Obesityand Hepatosteatosis—We previously generated an Id1 knock-out mouse strain in which the Id1 gene was disrupted by theinsertion of the GFP coding sequence and backcrossed it ontothe C57BL/6 background (30). We noticed that these mice wereslightly smaller than their wild type littermates and followed upby monitoring the weight gain after feeding cohorts of mice adiet with 60% of the calories derived from fat. Two-month-oldmice were maintained on this diet and weighed weekly for 8weeks (Fig. 1A). Wild type mice gained weight at a significantly

TABLE 1RT-PCR primer listUCP3, uncoupling protein 3; MCAD, medium-chain acyl-CoA dehydrogenase; Cyt-c, cytochrome c; aP2, adipocyte protein 2; HSL, hormone-sensitive lipase; SCD1,stearoyl-CoA desaturase 1.

Target Forward Reverse

�-Actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGTTNF� CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAGaP2a GGCGTGACTTCCACAAGAGTTTA GCCTCTTCCTTTGGCTCATGPPAR�a CAAGAATACCAAAGTGCGATCAA GAGCTGGGTCTTTTCAGAATAATAAGPGC-1�a AACCACACCCACAGGATCAGA TCTTCGCTTTATTGCTCCATGAUCP3 CAACGGTTGTGAAGTTCCTG CTCTGTGCGCACCATAGTCAHSL CTGCTGACCATCAACCGAC CGATGGAGAGAGTCTGCAMCADa GCCAAGATCTATCAGATTTATGAAGGT AGCTATGATCAGCCTCTGAATTTGTPPAR�a ACAAGGCCTCAGGGTACCA 5’GCCGAAAGAAGCCCTTACAGCPT1bb ATCATGTATCGCCGCAAACT CCATCTGGTAGGAGCACATGGPDK4b CCGCTTAGTGAACACTCCTTC TCTACAAACTCTGACAGGGCTTTLXRab AGCGTCCATTCAGAGCAAGT CCCTTCTCAGTCTGCTCCACScd1b CCTCCTGCAAGCTCTACACC CAGCCGAGCCTTGTAAGTTCSirt1c GCTGACGACTTCGACGACG TCGGTCAACAGGAGGTTGTCTCyt-cd GCAAGCATAAGACTGGACCAAA TTGTTGGCATCTGTGTAAGAGAATC

a From Pan et al. (45).b From Kleiner et al. (15).c From Wang and Seed (46). PrimerBank ID: 9790229a1.d From Seale et al. Ref. 47.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

faster pace than Id1�/� mice. Although wild type mice were15% heavier than Id1-deficient mice at the beginning of thetreatment, they weighed �30% more 8 weeks later. In contrast,when the mice were put on a diet with 10% of calories generatedfrom fat, no significant difference in weight gain between wildtype and Id1�/� mice was observed (Fig. 1B).

Examination of these mice on HFD using magnetic reso-nance imaging revealed a significantly higher fat content in wildtype mice compared with Id1-deficient mice (Fig. 1C). Leanbody mass and whole body adiposity were also determined by

dual-energy x-ray absorptiometry before and after being fed aHFD (Fig. 1D). Before a HF diet we did not observe any differ-ences in lean body mass or percent body fat. In contrast, afterHFD feeding, both lean body mass and percent body fat werelower in Id1�/� mice compared with wild type controls (Fig.1D). The difference in body mass between wild type mice andId1�/� mice was primarily due to differences in body fat con-tent rather than lean body mass.

We next determined the effect of Id1 deficiency on energyexpenditure and the respiratory exchange ratio (RER). We

FIGURE 1. Id1 deficiency protects the mice from HFD-induced obesity. A, weight gain while on a HFD. Cohorts of male wild type (n 20) and Id1�/� (n 20) mice at the age of 8 weeks were switched from chow to HFD. The mice were weighed weekly. The statistical significance of weight difference at each timepoint was calculated using Student’s t test, and the p values were 10�4–10�9. Two-way analysis of variance (p � 0.0001) indicates a significant interactionbetween the genotype and duration of the diet. B, weight gain while on a 10% kcal fat diet. Cohorts of male wild type (n 5) and Id1�/� (n 5) mice at the ageof 8 weeks were switched from chow to the 10% kcal fat diet. The mice were weighed weekly. No statistical significance was found between the genotypes ateach time point. C, magnetic resonance imaging for global fat content of male WT and Id1�/� mice on a HFD for 8-weeks. The bar graph shows the average dataof the analyses of three mice for each genotype. Two-month-old chow-fed mice (7 mice per genotype) were analyzed by dual-energy x-ray absorptiometryanalyses (D) and indirect calorimetry (E) before and after being switched to a HFD for 8 weeks. Two-way analysis of variance indicates a significant effect of HFDon body composition, including body mass, lean body mass, and body fat (p � 0.0001 for each). HFD also reduced energy expenditure normalized to total bodymass (p � 0.0001), lean body mass (p 0.0188), and RER (p � 0.0001). Differences in body composition and indirect calorimetry measures between wild typeand Id1�/� mice before or after a HFD were determined by Fisher’s least significant difference test as indicated by p values on graphs.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

measured oxygen consumption and carbon dioxide productionin animals before and after 8 weeks of a HFD. Before a HFDfeeding there was no difference in energy expenditure regard-less of normalization to total or lean body mass (Fig. 1E). How-ever, we did observe a reduced RER in the Id1-deficient animals,which indicates an increase in fatty acid oxidation. After 8weeks of a HFD, energy expenditure was elevated in Id1-defi-cient mice compared with wild type mice if normalized to totalbody mass, but there was no difference if normalized to leantissue mass (Fig. 1E). RER was reduced in both WT and Id1-deficient animals after HF feeding as expected due to an overallincrease in lipid metabolism. Although there was no overalldifference in the RER between wild type and Id1-deficient ani-mals after HF feeding (Fig. 1E), there was a trend for a reducedRER in Id1�/� mice during periods of low activity when thelights were on in the room (p 0.06) (data not shown). Thesedata suggest that the protection against HFD-induced weightgain and fat gain in Id1-deficient mice is not due to a substantialincrease in metabolic rate. However, Id1 deficiency is associ-ated with increased fat oxidation.

Histological examination of the tissues from these miceshowed severe hepatosteatosis and accumulation of large lipiddroplets in the brown fat of wild type but not Id1-deficient mice(Fig. 2A). Interestingly, the size of white adipocytes in wild typemice was significantly larger than those in Id1�/� mice (Fig.2A). By counting the number of nuclei per field under themicroscope, we estimated that the size difference of these twostrains of mice was �2-fold (Fig. 2B). In contrast, continuousBrdU labeling for 8 weeks showed no difference in the percent-age of BrdU� cells, suggesting no alterations in the proliferativeproperties of adipocytes between wild type and Id1�/� mice(Fig. 2B). We have also evaluated the in vitro differentiation ofId1-deficient adipocyte precursors and found no defect in theircapability (Fig. 2C). Taken together, it appears that Id1 defi-ciency protects the mice from lipid accumulation in the liver aswell as brown and white adipose tissues. We have ruled out thepossibility that the Id1-deficient mice exhibit reduced foodintake or lipid absorption as determined by measuring fecallipid contents as well as increased physical activity (data notshown), thus suggesting an intrinsic alteration in metabolism.

FIGURE 2. Id1 deficiency prevents lipid accumulation in tissues after HFD feeding. A, H&E staining of paraffin-fixed sections of the indicated tissues of miceas described in Fig. 1C. B, detection of BrdU labeling in epididymal fat after the mice were maintained on HFD for 8 weeks and BrdU drinking water for 6 weeks.Adipocytes were visualized by a counterstain with hematoxylin. The graph on the left shows the average percentage of BrdU-labeled nuclei obtained bycounting three fields. The graph on the right presents the average number of nuclei per field (n 3) as an indication of the size of adipocytes. NS, not significant.C, representatives of in vitro differentiation culture as described under “Materials and Methods.”




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Id1 Deficiency Protects the Mice from HFD-induced GlucoseIntolerance—Obesity is one of the leading causes of type 2 dia-betes. We, therefore, performed glucose tolerance tests to eval-uate the ability of wild type and Id1-deficient mice to clearglucose from their blood stream after a peritoneal injection of ahigh dose of glucose. Cohorts of wild type and Id1-deficientmice were treated in parallel, and blood glucose was measuredat different time points after glucose administration. Althoughno significant differences in glucose tolerance were detectedbetween the two cohorts of mice on regular-fat diet, wild typemice fed a HFD for 8 weeks dramatically delayed the clearanceof glucose (Fig. 3A). In contrast, feeding Id1-deficient animalswith a HFD had significantly less impact on glucose tolerance(Fig. 3A).

Elevation of fasting insulin secretion due to a compensatoryeffort of the body to lower post-absorptive blood glucose hasbeen considered an indicator of diabetic conditions. Consistentwith the results of the glucose tolerance tests, we found that aHFD significantly increased the level of serum insulin in wildtype mice but had little effect on Id1�/� mice (Fig. 3B). As aresult, a dramatic difference in insulin level was observed whencomparing wild type and Id1-deficient mice after being on aHFD.

Increased production of TNF� by adipose tissues has alsobeen thought to contribute to diabetes (36). We, therefore,tested the mRNA expression of TNF� in visceral fat tissues ofaged-matched wild type and Id1�/� mice maintained on achow or HFD for 16 weeks. HFD led to an increase in the

FIGURE 3. Id1 deficiency protects the mice from HDF-induced glucose intolerance. A, glucose tolerance tests of male mice maintained on a chow or HFDfor 8 weeks. ***, p � 0.001; **, p � 0.01; *, p � 0.05. B, serum insulin levels. Serum was collected from mice fasted for 16 h. The graph shows the average levelsof five individual animals of each genotype. Statistical value from a Student’s t test is as indicated. C, TNF� mRNA levels. Total RNA was isolated from epididymalfat of male mice fed a chow or HFD for 16 weeks. Levels of transcripts were normalized against that of �-actin by calculating �CT. Expression levels relative tothat of WT on chow were determined by using the ��CT formula.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

expression of TNF� transcription in wild type but not Id1�/�

mice (Fig. 3C). As a result, HFD-fed wild type mice expressedsignificantly higher levels of TNF� than Id1-deficient mice. Wealso measured TNF� expression after an 8-week feeding withHFD and observed a similar trend of lower expression in theId1�/� tissue (data not shown). Together, these results suggestthat ablation of the Id1 gene protects the mice from diet-in-duced glucose intolerance and adipose tissue inflammation.

Id1 Deficiency Protects the Mice from Age-related WeightGain and Glucose Intolerance—Aging is one of the leading riskfactors for obesity and diabetes. To test if loss of Id1 couldprotect the animals from age-related obesity, we compared thebody weight of 16-month-old wild type and Id1�/� mice main-tained on a chow diet. Wild type male and female mice weighed24 and 21% more than Id1�/� mice, respectively (Fig. 4A). Fur-thermore, we dissected out epididymal white fat and subscap-ular brown fat tissues and found that these two tissues in wild

type mice were 3.5- and 5-fold heavier, respectively, than thosein Id1-deficient mice (Fig. 4B).

To test the glucose tolerance in aged animals, we usedcohorts 18-month-old wild type and Id1�/� male mice to mea-sure glucose clearance. Wild type mice exhibited a significantdelay in the removal of glucose from the blood in comparison toId1�/� mice. At 60 min after glucose administration, wild typemice cleared only �10% of the extra blood glucose, whereasId1�/� mice had already removed 70% of the extra blood glu-cose (Fig. 4B). Even at 120 min, blood glucose of wild type micedid not return to base line. Interestingly, the kinetics of glucoseclearance in aged Id1�/� mice was similar to that in young mice(Fig. 3A). Thus, we postulate that ablation of the Id1 gene pre-vented the accumulation of lipids in both white and brown adi-pose tissues, which in turn protected the animals from age-related glucose intolerance.

Id1 Deficiency Augments Expression of Genes Involved inEnergy Metabolism—To understand the mechanism wherebyId1 ablation protects the mice from obesity induced by HFDand aging, we examined the expression of a number of genesinvolved in energy metabolism in tissues known to express Id1.Among muscle, brown fat, and white fat, we found that geneexpression was the most significantly different in the white adi-pose tissue when comparing between wild type and Id1�/�

mice as well as between mice on chow and HFD. In particular,levels of Sirt1 and PGC-1�, two critical regulators of energymetabolism and mitochondrial biogenesis, were higher inId1�/� mice than wild type mice on either chow or HFD eventhough HFD caused a reduction in the expression of these genes(Fig. 5A). We next examined the white adipose tissue of20-month-old mice in comparison to mice that are 2 monthsold. Expression of Sirt1 and PGC-1� was also elevated inId1�/� mice compared with wild type mice, but aging did notlead to a reduction in the expression of the two genes (Fig. 5B).In brown adipose tissue, there was also a trend of higher Sirt1and PGC-1� levels in Id1�/� mice maintained on a chow diet orHFD, but the differences were statistically insignificant exceptfor PGC-1� on chow diet (Fig. 5C).

To determine if the elevation of these important regulators ofenergy metabolism correlates with effector genes involved infatty acid oxidation and lipid metabolism, we examined theexpression of a set of genes in the white adipocytes of HFD-fedanimals. We found significantly higher mRNA levels of cyto-chrome c (Cyt-c), medium-chain acyl-CoA dehydrogenase(MCAD), and adipocyte protein 2 (aP3) in Id1-deficient micethan those in the wild type controls (Fig. 6). In addition, severalgenes including uncoupling protein 3 (UCP3), hormone-sensi-tive lipase (HSL), and stearoyl-CoA desaturase 1 (SCD1) werealso expressed at higher levels in Id1�/� mice, but the differ-ences failed to reach statistical significance. Taken together,data from the gene expression analyses suggest that loss of Id1leads to increases in genes capable of promoting fatty acid oxi-dation, thus preventing lipid accumulation in white as well asbrown adipocytes.

Augmentation of E Protein Function in Adipose Tissues HasSimilar Effects as Id1 Deficiency—Id1 along with the other threeId proteins (Id2– 4) are best known for their ability to inhibit theDNA binding activity of the basic helix-loop-helix E proteins,

FIGURE 4. Id1 deficiency protects the mice from age-related obesity andglucose intolerance. A, average weight of cohorts (n 5) of 16-month-oldmice of each gender. B, average weight of indicated tissues dissected fromthe male mice described in A. C, glucose tolerance test of 18-month-old malemice. **, p � 0.01; *, p � 0.05.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

which include E12, E47, HEB, and E2-2, by forming het-erodimers that are incapable of binding to DNA (20, 21, 37).However, these Id proteins have also been shown to have Eprotein-independent functions (38, 39). To test if the effectsof Id1 ablation on obesity are mediated through inhibition of

E proteins, we monitored the weight gain of a mouse strain inwhich a dominant-positive variant of E47 called ET2 isexpressed from the ROSA26 locus (29). ET2 is a fusion proteinconsisting of the N-terminal portion of E47, which includes itstranscriptional activation domains, and the C-terminal portion

FIGURE 5. Up-regulation of Sirt1 and PGC-1� in Id1-deficient mice. Sirt1 and PGC-1� mRNA levels were measured using real-time RT-PCR along with thatof �-actin and analyzed as described for Fig. 3C. Total RNA were isolated from epididymal fat of age-matched male mice maintained on chow or HFD for 16weeks (A), epididymal fat of 2 or 20-month-old male mice (B), subscapular brown fat of age-matched male mice maintained on chow or HFD for 16 weeks (C).Each cohort contains 4 or 5 mice.

FIGURE 6. Expression of genes involved in lipid metabolism. Expression of the indicated genes was measured using real-time RT-PCR and total RNA isolatedfrom epididymal fat of male mice maintained on HFD for 16 weeks. aP2, adipocyte protein 2; Cyt-c, cytochrome c; UCP3, uncoupling protein 3; HSL, hormone-sensitive lipase; MCAD, medium-chain acyl-CoA dehydrogenase; SCD1, stearoyl-CoA desaturase 1; LXRa, liver X receptor alpha; PKD4, polycystic kidney disease4; CPT1b, carnitine palmitoyltransferase 1B.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

of Tal1/SCL, which harbors the basic helix-loop-helix motifcapable of dimerizing with E proteins and binding to E boxes,known to be recognized by E proteins. ET2 does not associatewith Id proteins and does not form homodimers so can onlyactivate transcription of E protein targets when bound toendogenous E proteins (Fig. 7A). Therefore, ET2 can competewith all Id proteins to interact with E proteins and restore thetranscriptional activity of E proteins.

To investigate if the effects of Id1 deficiency are, at least inpart intrinsic to adipocytes, we crossed our ROSA26-STOP-ET2 mice with transgenic mice in which the Cre recombinase isexpressed off the Fabp4 promoter (31), which was reported todrive gene expression preferentially in adipocytes (Fig. 7B).The body weight of ROSA-ET2 male mice with or withoutthe Cre transgene were monitored for weight gain on chowdiet up to 8 weeks after birth. A significant difference wasobserved between the Cre� and Cre� cohorts (Fig. 7C). Fur-thermore, when these 8-week-old mice were put on a HFD foran additional 8 weeks, ET2-expressing mice gained weight at asignificantly slower pace compared with controls (Fig. 7D).Autopsy also revealed a much smaller size of visceral fat tissuesin ET2-expressing mice (data not shown).

In addition, we have also examined Sirt1 and PGC-1�expression in white adipose tissue from two separate litters of

HFD-fed control and ET2-expressing mice (Fig. 7E). As seen inId1-deficient mice, expression of ET2 appeared to have led toan increase in the expression of both Sirt1 and PGC-1�. How-ever, due to the mixed genetic background of the Fabp4-Cremice, variations in the levels of gene expression were ratherlarge, and statistical significance could not be reached. Collec-tively, data obtained using the ET2-expressing mice are consis-tent with the idea that augmented E protein activity due to Id1ablation is likely involved in the decreases in fat accumulationin Id1-deficient mice through direct or indirect activation ofSirt1 and PGC-1� transcription.

DISCUSSION

Obesity is a complex pathophysiological condition that canbe influenced by a variety of factors that are related to thefunctions of the endocrine system, the liver, the digestivesystem, and the muscle as well as the metabolic states of adi-pocytes themselves. Using conventional Id1 knock-out mice onC57BL/6 background, we have shown that Id1 ablation protectsthe animals from age and HFD-induced obesity and glucoseintolerance. These results are consistent with those reported byKeller and co-workers (22) who studied Id1 knock-out mice ona mixed background between C57BL/6 and 129 strains. How-ever, the weight differences between wild type and Id1-defi-

FIGURE 7. Enhancing E protein activity has similar effects as Id1 deficiency. A, schematic diagram of the mechanism of action of the ET2 construct. ET2 isa fusion between the N terminus of E47 and the C terminus of Tal1and does not form homodimers but competes with Id proteins to pair with endogenous Eproteins. ET2 activates transcription of E protein target genes by binding to E box DNA sequences. B, induction of ET2 expression. ROSA26-ET2 is an inducibleknock-in allele. By crossing with Fabp4-Cre transgenic mice, the stop sequence is removed, and ET2 as well as GFP are expressed from the ROSA26 promoter.C, body weight of ROSA26-ET2 male mice with (Fabp4/ET2) and without (Control) the Fabp4-Cre transgene. Weight was determined weekly after weaning. D,body weight of the mice described in C subsequently maintained on HFD for an additional 8 weeks. Two-way analysis of variance (p � 0.0001) indicates asignificant interaction between the genotype and the diet and a significant effect of the genotypes on weight gain. E, Sirt1 and PGC-1� expression inepididymal fat of control and Fabp4/ET2 mice in two separate litters.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

cient mice we observed were not as dramatic as those found bythe Keller group, probably reflecting a variation in genetic back-grounds. Consistent with the results by the Keller group, wedetected a lower RER value in Id1�/� mice, which indicates anincreased utilization of lipids in these animals.

To determine if the effects of Id1 deficiency can be attributedto increased E protein activity in adipocytes, we generatedROSA26-ET2/Fabp4-Cre mice and found a dramatic reductionin body weight before and after HFD. This result suggests thatgain of E protein function indeed has similar effects as loss ofId1. However, because Fabp4-Cre-mediated induction of geneexpression has recently been shown to occur in a broader rangeof tissues than originally appreciated (please see the website ofThe Jackson Laboratory for details), we could not rule out theimpact of augmented E protein activity in other cell types onobesity.

Histological examination of tissues from HFD-fed wild typeand Id1-deficient mice revealed major differences in lipid accu-mulation in the liver, brown fat, and visceral white fat. BecauseId1 is expressed at an extremely low level in the liver, we rea-soned that the attenuated hepatosteatosis in Id1�/� miceunlikely reflect a primary effect of Id1 deficiency. We, therefore,focused on examination of gene expression in adipocytes andfound more dramatic differences in white adipose tissuesbetween wild type and Id1-deficient mice. Remarkably, levels ofSirt1 and PGC-1� were significantly higher in Id1�/� micemaintained on a chow or high-fat diet at ambient temperature.Because PGC-1� is known to be a crucial regulator of mito-chondrial biogenesis, increased levels of PGC-1� could have aprofound impact on energy metabolism such as fatty acid oxi-dation (11, 12). Sirt1 is an NAD�-dependent protein lysinedeacetylase that is capable of modifying acetylated PGC-1� andthus allows the protein to transcriptionally activate down-stream target genes (17, 40). Sirt1 ablation in adipocytes resultsin increased adiposity and metabolic dysfunction (41). Expres-sion of the PGC-1� gene has also been shown to be auto-regu-lated by itself (19). Therefore, Sirt1-mediated activation ofPGC-1� proteins could in turn lead to higher levels of PGC-1�transcripts, and this Sirt1-PGC-1� axis could play an importantrole in energy metabolism in the white adipose tissue. Althoughthe level of PGC-1� expression in white fat is �50-fold lowerthan that in brown fat, the much larger size of white adiposetissues compared with brown adipose tissues in the body couldstill have a significant impact on metabolism. Satyanarayana etal. (22) has shown that PGC-1� protein levels are significantlyelevated in brown adipocytes of Id1�/� mice. We also observeda significantly higher level of PGC-1� transcript in brown adi-pose tissue of Id1�/� mice fed a chow diet, suggesting thatincreased PGC-1� activity in brown fat can also contribute tothe attenuation of obesity.

We also found that Id1�/� mice exhibited elevated expres-sion of genes such as cytochrome c and medium-chain acyl-CoA dehydrogenase, involved in oxidative phosphorylationand fatty acid oxidation. Cytochrome c is an essential compo-nent of the respiratory electron transport chain in the mito-chondria and thus instrumental for nutrient breakdown andATP production. Medium-chain acyl-CoA dehydrogenase cat-alyzes the oxidation of medium-chain fatty acid in the mito-

chondria of adipocytes and promotes the utilization of lipids. Inaddition, Sirt1 has also been shown to stimulate free fatty acidrelease from white adipocytes through inhibition of PPAR�(42). These results are in line with our observation of a lowerRER value in Id1�/� mice, which indicates an increased con-sumption of lipids. Taken together, the alteration of geneexpression detected in the adipose tissues of Id1-deficient micecould provide at least partial explanations for the resistance todiet and age-induced obesity.

Furthermore, Id1-deficient white adipocytes have beenshown to express TNF� at a lower level after a 16-week HFD.Mechanistically, this finding is consistent with our previousobservations that overexpression of Id1 stimulates TNF�expression in T cells, whereas Id1 deficiency dampens systemicTNF� production induced by lipopolysaccharides (43, 44).However, we have not been able to detect a statistically signifi-cant difference in the levels of serum TNF� between wild typeand Id1�/� mice or those of TNF� mRNA at an earlier timepoint with the limited samples measured. Because the protec-tion from glucose intolerance by Id1 deficiency can be observedafter feeding a HFD for 8 weeks, this may not be caused by adecreased TNF� production by the adipose tissue. Alterna-tively, subtle differences in TNF� levels over time could par-tially contribute to the protection of Id1�/� mice from diet-induced insulin resistance.

Because loss of Id1 or gain of E protein function had similareffects, it is possible that increased expression of genes con-trolled by E proteins is responsible for the protection from obe-sity and its related disorders such as glucose intolerance. Itwould be very interesting to determine if Sirt1 or PGC-1� aredirectly controlled by E proteins. This line of investigationrequires the examination of E protein binding to the locus ofSirt1 or PGC-1� in white adipose tissues, which is extremelychallenging and beyond the scope of the current study. How-ever, a better understanding of the role of Id and E proteins inthe regulation of energy metabolism could provide new thera-peutic options to combat obesity and diabetes.

Acknowledgments—We thank Dr. Stanley Kosanke at the Universityof Oklahoma Health Sciences Center for the histology services, Dr.Lorin Olson for providing Fabp4-Cre transgenic mice, and JoannaHudson for technical assistance.

REFERENCES1. Finucane, M. M., Stevens, G. A., Cowan, M. J., Danaei, G., Lin, J. K., Pa-

ciorek, C. J., Singh, G. M., Gutierrez, H. R., Lu, Y., Bahalim, A. N., Farzad-far, F., Riley, L. M., and Ezzati, M. (2011) National, regional, and globaltrends in body-mass index since 1980: systematic analysis of health exam-ination surveys and epidemiological studies with 960 country-years and9.1 million participants. Lancet 377, 557–567

2. Malik, V. S., Willett, W. C., and Hu, F. B. (2013) Global obesity: trends, riskfactors, and policy implications. Nat. Rev. Endocrinol. 9, 13–27

3. Gesta, S., Tseng, Y. H., and Kahn, C. R. (2007) Developmental origin of fat:tracking obesity to its source. Cell 131, 242–256

4. Seale, P., Kajimura, S., and Spiegelman, B. M. (2009) Transcriptional con-trol of brown adipocyte development and physiological function: of miceand men. Genes Dev. 23, 788 –797

5. Biddinger, S. B., and Kahn, C. R. (2006) From mice to men: insights intothe insulin resistance syndromes. Annu. Rev. Physiol. 68, 123–158

6. Spiegelman, B. M. (2013) Banting Lecture 2012: Regulation of adipogen-




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

esis: toward new therapeutics for metabolic disease. Diabetes 62,1774 –1782

7. Harms, M., and Seale, P. (2013) Brown and beige fat: development, func-tion and therapeutic potential. Nat. Med. 19, 1252–1263

8. Langin, D. (2010) Recruitment of brown fat and conversion of white intobrown adipocytes: strategies to fight the metabolic complications of obe-sity? Biochim. Biophys. Acta 1801, 372–376

9. Rosen, E. D., Sarraf, P., Troy, A. E., Bradwin, G., Moore, K., Milstone, D. S.,Spiegelman, B. M., and Mortensen, R. M. (1999) PPAR � is required for thedifferentiation of adipose tissue in vivo and in vitro. Mol. Cell 4, 611– 617

10. Barak, Y., Nelson, M. C., Ong, E. S., Jones, Y. Z., Ruiz-Lozano, P., Chien,K. R., Koder, A., and Evans, R. M. (1999) PPAR� is required for placental,cardiac, and adipose tissue development. Mol. Cell 4, 585–595

11. Spiegelman, B. M., Puigserver, P., and Wu, Z. (2000) Regulation of adipo-genesis and energy balance by PPAR� and PGC-1. Int. J. Obes. Relat.Metab. Disord. 24, S8 –S10

12. Puigserver, P., and Spiegelman, B. M. (2003) Peroxisome proliferator-ac-tivated receptor-� coactivator 1� (PGC-1�): transcriptional coactivatorand metabolic regulator. Endocr. Rev. 24, 78 –90

13. Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M., and Spiegel-man, B. M. (1998) A cold-inducible coactivator of nuclear receptors linkedto adaptive thermogenesis. Cell 92, 829 – 839

14. Tiraby, C., Tavernier, G., Lefort, C., Larrouy, D., Bouillaud, F., Ricquier, D.,and Langin, D. (2003) Acquirement of brown fat cell features by humanwhite adipocytes. J. Biol. Chem. 278, 33370 –33376

15. Kleiner, S., Mepani, R. J., Laznik, D., Ye, L., Jurczak, M. J., Jornayvaz, F. R.,Estall, J. L., Chatterjee Bhowmick, D., Shulman, G. I., and Spiegelman,B. M. (2012) Development of insulin resistance in mice lacking PGC-1� inadipose tissues. Proc. Natl. Acad. Sci. U.S.A. 109, 9635–9640

16. Rodgers, J. T., Lerin, C., Haas, W., Gygi, S. P., Spiegelman, B. M., andPuigserver, P. (2005) Nutrient control of glucose homeostasis through acomplex of PGC-1� and SIRT1. Nature 434, 113–118

17. Yang, T., Fu, M., Pestell, R., and Sauve, A. A. (2006) SIRT1 and endocrinesignaling. Trends Endocrinol. Metab. 17, 186 –191

18. Houtkooper, R. H., Pirinen, E., and Auwerx, J. (2012) Sirtuins as regulatorsof metabolism and healthspan. Nat. Rev. Mol. Cell Biol. 13, 225–238

19. Handschin, C., Rhee, J., Lin, J., Tarr, P. T., and Spiegelman, B. M. (2003) Anautoregulatory loop controls peroxisome proliferator-activated receptor� coactivator 1� expression in muscle. Proc. Natl. Acad. Sci. U.S.A. 100,7111–7116

20. Sun, X. H. (2004) Multitasking of helix-loop-helix proteins in lymphopoi-esis. Adv. Immunol. 84, 43–77

21. Kee, B. L. (2009) E and ID proteins branch out. Nat. Rev. Immunol. 9,175–184

22. Satyanarayana, A., Klarmann, K. D., Gavrilova, O., and Keller, J. R. (2012)Ablation of the transcriptional regulator Id1 enhances energy expendi-ture, increases insulin sensitivity, and protects against age- and diet-in-duced insulin resistance, and hepatosteatosis. FASEB J. 26, 309 –323

23. Park, K. W., Waki, H., Villanueva, C. J., Monticelli, L. A., Hong, C., Kang,S., MacDougald, O. A., Goldrath, A. W., and Tontonoz, P. (2008) Inhibitorof DNA binding 2 is a small molecule-inducible modulator of peroxisomeproliferator-activated receptor-� expression and adipocyte differentia-tion. Mol. Endocrinol. 22, 2038 –2048

24. Moldes, M., Lasnier, F., Fève, B., Pairault, J., and Djian, P. (1997) Id3 pre-vents differentiation of preadipose cells. Mol. Cell Biol. 17, 1796 –1804

25. Murad, J. M., Place, C. S., Ran, C., Hekmatyar, S. K., Watson, N. P., Kaup-pinen, R. A., and Israel, M. A. (2010) Inhibitor of DNA binding 4 (ID4)regulation of adipocyte differentiation and adipose tissue formation inmice. J. Biol. Chem. 285, 24164 –24173

26. Doran, A. C., Meller, N., Cutchins, A., Deliri, H., Slayton, R. P., Oldham,S. N., Kim, J. B., Keller, S. R., and McNamara, C. A. (2008) The helix-loop-helix factors Id3 and E47 are novel regulators of adiponectin. Circ. Res.103, 624 – 634

27. Cutchins, A., Harmon, D. B., Kirby, J. L., Doran, A. C., Oldham, S. N.,Skaflen, M., Klibanov, A. L., Meller, N., Keller, S. R., Garmey, J., and Mc-

Namara, C. A. (2012) Inhibitor of differentiation-3 mediates high fat diet-induced visceral fat expansion. Arterioscler. Thromb. Vasc. Biol. 32,317–324

28. Akerfeldt, M. C., and Laybutt, D. R. (2011) Inhibition of Id1 augmentsinsulin secretion and protects against high-fat diet-induced glucose intol-erance. Diabetes 60, 2506 –2514

29. Cochrane, S. W., Zhao, Y., Welner, R. S., and Sun, X. H. (2009) Balancebetween Id and E proteins regulates myeloid versus lymphoid lineage de-cisions. Blood 113, 1016 –1026

30. Perry, S. S., Zhao, Y., Nie, L., Cochrane, S. W., Huang, Z., and Sun, X. H.(2007) Id1, but not Id3, directs long-term repopulating hematopoieticstem-cell maintenance. Blood 110, 2351–2360

31. He, W., Barak, Y., Hevener, A., Olson, P., Liao, D., Le, J., Nelson, M., Ong,E., Olefsky, J. M., and Evans, R. M. (2003) Adipose-specific peroxisomeproliferator-activated receptor � knockout causes insulin resistance in fatand liver but not in muscle. Proc. Natl. Acad. Sci. U.S.A. 100, 15712–15717

32. Fasshauer, M., Klein, J., Ueki, K., Kriauciunas, K. M., Benito, M., White,M. F., and Kahn, C. R. (2000) Essential role of insulin receptor substrate-2in insulin stimulation of Glut4 translocation and glucose uptake in brownadipocytes. J. Biol. Chem. 275, 25494 –25501

33. Fasshauer, M., Klein, J., Kriauciunas, K. M., Ueki, K., Benito, M., and Kahn,C. R. (2001) Essential role of insulin receptor substrate 1 in differentiationof brown adipocytes. Mol. Cell Biol. 21, 319 –329

34. Tschöp, M., Smiley, D. L., and Heiman, M. L. (2000) Ghrelin inducesadiposity in rodents. Nature 407, 908 –913

35. Garteiser, P., Doblas, S., Towner, R. A., and Griffin, T. M. (2013) Calibra-tion of a semi-automated segmenting method for quantification of adi-pose tissue compartments from magnetic resonance images of mice. Me-tabolism 62, 1686 –1695

36. Nieto-Vazquez, I., Fernández-Veledo, S., Krämer, D. K., Vila-Bedmar, R.,Garcia-Guerra, L., and Lorenzo, M. (2008) Insulin resistance associated toobesity: the link TNF-�. Arch. Physiol. Biochem. 114, 183–194

37. Ruzinova, M. B., and Benezra, R. (2003) Id proteins in development, cellcycle, and cancer. Trends Cell Biol. 13, 410 – 418

38. Zhang, X., Ling, M. T., Wang, Q., Lau, C. K., Leung, S. C., Lee, T. K.,Cheung, A. L., Wong, Y. C., and Wang, X. (2007) Identification of a novelinhibitor of differentiation-1 (ID-1) binding partner, caveolin-1, and itsrole in epithelial-mesenchymal transition and resistance to apoptosis inprostate cancer cells. J. Biol. Chem. 282, 33284 –33294

39. Peng, X., Wang, Y., Kolli, S., Deng, J., Li, L., Wang, Z., Raj, J. U., and Gou,D. (2012) Physical and functional interaction between the ID1 and p65 foractivation of NF-�B. Am. J. Physiol. Cell Physiol. 303, C267–C277

40. Li, X. (2013) SIRT1 and energy metabolism. Acta Biochim. Biophys. Sin.45, 51– 60

41. Chalkiadaki, A., and Guarente, L. (2012) High fat diet triggers inflamma-tion-induced cleavage of SIRT1 in adipose tissue to promote metabolicdysfunction. Cell Metab. 16, 180 –188

42. Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T.,Machado De Oliveira, R., Leid, M., McBurney, M. W., and Guarente, L.(2004) Sirt1 promotes fat mobilization in white adipocytes by repressingPPAR-�. Nature 429, 771–776

43. Yang, Y., Liou, H. C., and Sun, X. H. (2006) Id1 potentiates NF-�B activa-tion upon T cell receptor signaling. J. Biol. Chem. 281, 34989 –34996

44. Zhao, Y., Ling, F., Wang, H. C., and Sun, X. H. (2013) Chronic TLR sig-naling impairs the long-term repopulating potential of hematopoieticstem cells of wild type but not Id1 deficient mice. PLoS. ONE 8, e55552

45. Pan, D., Fujimoto, M., Lopes, A., Wang, Y. X. (2009) Twist-1 is a PPAR�-inducible, negative-feedback regulator of PGC-1� in brown fat metabo-lism. Cell 137, 73– 86

46. Wang, X., and Seed, B. (2003) A PCR primer bank for quantitative geneexpression analysis. Nucleic Acids Res. 31, e154

47. Seale, P., Bjork, B., Yang, W., Kajimura, S., Chin, S., Kuang, S., Scimè, A.,Devarakonda, S., Conroe, H. M., Erdjument-Bromage, H., Tempst, P.,Rudnicki, M. A., Beier, D. R., and Spiegelman, B. M. (2008) PRDM16controls a brown fat/skeletal muscle switch. Nature 454, 961–967




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Xiao-Hong SunYing Zhao, Flora Ling, Timothy M. Griffin, Ting He, Rheal Towner, Hong Ruan and

DIET AND AGE-INDUCED GLUCOSE INTOLERANCEProtein-deficient Mice: IMPLICATIONS IN THE PROTECTION AGAINST

) Genes in White Adipose Tissue of Id1α (PGC-1α Coactivator-1γReceptor Up-regulation of the Sirtuin 1 (Sirt1) and Peroxisome Proliferator-activated

doi: 10.1074/jbc.M114.571679 originally published online September 4, 20142014, 289:29112-29122.J. Biol. Chem.

10.1074/jbc.M114.571679Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/289/42/29112.full.html#ref-list-1

This article cites 47 references, 17 of which can be accessed free at


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M114.571679

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;289/42/29112&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/289/42/29112

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=289/42/29112&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/289/42/29112

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/289/42/29112.full.html#ref-list-1

http://www.jbc.org/

up-regulationofthesirtuin1(sirt1)andperoxisome proliferator … · 2014. 10. 10. · id2 and id4...

Documents