university of groningen antimicrobials of bacillus species ... · amylocyclicin b....

University of Groningen

Antimicrobials of Bacillus species: mining and engineeringZhao, Xin

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2016

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Zhao, X. (2016). Antimicrobials of Bacillus species: mining and engineering. [Groningen]: University ofGroningen.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 31-03-2019

https://www.rug.nl/research/portal/en/publications/antimicrobials-of-bacillus-species-mining-and-engineering(4225953d-19e0-421c-821d-b29d036522b3).html

Antimicrobials of Bacillus species: mining and engineering

Xin Zhao

Paranymphs

Maike Bartholomae Haojie Cao

The work described in this thesis was carried out in the Molecular Genetics group of the Groningen Biomolecular Sciences and Biotechnology Institute (Faculty of Mathematics and Natural Sciences, University of Groningen, The Netherlands) and School of Chemical Engineering and Technology (Tianjin University, China); and was financially supported by China Scholarship Council, China. Printing of this thesis was financially supported by the Graduate School of Science and the University of Groningen.

Cover design by Xin Zhao Page layout by Zhibo Li Printed by Ipskamp Drukkers ISBN: 978-90-367-9420-6 (Printed version) 978-90-367-9419-0 (Digital version)

Antimicrobials of Bacillus species: mining and engineering

PhD thesis

to obtain the degree of PhD at the University of Groningen on the authority of the

Rector Magnificus Prof. E. Sterken and in accordance with

the decision by the College of Deans.

This thesis will be defended in public on

Monday 12 December 2016 at 9:00 hours

by

Xin Zhao

born on 4 November 1989 in Tianjin, China

Supervisors

Prof. O.P. Kuipers Prof. Z. Zhou

Assessment committee

Prof. L. Dijkhuizen Prof. G.P. van Wezel Prof. G.N. Moll

CONTENTS

CHAPTER 1 General introduction 7

CHAPTER 2 Identification and classification of known and putative 41 antimicrobial compounds produced by a wide variety of Bacillales species

CHAPTER 3 Isolation and identification of antifungal peptides from 109 Bacillus BH072, a novel bacterium isolated from honey

CHAPTER 4 Complete genome sequence of Bacillus amyloliquefaciens 135 strain BH072 isolated from honey

CHAPTER 5 Production of class I and II hybrid lantibiotics using the 141 nisin modification machinery NisBTC together with GdmD in Lactococcus lactis

CHAPTER 6 Summary and discussion 173

ABBREVIATIONS 186

NEDERLANDSE SAMENVATTING 187

ACKNOWLEDGMENTS 191

PUBLICATIONS 195

7

Chapter 1

General introduction

Chapter 1

8

1. Antimicrobial compounds produced by Bacillus

Bacillus represents a genus of Gram-positive, rod-shaped bacteria with significant

biotechnological applications [1]. The potential of Bacillus species to secrete

various secondary metabolites with distinct capabilities to inhibit pathogens has

been known for more than 50 years. Many of these compounds have become

increasingly important for different biotechnological applications in food, medicine

and agriculture [2, 3]. The wide arsenal of antimicrobial substances known to be

produced by Bacillus strains includes ribosomally synthesized peptides and non-

ribosomally synthesized peptides (NRPs) and polyketides (PKs) [1, 4]. Notably,

they sometimes display a rather broad spectrum of inhibition, which may include

not only Gram-positive bacteria, but also Gram-negative bacteria, yeasts or fungi,

some of which are known to be pathogenic to humans and/or animals. Reported

examples of antimicrobial compounds produced by Bacillus are listed in Table 1

that describes their classification and bioactivity. Additionally, their biosynthetic

gene cluster distribution among Bacillus species is shown in Fig. 1.

1.1. Bacteriocins of Bacillus

Bacteriocins are ribosomally synthesized peptides or proteins showing

antimicrobial activity against other bacteria, mainly closely related species [5, 6].

There are 3 major classes of bacteriocins produced by Bacillus, including class I

small ribosomally produced and posttranslationally modified peptides (RiPPs) (less

than 10 kDa); class II unmodified linear bacteriocins; and class III large

antimicrobial proteins (larger than 10 kDa) [5, 7]. RiPPs encompass all the peptides

that undergo enzymatic modification during their biosynthesis, resulting in unusual

amino acids and structures (e.g. dehydrated residues, lanthionines, heterocycles,

head-to-tail linkage, glycosylation, lasso structures) that have pronounced impacts

on their properties [7-9]. Bacilli also produce several unmodified bacteriocins,

General Introduction

9

some of which are similar to the pediocin-like bacteriocins of the lactic acid

bacteria (LAB) [10, 11], while others are beyond that of LAB’s with completely

unrelated sequences [4].

1.2. NRPs and PKs of Bacillus

NRPs and PKs are synthesized by large multimodular synthetases known as non-

ribosomal peptide synthetases (NRPS), polyketide synthetases (PKS) or hybrid

NRPS/PKS, respectively, thus produced by elongation of activated monomers of

amino- and hydroxyl acid building blocks [12, 13]. Based on a recent whole

genome mining study, 88% of the Bacillales are estimated to harbor known or

putative gene clusters of NRPS, PKS or NRPS/PKS hybrid secondary metabolites,

indicating that Bacilli are a rich source of NRPs and PKs with significant

antimicrobial activity (Table 1).

NRPSs are organized in modules responsible for the incorporation of a specific L-

or D-amino acid, which consist of three main core domains: adenylation domain

(A), thiolation domain (T) and condensation domain (C) [14]. Besides these three

main domains, many NRPSs feature more specialized domains within modules that

allow diversified residue modifications leading to a broader range of bioactivities,

namely epimerization (E), methylation (M), oxidation (Ox), reduction (R),

formylation (F) and heterocyclization (Cy) [14, 15]. The PKS machinery also

comprises three core domains: the acyl transferase (AT), the acyl carrier protein

(ACP) and the ketosynthase (KS) [16]. Several compounds isolated from bacteria

are synthesized by NRPS/PKS hybrid synthetases. These metabolites are composed

of a polyketide backbone featuring incorporated amino acids in the case of a PKS-

NRPS hybrid or a peptidyl chain harboring a ketone group characteristic of a

NRPS-PKS hybrid [17].

Chapter 1

10


11

Fig. 1. Distribution of gene clusters of known antimicrobial compounds among

Bacillales. The phylogenetic tree was constructed by bi-directional BLAST all

proteins of all genome of 328 Bacillales strains (in Chapter 2) using Proteinortho

[68]; the newick tree was generated by p02tree and visualized using FigTree v1.4.3

(http://tree.bio.ed.ac.uk/software/figtree/). Gene clusters distribution of

antimicrobial compounds (listed in Table 1) among different Bacillales are

summarized into different classifications with different colors.

Table 1. Classification and target organism of antimicrobials produced by

Bacillus sp.

Class/Names Producers Target organism References

Bacteriocins (Class I: small RiPPs)

Subtilin Bacillus subtilis ATCC 6633 Gram-positive bacteria (e.g. Staphylococcus

aureus)

[18]

Ericin A/S B. subtilis A1/3 Gram-positive bacteria (e.g. S. aureus) [19]

Entianin B. subtilis subsp. spizizenii DSM

15029(T)

several Gram-positive bacteria (e.g. S. aureus) [20]

Subtilomycin B. subtilis strain MMA7 Gram-positive and Gram-negative pathogens,

as well as several pathogenic Candida species

(e.g. Bacillus cereus, Vibrio anguillarum)

[21]

Thuricin Bacillus thuringiensis serovar,

thuringiensis (HD-2)

several Gram-positive bacteria (e.g. Bacillus

polyxyma)

[22]

Paenicidin Paenibacillus polymyxa NRRL B-

30509

Gram-negative bacteria (e.g. Campylobacter

jejuni)

[23]

Clausin Bacillus clausii Gram-positive bacteria [24]

Geobacillin Geobacillus thermodenitrificans

NG80-2

Gram-positive bacteria (e.g. Streptococcus

dysgalactiae)

[25]

Mersacidin Bacillus sp. HIL Y-85,54728 Gram-positive bacteria (e.g. S. aureus) [26]

Amylolysin Bacillus amyloliquefaciens GA1 Gram-positive bacteria (e.g. Listeria

monocytogenes)

[27]

Pseudomycoici

din

Bacillus pseudomycoides DSM

12442

most Gram-positive bacteria (e.g. Micrococcus

luteus)

[28]

Cerecidins Bacillus cereus strain As 1.1846 most Gram-positive bacteria (e.g. vancomycin-

resistant Enterococcus faecalis)

[29]

http://tree.bio.ed.ac.uk/software/figtree/

Chapter 1

12

Lichenicidin Bacillus licheniformis ATCC

14580

L. monocytogenes, methicillin-resistant S.

aureus, and vancomycin-resistant Enterococcus

strains

[30]

Haloduracin Bacillus halodurans C-125 most Gram-positive bacteria (e.g. L.

monocytogenes)

[31]

Amylocyclicin B. amyloliquefaciens FZB42 Gram-positive bacteria (e.g. B. subtilis) [32]

Subtilosin A B. subtilis 168 several Gram-positive bacteria (e.g.

Enterococcus faecium)

[33]

Plantazolicin B. amyloliquefaciens FZB42 Bacillus [34]

Thiocillin B. cereus ATCC 14579 B. subtilis, methicillin-resistant S. aureus [35]

Sublancin 168 B. subtilis 168 Gram-positive bacteria [36]

Bacteriocins (Class II: unmodified peptides)

Coagulin Bacillus coagulans I4 Enterococcus, Leuconostoc, Oenococcus,

Listeria and Pediococcus

[10]

Lichenin B. licheniformis 26 L-10/3RA Streptococcus bovis, Ruminococcus

flavefaciens and Eubacterium ruminantium

[37]

Cerein B. cereus 8A Gram-positive and Gram-negative bacteria (e.g.

L. monocytogenes and Escherichia coli)

[38]

Bacteriocins (Class III: large antimicrobial proteins)

Megacins B. megaterium ATCC 19213 B. megaterium [39]

NRPs

Surfactins B. subtilis, B. amyloliquefaciens Antibacterial, antiviral, antifungal, anti-

mycoplasma and hemolytic activities

[40]

Iturins B. subtilis, B. amyloliquefaciens pathogenic yeasts and fungi; but their

antibacterial activities are restricted to some

bacteria such as M. luteus

[41]

Fengycins B. subtilis, B. amyloliquefaciens Antifungal activity [42]

Kustakins B. thuringiensis Antifungal activities against Stachybotrys

charatum

[43]

Cerexins B. cereus Gram-postive bacteria (e.g. S. aureus) [44]

Locillomycins B. subtilis 916 Antibacterial and antiviral activities [45]

Polymyxins Paenibacillus polymyxa Gram-positive and Gram-negative bacteria [46]

Fusaricidins P. polymyxa Antifungal activity against Fusarium

oxysporum , Aspergillus niger, Aspergillus

oryzae, Penicillium thomii, Candida albicans

and Saccharomyces cerevisiae, Leptosphaeria

maculans, and also active against some bacteria

(e.g. S. aureus)

[47]


13

Tridecaptins P. polymyxa Gram-positive and Gram-negative bacteria [48]

Bacilysin B.subtilis S. aureus [49]

Bacitracin B. subtilis Gram-positive and Gram-negative bacteria [50]

Rhizocticins B. subtilis ATCC6633 Antifungal activity [51]

Paenibacterin Paenibacillus OSY-SE Gram-positive and Gram-negative bacteria [52]

Sevadicin Paenibacillus larvae Bacillus [53]

Gramicidin S Brevisbacilllus brevis Antibacterial and antifungal activities [54]

Tyrocidine B. brevis Gram-positive bacteria and toxic toward human

blood and reproductive cells

[55]

Polypeptin Bacillus circulans Gram-positive and Gram-negative bacteria [56]

Pelgipeptins Paenibacillus elgii B69 Gram-positive, Gram-negative bacteria and

some fungi like Candida albicans

[57]

Octapeptins Bacillus and Paenibacillus spp. Gram-positive, Gram-negative bacteria,

filamentous fungi, protozoa and yeasts.

[58]

Gavaserin P. polymyxa bacteria and fungi [59]

Saltavalin P. polymyxa bacteria and fungi [59]

PKs

Bacillaene B. subtilis human pathogens such as Serratia marcescens,

Klebsiella pneumoniae and S. aureus

[60]

Difficidin B. subtilis Gram-positive and Gram-negative bacteria [61]

Macrolactin B. amyloliquefaciens Selective antibacterial activities, inhibit B16-

F10 murine melanoma cancer cells and

mammalian Herpes simplex viruses, protect

lymphoblast cells against HIV by inhibiting

virus replication

[62]

Paenimacrolidi

n

Paenibacillus sp. F6-B70 methicillin-resistant S. aureus [63]

Basiliskamides Brevibacillus laterosporus C. albicans and Aspergillus fumigatus [64]

NRPS/PKS hybrid synthesized compounds

Paenilarvins P. larvae Antifungal activity [65]

Zwittermicin A B. cereus Gram-positive, Gram-negative, and eukaryotic

microorganisms

[66]

Paenilamicin P. larvae Antibacterial and antifungal activities [67]

Chapter 1

14

2. Genome mining: Prediction of antimicrobial

compounds

The constant increase of multi-drug resistant pathogenic microorganisms stimulates

more than ever the effort to identify and develop new antimicrobial compounds

[69]. Isolation and screening of microorganisms from natural sources have always

been powerful means to obtain useful and genetically-stable strains for industrially-

important antimicrobial products [70]. The development of genomics, particularly

high-throughput sequencing and effective in silico mining methods of the most

promising targets within genomes, allows the fast identification and

characterization of putative antimicrobial genes and has created new opportunities

for antibiotic discovery. Various powerful genome mining tools and extensive

databases have been created [71, 72]. Here, we describe 2 relevant automatic

genomic identification and prediction tools, i.e. BAGEL3

(http://bagel.molgenrug.nl/) and antiSMASH (http://antismash.secondary

metabolites.org/) (Table 2).

2.1. BAGEL3

BAGEL3 (http://bagel.molgenrug.nl/) is a versatile fast genome-mining tool

targeted to identify not only modified- and non-modified bacteriocins, but also

non-bactericidal ribosomally produced compounds and RiPPs with corresponding

databases [72, 73]. Each database contains all the records belonging to one of the

three classes of proteins being core to BAGEL3: Class I contains RiPPs of less than

10 kDa, which currently is divided into more than 12 supported subclasses; Class II

contains unmodified peptides not fitting the criteria of the first database; Class III

contains antimicrobial proteins larger than 10 kDa. BAGEL3 uses DNA nucleotide

sequences in FASTA format as input; multiple sequence entries per file are

allowed. The input DNA sequences are analyzed in parallel via two different

http://bagel.molgenrug.nl/



15

approaches; one is the context of bacteriocin- or RiPP gene-based mining, the other

is precursor (structural gene)-based mining directly by Glimmer, which increases

the success rate and lowers the need for manual evaluation of results. The output is

visualized in an html page, by a Table of putative bacteriocins or modified peptides

classified into the detailed bacteriocin class found in the mining sequence; graphics

of gene clusters; annotation of each ORF in the context; as well as detailed

information of putative bacteriocins, such as BLAST hits in the bacteriocin

database, or the pI (Isoelectric point) value.

2.2. antiSMASH

antiSMASH (http://antismash.secondarymetabolites.org) is another web server and

stand-alone tool for the automatic genomic identification and analysis of

biosynthetic gene clusters of secondary metabolite compounds such as NRPs, PKs

and other antimicrobials [71, 74, 75]. A database of classes specific for many types

of biosynthesis signature genes is constructed by Hidden Markov Models

(pHMMs) covering a wide range of known or putative secondary metabolite

compounds. The antiSMASH web server allows uploading of sequence files of not

only a variety of types (FASTA, GBK, or EMBL files), but also GenBank/RefSeq

accession numbers. Gene clusters are first predicted and identified by Glimmer and

pHMMs, respectively. Subsequently, several downstream analyses can be

performed by different modules: NRPS/PKS domain analysis and annotation;

prediction of the core chemical structure of PKSs and NRPSs; ClusterBlast gene

cluster comparative analysis; active enzyme site analysis; and secondary

metabolism Clusters of Orthologous Groups (smCOG) analysis. Moreover, the

ClusterFinder algorithm is used to detect putative gene clusters of unknown types.

Finally, an html output is generated and putative gene clusters are listed in a Table.

Further details including gene cluster description, annotation, percentage of gene

homology with known gene clusters or published genome sequences; genomic loci

http://antismash.secondarymetabolites.org/

Chapter 1

16

for this biosynthetic pathway are shown by clicking on the related words.

Biochemical properties of the putative compounds are also predicted, especially

chemical structures of NRPs and PKs. Results, stored in an EMBL/XLS/

GenBank/BiosynML file, can be downloaded for additional analysis.

Table 2. Comparison of applications between BAGEL3 and antiSMASH

BAGEL3 antiSMASH

Database modified or unmodified ribosomally

synthesized bacteriocins and other

non-bactericidal posttranslationally

modified peptides

many major classes of secondary metabolites

Classifi-

cation

Class I small RiPPs (Bottromycins,

Cyanobactins, Glycocins, Head-to-

tail cyclized peptides, Lanthipeptides

class I, Lanthipeptides class II,

Lanthipeptides class III,

Lanthipeptides class IV, Linear azole-

containing peptides (LAPs), Lasso

peptides, Linaridins, Microcins,

Sactipeptides and Thiopeptides);

Class II unmodified peptides;

Class III large proteins

Aminocoumarins, Aminoglycosides/aminocyclitols, Aryl

polyenes, Bacteriocins, Beta-lactams, Bottromycins,

Butyrolactones, ClusterFinder fatty acids, ClusterFinder

saccharides, Cyanobactins, (Dialkyl)resorcinols,

Ectoines, Furans, Glycocins, Head-to-tail cyclized

peptides, Heterocyst glycolipid PKS-like, Homoserine

lactones, Indoles, Ladderane lipids, Lantipeptides, LAPs,

Lasso peptides, Linaridins, Melanins, Microcins,

Microviridins, Non-ribosomal peptides, Nucleosides,

Oligosaccharide, Others, Phenazines,

Phosphoglycolipids, Phosphonates, Polyunsaturated fatty

acids, Trans-AT type I PKS, Type I PKS, Type II PKS,

Type III PKS, Proteusins, Sactipeptides, Siderophores,

Terpenes, Thiopeptides

Input DNA nucleotide sequences in FASTA

format

DNA sequence files of a variety of types (FASTA, GBK,

or EMBL files); GenBank/RefSeq accession number

Mining

procedure

In parallel using two different

approaches, one based on finding

genes commonly found in the context

of bacteriocin or RiPP genes, the other

based on finding the gene itself by

Glimmer.

Gene clusters prediction and identification by Glimmer

and pHMMs and analysis with following modules:

NRPS/PKS domain analysis and annotation; chemical

structure prediction; ClusterBlast and smCOG analysis;

Active Site Finder; ClusterFinder algorithm.

Output Html Html

Time cost Average 3 minutes per file Depends on the server working status (not so fast)


17

3. Lantibiotics

Many of the Bacillus bacteriocins belong to the lantibiotics class, a category of

posttranslationally modified peptides widely disseminated among different

bacterial clades [76]. The lantibiotics are a group of ribosomally synthesized,

posttranslationally modified peptides containing unusual amino acids, such as

dehydrated amino acids and lanthionine residues [8]. Lantibiotics are among the

best-characterized antimicrobial peptides at the level of classification,

posttranslational modifications (PTMs), biosynthesis mechanisms, peptide

structures and modes of action.

3.1. Classification of lantibiotics

Based on the pathway of maturation, lantibiotics are divided into four classes

following the classification of lanthipeptides (Class I, II, III and IV) [77].

Lanthipeptides with antimicrobial activity are the so-called lantibiotics. Class I

lanthipeptides are modified by two distinct enzymes: a LanB enzyme, which

dehydrates threonine (Thr) and serine (Ser) residues, and a LanC enzyme that

catalyzes cyclization with cysteine (Cys). The peptides are exported by an ABC

transporter, named LanT. Class I lanthipeptides’ leader peptides are cleaved by

either a LanP or general Ser proteases. Class II lanthipeptides are modified by a

bifunctional LanM-type modification enzymes, which exhibits both dehydratase

and cyclase activities. Class II lanthipeptides secretion and leader processing is

most frequently performed by a single, multifunctional protein LanT with a

conserved N-terminal Cys protease domain. Despite the functional difference

between class I and class II exporters, they share the designation LanT. Unique

within the class II lantibiotics are two-peptide assembled molecules. Each peptide

of two-component lanthipeptides is encoded by its own structural gene and

modified by separate LanM enzymes. Class III lanthipeptides are modified by a

Chapter 1

18

trifunctional synthetase, LanKC, with an N-terminal lyase domain, a central kinase

domain, and a putative C-terminal cyclase domain [78, 79]. Additionally, class IV

lanthipeptides are modified by a synthetase, LanL, containing an N-terminal lyase

and kinase domains as in class III, and a C-terminal cyclase domain [80]. LanKC

lacks the conserved zinc-binding motif (Cys-Cys-His/Cys) present in LanC and the

C-terminal domains of LanM and LanL [81].

3.2. Posttranslational modifications (PTMs) of lantibiotics

Lantibiotics are highly posttranslationally modified bacterial antimicrobial

molecules formed by the dehydration of selected Ser and Thr residues and the

intramolecular addition of Cys thiols to the resulting unsaturated amino acids

dehydroalanine (Dha) and dehydrobutyrine (Dhb) to form (2S,6R)-lanthionine

(Lan) and (2S,3S,6R)-3-methyllanthionine (MeLan) bridges, respectively.

However, additional PTMs have been documented in lantibiotics by various

scientists [82, 83], based on their structural and functional features. Examples of

PTMs of lantibiotics are listed in Table 3. This structural diversity releases the

peptides from the constraints imposed by the use of only 20 amino acids. C-

terminal Cys residues may form S-[(Z)-2-aminovinyl]-D-cysteine (AviCys) or S-

[(Z)-2-aminovinyl]-(3S)-3-methyl-D-cysteine (AviMeCys) residue structures, such

as those found in gallidermin, epidermin and mersacidin. Specific LanD enzymes

(EpiD, GdmD and MrsD) have been investigated for biosynthesis of the parent

peptide to generate an AviCys or AviMeCys at the C-terminal end of the mature

peptide [84-86]. L-Ser can be converted to D-Alanine (D-Ala) with Dha as an

intermediate, such as in lactocin S, lacticin 3147 and carnolysin. When this

phenomenon was first noted in lactocin S, it was postulated that a conversion of L-

Ser to D-Ala occurred via a two-step process of carbon stereo inversion [87]. LtnJ

and CrnJ are reductases responsible for the introduction of D-Ala or D-Abu in the

lantibiotic lacticin 3147 and carnolysin at the relevant locations, respectively [88-


19

91]. During the maturation of pep5, epicidin 280, and epilancin 15X [92-94], after

leader cleavage, Dha and Dhb residues exposed at the N-terminus will be

spontaneously hydrolyzed to yield 2-oxopropionyl (OPr) and 2-oxobutyryl (OBu).

Furthermore, EciO and ElxO catalyze Opr reduction to form an N-terminal D-

lactate (D-Lac) in epicidin 280 and epilancin 15X, respectively [93, 94]. Moreover,

cinnamycin contains a lysinoalanine bridge (catalyzed by Cinorf7) and a

hydroxylated aspartic acid (Asp) (catalyzed by CinX) [95]. Microbisporicin

(previously patented as antibiotic 107891 and NAI-107) contains two unique

modifications: a chlorinated tryptophan (Cl-Trp) and a hydroxylated proline (HPro)

[82, 96]. MibO might be responsible for the hydroxylation of Pro-14 of

microbisporicin, while MibV and MibH might be essential for chlorination of Trp

to occur [97]. GarO is a putative monooxygenase responsible for the formation of a

sulfoxide bond in actagardine [98]. The acetylase PaeN catalyzes the N-terminal

acetylation of paenibacillin during its biosynthesis [99]. Bovicin HJ50 is a

lantibiotic containing two β-methyllanthionines and a disulfide bond catalyzed by a

thiol–disulfide oxidoreductase encoding by sdb1 gene produced by Streptococcus

bovis HJ50 [100, 101]. Some class III lanthipeptides, but not all, contain the

unusual triamino acid labionin (Lab) or methyllabionin (Melab), which results

from cyclodehydration of Ser/Ser or Ser/Thr and one Cys residues in a mechanism

similar to that used for lanthionine formation catalyzed by LanKC. NAI-112

contains an N-terminal Lab, a C-terminal MeLab and a N-glycosylated Trp residue,

which is catalyzed by LabKC and a glycosyltransferase, respectively [102].

Table 3. Posttranslational modifications (PTMs) in lantibiotics that have been

reported to date

PTMs Structures Modification

enzymes

Lantibiotics

(e.g.)

References

Chapter 1

20

2,3-Didehydroalanine

(Dha)

LanB or

LanM

nisin,

mersacidin etc. [8]

(Z)-2,3-didehydrobutyrine

(Dhb)

Meso-lanthionine (Lan)

LanB and

LanC; or

LanM

All [8] (2S,3S,6R)-3-

methyllanthionine

(MeLan)

S-[(Z)-2-aminovinyl]-D-

cysteine (AviCys)

LanD

gallidermin,

epidermin [103]

S-[(Z)-2-aminovinyl]-(3S)-

3-methyl-D-cysteine

(AviMeCys)

mersacidin [84]

D-Alanine (D-Ala)

LtnJ, CrnJ,

lactocin S,

lacticin 3147,

carnolysin

[88-91]

D-Aminobutyrate (D-Abu)

CrnJ carnolysin [90]

2-Oxobutyryl (OBu)

LanB pep5 [92]

2-Oxopropionyl (OPr)

LanB epicidin 280,

epilancin 15X [93, 94]


21

D-lactate (D-Lac)

EciO, ElxO epicidin 280,

epilancin 15X [93, 94]

Erythro-3-hydroxy L-

aspartic acid (Asp-OH)

CinX

cinnamycin [95] (2S,9S)-lysinoalanine

(Ala-NH-Lys)

Cinorf7

Dihydroxyproline (HPro)

MibO

microbisporicin [97] Chlorinated trptophan

(Cl-Trp)

MibV and

MibH

β-Methyllanthionine

sulfoxide

GarO actagardine [98]

N-terminal acetylation

PaeN paenibacillin [99]

Disulfide bridge

Sdb1 bovicin J50 [100]

Labionin (Lab)

LabKC NAI-112 [102]

Chapter 1

22

Methyl-labionin (MeLab)

N-glycosylated Trp

Glycosyltrans

ferase

3.3. Structures and modes of action

Most class I lantibiotics are elongated, cationic peptides that show a similar

arrangement of their lanthionine bridges (e.g. nisin, subtilin, epidermin,

gallidermin) (Fig. 2). The lantibiotic nisin primarily binds to its docking molecule

(lipid II), which is an essential intermediate in cell wall biosynthesis, and

subsequently forms pores in the cell membrane [105, 106]. Consequently, this

unique double mode of action makes nisin highly potent at nanomolar

concentrations against many Gram-positive bacteria [107]. Unlike nisin, the C-

terminal tail of epidermin and gallidermin is shorter and unable to translocate the

cell membrane to form pores [103]. Class II lantibiotics such as mersacidin and

cinnamycin are globular and also bind to lipid II, but have no structural similarity

with nisin and epidermin (Fig. 2) [108, 109]. Mersacidin acts by disrupting the

enzyme function of cell wall biosynthesis, by the formation of a complex with lipid

II. Specifically, it prevents the activity of transglycosylases. It is important to note

that mersacidin does not form pores upon binding to lipid II. Mersacidin and

closely related lantibiotics show potential for chemotherapeutic application [108].

Cinnamycin and the duramycins contain an unusual lysinoalanine ring and have a


23

different mechanism of action. They bind to phosphatidylethanolamine in the cell

membrane, and then cause toxicity by inducing transbilayer lipid movement [109].

Some other class II lantibiotics such as lacticin 481 and its relatives display an N-

terminal linear region and a C-terminal globular region with overlapping

lanthionine bridges [110]. Lacticin 481 may form complexes with lipid II and

inhibits the transglycosylation reaction involved in peptidoglycan biosynthesis

[111]. The two-component lantibiotics, such as lacticin 3147, consist of two

modified peptides, namely Lanα and Lanβ, where Lanβ displays a relatively more

globular structure than Lanα (Fig. 2) [82]. In lacticin 3147, Ltnα binds to lipid II

first, then Ltnβ is recruited by the lipid II-Ltnα complex, leading to high-affinity,

three-component complex, finally resulting in inhibition of cell wall biosynthesis

and pore formation [112].

Due to the importance of the unusual structures of lantibiotics, structure-activity

relationships have been determined in many studies. Some conserved regions are

essential for activity. For instance, the A and B rings of nisin, which have been

shown to be responsible for binding to lipid II, in particular to the pyrophosphate

moiety, are also conserved in subtilin, epidermin and gallidermin [93]. The C-

terminal region of nisin, as well as the overall negative surface charge of the

membrane are important for binding and pore formation [113, 114]. Mersacidin

inhibits peptidoglycan biosynthesis at the level of transglycosylation by forming a

complex with the membrane-bound peptidoglycan precursor lipid II with its C-

terminal region [115, 116]. Natural variants of lantibiotics suggest that the presence

of certain amino acids in specific locations is crucial, whereas other amino acids

are flexible in nature [117]. Positively charged residues consistently play an

important role on activity within specific domains of some lantibiotics through

disruption of the anionic bacterial membrane [118]. Bonelli et al. showed that

gallidermin/epidermin has a higher affinity to lipid II than nisin and suggested that

this may be caused by a structural element, probably the lysine at position 4

Chapter 1

24

(isoleucine in nisin) [103]. No interaction of nisin was observed with the D-Ala-D-

Ala moiety of lipid II, which is the binding motif of the peptide antibiotic

vancomycin [119]. That is why nisin is still effective against vancomycin-resistant

strains that change their terminal D-Ala into D-Lac resulting in a high level of

vancomycin resistance.

Fig. 2. Structures of class I and class II lantibiotics


25

3.4. Mersacidin - a type II lantibiotic produced by Bacillus sp.

Mersacidin is a typical globular type II lantibiotic first isolated from Bacillus sp.

HIL Y-85, 54728. It shows activity against Gram-positive bacteria, such as S.

aureus [26]. It is the smallest lantibiotic (1825 Da) reported till now, and it is

synthesized as a 20 amino acid residues core peptide containing three MeLan rings,

one Dha and a C-terminal AviMeCys. The whole gene cluster of mersacidin covers

12.3 kb and contains 10 putative open reading frames, 3 of which were located on

the opposite strand of mrsA, the structural gene of the mersacidin prepeptide [120]

(Fig. 3). Besides the structural gene mrsA, there are two modification genes (i.e.

mrsM coding for both dehydration and cyclisation and mrsD coding for a C-

terminal AviMeCys formation enzyme), the gene mrsT coding for a transporter

with a cysteine protease domain, as well as three genes, mrsEFG, coding for

immunity and three genes, mrsR1,R2,K1, coding for regulation. Biosynthesis of

mersacidin can be regulated by an autoinducing mechanism, which is performed by

the MrsR2/K2 two-component system [121]. This system is probably involved in

the recognition of mersacidin in the supernatant, and the producer self-protection is

regulated by MrsR2/K2, i.e. transcription of the ABC transporter MrsFGE.

Transcription of mrsA and biosynthesis of the mature lantibiotic is regulated by

MrsR1 [122, 123]. Remarkably, based on genome mining, the complete mersacidin

operon was detected in several Bacillus sp. strains, such as B. amyloliquefaciens

YAU B9601-Y2, Bacillus sp. BH072 and HIL Y-85, 54728 [124-126]. The

mersacidin producing strain HIL Y-85 cannot be made naturally competent so far,

limiting the manipulation of the gene cluster. Therefore, researchers transferred the

mersacidin gene cluster into a naturally competent B. amyloliquefaciens strain

FZB42, which already harbors mersacidin immunity genes and thus active

mersacidin could be obtained [120].

Chapter 1

26

Fig. 3. Model for the biosynthesis of mersacidin (based on Barbosa et al. 2015)

3.5. Biosynthesis of nisin

Nisin autoregulates its biosynthesis by acting as a peptide pheromone via a 2-

component regulatory system, involving a histidine protein kinase NisK and a

response regulator protein NisR [127, 128] (Fig. 4). NisK senses the presence of

nisin in the medium and autophosphorylates. The phosphate-group is transferred to

NisR, which activates transcription of the operons nisABTCIP and nisFEG. The

ribosomally synthesized prepeptide NisA undergoes PTMs, including unusual

amino acid formation and transport by a membrane located multimeric complex

consisting of NisB, NisC, and NisT. NisFEG is a membrane protein complex that

functions as an ABC transporter to transport the produced nisin from the

cytoplasmic membrane into the extracellular space. The lipoprotein NisI intercepts

and binds to nisin at the surface of the cytoplasmic membrane [129]. The leader

peptide is proteolytically removed by the protease NisP outside the cell [130].


27

Fig. 4. Model for the biosynthesis of nisin (based on Kuipers et al.1995, Lubelski

et al. 2008)

3.6. Engineering and applications of lantibiotics

Lantibiotics show a marked potential in addition to traditional antibiotics due to

their significant applications in the food and medical field [131]. The best-studied

lantibiotic nisin has no known toxicity to humans for over 40 years in use in food

industry, and it has occupied a unique status worldwide. Nisin has been approved

by the Food and Drug Administration as a safe food additive that inhibits food

spoilage bacteria [2]. Genome-wide screening may contribute to the discovery of

novel lantibiotics to extend their applications. Lantibiotics are gene-encoded, and,

therefore, can be readily manipulated by genetic engineering. This provides another

way to produce various lantibiotic structural analogs by rational designing and

engineering. By characterization of site-directed mutants of nisin, valuable

information on biosynthetic requirements was obtained [132]. Several mutants,

such as M17Q/G18T nisin Z, showed increasing activity of wild-type nisin Z

Chapter 1

28

against Micrococcus flavus [133]; mutant T2S gave rise to a Dha residue and

displayed a twofold higher antimicrobial activity against M. flavus and

Streptococcus thermophilus [134]. Thus far, after many trials, the successful

generation of bioengineered nisin variants with improved specific activity against

Gram-positive and Gram-negative bacteria was recently reported by variation in

the hinge region (N20, M21, K22). Mutants N20P/M21V/K22S nisin A, showed

enhanced activity against Gram-positive pathogens including L. monocytogenes

and/or S. aureus [135]. By introducing a positive charge in the hinge region, the

mutant N20K/M21K nisin Z displayed antimicrobial activity against the Gram-

negative bacteria Shigella, Pseudomonas and Salmonella; and they had a higher

solubility than wild-type nisin Z [136]. Moreover, Zhou et al. enhanced the activity

of nisin against Gram-negative microorganisms by designing a tail that could

facilitate traversing the outer membrane [137]. Marked achievements on

engineering lantibiotics further encourage and also extend the possible applications

of these compounds.

The nisin-controlled gene expression system (NICE) employs an auto-induction

mechanism of nisin for gene expression, discovered by Kuipers et al. [127]. When

a gene of interest is placed behind the inducible promoter PnisA on a plasmid (e.g.

pNZ8048 [138]) or on the chromosome [139-142], expression of that gene can be

induced by the addition of sub-inhibitory amounts of nisin (0.1-5 ng/mL) to the

culture medium [143]. Depending on the presence or absence of the corresponding

targeting signals, the protein is expressed into the cytoplasm, into the membrane or

secreted into the medium. The NICE system has been used in various Gram-

positive hosts to express genes of different backgrounds (Gram-positive, Gram-

negative and eukaryotic origin) to study metabolic and enzyme functions and to

produce larger amounts of an enzyme for food, medical or technological

applications [144]. By integration of the nisA promoter upstream of the lantibiotic

gene under study, expression of lantibiotics can be controlled by the addition of


29

nisin to the medium. Therefore, development of genetic analysis and engineering

will facilitate the creation of novel lantibiotics for therapeutical purposes.

4. Scope of thesis

There are 6 chapters in this thesis. Chapter 1 contains a general introduction on

the background of antimicrobials produced by Bacillus, genome mining of

antimicrobial gene clusters and lantibiotics. Bacillus sp. have been successfully

used to suppress various bacterial and fungal pathogens. Due to the wide

availability of whole genome sequence data and the development of genome

mining tools, novel antimicrobials are being discovered and updated, not only

bacteriocins, but also NRPs and PKs. A new classification system of known and

putative antimicrobial compounds of Bacillus by genome mining is presented in

Chapter 2. Importantly, predicting, isolating and screening of Bacillus strains with

antimicrobial activity from natural sources keeps showing surprises and underlines

the wealth of antimicrobial power these organisms have. Chapter 3 describes the

bacterium Bacillus sp. BH072, isolated from a honey sample, with antifungal

activities against molds. In order to explain the antifungal activity, the peptides of

the fermentation broth were isolated and identified by a combination of several

purification methods, and their genes were identified and analyzed. Subsequently

in Chapter 4, the genome of Bacillus sp. BH072 was completely sequenced and it

was identified to be B. amyloliquefaciens. BAGEL3 mining results showed that the

whole mersacidin operon is present in the genome of BH072, while no mersacidin

product was obtained by direct production. Considering that the nisin synthetic

machinery with additional modification enzymes brings a new opportunity to

produce a broader range of lanthipeptides with various modifications, Chapter 5

describes production of class I and II hybrid lantibiotics (nisin and mersacidin)

using the nisin leader sequence and NisBC together with GdmD in Lactococcus

lactis. Finally in Chapter 6, all the results of this thesis are discussed and put in a

Chapter 1

30

further and future perspective.

References

1. Baruzzi F, Quintieri L, Morea M, Caputo L. Antimicrobial compounds produced by Bacillus spp. and

applications in food In: Science against microbial pathogens: communicating current research and

technological advances Edited by Méndez-Vilas A. Spain; 2011.

2. Lucera A, Costa C, Conte A, Del Nobile MA: Food applications of natural antimicrobial compounds.

Front Microbiol. 2012,3(287):1-13.

3. Nath S, Chowdhury S, Dora KC. Application of Bacillus sp. as a biopreservative for food preservation.

Int J Eng Res Appl. 2015,5(4):85-95.

4. Abriouel H, Franz CM, Ben Omar N, Galvez A. Diversity and applications of Bacillus bacteriocins.

FEMS Microbiol Rev. 2011,35(1):201-232.

5. Cotter PD, Ross RP, Hill C. Bacteriocins - a viable alternative to antibiotics?. Nat Rev Microbiol.

2013,11(2):95-105.

6. Riley MA, Wertz JE. Bacteriocin diversity: ecological and evolutionary perspectives. Biochimie.

2002,84(5-6):357-364.

7. Alvarez-Sieiro P, Montalban-Lopez M, Mu D, Kuipers OP. Bacteriocins of lactic acid bacteria:

extending the family. Appl Microbiol Biotechnol. 2016,100(7): 2939-2951.

8. McAuliffe O, Ross RP, Hill C. Lantibiotics: structure, biosynthesis and mode of action. FEMS

Microbiol Rev. 2001,25(3):285-308.

9. Velasquez JE, van der Donk WA. Genome mining for ribosomally synthesized natural products. Curr

Opin Chen Biol. 2011,15(1):11-21.

10. Hyronimus B, Le Marrec C, Urdaci MC. Coagulin, a bacteriocin-like inhibitory substance produced by

Bacillus coagulans I4. J Appl Microbiol. 1998,85(1):42-50.

11. Le Marrec C, Hyronimus B, Bressollier P, Verneuil B, Urdaci MC. Biochemical and genetic

characterization of coagulin, a new antilisterial bacteriocin in the pediocin family of bacteriocins,

produced by Bacillus coagulans I(4). Appl Environ Microbiol. 2000,66(12):5213-5220.

12. Wang H, Fewer DP, Holm L, Rouhiainen L, Sivonen K. Atlas of nonribosomal peptide and polyketide

biosynthetic pathways reveals common occurrence of nonmodular enzymes. Proc Natl Acad Sci USA.

2014,111(25):9259-9264.

13. Weissman KJ. The structural biology of biosynthetic megaenzymes. Nat Chem Biol. 2014,11(9):660-

670.

14. Felnagle E, Jackson E, Chan Y, Podevels A, Berti A, McMahon M, Thomas M. Nonribosomal peptide

synthetases involved in the production of medically relevant natural products. Mol Pharmaceut.

2008,5(2):191-211.

15. Fickers P. Antibiotic Compounds from Bacillus: Why are they so Amazing? . Am J Biochem

Biotechnol 2012,8(1):38-43.


31

16. Aleti G, Sessitsch A, Brader G. Genome mining: Prediction of lipopeptides and polyketides from

Bacillus and related Firmicutes. Comput Struct Biotechnol J. 2015,13:192-203.

17. Amoutzias GD, Chaliotis A, Mossialos D. Discovery strategies of bioactive compounds synthesized by

nonribosomal peptide synthetases and type-I polyketide synthases derived from marine microbiomes.

Mar Drugs. 2016,14(4):1-20.

18. Klein C, Kaletta C, Schnell N, Entian KD. Analysis of genes involved in biosynthesis of the lantibiotic

subtilin. Appl Environ Microbiol. 1992,58(1):132-142.

19. Stein T, Borchert S, Conrad B, Feesche J, Hofemeister B, Hofemeister J, Entian KD. Two different

lantibiotic-like peptides originate from the ericin gene cluster of Bacillus subtilis A1/3. J Bacteriol.

2002,184(6):1703-1711.

20. Fuchs SW, Jaskolla TW, Bochmann S, Kotter P, Wichelhaus T, Karas M, Stein T, Entian KD.

Entianin, a novel subtilin-like lantibiotic from Bacillus subtilis subsp. spizizenii DSM 15029T with

high antimicrobial activity. Appl Environ Microbiol. 2011,77(5):1698-1707.

21. Phelan RW, Barret M, Cotter PD, O'Connor PM, Chen R, Morrissey JP, Dobson AD, O'Gara F,

Barbosa TM. Subtilomycin: a new lantibiotic from Bacillus subtilis strain MMA7 isolated from the

marine sponge Haliclona simulans. Mar Drugs. 2013,11(6):1878-1898.

22. Favret ME, Yousten AA. Thuricin: the bacteriocin produced by Bacillus thuringiensis. J Invertebr

Pathol. 1989,53(2):206-216.

23. van Belkum MJ, Lohans CT, Vederas JC. Draft genome sequences of Paenibacillus polymyxa NRRL

B-30509 and Paenibacillus terrae NRRL B-30644, strains from a poultry environment that produce

tridecaptin A and paenicidins. Genome Announcements. 2015,3(2):e00372-00315.

24. Bouhss A, Al-Dabbagh B, Vincent M, Odaert B, Aumont-Nicaise M, Bressolier P, Desmadril M,

Mengin-Lecreulx D, Urdaci MC, Gallay J. Specific interactions of clausin, a new lantibiotic, with lipid

precursors of the bacterial cell wall. Biophys J. 2009,97(5):1390-1397.

25. Garg N, Tang W, Goto Y, Nair SK, van der Donk WA. Lantibiotics from Geobacillus

thermodenitrificans. Proc Natl Acad Sci USA. 2011,109(14):5241-5246.

26. Bierbaum G, Brötz H, Koller KP, Sahl HG. Cloning, sequencing and production of the lantibiotic

mersacidin. FEMS Microbiol Lett. 1995,127(1-2):121-126.

27. Arguelles Arias A, Ongena M, Devreese B, Terrak M, Joris B, Fickers P. Characterization of

amylolysin, a novel lantibiotic from Bacillus amyloliquefaciens GA1. Plos One. 2013,8(12):e83037.

28. Basi-Chipalu S, Dischinger J, Josten M, Szekat C, Zweynert A, Sahl HG, Bierbaum G.

Pseudomycoicidin, a class II lantibiotic from Bacillus pseudomycoides. Appl Environ Microbiol.

2015,81(10):3419-3429.

29. Wang J, Zhang L, Teng K, Sun S, Sun Z, Zhong J. Cerecidins, novel lantibiotics from Bacillus cereus

with potent antimicrobial activity. Appl Environ Microbiol. 2014,80(8):2633-2643.

30. Begley M, Cotter PD, Hill C, Ross RP. Identification of a novel two-peptide lantibiotic, lichenicidin,

following rational genome mining for LanM proteins. Appl Environ Microbiol. 2009,75(17):5451-

5460.

31. Lawton EM, Cotter PD, Hill C, Ross RP. Identification of a novel two-peptide lantibiotic, haloduracin,

produced by the alkaliphile Bacillus halodurans C-125. FEMS Microbiol Lett. 2007,267(1):64-71.

Chapter 1

32

32. Scholz R, Vater J, Budiharjo A, Wang Z, He Y, Dietel K, Schwecke T, Herfort S, Lasch P, Borriss R.

Amylocyclicin, a novel circular bacteriocin produced by Bacillus amyloliquefaciens FZB42. J

Bacteriol. 2014,196(10):1842-1852.

33. Kawulka K, Sprules T, McKay RT, Mercier P, Diaper CM, Zuber P, Vederas JC. Structure of

subtilosin A, an antimicrobial peptide from Bacillus subtilis with unusual posttranslational

modifications linking cysteine sulfurs to alpha-carbons of phenylalanine and threonine. J Am Chem

Soc. 2003,125(16):4726-4727.

34. Scholz R, Molohon KJ, Nachtigall J, Vater J, Markley AL, Sussmuth RD, Mitchell DA, Borriss R.

Plantazolicin, a novel microcin B17/streptolysin S-like natural product from Bacillus amyloliquefaciens

FZB42. J Bacteriol. 2011,193(1):215-224.

35. Wieland Brown LC, Acker MG, Clardy J, Walsh CT, Fischbach MA. Thirteen posttranslational

modifications convert a 14-residue peptide into the antibiotic thiocillin. Proc Natl Acad Sci USA.

2009,106(8):2549-2553.

36. Paik SH, Chakicherla A, Hansen JN. Identification and characterization of the structural and transporter

genes for, and the chemical and biological properties of, sublancin 168, a novel lantibiotic produced by

Bacillus subtilis 168. J Biol Chem. 1998,273(36):23134-23142.

37. Pattnaik P, Kaushik J, Grover S, Batish V. Purification and characterization of a bacteriocin-like

compound (Lichenin) produced anaerobically by Bacillus licheniformis isolated from water buffalo. J

Appl Microbiol. 2001,91(4):636-645.

38. Bizani D, Motta A, Morrissy J, Terra R, Souto A, Brandelli A. Antibacterial activity of cerein 8A, a

bacteriocin-like peptide produced by Bacillus cereus. Int Microbiol. 2005,8(2):125-131.

39. Von Terschm M, Carlton B. Bacteriocin from Bacillus megaterium ATCC 19213: comparative studies

with megacin A-216. J Bacteriol. 1983,155(2):866-871.

40. Pathak KV, Keharia H. Identification of surfactins and iturins produced by potent fungal antagonist,

Bacillus subtilis K1 isolated from aerial roots of banyan (Ficus benghalensis) tree using mass

spectrometry. 3 Biotech. 2013,4(3):283-295.

41. Maget-Dana R, Peypoux F. Iturins, a special class of pore-forming lipopeptides: biological and

physicochemical properties. Toxicology. 1994,87(1-3):151-174.

42. Cawoy H, Debois D, Franzil L, De Pauw E, Thonart P, Ongena M. Lipopeptides as main ingredients

for inhibition of fungal phytopathogens by Bacillus subtilis/amyloliquefaciens. Microb Biotechnol.

2015,8(2):281-295.

43. Bechet M, Caradec T, Hussein W, Abderrahmani A, Chollet M, Leclere V, Dubois T, Lereclus D,

Pupin M, Jacques P. Structure, biosynthesis, and properties of kurstakins, nonribosomal lipopeptides

from Bacillus spp. Appl Microbiol Biotechnol. 2012,95(3):593-600.

44. Shoji J, Hinoo H. Chemical characterization of new antibiotics, cerexins A and B. (Studies on

antibiotics from the genus Bacillus. II). J Antibiot (Tokyo). 1975,28(1):60-63.

45. Luo C, Liu X, Zhou X, Guo J, Truong J, Wang X, Zhou H, Li X, Chen Z. Unusual biosynthesis and

structure of locillomycins from Bacillus subtilis 916. Appl Environ Microbiol. 2015,81(19):6601-6609.

46. Choi SK, Park SY, Kim R, Kim SB, Lee CH, Kim JF, Park SH. Identification of a polymyxin

synthetase gene cluster of Paenibacillus polymyxa and heterologous expression of the gene in Bacillus


33

subtilis. J Bacteriol. 2009,191(10):3350-3358.

47. Li S, Zhang R, Wang Y, Zhang N, Shao J, Qiu M, Shen B, Yin X, Shen Q. Promoter analysis and

transcription regulation of fus gene cluster responsible for fusaricidin synthesis of Paenibacillus

polymyxa SQR-21. Appl Microbiol Biotechnol. 2013,97(21):9479-9489.

48. Shoji J, Hinoo H, Sakazaki R, Kato T, Wakisaka Y, Mayama M, Matsuura S, Miwa H. Isolation of

tridecaptins A, B and C (studies on antibiotics from the genus Bacillus. XXIII). J Antibiot (Tokyo).

1978,31(7):646-651.

49. Ozcengiz G, Ogulur I. Biochemistry, genetics and regulation of bacilysin biosynthesis and its

significance more than an antibiotic. New Biotechnol. 2015,32(6):612-619.

50. Azevedo EC, Rios EM, Fukushima K, Campos-Takaki GM. Bacitracin production by a new strain of

Bacillus subtilis. Extraction, purification, and characterization. Appl Biochem Biotechnol.

1993,42(1):1-7.

51. Borisova SA, Circello BT, Zhang JK, van der Donk WA, Metcalf WW. Biosynthesis of rhizocticins,

antifungal phosphonate oligopeptides produced by Bacillus subtilis ATCC6633. Chem Biol.

2010,17(1):28-37.

52. Huang E, Yousef AE. The lipopeptide antibiotic paenibacterin binds to the bacterial outer membrane

and exerts bactericidal activity through cytoplasmic membrane damage. Appl Environ Microbiol.

2014,80(9):2700-2704.

53. Tang Y, Frewert S, Harmrolfs K, Herrmann J, Karmann L, Kazmaier U, Xia L, Zhang Y, Muller R.

Heterologous expression of an orphan NRPS gene cluster from Paenibacillus larvae in Escherichia

coli revealed production of sevadicin. J Biotechnol. 2015,194:112-114.

54. Kleinkauf H, Gevers W. Nonribosomal polypeptide synthesis: the biosynthesis of a cyclic peptide

antibiotic, gramicidin S. Cold Spring Harb Sym. 1969,34:805-813.

55. Hansen J, Pschorn W, Ristow H. Functions of the peptide antibiotics tyrocidine and gramicidin.

Induction of conformational and structural changes of superhelical DNA. Eur J Biochem.

1982,126(2):279-284.

56. Howell SF. Polypeptin, an antibiotic rom a member of the Bacillus Circulans group II. Purification

crystallization, and properties of polypeptin. J Biol Chem. 1950,186(2):863-877.

57. Ding R, Wu XC, Qian CD, Teng Y, Li O, Zhan ZJ, Zhao YH. Isolation and identification of

lipopeptide antibiotics from Paenibacillus elgii B69 with inhibitory activity against methicillin-

resistant Staphylococcus aureus. J Microbiol. 2011,49(6):942-949.

58. Cochrane SA, Vederas JC. Lipopeptides from Bacillus and Paenibacillus spp.: A gold mine of

antibiotic candidates. Med Res Rev. 2016,36(1):4-31.

59. Pichard B, Larue JP, Thouvenot D. Gavaserin and saltavalin, new peptide antibiotics produced by

Bacillus polymyxa. FEMS Microbiol Lett. 1995,133(3):215-218.

60. Patel PS, Huang S, Fisher S, Pirnik D, Aklonis C, Dean L, Meyers E, Fernandes P, Mayerl F.

Bacillaene, a novel inhibitor of procaryotic protein synthesis produced by Bacillus subtilis: production,

taxonomy, isolation, physico-chemical characterization and biological activity. J Antibiot (Tokyo).

1995,48(9):997-1003.

61. Wu L, Wu H, Chen L, Yu X, Borriss R, Gao X. Difficidin and bacilysin from Bacillus

Chapter 1

34

amyloliquefaciens FZB42 have antibacterial activity against Xanthomonas oryzae rice pathogens. Sci

Rep. 2015,5:12975.

62. Gustafson K, Roman M, Fenical W. The macrolactins, a novel class of antiviral and cytotoxic

macrolides from a deep-sea marine bacterium. J Am Chem Soc. 1989,111(19):7519-7524.

63. Wu XC, Qian CD, Fang HH, Wen YP, Zhou JY, Zhan ZJ, Ding R, Li O, Gao H. Paenimacrolidin, a

novel macrolide antibiotic from Paenibacillus sp. F6-B70 active against methicillin-resistant

Staphylococcus aureus. Microb Biotechnol. 2011,4(4):491-502.

64. Barsby T, Kelly MT, Andersen RJ. Tupuseleiamides and basiliskamides, new acyldipeptides and

antifungal polyketides produced in culture by a Bacillus laterosporus isolate obtained from a tropical

marine habitat. J Nat Prod. 2002,65(10):1447-1451.

65. Sood S, Steinmetz H, Beims H, Mohr KI, Stadler M, Djukic M, von der Ohe W, Steinert M, Daniel R,

Muller R. Paenilarvins: Iturin family lipopeptides from the honey bee pathogen Paenibacillus larvae.

Chembiochem. 2014,15(13):1947-1955.

66. Luo Y, Ruan LF, Zhao CM, Wang CX, Peng DH, Sun M. Validation of the intact zwittermicin A

biosynthetic gene cluster and discovery of a complementary resistance mechanism in Bacillus

thuringiensis. Antimicrob Agents Chemother. 2011,55(9):4161-4169.

67. Garcia-Gonzalez E, Muller S, Hertlein G, Heid N, Sussmuth RD, Genersch E. Biological effects of

paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium

Paenibacillus larvae. Microbiology Open. 2014,3(5):642-656.

68. Lechner M, Findeiß S, L. S, Marz M, Stadler P, Prohaska S. Proteinortho: Detection of (co-)orthologs

in large-scale analysis. BMC Bioinformatics. 2011,12(1):124.

69. Davies J, Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev.

2010,74(3):417-433.

70. Yang E, Fan L, Jiang Y, Doucette C, Fillmore S. Antimicrobial activity of bacteriocin-producing lactic

acid bacteria isolated from cheeses and yogurts. AMB Express. 2012,2(1): 1-12.

71. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, Weber T, Takano E,

Breitling R. antiSMASH: rapid identification, annotation and analysis of secondary metabolite

biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res.

2011,39(8):W339-346.

72. van Heel AJ, de Jong A, Montalban-Lopez M, Kok J, Kuipers OP. BAGEL3: Automated identification

of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides. Nucleic

Acids Res. 2013,41: 448-453.

73. de Jong A, van Hijum SA, Bijlsma JJ, Kok J, Kuipers OP. BAGEL: a web-based bacteriocin genome

mining tool. Nucleic Acids Res. 2006,34:273-279.

74. Blin K, Medema MH, Kazempour D, Fischbach MA, Breitling R, Takano E, Weber T. antiSMASH

2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res.

2013,41:204-212.

75. Weber T, Blin K, Duddela S, Krug D, Kim HU, Bruccoleri R, Lee SY, Fischbach MA, Muller R,

Wohlleben W. et al. antiSMASH 3.0-a comprehensive resource for the genome mining of biosynthetic

gene clusters. Nucleic Acids Res. 2015,43:237-243.


35

76. Lee H, Kim HY. Lantibiotics, class I bacteriocins from the genus Bacillus. J Microbiol Biotechnol.

2011,21(3):229-235.

77. Knerr PJ, van der Donk WA. Discovery, biosynthesis, and engineering of lantipeptides. Annu Rev

Biochem. 2012,81(1):479-505.

78. Wang H, van der Donk WA. Biosynthesis of the class III lantipeptide catenulipeptin. ACS Chem Biol.

2012,7(9):1529-1535.

79. Kodani S, Hudson ME, Durrant MC, Buttner MJ, Nodwell JR, Willey JM. The SapB morphogen is a

lantibiotic-like peptide derived from the product of the developmental gene ramS in Streptomyces

coelicolor. Proc Natl Acad Sci USA. 2004,101(31):11448-11453.

80. Goto Y, Okesli A, van der Donk WA. Mechanistic studies of Ser/Thr dehydration catalyzed by a

member of the LanL lanthionine synthetase family. Biochemistry. 2011,50(5):891-898.

81. Zhang Q, Yu Y, Velasquez JE, van der Donk WA. Evolution of lanthipeptide synthetases. Proc Natl

Acad Sci USA. 2012,109(45):18361-18366.

82. Willey JM, van der Donk WA. Lantibiotics: peptides of diverse structure and function. Annu Rev

Microbiol. 2007,61(1):477-501.

83. Montalban-Lopez M, Zhou L, Buivydas A, van Heel AJ, Kuipers OP. Increasing the success rate of

lantibiotic drug discovery by synthetic biology. Expert Opin Drug Dis. 2012,7(8):695-709.

84. Majer F, Schmid DG, Altena K, Bierbaum G, Kupke T. The flavoprotein MrsD catalyzes the oxidative

decarboxylation reaction involved in formation of the peptidoglycan biosynthesis inhibitor mersacidin.

J Bacteriol. 2002,184(5):1234-1243.

85. Kupke T, Stevanović S, Sahl H, Götz F. Purification and characterization of EpiD, a flavoprotein

involved in the biosynthesis of the lantibiotic epidermin. J Bacteriol. 1992,174(16):5354-5361.

86. Kupke T, Kempter C, Jung G, Götz F. Oxidative decarboxylation of peptides catalyzed by flavoprotein

EpiD. Determination of substrate specificity using peptide libraries and neutral loss mass spectrometry.

J Biol Chem. 1995,270(19):111282-111289.

87. Skaugen M, Abildgaard C, Nes I. Organization and expression of a gene cluster involved in the

biosynthesis of the lantibiotic lactocin S. Mol Gen Genet. 1997,253(6):674-686.

88. Mu D, Montalban-Lopez M, Deng J, Kuipers OP. Lantibiotic reductase LtnJ substrate selectivity

assessed with a collection of nisin derivatives as substrates. Appl Environ Microbiol.

2015,81(11):3679-3687.

89. van Heel AJ, Mu D, Montalban-Lopez M, Hendriks D, Kuipers OP. Designing and producing

modified, new-to-nature peptides with antimicrobial activity by use of a combination of various

lantibiotic modification enzymes. ACS Synth Biol. 2013,2(7):397-404.

90. Lohans CT, Li JL, Vederas JC. Structure and biosynthesis of carnolysin, a homologue of enterococcal

cytolysin with D-amino acids. J Am Chem Soc. 2014,136(38):13150-13153.

91. Cotter PD, O'Connor PM, Draper LA, Lawton EM, Deegan LH, Hill C, Ross RP. Posttranslational

conversion of L-serines to D-alanines is vital for optimal production and activity of the lantibiotic

lacticin 3147. Proc Natl Acad Sci USA. 2005,102(51):18584-18589.

92. Kaletta C, Entian K, Kellner R, Jung G, Reis M, Sahl H. Pep5, a new lantibiotic: structural gene

isolation and prepeptide sequence. Arch Microbiol. 1989,152(1):16-19.

Chapter 1

36

93. Heidrich C, Pag U, Josten M, Metzger J, Jack RW, Bierbaum G, Jung G, Sahl HG. Isolation,

characterization, and heterologous expression of the novel lantibiotic epicidin 280 and analysis of its

biosynthetic gene cluster. Appl Environ Microbiol. 1998,64(9):3140-3146.

94. Velasquez JE, Zhang X, van der Donk WA: Biosynthesis of the antimicrobial peptide epilancin 15X

and its N-terminal lactate. Chem Biol. 2011,18(7):857-867.

95. Okesli A, Cooper LE, Fogle EJ, van der Donk WA. Nine post-translational modifications during the

biosynthesis of cinnamycin. J Am Chem Soc. 2011,133(34):13753-13760.

96. Castiglione F, Lazzarini A, Carrano L, Corti E, Ciciliato I, Gastaldo L, Candiani P, Losi D, Marinelli F,

Selva E. et al. Determining the structure and mode of action of microbisporicin, a potent lantibiotic

active against multiresistant pathogens. Chem Biol. 2008,15(1):22-31.

97. Foulston LC, Bibb MJ. Microbisporicin gene cluster reveals unusual features of lantibiotic biosynthesis

in actinomycetes. Proc Natl Acad Sci USA. 2010,107(30):13461-13466.

98. Boakes S, Cortes J, Appleyard AN, Rudd BA, Dawson MJ. Organization of the genes encoding the

biosynthesis of actagardine and engineering of a variant generation system. Mol Microbiol.

2009,72(5):1126-1136.

99. Huang E, Yousef AE. Biosynthesis of paenibacillin, a lantibiotic with N-terminal acetylation, by

Paenibacillus polymyxa. Microbiol Res. 2015,181:15-21.

100. Liu G, Zhong J, Ni J, Chen M, Xiao H, Huan L. Characteristics of the bovicin HJ50 gene cluster in

Streptococcus bovis HJ50. Microbiology. 2009,155(2):584-593.

101. Xiao H, Chen X, Chen M, Tang S, Zhao X, Huan L. Bovicin HJ50, a novel lantibiotic produced by

Streptococcus bovis HJ50. Microbiology. 2004,150(1):103-108.

102. Iorio M, Sasso O, Maffioli SI, Bertorelli R, Monciardini P, Sosio M, Bonezzi F, Summa M, Brunati C,

Bordoni R. et al. A glycosylated, labionin-containing lanthipeptide with marked antinociceptive

activity. ACS Chem Biol. 2014,9(2):398-404.

103. Bonelli RR, Schneider T, Sahl HG, Wiedemann I. Insights into in vivo activities of lantibiotics from

gallidermin and epidermin mode-of-action studies. Antimicrob Agents Chemother. 2006,50(4):1449-

1457.

104. Yang X, van der Donk WA. Post-translational introduction of D-Alanine into ribosomally synthesized

peptides by the dehydroalanine reductase NpnJ. J Am Chem Soc. 2015,137(39):12426-12429.

105. Bauer R, Dicks LM: Mode of action of lipid II-targeting lantibiotics. Int J Food Microbiol.

2005,101(2):201-216.

106. Breukink E, Wiedemann I, van Kraaij C, Kuipers OP, Sahl HG, de Kruijff B. Use of the cell wall

precursor lipid II by a pore-forming peptide antibiotic. Science. 1999,286(5448):2361-2364.

107. Brötz H, Sahl H. New insights into the mechanism of action of lantibiotics--diverse biological effects

by binding to the same molecular target. J Antimicrobiol Chemother. 2000,46(1):1-6.

108. Brötz H, Bierbaum G, Leopold K, Reynolds PE, Sahl HG. The lantibiotic mersacidin inhibits

peptidoglycan synthesis by targeting lipid II. Antimicrob Agents Chemother. 1998,42(1):154-160.

109. Makino A, Baba T, Fujimoto K, Iwamoto K, Yano Y, Terada N, Ohno S, Sato SB, Ohta A, Umeda M.

et al. Cinnamycin (Ro 09-0198) promotes cell binding and toxicity by inducing transbilayer lipid

movement. J Biol Chem. 2003,278(5):3204-3209.


37

110. van den Hooven HW, Lagerwerf FM, Heerma W, Haverkamp J, Piard JC, Hilbers CW, Siezen RJ,

Kuipers OP, Rollema HS. The structure of the lantibiotic lacticin 481 produced by Lactococcus lactis:

location of the thioether bridges. FEBS Lett. 1996,391(3):317-322.

111. Knerr PJ, Oman TJ, Garcia De Gonzalo CV, Lupoli TJ, Walker S, van der Donk WA. Non-

proteinogenic amino acids in lacticin 481 analogues result in more potent inhibition of peptidoglycan

transglycosylation. ACS Chem Biol.2012,7(11):1791-1795.

112. Wiedemann I, Bottiger T, Bonelli RR, Wiese A, Hagge SO, Gutsmann T, Seydel U, Deegan L, Hill C,

Ross P. et al. The mode of action of the lantibiotic lacticin 3147--a complex mechanism involving

specific interaction of two peptides and the cell wall precursor lipid II. Mol Microbiol. 2006,61(2):285-

296.

113. van Kraaij C, Breukink E, Noordermeer MA, Demel RA, Siezen RJ, Kuipers OP, de Kruijff B. Pore

formation by nisin involves translocation of its C-terminal part across the membrane. Biochemistry.

1998,37(46):16033-16040.

114. Breukink E, van Kraaij C, Demel RA, Siezen RJ, Kuipers OP, de Kruijff B. The C-terminal region of

nisin is responsible for the initial interaction of nisin with the target membrane. Biochemistry.

1997,36(23):6968-6976.

115. Brötz H, Bierbaum G, Reynolds PE, Sahl HG. The lantibiotic mersacidin inhibits peptidoglycan

biosynthesis at the level of transglycosylation. Eur J Biochem. 1997,246(1):193-199.

116. Hoffmann A, Pag U, Wiedemann I, Sahl H. Combination of antibiotic mechanisms in lantibiotics.

Farmaco. 2002,57(8):685-691.

117. Asaduzzaman SM, Mahin A, Bashar T, Noor R. Lantibiotics: A candidate for future generation of

antibiotics. Stamford J Microbiol. 2011,1(1):1-11.

118. Suda S, Hill C, Cotter PD, Ross RP. Investigating the importance of charged residues in lantibiotics.

Bioeng Bugs, 2010,1(5):345-351.

119. Breukink E, de Kruijff B. Lipid II as a target for antibiotics. Nat rev Drug discov. 2006,5(4):321-332.

120. Altena K, Guder A, Cramer C, Bierbaum G. Biosynthesis of the lantibiotic mersacidin: organization of

a type B lantibiotic gene cluster. Appl Environ Microbiol. 2000,66(6):2565-2571.

121. Schmitz S, Hoffmann A, Szekat C, Rudd B, Bierbaum G. The lantibiotic mersacidin is an autoinducing

peptide. Appl Environ Microbiol. 2006,72(11):7270-7277.

122. Guder A, Schmitter T, Wiedemann I, Sahl HG, Bierbaum G. Role of the single regulator MrsR1 and

the two-component system MrsR2/K2 in the regulation of mersacidin production and immunity. Appl

Environ Microbiol. 2002,68(1):106-113.

123. Barbosa J, Caetano T, Mendo S. Class I and Class II Lanthipeptides Produced by Bacillus spp. J Nat

Prod. 2015,78(11):2850-2866.

124. Hao K, He P, Blom J, Rueckert C, Mao Z, Wu Y, He Y, Borriss R. The genome of plant growth-

promoting Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601-Y2 contains a gene cluster

for mersacidin synthesis. J Bacteriol. 2012,194(12):3264-3265.

125. He P, Hao K, Blom J, Ruckert C, Vater J, Mao Z, Wu Y, Hou M, He P, He Y. et al. Genome sequence

of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and

expression of mersacidin and other secondary metabolites. J Biotechnol. 2012,164(2):281-291.

Chapter 1

38

126. Zhao X, de Jong A, Zhou Z, Kuipers OP. Complete genome sequence of Bacillus amyloliquefaciens

Strain BH072, isolated from honey. Genome Announcements. 2015,3(2):e00098-00015.

127. Kuipers OP, Beerthuyzen MM, de Ruyter PG, Luesink EJ, de Vos WM. Autoregulation of nisin

biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem. 1995,270(45):27299-27304.

128. Lubelski J, Rink R, Khusainov R, Moll GN, Kuipers OP. Biosynthesis, immunity, regulation, mode of

action and engineering of the model lantibiotic nisin. Cell Mol Life Sci. 2008,65(3):455-476.

129. Khosa S, Lagedroste M, Smits SH. Protein defense systems against the lantibiotic Nisin: function of the

immunity protein NisI and the resistance protein NSR. Front Microbiol. 2016,7:504.

130. Van der Meer JR, Polman J, Beerthuyzen MM, Siezen RJ, Kuipers OP, De Vos WM. Characterization

of the Lactococcus lactis nisin A operon genes nisP, encoding a subtilisin-like serine protease involved

in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis. J

Bacteriol. 1993,175(9):2578-2588.

131. Nagao J, Asaduzzaman SM, Aso Y, Okuda K, Nakayama J, Sonomoto K. Lantibiotics: insight and

foresight for new paradigm. J Biosci Bioeng. 2006,102(3):139-149.

132. Kuipers OP, Bierbaum G, Ottenwalder B, Dodd HM, Horn N, Metzger J, Kupke T, Gnau V, Bongers

R, Van den Bogaard P. et al. Protein engineering of lantibiotics. Antonie Van Leeuwenhoek.

1996,69(2):161-169.

133. Kuipers OP, Yap W, oilema H, Beerthuyzen M, Siezen R, de Vos WM. Expression of wild-type and

mutant nisin genes in Lactococcus lactis in Nisin and novel lantibiotics. Leiden: Escom Publ; 1991.

134. Kuipers OP, Rollema HS, Bongers R, van den Bogaard P, Kosters H, de Vos WM, Siezen RJ.

Structure-function relationships of nisin studied by protein engineering. In: 2nd International Workshop

on Lantibiotics. Arnhem, the Netherlands; 1994.

135. Field D, Connor PM, Cotter PD, Hill C, Ross RP. The generation of nisin variants with enhanced

activity against specific Gram-positive pathogens. Mol Microbiol. 2008,69(1):218-230.

136. Yuan J, Zhang ZZ, Chen XZ, Yang W, Huan LD. Site-directed mutagenesis of the hinge region of

nisinZ and properties of nisin Z mutants. Appl Microbiol Biotechnol. 2004,64(6):806-815.

137. Zhou L, van Heel AJ, Montalban-Lopez M, Kuipers OP. Potentiating the activity of nisin against

Escherichia coli. Front Cell Dev Biol. 2016,4:7.

138. Kuipers OP, de Ruyter PG, Kleerebezem M, de Vos WM. Quorum sensing-controlled gene expression

in lactic acid bacteria. J Biotechnol. 1998,64:15-21.

139. Koebmann BJ, Nilsson D, Kuipers OP, Jensen PR. The membrane-bound H(+)-ATPase complex is

essential for growth of Lactococcus lactis. J Bacteriol. 2000,182(17):4738-4743.

140. Boels IC, Kleerebezem M, de Vos WM. Engineering of carbon distribution between glycolysis and

sugar nucleotide biosynthesis in Lactococcus lactis. Appl Environ Microbiol. 2003,69(2):1129-1135.

141. Boels IC, Beerthuyzen MM, Kosters MHW, Van Kaauwen MPW, Kleerebezem M, de Vos WM.

Identification and functional characterization of the Lactococcus lactis rfb operon, required for dTDP-

rhamnose biosynthesis. J Bacteriol. 2004,186(5):1239-1248.

142. Simoes-Barbosa A, Abreu H, Silva Neto A, Gruss A, Langella P. A food-grade delivery system for

Lactococcus lactis and evaluation of inducible gene expression. Appl Microbiol Biotechnol.

2004,65(1):61-67.


39

143. de Ruyter PG, Kuipers OP, de Vos WM. Controlled gene expression systems for Lactococcus lactis

with the food-grade inducer nisin. Appl Environ Microbiol. 1996,62(10):3662-3667.

144. Mierau I, Kleerebezem M. 10 years of the nisin-controlled gene expression system (NICE) in

Lactococcus lactis. Appl Microbiol Biotechnol. 2005,68(6):705-717.

41

Chapter 2

Identification and classification of known

and putative antimicrobial compounds

produced by a wide variety of Bacillales

species

Xin Zhao1,2

, Oscar P. Kuipers1*

1 Department of Molecular Genetics, University of Groningen, Nijenborgh 7, 9747AG

Groningen, the Netherlands

2 School of Chemical Engineering and Technology, Tianjin University, 300072 Tianjin,

P. R. China

This chapter has been published in BMC Genomics.

doi: 10.1186/s12864-016-3224-y (2016).

Chapter 2

42

Abstract

Gram-positive bacteria of the Bacillales are important producers of antimicrobial

compounds that might be utilized for medical, food or agricultural applications.

Thanks to the wide availability of whole genome sequence data and the

development of specific genome mining tools, novel antimicrobial compounds,

either ribosomally- or non-ribosomally produced, of various Bacillales species can

be predicted and classified. Here, we provide a classification scheme of known and

putative antimicrobial compounds in the specific context of Bacillales species. We

identify and describe known and putative bacteriocins, non-ribosomally

synthesized peptides (NRPs), polyketides (PKs) and other antimicrobials from 328

whole-genome sequenced strains of 57 species of Bacillales by using web-based

genome-mining prediction tools. We provide a new classification scheme for

bacteriocins, update the findings of NRPs and PKs and investigate their

characteristics and suitability for biocontrol by describing per class their genetic

organization and structure. Moreover, we highlight the potential of several known

and novel antimicrobials from various species of Bacillales. Our extended

classification of antimicrobial compounds demonstrates that the genus Bacillales

provides a rich source of novel antimicrobials that can now readily be tapped

experimentally, since many new gene clusters are identified.

Keywords: antimicrobials, Bacillales, Bacillus, genome-mining, lanthipeptides,

sactipeptides, thiopeptides, NRPs, PKs

Antimicrobial Compounds of Bacillales Species

43

1. Introduction

Most of the species of the genus Bacillus and related Firmicutes are Gram-positive,

aerobic endospore-forming and rod-shaped bacteria, which are found in diverse

environments such as soil and clay, rocks, dust, aquatic environments, on

vegetation, in food and in the gastrointestinal tracts of various insects and animals

[1]. Antimicrobial compounds have been used for a variety of purposes, such as

delaying spoilage by plant pathogens in agriculture and extending product shelf life

in the food industry [2, 3]. In particular, Bacillus strains are known to produce a

wide variety of biocontrol metabolites, including the ribosomally synthesized

antimicrobial peptides (bacteriocins) [4], as well as non-ribosomally synthesized

peptides (NRPs) and polyketides (PKs) [5].

The discovery of biosynthetic gene clusters of antimicrobial compounds by

genome mining is a rewarding task, because this methodology can lead to the

identification and subsequent isolation of novel molecules of pharmacological and

biotechnological interest [6]. Various powerful tools with broad databases have

been created for the automated screening of bacteriocin gene clusters. BAGEL3

(http://bagel.molgenrug.nl/) is a versatile fast genome-mining tool valid not only

for modified- and non-modified bacteriocins, but also for non-bactericidal

ribosomally produced and posttranslationally modified peptides (RiPPs) [7]. A

detailed prediction of the gene clusters of NRPs, PKs and other antimicrobials is

provided by antiSMASH (http://antismash.secondarymetabolites.org), a web server

and stand-alone tool for the automatic genomic identification and analysis of

biosynthetic gene clusters [8-10].

Although a description of Bacillus subtilis antimicrobials has been made before

(excellent review of Stein, 2005) [11], we aim to give an updated overview and

classification of bacteriocins covering various species of Bacillales, as well as

http://antismash.secondarymetabolites.org/

Chapter 2

44

NRPs and PKs, by genome mining of 57 different species within 328 whole-

genome sequenced strains of Bacillales reported before March 2016 (Table 1,

Table S1 and Fig. 1). We also highlight examples of each class by describing the

genetics, structure and mechanism of action, with a keen eye on biocontrol

properties and applications. Within the genus Bacillus, B. subtilis, B.

amyloliquefaciens, B. licheniformis, B. cereus and B. thuringiensis are the best-

studied species for antimicrobials production [12]. Genome mining and subsequent

analyses and classification of antimicrobials of other less explored Bacillales,

including Paenibacillus, Brevibacillus, Alicyclolacillus, Anoxybacillus,

Lysinibacillus and Geobacillus will be also included in this analysis, revealing

interesting new features and distributions.

2. Results

Classification of antimicrobial peptides encountered in

Bacillales

The main classification scheme for ribosomally synthesized antimicrobial peptides

currently available is that of the lactic acid bacteria (LAB) bacteriocins [13], which

was recently reviewed and revised by Alvarez-Sieiro et al (2016) [14]. The main

classification scheme for RiPPs (Class I) was provided by the paper of Arnison et

al (2013) [15]. Although some bacteriocins produced by Bacillus are similar to

those of LAB’s, the Bacillus antimicrobial compound classification system now is

lagging behind that of LAB classifications. Conveniently, BAGEL3 can be used

for mining bacteriocin gene clusters, some of which were not identified before.

Moreover, some cryptic gene clusters of bacteriocins were identified that have not

been isolated yet from wild-type microorganisms. In this study, we identified 583

putative bacteriocin gene clusters from 328 strains of 57 species of Bacillales

(Table 1), and these gene clusters were further classified into 3 classes harboring


45

46 types of bacteriocins covering 50 species of Bacillales (Table 2) according to

their gene organization and the homologies of their structural and biosynthetic

genes. In addition to the published bacteriocins, many novel putative bacteriocin

gene clusters were discovered. Combining this with the genome mining results of

antiSMASH, we also address the non-ribosomally synthesized and polyketide

synthesized antimicrobial compounds. In total 1231 putative non-ribosomal

antimicrobial gene clusters were detected and subgrouped into 23 types of NRPs, 5

types of PKs and 3 types of NRPS/PKS hybrid synthesized compounds distributed

over 49 species of Bacillales (Table 3). In the following sections, we will describe

the various classes of ribosomally synthesized peptides, NRPs, PKs and other

antimicrobials present in Bacillales and indicate their presence in the various

genomes.

2.1. Ribosomally synthesized antimicrobial peptides

The classification system used in this paper for Bacillus ribosomally synthesized

antimicrobial peptides (Table 1) comprises the major Class I: small RiPPs (based

on Arnison et al) [15] Class II: unmodified bacteriocins; Class III: large

antimicrobial proteins (see also Alvarez-Sieiro et al 2016) [14]. Characteristics of

the identified bacteriocins of Bacillales are listed in Table 2, describing their

precursor sequences, gene clusters and predicted producer species, respectively.

2.1.1. Class I: Ribosomally produced and posttranslationally modified peptides

(RiPPs)

This class consists of antimicrobial peptides (less than 10 kDa) that are ribosomally

synthesized, undergoing posttranslational modifications (PTMs), resulting in

different structures and properties. In this study, we found 438 putative gene

clusters of class I bacteriocins, widely distributed over 49 species of Bacillales

(Table 1). According to the modification differences, this class can be subdivided

Chapter 2

46

into 7 subclasses. Subclass 1 includes peptides with modifications typical for

lantibiotics (e.g. lanthionine), while subclasses 2-7 include peptides with other

unique modifications [15-17].

Subclass 1: Lanthipeptides

Lanthipeptides are peptides containing unusual amino acids, such as

dehydroalanine/dehydrobutyrine, lanthionine/methyl-lanthionine residues,

introduced by different kinds of PTMs [15]. Lanthipeptides with antimicrobial

activity form the so-called lantibiotics [17], which can be subdivided into 4

subclasses, following the classification scheme of lanthipeptides [18]. The main

differences between class I, II, III and IV lanthipeptides are the PTM enzymes

involved. Class I lanthipeptides are modified by two distinct enzymes that carry out

the PTM process: dehydratase LanB and cyclase LanC, while class II peptides are

modified by a bifunctional lanthionine-introducing enzyme, called LanM. There

are also two-component lanthipeptides consisting of two peptides, which belong to

class II lanthipeptide, because they are processed by a single modifying enzyme,

called LanM [19-23]. For other lanthipeptides (class III and IV), the dehydration

and cyclization reactions are catalyzed by multifunctional enzymes (RamC/LabKC

or LanL) or they lack significant antibiotic activity, which are not further described

here [24].

Subtilin is a well-investigated class I lanthipeptide produced by B. subtilis, the

encoding gene cluster of which is also found in the genome of Bacillus sp. YP1.

The gene encoding subtilin encodes a 56-residue peptide precursor that is

processed to yield the 32-residue mature peptide, which is structurally related to

the lantibiotic nisin of Lactococus lactis [25]. The subtilin gene cluster includes the

structural gene spaS, encoding its prepeptide; PTM genes precursor subtilin spaB

and spaC, encoding a dehydratase and a cyclase for lanthionine formation,

respectively; transporter gene spaT for modified precursor export and immunity


47

genes spaIFEG (Table 2) [26-28]. The presubtilin will be converted to mature

subtilin by serine proteases secreted by B. subtilis [29]. Subtilin exhibits

bactericidal activity against a broad spectrum of Gram-positive bacteria, based on

pore formation in the cytoplasmic membrane, using cell wall precursors such as

lipid II and undecaprenyl pyrophosphate, the hydrophobic carrier module for

peptidoglycan monomers, as docking module and as a central constituent of the

pore [30-31]. The class II lanthipeptide mersacidin produced by several B.

amyloliquefaciens strains [32-34], with a more globular structure comprising 20

amino acid residues, inhibits cell wall biosynthesis by binding to lipid II [35-36].

The mersacidin gene cluster includes the structural gene mrsA, two modification

genes (Table 2), i.e. mrsM coding for both dehydration and cyclation and mrsD

coding for a C-terminal S-[(Z)-2-aminovinyl]-3methyl-D-cysteine formation

enzyme, and the gene mrsT coding for a transporter with an associated protease

domain, as well as three genes, mrsEFG, coding for immunity and three genes,

mrsR1,R2,K1, coding for regulation [37-39].

A total of 105 putative lanthipeptide gene clusters were discovered in Bacillales in

this study (Table 1). Among them, gene clusters of class I lanthipeptides distribute

over the genomes of B. subtilis, B. thuringinensis, B. cereus, B. megaterium, B.

mycoides, B. clausii, Bacillus sp., Geobacillus thermodenitrificans, Geobacillus

kaustophilus, Paenibacillus polymyxa, Paenibacillus larvae, Paenibacillus peoriae

and Paenibacillus durus, while gene clusters of class II lanthipeptides distribute

over the genomes of B. thuringinensis, B. cereus, B. amyloliquefaciens, B.

licheniformis, B. mycoides, B. halodurans, B. methylotrophicus, B.

paralicheniformis, B. endophyticus, B. pseudomycoides, Bacillus sp., G.

thermodenitrificans, P. polymyxa, P. durus and Paenibacillus sp. (Table 2 and Fig.

2). Class I lanthipeptides identified by BAGEL3 includes subtilin, clausin,

subtilomycin and geobacillin I [22, 40-42]. Gene clusters of entianin, ericinA/S,

paenibacillin, paenicidin A, B, thuricin 4A and its derivative thuricin 4D were not

Chapter 2

48

found by genome mining tools (because whole genome sequences of the producing

organisms were not available in most cases) but were also added to the list (Table

2) [43-47]. Class II lanthipeptides usually exhibit a globular structure, including

mersacidin, amylolysin, pseudomycoicidin, cerecidin A1-A6 and geobacillin II;

also two-component class II lanthipeptides including haloduracin and lichenicidin

were identified [19, 22, 23, 48-52]. It is notable that gene clusters of two novel

subtilin-like lantibiotics were found in several P. polymyxa strains. By further

analysis, both of their sequence of core peptides showed high similarity with the N-

terminal part of subtilin but were quite different in the C-terminal part. Moreover,

we report a novel gallidermin/nisin-like lantibiotic from genomes of Bacillus

mycoides ATCC 6462, B. mycoides 2048 and B. cereus AH1272. Looking into the

sequence of its precursor peptide (see Table 2), it has the conserved F(N/D)LD

motif in its leader and theoretically could form the same rings as gallidermin/nisin

according to the position of serine and cysteine residues. All of the 3 putative

lantibiotics have lanBC genes in their gene clusters, which suggest they are

involved in their production. A gene cluster of a two-peptide bacteriocin was found

in the genome of B. cereus Q1. Due to the existence of a lanM gene, it was

predicted to be a class II lanthipeptide. Interestingly, the C-terminal parts of both

its core peptides are similar to lichenicidin and haloduracin, and the N-terminal

part of one of the core peptides shows high similarity with one of cytolysins

produced by Enterococcus faecalis [53].

Subclass 2: Head to tail cyclized peptides

Head to tail cyclic peptides are named by their unifying feature, which is the head

to tail circularization of their peptide backbones by direct linkage of their N- and

C-terminal amino acids, resulting in a well-defined three-dimensional structure, by

folding in α-helical manner [54-57]. To our knowledge, these peptides contain no

lanthionine, β-methyl-lanthionine, and dehydrated residues, making them clearly


49

distinguishable from lanthipeptides [58].

Amylocyclicin was recently reported to be produced by B. amyloliquefaciens

FZB42 and identified as a novel circular bacteriocin [59], which is derived from

the 112 amino acid precursor AcnA (Table 2) encoded by acnA, with a 48 amino

acid derived leader cleaved by a protease that is still unknown, and then

circularization occurring between Leu-1 and Trp-64 [59]. There are gene clusters

present, regulating their maturation (e.g. circularization and cleavage),

transportation and self-protection. The first gene of the putative operon, acnB,

encodes a membrane-anchored protein comprising five transmembrane helices with

unknown function. acnD is likely to encode the transporter complex, whereas

AcnC might act as circularization enzyme showing high similarity with the

sequence of UclB, which brings uberlysin to maturation [60]. AcnEF are proposed

to be the putative immunity genes. Amylocyclicin has the ability to inhibit Gram-

positive bacteria like B. subtilis, but not against Gram-negative bacteria.

There are 52 gene clusters of putative head to tail cyclized peptides identified in

this genome-mining study, which distribute over the genomes of B. thuringiensis,

B. cereus, B. coagulans, B. pumilus, B. paralicheniformis, B. gobiensis, Bacillus

sp., Kyrpidia tusciae, Geobacillus stearothermophilus, G. kaustophilus,

Geobacillus sp., P. larvae and Paenibacillus mucilaginosus (Table 1 and Fig. 2).

An amylocyclicin-like circular bacteriocin gene cluster was found in the genomes

of B. coagulans. The core peptide sequence is identical to that of amylocyclicin of

B. amyloliquefaciens FZB42, but the leader peptide sequence is quite different

(Table 2). It is noteworthy that a gene cluster of an uberolysin-like peptide was

detected in the genome of Bacillus sp. 1NAL3E and gene clusters of circularin

A/bacteriocin AS-48 like peptide were detected in several Geobacillus sp., while

uberolysin was produced by Streptococcus uberis, circularin A was produced by

Clostridium beijerinckii and bacteriocin AS-48 was produced by E. faecalis [54,

Chapter 2

50

60-63]. From the core peptide sequences, their circularization is most likely being

formed between leucine and tryptophan (Table 2). There are also other putative

gene clusters of head to tail cyclized peptides found in this study, but notably these

show no similarity with reported peptides. Whether these are real circular

bacteriocins or not, need to be further investigated experimentally.

Subclass 3: Sactipeptides

Sactipeptides form a class of cyclic antimicrobial peptides with unusual sulfur to α-

carbon cross-links, which are catalyzed by radical S-adenosylmethionine (SAM)

enzymes in a leader peptide-dependent manner [64, 65]. Posttranslational linkage

of a thiol to the α-carbon of an amino acid residue responsible for their

antimicrobial bioactivities is rare in ribosomal synthesized peptides and they are

classified as an independent group [66-68]. These unusual linkages differ from

lanthionine bridges containing sulfur to β-carbon linkages.

Subtilosin A is a 35-residue peptide, formed by cleavage of a seven amino acid

leader peptide, cyclization of the N- and C-terminal parts, and further modification

of cysteine, threonine and phenylalanine residues. The maturation of subtilosin A

begins with the transcription and translation of the sbo-alb genes (Table 2),

resulting in the precursor peptide SboA [69, 70]. Subsequently, the radical SAM

enzyme AlbA generates the thioether linkages between the sulfur atom of the

cysteine residue and the α-carbon of the threonine residue [68]. Afterwards, either

AlbE or AlbF (putative proteases) cleaves off the leader peptide. In the last step,

the peptide backbone is circularized by one of the two proteases, resulting in

subtilosin A, which is subsequently exported by the putative ABC transporter

AlbC. The operon is induced under anaerobic conditions and is controlled by the

transition state regulatory protein AbrB [4]. It shows antibacterial activity against

Bacillus spp., E. faecalis, Gardnerella vaginalis and Listeria monocytogenes by

targeting their membranes and forming pores [71-73].


51

In this study, we found 87 putative gene clusters of sactipeptides in the genomes of

Bacillales (Table 1), most of which belong to 3 reported types of sactipeptides

(Table 2): subtilosin A from B. subtilis, B. atrophaeus, B. simthii and Bacillus sp.

strains; sporulation killing factor (SKF) from B. atrophaeus, B. pumilus and B.

subtilis strains; and thuricins, such as thuricin H (17) and thuricin CD from B.

thuringiensis and B. cereus [67, 74-77]. We found several other putative gene

clusters of sactipeptides in the genomes of B. clausii, G. stearothermophilus,

Brevibacillus laterosporus, P. larvae, Paenibacillus odorifer, Paenibacillus

graminis, Paenibacillus riograndensis and Paenibacillus sp. (Table 2 and Fig. 2),

which showed very limited similarity with reported sactipeptides, and that need to

be further experimentally confirmed.

Subclass 4: Linear azole-containing peptides (LAPs)

The linear azole-containing peptides (LAPs), form an important subgroup of RiPPs

with a distinguishing heterocyclic ring of oxazoles and thiazoles derived from

serine/threonine and cysteine by enzymatic cyclodehydration and dehydrogenation

[78-81]. Prominent natural products such as microcin B17 produced by

Escherichia coli and streptolysin S produced by LAB, are model of representive

LAPs peptides [82-86]. The LAP family has already been extended with

plantazolicin A and B produced by B. amyloliquefaciens and B. methylotrophicus

[80, 81].

Plantazolicin A (Table 2) and its desmethyl analogue plantazolicin B represent an

unusual type of thioazole/oxazole-containing peptide antibiotic with a hitherto

unknown mechanism of action, which show inhibition against Bacillus [80, 87].

The mature product plantazolicin is a linear 41 amino acid precursor peptide with

the 14 amino acid core-peptide encoded by the structural gene pznA. The trimeric

protein complex PznBCD (cyclodehydratase, dehydrogenase, and

docking/scaffolding protein) likely catalyzes PTMs of ten cyclodehydrations

Chapter 2

52

followed by nine dehydrogenations. After the protease PznE cleaves off the leader

peptide to yield desmethylplantazolicin plantazolicin B, a final N, N-

bismethylation by methyltransferase PznL gives plantazolicin A [80, 81].

A total of 117 putative gene clusters of LAPs occupy 20 % of the total putative

gene clusters of bacteriocins in this study and are widely distributed in more than

20 species of Bacillales (Table 1 and Fig. 2). However, only plantazolicin A and B

produced by B. amyloliquefaciens and B. methylotrophicus have been reported

before (Table 2). This means that many novel LAPs can be found and need further

experimental investigation.

Subclass 5: Thiopeptides

Thiopeptides, or thiazolyl peptides are highly modified via either non-ribosomal or

ribosomal assembly, with a six-membered nitrogenous macrocycle being central of

piperidine/pyridine/dehydropiperidine and including additional thiazoles and

dehydrated amino acid residues [15, 88, 89]. Because of the trithiazolyl

(tetrahydro) pyridine core, they display high affinity binding to either the 50S

ribosomal subunit or elongation factor Tu.

In the thiocillins, found in the producer B. cereus ATCC 14579, at least 10 and up

to 13 of the 14 C-terminal residues undergo PTM to generate a set of eight related

antibiotics. The thiocillin gene cluster contains four identical copies of a gene

encoding a 52-residue precursor peptide (tclE-H), which is thought to be

posttranslationally modified to yield the mature antibiotic scaffold (Table 2). Four

of the eight thiocillins produced abundantly by B. cereus display similar efficacies

against B. subtilis and two methicillin-resistant Staphylococcus aureus (MRSA)

strains [90, 91].


53

Thiopeptide gene clusters involved in ribosomal synthesis are found in the genome

sequences of several B. cereus, B. subtilis and Lysinibacillus sphaericus (Table 2

and Fig. 2), which might go beyond the classification for LAB bacteriocins [14].

Subclass 6: Glycocins

Glycocins are bacteriocins with glycosylated residues. There are various unique

and diverse putative glycopeptide containing bacteriocins named glycocins in

Firmicutes [15, 92].

There is one model glycopeptide bacteriocin, sublancin 168 (Table 2), produced by

B. subtilis with a β-S-linked glucose moiety attached to cysteine22 and two

disulfides [92-95]. The sublancin 168 biosynthetic gene cluster contains the

precursor gene sunA coding a 56-residue polypeptide consisting of a 19-residue

leader peptide and a 37-residue mature peptide and genes bdbA and bdbB encoding

two thiol-disulfide oxidoreductases, i.e. BdbA and BdbB [95, 96]. In addition, it

contains two open reading frames of unknown function, yolJ and yolF. YolF was

recently suggested to be important for immunity of the producing strain and was

renamed SunI; the function of YolJ has not yet been reported [97]. SunT is

responsible for transport. The antimicrobial activity spectrum of sublancin 168 was

like that of lantibiotics, inhibiting Gram-positive bacteria, but not Gram-negative

bacteria; and acts also similar to the lantibiotics nisin and subtilin in its ability to

inhibit both bacterial spore outgrowth and vegetative cell growth [17].

In addition to sublancin 168 found in B. subtilis, genome-mining study indicated

that 9 other putative gene clusters of glycocins were found in genomes of B.

thuringiensis, B. cereus, B. weihenstephanensis, B. lehensis, Bacillus sp.,

Geobacillus sp. and Paenibacillus sp., which need further characterization (Table 1

and Fig. 2).

Chapter 2

54

Subclass 7: Lasso peptides

Lasso peptides, which form an emerging class of RiPPs from bacteria, were first

described in 1991 [98]. Their defining structural feature is an N-terminal

macrolactam ring that is threaded by the C-terminal tail resulting in a unique lasso

structure - the so-called lariat knot. The ring is formed by an isopeptide bond

between the N-terminal α-amino group of a glycine, alanine, serine, or cysteine and

the carboxylic acid side chain of an aspartate or glutamate, which can be located at

positions 7, 8, or 9 of the amino acid sequence [16, 99].

In general, lasso peptide production requires at least three genes encoding a

precursor peptide A, a cysteine protease B, and an ATP-dependent lactam

synthetase C. Gene clusters might contain additional genes, but so far no system

was proven to be in need of an additional enzyme to produce mature lasso peptides

[100-104]. Microcin J25 produced by E. coli AY25 has served as a model for

studies of lasso peptides [105]. Known lasso peptides display antimicrobial activity

by enzyme inhibition [106, 107].

Genome mining of Bacillales indicated 48 gene clusters of hypothetical peptides,

which are likely lasso peptides in the genomes of 20 Bacillales species (Table 1

and Fig. 2), but these still need to be experimentally confirmed.

2.1.2. Class II: unmodified bacteriocins

Class II bacteriocins include small (less than 10 kDa), ribosomally synthesized,

heat-stable, membrane-active linear peptides [4, 108, 109]. According to genome

mining results, we found in total 121 putative gene clusters of class II bacteriocins

distributed over 16 species of Bacillales (Table 1 and Fig. 2). This class can be

subdivided into 2 subclasses: 1. Pediocin-like peptides; 2. Other unmodified

peptides (Table 2).


55

Subclass 1: Pediocin-like peptides

The pediocin-like bacteriocins are antilisterial peptides that have a YGNGVXC

consensus motif [110, 111]. Coagulin produced by B. coagulans I4 is a peptide of

44 residues has an amino acid sequence similar to that described for pediocins AcH

and PA-1 [109, 112]. Coagulin and pediocin differ only by a single amino acid at

their C-terminus (asparagine41threonine). Gene clusters of coagulin are located on

a plasmid including the structural gene coaA, immunity gene coaB, and ABC

transporter genes coaC and coaD [113].

Subclass 2: Other unmodified peptides

Subclass 2 includes other unmodified peptides, such as lichenin produced by B.

licheniformis, or cereins produced by B. cereus, which have already been described

in a previous review although not yet detected in the reported complete genome

sequences [4]. We found a lactobin A family protein [114] and a lactococcin A1

family protein [115] belonging to class II bacteriocins from Anoxybacillus

flavithermus WK1. Here, we mainly added some new members of Bacillus class II

bacteriocins detected by BAGEL3, in particular holins and holin-like peptide BhlA,

antimicrobial peptide LCI, and leaderless bacteriocin aureocin A53 (Table 2).

Analysis of all Bacillales genome sequences revealed the presence of a structural

gene encoding a holin in Geobacillus sp. WCH70 and BhlA encoding genes in

most of B. subtilis, B. amyloliquefaciens, B. mycoides, B. pseudomycoides, B.

licheniformis, B. pumilus and B. thuringiensis, and further structural analysis of

their sequence revealed features similar to holin (Table 2) [116, 117]. Holins are

phage-encoded proteins involved in the disruption of bacterial membrane to

facilitate the release of progeny phage particles [118-121]. However, the functions

of these specific ORFs have not yet been identified. The bacteriocin-related holin-

like peptide BhlA from Bacillus showed antibacterial activity against several

Chapter 2

56

Gram-positive bacteria, including MRSA and Micrococcus luteus by destroying

cell membranes [122]. BhlA consists of 70 amino acid residues with a single

transmembrane domain at the N-terminus, a number of highly charged amino acid

residues at the C-terminus. The presence of hydrophilic residues and the membrane

topology of BhlA make it different from holins [122].

The lci gene encoding LCI was found in the genomes of B. amyloliquefaciens and

B. methylotrophicus strains (Table 2), sharing 98%-100% identity with the LCI

sequence of B. subtilis. The antimicrobial peptide LCI was first identified and

isolated by Liu et al (1990) [123] from a B. subtilis strain named A014 that

possesses very strong antagonistic activity against the Gram-negative pathogen

Xanthomonas campestris pv oryzea causing rice leaf-blight disease, which is a

serious threat to rice production and causes great losses in yields in most rice fields

annually. LCI is a β-structure antimicrobial peptide containing 47 residues of 5460

Da with no disulfide bridge or circular structure. It also contains a hydrophobic

core formed by valine5, tyrosine41 and tryptophan44 as well as 23 H-bonds which

contribute to its considerable thermal stability [124, 125]. According to our

BAGEL3 gene cluster mining results, there are 2 genes: a structural gene lci and an

immunity/transporter-like gene which was still unknown. LCI’s positively charged

residues lead to a short-lived channel in the bacterial membrane of sensitive strains

[126].

Another new member of Bacillus class II bacteriocins is leaderless aureocin A53,

whose gene cluster was identified in the genome sequence of B. pumilus strains

(Table 2). It is active against L. monocytogenes by dissipating the membrane

potential and simultaneously stopped biosynthesis of DNA, polysaccharides, and

protein [127]. Aureocin A53 is a highly cationic 49-residue peptide containing six

lysine and four tryptophan residues. Unlike most class II bacteriocins, aureocin

A53 is synthesized without a leader peptide and retains a formylated N-terminus.


57

Notably, genes for biosynthetic enzymes, immunity functions, or regulation of

biosynthesis are not found in the vicinity of the aureocin A53 structural gene [128].

2.1.3. Class III: large antimicrobial proteins

This group includes large proteins (larger than 10 kDa) with antimicrobial activity.

Gene clusters of these proteins normally include an immunity gene and a structural

gene [126]. We found 24 putative gene clusters of class III bacteriocins distributed

over 7 species of Bacillales (Table 1 and Fig. 2). In a previous review, megacins

produced by B. megaterium ATCC 19213 were reported as class III bacteriocins [4,

129]. Here, we identified and introduced some class III bacteriocins by BAGEL3

respresented by colicin, M23 peptidase and pyocin AP41 (Table 2).

Gene clusters of colicins were identified in the genomes of B. thuringiensis, B.

cereus and Bacillus sp. BH072 (Table 2). Channel-forming colicins (colicins A, B,

E1, Ia, Ib, and N) are transmembrane proteins that depolarize the cytoplasmic

membrane, leading to dissipation of cellular energy. Their immunity gene is often

produced constitutively, while the bacteriocin release protein is generally produced

only as a read-through of the stop codon on the colicin structural gene. The colicin

itself is repressed by the SOS response and may be regulated in other ways, as well

[130]. Pyocin AP41 is also discovered as a large bacteriocin from B. thuringiensis

(Table 2), which was first isolated from Pseudomonas aeruginosa PAF41.

According to literature, it showed a similar mode of action to that of colicin [131].

Interestingly, we found gene clusters of M23 peptidase in the genomes of B.

thuringiensis, B. coagulans and B. halodurans (Table 2), while M23 peptidase has

not been reported to be secreted by Bacillus before, and so needs to be further

experimentally confirmed. Over the past years, many members of the M23

metallopeptidase family have been identified and biochemically characterized.

Structures have been determined for some of them, e.g. LytM, LasA and recently

lysostaphin, a prototypic enzyme of the M23B group and the best-studied

Chapter 2

58

bacteriocin of this group [132, 133].

2.2. Non-ribosomal synthesized peptides (NRPs) and polyketides (PKs) of

Bacillales

NRPs and PKs encompass a variety of linear, cyclic and branched structures, which

are generated by complex enzymes known as non-ribosomal peptide synthetases

(NRPS), polyketide synthetases (PKS) and hybrid NRPS/PKS, respectively [134,

135]. Among them, NRPs produced by Bacillales include lipopeptides (LPs) and

others, with significant antimicrobial activity [136]. Here we present an extended

collection based on members described in a previous review by Aleti et al (2015)

[136]. By use of antiSMASH, we identified 31 types of putative NRPs, PKs and

NRPS/PKS hybrid synthesized antimicrobials, which will be described in detail

below. Characteristics of them are listed in Table 3 by displaying their chemical

structures, gene clusters and predicted producer species, respectively.

2.2.1. Lipopeptides (LPs)

Lipopeptides (LPs) are natural compounds of bacterial origin consisting of a

hydrophobic long alkyl chain linked to a hydrophilic polypeptide to form a cyclic

or linear structure [137]. According to our mining results, B. amyloliquefaciens, B.

methylotrophicus, B. atrophaeus, B. subtilis, B. licheniformis, B. paralicheniformis,

B. pumilus, B. lehensis, B. laterosporus, Bacillus sp., P. polymyxa, P. larvae, P.

mucilaginosus, P. peoriae, P. bovis, Paenibacillus terrae and Paenibacillus sp. are

likely to be the main producers of LPs, which are mainly known for their

antifungal properties [138-140]. Based on a previous genome mining work (see

review Aleti et al 2015), we identified locillomycins as novel members of LPs in

species of Bacillales (Table 3).

Traditional LPs (comprising the surfactins, iturins and fengycins) from Bacillus are

homologues differing in length, branching, and saturation of their acyl chain. The


59

surfactin family (exemplified by surfactin, lichenysins and pumilacidins) contain a

cyclic heptapeptide that forms a lactone bridge with ß hydroxy fatty acids [141].

The iturin group includes A, C, D and E isoforms, bacillomycin D, F and L and

mycosubtilin. All these compounds contain a cyclic heptapeptide acylated with ß

amino fatty acids [142, 143]. The fengycin family comprises the decapeptide

fengycin A and fengycin B, which differ in a single amino acid at the sixth position

(D-alanine and D-valine, respectively) [144]. Kurstakins form another family of

LPs composed of four partially cyclic heptalipopeptides, which differ only in their

fatty acid chains [145]. The gene clusters of the Bacillus LPs encoding the

surfactin, fengycin, iturin and kurstakin families have been described and

summarized in a number of recent reviews [6, 11, 136, 145]. Cerexins are linear

LPs with strong antimicrobial activity against S. aureus and Streptococcus

pneumoniae [146]. Kurstakins and cerexins are isolated and identified from B.

thuringiensis and B. cereus strains before, respectively [146, 147]. Locillomycins

(locillomycin A, B, and C derivatives), a novel family of cyclic lipopeptides active

against bacteria and viruses produced by B. subtilis 916 [148, 149], include a

unique nonapeptide sequence and macrocyclization. The locillomycin biosynthetic

gene cluster encodes 4 proteins (LocA, LocB, LocC, and LocD) that form a

hexamodular NRPS to biosynthesize cyclic nonapeptides.

Paenibacillus now are found to produce a large number of LPs [136]. Polymyxins

are cyclic cationic LPs which contain the non-proteogenic amino acid 2, 4-

diaminobutyric acid contributing to the overall positive charge of the cationic LPs,

exhibiting antibacterial activity against both Gram-positive and Gram-negative

bacteria by acting on their membranes. The gene cluster consists of five genes, of

which pmxA, B and E encode the polymyxin synthetase, whereas pmxC and D are

involved in transport [136, 150]. Another cationic lipopeptide, paenibacterin is a

new broad-spectrum antimicrobial agent consisting of a cyclic 13-residue peptide

and an N-terminal C15 fatty acyl chain [151]. There are also cyclic noncationic

Chapter 2

60

LPs from Paenibacillus comprising fusaricidins containing a cyclic hexapeptide

structure with antagonistic activity against Fusarium oxysporum, tridecaptins with

strong antimicrobial activity against Gram-negative bacteria. Polypeptins,

octapeptins, pelgipeptins, gavaserin and saltavalin are LPs isolated from

Paenibacillus sp. strains, reported before by other scientists, and should also be

included in this collection [136, 152-155].

2.2.2. Other NRPs

By antiSMASH, we also found non-lipopeptide but NRPSs gene clusters putatively

encoding NRPs with antimicrobial activity mainly in the species of Bacillus,

Paenibacillus and Brevibacilllus. We collected them as a group of other NRPs,

which is exemplified by the following NRPs (Table 3).

The non-ribosomal dodecapeptide bacitracin, released by some B. licheniformis

and B. subtilis strains, proved to be an inhibitor of cell wall biosynthesis of Gram-

positive bacteria [156, 157]. Small peptide bacilysin secreted by B. subtilis, B.

amyloliquefaciens and B. pumilus contains an N-terminal alanine residue and L-

anticapsin with antibacterial activity against S. aureus [158]. B. subtilis also

produces rhizocticins, phosphonate oligopeptide antibiotics containing the C-

terminal non-proteinogenic amino acid (Z)-1-2-amino-5-phosphono-3-pentenoic

acid displaying antifungal activity [159]. Petrobactin and bacillibactin produced by

several Bacillus strains under iron-limited conditions, are catecholate siderophores

associated with two operons, asb (for petrobactin) and bac (for bacillibactin) [160].

Sevadicin is a tripeptide (D-phenylalanine-D-alanine-tryptophan) produced by a

NRPS encoded by a gene cluster found in the genome of P. larvae, which was

shown to have antibacterial activity [161].

Both the cyclic peptides gramicidin S and tyrocidine, produced by Brevisbacillus,

consist of 10 amino acid residues [162]. Gramicidin S consists of 2 identical


61

pentapeptides, which are linked head to tail, and together form the stable

amphiphilic cyclic decapeptide. The first amino acid residue of the 2 pentapeptides

is in the D-configuration [163]. The peptide exhibits strong antibacterial and

antifungal activity [164]. Tyrocidine, actually a mixture of slightly different

decapeptides, is active against several Gram-positive bacteria and it has been

suggested that this peptide plays a role in the regulation of sporulation of B. brevis

[162]. The gramicidin S biosynthesis operon (grs) contains 3 genes, which are

grsA, encoding the gramicidin S synthetase 1; grsB, encoding the gramicidin S

synthetase 2, and grsT, encoding a protein of unknown function. The sequence of

the grsA gene product showed a high similarity with the tyrocidine synthetase 1

(TycA protein) [165, 166].

2.2.3. Polyketides (PKs)

Polyketides represent a group of secondary metabolites, exhibiting remarkable

diversity both in terms of their structure and function. Polyketide natural products

are known to possess a wealth of pharmacologically important activities, including

antimicrobial, antifungal, antiparasitic, antitumor and agrochemical properties

(http://www.nii.ac.in/~pksdb/polyketide.html). Novel gene clusters likely encoding

similar PKSs were identified using antiSMASH. They were most prominent in B.

subtilis, B. amyloliquefaciens, B. methylotrophicus, B. atrophaeus, B. laterosporus

and Paenibacillus sp. (Table 3 and Fig. 2). The genus Bacillus produces 3 types of

PKs including bacillaene, difficidin and macrolactin; Paenibacillus produces

paenimacrolidin [6, 167]. B. laterosporus also produced the polyketide

basiliskamide with antifungal activity [168], and it was added as a novel member

of PKs in species of Bacillales (Table 3).

Bacillaene was first isolated from B. subtilis strains [169], are found to display a

linear structure comprising a conjugated hexane, while its gene clusters bae (baeJ,

L, M, N and R) has now been discovered in several other Bacillus genomes,

http://www.nii.ac.in/~pksdb/polyketide.html

Chapter 2

62

including B. amyloliquefaciens, B. atrophaeus and P. polymyxa. It is an inhibitor of

prokaryotic protein synthesis, constituted by an open-chain enamine acid with an

extended polyene system and shows good antimicrobial activity against human

pathogens such as Serratia marcescens, Klebsiella pneumoniae and S. aureus [37,

169, 170]. Difficidin is known to be produced by B. amyloliquefaciens strains,

which is active against the phytopathogen Erwinia amylovora causing fire blight,

and contains a highly unsaturated macrocyclic polyene comprising a 22 membered

carbon skeleton with a phosphate group rarely found in secondary metabolites

[171]. Difficidin is encoded by the gene cluster dif with 14 open reading frames

from difA to difN and difY. The contribution of the genes difJ and difK are unclear

and their potential activities are not seen in the final product [172]. Macrolactin has

also been isolated from B. amyloliquefaciens strains [173]. Most macrolactins

consist of a 24 membered lactone ring with three diene moieties in the carbon

backbone, which is encoded by the gene cluster mln, containing nine operons

including mlnA-I [174]. As the other Bacillus polyketides, macrolactins show

antibacterial activity and might have the potential to be used in medical

application. Moreover, they could inhibit the proliferation of murine melanoma

cancer cells and the replication of mammalian Herpes simplex virus and HIV in

lymphoblast cells [136, 173]. Paenimacrolidin was isolated from Paenibacillus sp.

F6-B70 with a 22 membered lactone ring showed high similarity with difficidin,

which has antimicrobial activity against Staphylococcus [167]. The polyketide

antibiotics basiliskamides A and B, which exhibit potent activity against Candida

albicans and Aspergillus fumigatus, both comprise a 21 membered carbon skeleton,

structurally identical in every respect, except for the position of the cinnamate

ester: C9 in basiliskamide A and C7 in basiliskamide B [175, 176].

2.2.4. NRPS/PKS hybrid synthesized compounds

There are 3 NRPS/PKS hybrid synthesized NRPs or PKs of Bacillales identified in

this study (Table 3). Paenilarvins are iturinic LPs exhibiting strong antifungal


63

activities [177-180]. Paenilarvin A and B were first isolated from P. larve strain,

whose NRPS gene clusters showed similarities with those of the iturin family LPs

[180]. Zwittermicin A is also a hybrid polyketide-nonribosomal peptide produced

by certain B. cereus group strains, inhibiting certain Gram-positive, Gram-

negative, and eukaryotic microorganisms [181, 182]. Paenilamicin is another

hybrid NRPS/PKS synthesized peptide with antibacterial and antifungal activity,

whose encoded gene clusters (pam) were found the genomic sequence of the Gram-

positive bacterium P. larvae [183].

In this study, 10 novel gene clusters encoding putative NRPs, PKs or NRPS/PKS

hybrids were predicted from the genome of B. brevis NBRC 100599, B. cereus

AH820, B. cereus G9842, B. cereus B4264, B. cereus E33L, B. thuringiensis

HD771, B. thuringiensis HD789, B. amyloliquefaciens DSM7, B.

amyloliquefaciens CC178, B. methylotrophicus NAU-B3, B. anthracis str. A0248,

B. anthracis str. H9401 and Bacillus sp. BH072. The identified gene clusters

(uncharacterized) show limited homology with gene clusters in the integrated

databases. Related genes encoding the biosynthesis, predicted structures and

antimicrobial activity of these compounds deserve to be experimentally validated.

Chapter 2

64

Table 1. Number of putative antimicrobial gene clusters identified in 328 Bacillales genomes (reported in Genbank)

Class RPs* RPs RPs RPs RPs RPs RPs RPs RPs RPs RPs NRPs PKs

I I I I I I I I II III TOT

AL

Genera Lanthipeptides

type I

Lanthipeptides

type II

Head to

tail

cyclized

peptides

Sacti-

peptides

Glyco-

cins

Lasso

peptides

LAPs Thio

pepti

des

Bacillus subtilis (39) 6 53 15 1 1 8 84 168 66

Bacillus thuringiensis

(46)

4 8 6 5 3 4 24 31 14 99 152

Bacillus anthracis (39) 25 25 117

Bacillus cereus (55) 1 16 11 4 1 9 34 3 22 4 105 144 1

Bacillus

amyloliquefaciens (13)

16 1 12 1 30 59 48

Bacillus licheniformis (3) 1 3 4 6 3

Bacillus coagulans (5) 6 1 7

Bacillus megaterium (5) 1 1 2 5 5

Bacillus pumilus (8) 8 2 14 24 17 8

Bacillus atrophaeus (4) 5 4 9 20 8

Bacillus

weihenstephanensis (2)

1 1 2 8

Bacillus mycoides (5) 2 4 5 5 4 20 14

Bacillus cytotoxicus (1) 1 1


65

Bacillus clausii (2) 1 2 3 2

Bacillus halodurans (1) 2 1 3

Bacillus cellulosilyticus

(1)

Bacillus infantis (1)

Bacillus selenitireducens

(1)

Bacillus methylotrophicus

(15)

7 4 15 26 68 58

Bacillus

paralicheniformis (3)

3 3 3 9 12 2

Bacillus methanolicus (1) 1 1 1

Bacillus endophyticus (1) 2 1 1 4 2 1

Bacillus smithii (1) 1 1 1

Bacillus pseudomycoides

(1)

1 1 1 1 4 3

Bacillus pseudofirmus (1) 1 1

Bacillus bombysepticus

(1)

4

Bacillus lehensis (1) 1 1 4

Bacillus toyonensis (1) 1 1 1 3 3

Bacillus gobiensis (1) 1 1 2 2 1

Bacillus sp. (13) 3 1 3 5 1 1 2 6 2 24 36 24

Kyrpidia tusciae (1) 3 3 1

Alicyclobacillus

Chapter 2

66

acidocaldarius (2)

Anoxybacillus

flavithermus (1)

2 2 1

Geobacillus

stearothermophilus (2)

1 1 1 3 2

Geobacillus

thermodenitrificans (1)

1 1 2 1

Geobacilllus kaustophilus

(1)

1 1 2 1

Geobacillus sp. (9) 5 1 2 1 9 3 6

Lysinibacillus sphaericus

(1)

1 1 3 1

Lysinibacillus fusiformis

(1)

1 1

Brevibacillus

laterosporus (1)

1 1 1 3 5

Brevibacillus brevis (1) 1 1 2 3 3

Paenibacillus polymyxa

(7)

11 3 7 21 39 7

Paenibacillus larvae (1) 1 2 2 1 1 7 4

Paenibacillus

mucilaginosus (3)

2 3 5 10 4

Paenibacillus peoriae (1) 1 1 2 6

Paenibacillus odorifer (1) 1 1 1

Paenibacillus stellifer (1) 1 1 1

Paenibacillus borealis (1) 1 1 1 2


67

Paenibacillus bovis (1) 1 1 4

Paenibacillus

naphthalenovorans (1)

1 1 1

Paenibacillus beijingensis

(1)

1

Paenibacillus graminis

(1)

1 1 4

Paenibacillus durus (2) 1 3 2 1 7 4 1

Paenibacillus terrae (1) 1 1 3

Paenibacilllus

riograndensis (1)

1 1 4

Paenibacillus sabinae (1) 1 1 1

Paenibacillus sp. (12) 3 3 1 3 1 11 22 6

TOTAL 34 71 52 87 24 48 117 5 121 24 583 964 267

Numbers in parentheses () indicate the number of genomes analyzed per genus.*RPs is short for ribosomally synthesized peptides.

Chapter 2

68

Table 2. Characteristics of ribosomally synthesized antimicrobial peptides of Bacillales

Name Precursor sequence (core peptide in

bold) Gene cluster*

Predicted

producer species

Examples

Classification Class I small RiPPs Subclass 1 Lanthipeptides Lanthipeptides class I

Subtilin MSKFDDFDLDVVKVSKQDSKI

TPQWKSESLCTPGCVTGALQ

TCFLQTLTCNCKISK

Bacillus subtilis,

Bacillus sp.

26, Bacillus sp. YP1

Ericin A MTNMSKFDDFDLDVVKVSKQ

DSKITPQVLSKSLCTPGCITGP

LQTCYLCFPTFAKC

B. subtilis

46

Ericin S MSKFDDFDLDVVKVSKQDSKI

TPQWKSESLCTPGCVTGVLQ

TCFLQTITCNCHISK

B. subtilis

46

Entianin MSKFDDFDLDVVKVSKQDSKI

TPQWKSESLCTPGCVTGLLQT

CFLQTITCNCKISK

B. subtilis 45

Subtilomyc

in

MEKNNIFDLDINKKMESTSEVS

AQTWATIGKTIVQSVKKCRTF

TCGCSLGSCSNCN

B. subtilis 42, B. subtilis OH 311

Paenibacilli

n

MKVDQMFDLDLRKSYEASELS

PQASIIKTTIKVSKAVCKTLTC

ICTGSCSNCK

Paenibacillus

polymyxa

43

Thuricin

4A

MNKELFDLDINKKMETPTEMT

AQTWTTIVKVSKAVCKTGTCI

Bacillus

thuringiensis

47


69

CTTSCSNCK

Clausin MEKAFDLDLEVVHTKAKDVQP

DFTSVSFCTPGCGETGSFNSF

CC

Bacillus clausii 41, B. clausii ENTPro

Paenicidin

A

MAENLFDLDIQVNKSQGSVEPQ

VLSIVACSSGCGSGKTAASCV

ETCGNRCFTNVGSLC

P. polymyxa,

Paenibacillus

terrae

44

Paenicidin

B

MANNLFDLDVQVNKSQGSVEP

QVLSIVACSSGCGSGKTAASC

VATCGNKCFTNVGSLC

P. polymyxa,

P. terrae,

Paenibacillus sp.

44

Geobacillin

I

MAKFDDFDLDIVVKKQDDVVQ

PNVTSKSLCTGCITGVLMCLT

QNSCVSCNSCIRC

Geobacillus

thermodenitrifica

ns

22, G. thermodenitrificans

NG80-2

Galidermin/

Nisin like

lantibiotic

MINEKNLFDLDVQTTASGDVDP

QITSISACTPGCGNTGSFNSFC

C

Bacillus

mycoides,

Bacillus cereus

B. mycoides ATCC 6462, B.

mycoides 2048, B. cereus

AH1272

Subtilin

like

lantibiotic

MKNQFDLDLQVAKNEVAPKG

VQPASGIICTPSCATGTLNCQ

VSLTFCKTC

P. polymyxa P. polymyxa SQR 21, P.

polymyxa CF05, P.

polymyxa CR1, P.

Polymyxa E681, P.

polymyxa M1, P. polymyxa

SC2

Subtilin

like

lantibiotic

MKNQFDLDLQVTKSESASKEL

QADSGIICTPTCLTSILNCYTSI

SHCGPC

P. polymyxa P. polymyxa M1, P.

polymyxa SC2

Classification Class I small RiPPs Subclass 1 Lanthipeptides Lanthipeptides class II

Chapter 2

70

Mersacidin MSQEAIIRSWKDPFSRENSTQN

PAGNPFSELKEAQMDKLVGAG

DMEAACTFTLPGGGGVCTLT

SECIC

Bacillus

amyloliquefaciens

,

Bacillus sp.

32, 33, 34, Bacillus sp.

BH072

Amylolysin MNEKMYRFAGDLREELEEISLS

EFSGGGGAEQRGISQGNDGKL

CTLTWECGLCPTHTCWC

B.

amyloliquefaciens

,

Bacillus

methylotrophicus

50, B. methylotrophicus

B25, B. methylotrophicus

NJN-6, B.

amyloliquefaciens LH15, B.

amyloliquefaciens LS60

Pseudomyc

oicidin

MNDKIIQYWNDPAKRSTLSAAE

LSKMPVNPAGDILAELSDADLD

KVVGAGDCGGTCTWTKDCSI

CPSWSCWSWSC

Bacillus

pseudomycoides

51, B. pseudomycoides

DSM 12442

Cerecidins MSKGYKFTKEELVEAWKDPQV

REKLNDLPKHPSGKALNELSEE

ELAEIQGASDVQPETTPLCVG

VIIGLTTSIKICK

B. cereus 52

Geobacillin

II

MKGGIQMEKQEQTFVSKISEEE

LKKLAGGYTEVSPQSTIVCVSL

RICNWSLRFPSFKVRCPM

G.

thermodenitrifica

ns

22, G. thermodenitrificans

NG80-2

Lichenicidi

n

A1:MSKKEMILSWKNPMYRTES

SYHPAGNILKELQEEEQHSIAG

GTITLSTCAILSKPLGNNGYLC

TVTKECMPSCN

A2:MKTMKNSAAREAFKGANH

PAGMVSEEELKALVGGNDVNP

Bacillus

licheniformis

21, B. licheniformis WX-02


71

ETTPATTSSWTCITAGVTVSAS

LCPTTKCTSRC

Haloduraci

n

A1:MTNLLKEWKMPLERTHNNS

NPAGDIFQELEDQDILAGVNGA

CAWYNISCRLGNKGAYCTLT

VECMPSCN

A2:MVNSKDLRNPEFRKAQGLQ

FVDEVNEKELSSLAGSGDVHA

QTTWPCATVGVSVALCPTTK

CTSQC

Bacillus

halodurans

19, B. halodurans C-125

Cytolysin/

Lichenicidi

n/

Haloduraci

n like

lantibiotic

A1:MSSKKVVESWKNPVLRSKN

EDAPSHPAGEVDSKEIKELFGA

GEGDVTPEGLSSWLGNKGGY

CTLTKECMPSCN

A2:MSKNEKLNKLRDQEFDTKE

LIGSVDENDLKQVAGAGDVNP

ETTPATPTIVAVSLGICPTTKC

TSKC

B. cereus B. cereus Q1

Classification Class I small RiPPs Subclass 2 Head to tail cyclized peptides

Amylocycli

cin

MMNLVKSNKKSFILFGAALAA

ATLVYALLLTGTELNVAAAHA

FSANAELASTLGISTAAAKKAI

DIIDAASTIASIISLIGIVTGAGA

ISYAIVATAKTMIKKYGKKYA

AAW

B.

methylotrophicus

59, B. methylotrophicus

FZB42

Chapter 2

72

Amylocycli

cin like

circular

bacteriocin

MVNSLSNKKRVFLFVVIGLVLA

TLSSVAYISTLQITIHQTAVLPG

NAYLASTLGISTAAAKKAIDII

DTASTIASIISLIGVVTGAGAIS

YAVVATAKAMIKKYGKKYAA

AW

Bacillus

coagulans

B. coagulans HM08

Uberolysin

like circular

bacteriocin

MLEAMGFFGVGKTLATQIVN

VVDAVGYAAIAVSTIMAILSA

GGLAPTAAAIDFAIIYIKKKIA

NNLKAQAIVW

Bacillus sp. Bacillus sp. 1NAL3E

Circularin

A/

Bacteriocin

AS-48 like

circular

bacteriocin

MSLLALVAGTLGVSQSIATTV

VSIVLTGSTLISIILGITAILSGG

VDAILEIGWSAFVATVKKIVA

ERGKAAAIAW

Geobacillus

stearothermophilu

s,

Geobacillus

kaustophilus,

Geobacillus sp.

G. stearothermophilus 10,

G. kaustophilus HTA426,

Geobacillus sp. C56T3,

Geobacillus sp. LC300

Classification Class I small RiPPs Subclass 3 Sactipeptides

Subtilosin

A

MKKAVIVENKGCATCSIGAAC

LVDGPIPDFEIAGATGLFGLW

G

B. subtilis,

Bacillus

atrophaeus,

Bacillus smithii,

Bacillus sp.

67, B. atrophaeus subsp.

globigii BSS, B. atrophaeus

1942, B. atrophaeus NRS

1221A, B. atrophaeus

UCMB-5137, B. smithii

DSM 4216, Bacillus sp. JS,

Bacillus sp. YP1, Bacillus

sp. BS34A, Bacillus sp. LM

4-2


73

SKF MKRNQKEWESVSKKGLMKPG

GTSIVKAAGCMGCWASKSIA

MTRVCALPHPAMRAI

B. subtilis,

Bacillus pumilus,

B. atrophaeus,

Bacillus sp.

74, B. pumilus NJ-M2, B.

pumilus NJ-V2, B.

atrophaeus UCMB-5137

Thuricin

H(17)

METPVVQPRDWTCWSCLVCA

ACSVELLNLVTAATGASTAS

B. thuringiensis,

B. cereus

75, B. cereus Rock4-2

Thuricin

CD

α:MEVMNNALITKVDEEIGGNA

ACVIGCIGSCVISEGIGSLVGTAF

TLGGNAACVIGCIGSCVISEGI

GSLVGTAFTLG

β:MEVLNKQNVNIIPESEEVGG

WVACVGACGTVCLASGGVGTE

FAAASYFLGWVACVGACGTV

CLASGGVGTEFAAASYFL

B. thuringiensis,

B. cereus

77, B. cereus 95-8201

Classification Class I small RiPPs Subclass 4 LAPs

Plantazolici

n

MTQIKVPTALIASVHGEGQHLF

EPMAARCTCTTIISSSSTF

B. subtilis,

B.

amyloliquefaciens

,

B.

methylotrophicus,

Bacillus sp.

80, B. subtilis B1, B.

amyloliquefaciens CC178,

B. methylotrophicus JJ-D34,

B. methylotrophicus FZB42,

B. methylotrophicus CAU

B946, B. methylotrophicus

UCMB5036, Bacillus sp.

WP8

Classification Class I small RiPPs Subsclass 5 Thiopeptides

Chapter 2

74

Thiocillin MSEIKKALNTLEIEDFDAIEMV

DVDAMPENEALEIMGASCTTC

VCTCSCCTT

B. cereus 91

Classification Class I small RiPPs Subclass 6 Glycocins

Sublancin

168

MEKLFKEVKLEELENQKGSGL

GKAQCAALWLQCASGGTIGC

GGGAVACQNYRQFCR

B. subtilis,

Bacillus sp.

92, Bacillus sp. BS34A

Classification Class II unmodified bacteriocins Subclass1 Pediocin-like peptides

Coagulin MKKIEKLTEKEMANIIGGKYYG

NGVTCGKHSCSVDWGKATTC

IINNGAMAWATGGHQGTHKC

B. coagulans 109

Classification Class II unmodified bacteriocins Subclass 2 Other unmodified peptides

Lichenin ISLEICXIFHDN - B. licheniformis 4

Cerein MENLQMLTEEELMEIEGGGW

WNSWGKCVAGTIGGAGTGG

LGGAAAGSAVPVIGTGIGGAI

GGVSGGLTGAATFC

-

B. cereus 4

Lactobin A

family

protein

MEGVVFTMELMLEKNGSISFLS

EEELKEIDGGRGSWTNAVIGAG

TLSPIVASAVRGAQQGVRFGRL

GGPWGVVAGAVVGAVVGGYL

GYDG

Anoxybacillus

flavithermus

A. flavithermus WK1

Lactococin

A1 family

protein

MFQELNHVELQGIDGGSWKSH

VVNLVGVVSGFGTTGAVIGGSF

GGPLGAAAGGFVGAHYGAVA

A. flavithermus A. flavithermus WK1


75

YAIGVLLDSSNRRK

Holin MDLTSIPIEQFVSNGVFALLFV

WLLVDTRKESKQREEKLIQQIE

KQNEAQERIVQAIERIEQKIEKL

EVSMNG

Geobacillus sp. Geobacillus sp. WCH70

BhlA MEMDISQYLITQGPFAVLFCWL

LFYVMKTSKERESKLYDQIDSQ

NEVLGKFSEKYDVVIEKLDKIE

SKVQ/MEEQIFNSMIQQGAFAA

LFVWMLFTTQKKNEQREEQYQ

KVIEKNQDVITKQAEAFGDLSK

DVSEIKQKILGSGDVQ/MEVDV

VQNLMTQGPFAVLFCWILFYVL

NTTKERENKLNEQIEAQNDVLA

KFSEKYDVVIDKLDKIERNLK

B. subtilis,

B. thuringiensis,

B. pumilus,

B. mycoides,

B.

pseudomycoides,

B.

amyloliquefaciens

B. subtilis T30, B. subtilis

subsp. inaquosorum, B.

subtilis subsp. spizizenii

NRS 231, B. thuringiensis

Bt407, B. thuringiensis

HD1002, B. thuringiensis

IBL4222, B. thuringiensis

serovar berliner ATCC

10792, B. thuringiensis

serovar thuringiensis str.

T01001, all B. pumilus in

this study, B. mycoides

Rock1-4, B. mycoides

219298, B. mycoides

Rock3-17, B.

pseudomycoides DSM

12442, B. amyloliquefaciens

DSM 7, B.

amyloliquefaciens XH7, B.

amyloliquefaciens

Chapter 2

76

MBE1283

LCI MKFKKVLTGSALSLALLMSAA

PAFAASPTASASAENSPISTKAD

AGINAIKLVQSPNGNFAASFVL

DGTTWIFKSKYYDSSKGYWV

GIYESVDK

B. subtilis,

B.

amyloliquefaciens

,

B.

methylotrophicus,

Bacillus sp.

123, B. amyloliquefaciens

IT-45, B. amyloliquefaciens

Y2, B. amyloliquefaciens

CC178, B.

amyloliquefaciens LFB112,

B. amyloliquefaciens L-

H15, B. amyloliquefaciens

KHG19, B.

amyloliquefaciens L-S60, B.

amyloliquefaciens G341, B.

amyloliquefaciens

MBE1283, all B.

Methylotrophicus in this

study, Bacillus sp. BH072

Aureocin

A53

MVAFLKLVAQLGTKAAKWAW

DNKSTVINWIKNGATFQWISDK

IDSIING

B. pumilus B. pumilus W3, B. pumilus

GR-8, B. pumilus TUAT1

Classification Class III large antimicrobial proteins


77

Colicin MSLNMYLGQVKAQTESMNAF

CNATIQGMEQIIHSINAFALDTV

LQGQTYSSAKAYFLQTFRPLAQ

GIIYLCEELIRQNDAFPRDFQSQ

VASTDVIEQEILEQIREIDRMIAS

TEALNQTMPIPGMDAMVNLFT

VMRQKLQEKLEHLYEFNYTSS

NNYDTALQLAASIATGLAEVQS

GKGFSPASGTFSTQGLNMEWT

GPIQAITEEKKRKADHLIKDGE

MCGRLEETSAIKKAWGDKVDS

VVEMFETVKKIWNGTVIGTGKS

VEDAIKSMETLSNMNIRNMDIE

TFINVTYAILHLDETAKNMWHT

FSSTVKRDMINGDAESRTQWIT

YALTQIGIGLIADKGLGRAGLVI

KGVKASSGASTLTKGVTLIKEM

KHASEILQSFKKDVSYAFSGGTI

ITKIPQSELNQAYYNFAKTTISS

AQKRNSPGTVTSSFNLERSLGT

QKKLMYNKGSIGVIPQEIRNKLI

GKNFNSFDDFRKEFWKTVADS

DYATEFNQRNINLMKEGKAPF

APLSEKYGQHNQYILHHKQPIH

QGGDVYNLDNLIIVSPKMHQN

VLDRSYHFGKKG

B. thuringiensis,

B. cereus,

Bacillus sp.

B. thuringiensis IBL-200, B.

thuringiensis serovar

morrisoni BGSC 4AA1, B.

thuringiensis HD-771, B.

thuringiensis serovar sotto

str T04001, B. thuringiensis

serovar huazhongensis

BGSC 4BD1, B. cereus

FORC-005, B. cereus

m1550, Bacillus sp. BH072

Chapter 2

78

Pyocin

AP41

MGQVRVDPDKLESAANSMSRN

RESMESIIRELLQVTFELQMSWE

GMAYQRFFDEFFSKKRSMDDL

VKHLHHTELELKKAAKTFREA

DEKAFGDFNQMGKLWDAFQR

GSGKAAGDTIFDPLKKGWNQT

SDFFGNLVDNPMDALEDAKYG

LTDFVESSIDDTKEEFRDKYEF

MKDMWNNPIGTLKHELDEEVQ

EMYAIRNVLSDWYVENIKYGD

AESITESVAYGATNLAFFGLVT

RGASAVGNGARWGKNLSSISK

LQLENRLEPAFAYGKIDYKVDT

IKPSDTYMFAKTSSAVKRKTPG

TVTSSFNLERSLGTQKKLMYND

GAIGIIPQEVREKLVGREFKSFD

DFREEFWKTLSDSSYAKEFSPM

NIKLMKQGKAPYSPRAEHYGN

HNKYILHHKQPIDKGGDVYNL

DNLIIVSPKMHQNVLDPAYHFG

TKGL

B. thuringiensis B. thuringiensis serovar

thuringiensis str. IS5056, B.


chinensis CT-43

M23

Peptidase

MKKRSILPAAVVCTLSLGGLFG

YQSNASAAGDLQQKKSEIESKL

SNVQSEMDKKDNQISNIQDKQ

ASLGSQLEAIESKIQSANKKISE

QEQNISTTKSQIADLKKNIAEIK

B. thuringiensis,

B. coagulans,

B. halodurans

B. thuringiensis HD-789, B.

thuringiensis IBL 4222, B.

coagulans 2-6, B.

halodurans C-125


79

KRIEDRNAILEDRARAMQKNG

GGSVNYLDVFLEAKSVGDFIDR

FSAVKTLVEADRQILEEQKKDE

QDLKDKQASVEKKLSDLESML

SDLQSLKDSLKQDESEKSALIK

QLDKQKDSLKEEKMSLSEQKSI

LADQKASIEKAIAFAKKQAEAR

KEAAAKADAAAKAQTNTNAG

STGSKAGTTSAASSASPSSGSHS

GGPLPEVSSGAFTRPASGYISSG

FGGRSGGFHPGVDIANSIGTPV

VAAADGVVFRAYRSSSYGNCV

MITHYINGKLYTTVYAHLSSYS

VSTGQHVSKGQQIGAMGNTGE

STGPHLHFEIYNGRWTPPPHAG

AQNPRNYVNF

Megacins MKDLNYGLEMIGVKNMWKHS

FLGEGVVVAVIDSGAEKEHPAI

HSNIIGGFNFTNDDGGEENKYID

YIGHGTHVAGIIAGYDRDLKKII

GVAPLAKLLILKIIDKDGQATID

NACKAIEYALNWRGENGEKVN

VMNMSFGTNKDNEHLKSLIKE

TYSENVIMVASSGNYGDGNAL

TNELLYPAYYKEVIEVGAVKQ

NFEIYDYSNSNDEIDFVAPGYKI

Bacillus

megaterium

129

Chapter 2

80

LSSYLNETYVKLSGTSMAAPHV

SGAMALLINKFQKEDKEINYKS

FYSYLRKDAKKLNYPITLQGHG

LIQFKNSKI

*Structural genes are indicated in black. The genes involved in maturation are indicated in gray. Genes coding for transport and

immunity proteins are indicated in white filled solid black box. The white and black grid denotes regulatory genes. The dotted black box

denotes gene functions not clearly conserved among the clusters or function unknown. “-” means lack of information. References

(presented as numbers) refer to examples of reported peptides and strains of predicted gene clusters in this study.


81

Table 3. Characteristics of NRPs, PKs and NRPS/PKS hybrid synthesized antimicrobials of Bacillales

Name Structure Gene cluster of NRPS/PKS* Predicted producer

species

Examples

Classification NRPs Lipopeptides

Surfactins

(e.g.

surfactin)

Bacillus subtilis,

Bacillus

amyloliquefaciens,

Bacillus

methylotrophicus,

Bacillus

licheniformis,

Bacillus

paralicheniformis,

Bacillus pumilus,

Bacillus atrophaeus,

Bacillus sp.

141, most of the predicted

species strains in this

study

Iturins

(e.g. iturinA)

B. atrophaeus,

Bacillus lehensis,

Bacillus sp.,

Paenibacillus

polymyxa

142, all B. atrophaeus

strains in this study, B.

lehensis G1, Bacillus sp.

BH072, P. polymyxa Sb3-

1, P. polymyxa M1, P.

polymyxa CF05, P.

polymyxa SC2

Chapter 2

82

Fengycins

(e.g.

fengycin)

B. subtilis,

B. amyloliquefaciens,

B. methylotrophicus,

B. paralicheniformis,

Bacillus sp.



study

Kustakins

(e.g.

kurstakin)

Bacillus thuringiensis 147

Cerexins

(e.g. cerexin

B)

- Bacillus cereus 146

Locillomycin

s

(e.g.

locillomycin)

B. subtilis,



Paenibacillus

mucilaginosus

149, B. subtilis subsp.

inaquosorum, B.

amyloliquefaciens

LFB112, B.

methylotrophicus NJN-6,

P. mucilaginosus

KNP414, P.

mucilaginosus K02

Polymyxins

(e.g.

polymyxin A)

P. polymyxa,

Paenibacillus peoriae

150, P. polymyxa SQR-

21, P. polymyxa Sb3-1, P.

polymyxa M1, P.

polymyxa E681, P.

polymyxa SC2, P. peoriae

HS311


83

Paenibacterin Brevibacillus

laterosporus,

P. mucilaginosus,

P. peoriae,

Paenibacillus terrae,

Paenibacillus sp.

151, B. laterosporus LMG

15441, P. mucilaginosus

KNP414, P.

mucilaginosus 3016, P.

peoriae HS311, P. terrae

HPL-003, Paenibacillus

sp. FSL H7-0357

Fusaricidins

(e.g.

fusaricidin

C)

P. polymyxa,

P. peoriae,

Paenibacillus bovis,

Paenibacillus sp.


21, P. polymyxa Sb3-1, P.

polymyxa M1, P.

polymyxa E681, P.

polymyxa SC2, P.

polymyxa CF05, P.

peoriae HS311, P. bovis

BD3526, Paenibacillus

sp. IHB B 3084

Tridecaptins

(e.g.

tridecaptin

A1)

P. polymyxa,

P. mucilaginosus,

P. peoriae,

P. terrae,

Paenibacillus sp.

136, all P. Polyxyma, P.

mucilaginosus, P. Peoriae

and P. terrae strains in

this study, Paenibacillus

sp. IHBB 10380

Polypeptin

- Paenibacillus sp. 154

Chapter 2

84

Pelgipeptins

(e.g.

pelgipeptinC)

Paenibacillus sp. 152

Octapeptins

(e.g.

octapeptinD)

- Paenibacillus sp. 155

Gavaserin - - P. polymyxa 153

Saltavalin - - P. polymyxa 153

Classification NRPs Others

Bacitracin

B. cereus,


P. bovis,

Paenibacillus durus

156, 157, B. cereus ATCC

10876, B. cereus m1550,

B. cereus Rock3-28, B.

cereus Rock3-29, B.

cereus Rock4-18, all B.

paralicheniformis strains

in this study, P. bovis

BD3526, P. durus DSM

1735

Bacilysin

B. subtilis,



Bacillus pumilus,

Bacillus sp.



study


85

Rhizocticins

(e.g.

rhizocticinA)

B. subtilis,

B. atrophaeus,

Bacillus sp.

159, most of B. subtilis

and

B. atrophaeus strains in

this study, Bacillus sp.

BS34A

Petrobactin

B. thurigiensis,

B. anthracis,

B. cereus,

Bacillus mycoides,

Bacillus

weihenstephanensis,

Bacillus

bombysepticus,

Bacillus toyonensis,

B. laterosporus,

Brevibacillus brevis,

P. mucilaginosus



study

Chapter 2

86

Bacillibactin B. subtilis,

B. thuringiensis,

B. anthracis,

B. cereus,



B. licheniformis,


B. atrophaeus,

B. mycoides,

B.

weihenstephanensis,

Bacillus cytotoxicus,

Bacillus

endophyticus,

Bacillus

pseudomcoides,

B. bombysepticus,

B. toyonensis,

Bacillus sp.,

Geobacillus sp.,

P. larvae,

P. bovis,

Paenibacillus sp.



study

Sevadicin P. polymyxa,

P. larvae


21, P. larvae subsp.


87

larvae DSM 25430

Gramicidin S B. brevis 163, B. brevis NBRC

100599

Tyrocidine B. laterosporus,

B. brevis

166, B. brevis NBRC

100599, B. laterosporus

LMG 15441

Classification PKs

Bacillaene

B. subtilis,



B. atrophaeus,

Bacillus sp.,

P. polymyxa

P. durus

Paenibacillus sp.



study, Paenibacillus sp.

FSL P4-0081

Difficidin



Bacillus sp.,

Paenibacillus sp.



study, Bacillus sp.

BH072, Bacillus sp.

SDLI1, Paenibacillus sp.

FSL R7-0273

Chapter 2

88

Macrolactin



Bacillus sp.

173, most of the

predicted species strains

in this study, Bacillus sp.

BH072, Bacillus sp.

SDLI1

Paenimacroli

din

Paenibacillus sp. 167

Basiliskamid

es

B. laterosporus 175

Classification NRPS/PKS hybrid synthesized compounds


89

Paenilarvins

(e.g.

paenilarvin

A)

P. polymyxa,

P. larvae

180, P. polymyxa SC2, P.

polymyxa E681, P.

polymyxa CF05, P.

polymyxa M1, SQR2-1, P.

larvae subsp. larvae DSM

25430,

Zwittermicin

A

B. thurigiensis,

B. cereus

181, B. thuringiensis

serovar thuringiensis str.

IS5056, B. thuringiensis

serovar galleriae HD-29,

B. thuringiensis serovar

kurstaki str. HD-1, B.


kurstaki str. YBT-1520,

B. thuringiensis YC-10, B.

cereus ATCC 10876, B.

cereus F65185

Paenilamicin

s

(e.g.

paenilamicin

A1)

B.

weihenstephanensis,

B. endophyticus,

Bacillus gobiensis,

P. larvae



study

*Gene clusters encoding NRPSs or PKSs or NRPS/PKS hybrids are indicated in different arrow boxes. “-” means lack of information.

Structures of compounds are drawn by ChemDraw. References (presented by numbers) refer to examples of reported peptides and strains

of predicted gene clusters in this study.

Chapter 2

90

Fig. 1. Potential of different Bacillales for ribosomally synthesized peptides,

NRPs and PKs production. Phylogenetic tree was constructed by bi-directional

BLAST all proteins of all genome of 328 Bacillales strains using Proteinortho; the

newick tree was generated by p02tree and visualized using FigTree v1.4.3

(http://tree.bio.ed.ac.uk/software/figtree/). The percentage of strains harboring

putative gene clusters of different antimicrobial compounds was calculated.

Numbers in parentheses () indicate the number of genomes analyzed per genus.


91

Bacillus subtilis (39)

Bacillus thuringiensis (46)

Bacillus anthracis (39)

Bacillus cereus (55)

Bacillus amyloliquefaciens (13)

Bacillus licheniformis (3)

Bacillus coagulans (5)

Bacillus megaterium (5)

Bacillus pumilus (8)

Bacillus atrophaeus (4)

Bacillus weihenstephanensis (2)

Bacillus mycoides (5)

Bacillus cytotoxicus (1)

Bacillus clausii (2)

Bacillus halodurans (1)

Bacillus cellulosilyticus (1)

Bacillus infantis (1)

Bacillus selenitireducens (1)

Bacillus methylotrophicus (15)

Bacillus paralicheniformis (3)

Bacillus methanolicus (1)

Bacillus endophyticus (1)

Bacillus smithii (1)

Bacillus pseudomycoides (1)

Bacillus pseudofirmus (1)

Bacillus bombysepticus (1)

Bacillus lehensis (1)

Bacillus toyonensis (1)

Bacillus gobiensis (1)

Bacillus sp. (13)

Kyrpidia tusciae (1)

Alicyclobacillus acidocaldarius (2)

Anoxybacillus flavithermus (1)

Geobacillus stearothermophilus (2)

Geobacillus thermodenitrificans (1)

Geobacilllus kaustophilus (1)

Geobacillus sp. (9)

Lysinibacillus sphaericus (1)

Lysinibacillus fusiformis (1)

Brevibacillus laterosporus (1)

Brevibacillus brevis (1)

Paenibacillus polymyxa (7)

Paenibacillus larvae (1)

Paenibacillus mucilaginosus (3)

Paenibacillus peoriae (1)

Paenibacillus odorifer (1)

Paenibacillus stellifer (1)

Paenibacillus borealis (1)

Paenibacillus bovis (1)

Paenibacillus naphthalenovorans (1)

Paenibacillus beijingensis (1)

Paenibacillus graminis (1)

Paenibacillus durus (2)

Paenibacillus terrae (1)

Paenibacilllus riograndensis (1)

Paenibacillus sabinae (1)

Paenibacillus sp. (12)

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

31

32

33

34

35

36

37

38

39

40

41

42

43

44

45

46

47

48

49

50

51

52

53

54

55

56

57

No.

Type I Lanthipeptide Type II Lanthipeptide Head to tail peptide

Glycocin

LAP Lasso peptide Thiopeptide

Class I Ribosomally synthesized

peptide

A

Class II Ribosomally synthesized peptide

Class III Ribosomally synthesized peptide

B C

D

Ribosomally synthesized peptide NRPs PKs

Sactipeptide

Fig. 2. Distribution of antimicrobials biosynthetic gene clusters among different

Bacillales. (A) Class I ribosomally synthesized peptides; (B) Class II ribosomally

synthesized peptides; (C) Class III ribosomally synthesized peptides; (D) Total

ribosomally synthesized peptides, NRPs and PKs, respectively.

Chapter 2

92

3. Discussion

An extensive investigation of 328 published whole genome sequences of Bacillales

for the presence of ribosomally synthesized antimicrobials, NRPs or PKs encoding

genes, revealed that most species of the genus Bacillus, Paenibacillus and

Geobacillus have good potential to produce a wide variety of antimicrobials and

there is a high occurrence of putative biosynthetic gene clusters. The ability of

Bacillus from different species to produce putative antimicrobial compounds relate

to their phylogenetic relationship. According to the phylogenetic tree (Fig. 1),

Bacillales are divided into several groups. Among them, the group of B. subtilis

and B. atrophaeus, the group of B. amyloliquefaciens, B. methylotrophicus, B.

paralicheniformis, B. licheniformis, B. pumilus and B. endophyticus are excellent

producers of all the three kinds of antimicrobials. Additionally, the B. cereus

group, Paenibacillus strains are rich sources of bacteriocins and NRPs, while

Geobacillus strains mainly produce bacteriocins and PKs.

More than 89% strains covering 50 species have a predisposition towards

producing ribosomally synthesized peptides (Fig. 1), some gene clusters of which

show similarity with those of known bacteriocins, while some are uncharacterized

or show limited homology. When it comes to the distribution of biosynthetic gene

clusters of ribosomally synthesized antimicrobials among different Bacillales,

lanthipeptides, head to tail cyclized peptides, sactipeptides, lasso peptides and

LAPs of Class I are the most common types (Fig. 2), whilst glycocin and

thiopeptide genes are present predominantly in B. subtilis and B. cereus strains,

respectively. Gene clusters of class II and III appear to be also regularly contained

within genus Bacillus genomes.

Although the emphasis here is on ribosomally synthesized peptide classes, several

new NRPs and PKs with potential antimicrobial activity were also identified.


93

Bacillales are potential NRPs producers, and the gene clusters are widely spread in

40 species of the sequenced genomes in our analysis (Fig. 1). In contrast, only half

of the genomes of these organisms appear to have PKs encoding genes. Bacillus

and Paenibacillus genera in particular are well noted for their capability to produce

structurally diverse NRPs and PKs. Approximately 35% strains of the Bacillale

species analyzed have the ability to produce all 3 types of antimicrobial compounds

simultaneously. In this study, most of the genomes (255 of 328) were completely

sequenced yielding one or only a few contigs, while there are some other level

sequence data (shown in Table S1) composed of relatively many single contigs.

Some of these contigs are not in the correct order, which can result in higher

mining counts of NRPs (caused by duplications or multiplications) than actual

correct. In order to avoid this overestimation, the numbers of putative gene clusters

of NRPs identified in Bacillales genomes, especially for B. cereus group strains,

were adjusted by removing duplications or multiplications of NRPs manually. It is

valuable to take this issue into account in further and future data mining and

analyses.

The massive numbers of bacteria with whole genome sequence data and the

development of various specific genome mining tools have made it possible to

identify an informative set of putative antimicrobial gene clusters across the

genomes that can be developed into new antimicrobials. Novel information found

in this genome mining study includes 3 types that are novel: class I bacteriocins

with either a new leader sequence or new core sequence; known antimicrobial

compounds previously produced by other microorganisms; and completely novel

gene clusters that need experimental confirmation. Another value of this study is

that the post-genome mining analysis includes a number of potential species never

considered to be antimicrobial producers before and provide a reference for future

Bacilli to be sequenced.

Chapter 2

94

4. Conclusions

A multitude of antimicrobial compounds have been found to be produced by a

variety of Bacillus strains. In the past, these compounds had to be identified by

intensive screening for antimicrobial activity against appropriate targets and

subsequently purified using fastidious methods prior to assess their potential

utilization as antibacterial or antifungal compound. Nowadays, gene clusters

encoding for ribosomally produced bacteriocins, NRPs and PKs can readily be

identified in the genomic sequences by genome-mining tools that not only add

missing ones, but also predict novel ones. Notably, genomic tools like BAGEL3

and antiSMASH combined with specific BLAST searches, makes the identification

of new compounds much easier. Although several novel gene clusters of putative

antimicrobials were found, they are as yet uncharacterized and their functions

remain to be studied. Our extended classification of antimicrobial compounds

demonstrates that Bacillales provides a rich source of novel antimicrobials that can

now be readily tapped experimentally, since many new gene clusters were

identified.

5. Methods

5.1. Genome sequences

Whole genome sequences of 328 strains of Bacillales (Additional file: Table S1)

were obtained from NCBI Genome database (http://www.ncbi.nlm.

nih.gov/genome). All proteins of all genomes were compared by bi-directional

BLAST using Proteinortho and newick tree file was generated by p02tree [184].

The newick tree file was visualized using FigTree v1.4.3

(http://tree.bio.ed.ac.uk/software/figtree/).

http://tree.bio.ed.ac.uk/software/figtree/


95

5.2. Genome mining for gene clusters of putative antimicrobials by BAGEL 3

and antiSMASH

Genomes were analyzed for gene clusters of putative bacteriocins, NRPs, PKs or

other antimicrobials by using web-based genome mining tools BAGEL3

(http://bagel.molgenrug.nl/) [7] and antiSMASH (http://antismash.secondary

metabolites.org) [8-10]. Genome mining data were collected and putative gene

clusters were classified manually. By BLAST, known and novel antimicrobials

were predicted and identified.

Additional file

Additional file 1: Table S1. Accession numbers of whole genome sequences

(reported in Genbank) of Bacillales analyzed in this study.

Availability of data and materials

Genome mining work was done base on the whole genome sequences of 328

strains of Bacillales listed in Additional file: Table S1, which can be obtained from

NCBI Genome database by corresponding accession numbers

(http://www.ncbi.nlm.nih.gov/genome). All the other data supporting the findings

is contained within the manuscript.

Reference

1. Nicholson WL. Roles of Bacillus endospores in the environment. Cell Mol Life Sci. 2002,59:410-416.

2. Lucera A, Costa C, Conte A, Del Nobile MA. Food applications of natural antimicrobial compounds.

Front Microbiol. 2012,3:287.

3. Sumi CD, Yang BW, Yeo I-C, Hahm YT. Antimicrobial peptides of the genus Bacillus: a new era for

antibiotics. Can J Microbiol. 2015,61(2):93-103.




http://www.ncbi.nlm.nih.gov/genome

Chapter 2

96

5. Finking R, Marahiel MA. Biosynthesis of nonribosomal peptides1. Annu Rev Microbiol. 2004,58:453-

488.

6. Fickers P. Antibiotic Compounds from Bacillus: Why are they so Amazing?. Am J Biochem Biotechnol.

2012,8(1):38-43.

7. van Heel AJ, de Jong A, Montalban-Lopez M, Kok J, Kuipers OP. BAGEL3: Automated identification


Acids Res. 2013,41:448-453.

8. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, et al. antiSMASH:

rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in

bacterial and fungal genome sequences. Nucleic Acids Res. 2011,39:339-346.

9. Blin K, Medema MH, Kazempour D, Fischbach MA, Breitling R, Takano E, et al. antiSMASH 2.0--a

versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res.

2013,41:204-212.

10. Weber T, Blin K, Duddela S, Krug D, Kim HU, Bruccoleri R, et al. antiSMASH 3.0-a comprehensive

resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 2015,43:237-243.

11. Stein T: Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Microbiol.

2005,56(4):845-857.

12. Mondol MA, Shin HJ, Islam MT. Diversity of secondary metabolites from marine Bacillus species:

chemistry and biological activity. Mar Drugs. 2013,11(8):2846-2872.

13. Klaenhammer TR. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol Rev.

1993,12:39-86.

14. Alvarez-Sieiro P, Montalban-Lopez M, Mu D, Kuipers OP. Bacteriocins of lactic acid bacteria:

extending the family. Appl Microbiol Biotechnol. 2016,100(7):2939-51.

15. Arnison PG, Bibb MJ, Bierbaum G, Bowers AA, Bugni TS, Bulaj G, et al. Ribosomally synthesized

and post-translationally modified peptide natural products: overview and recommendations for a

universal nomenclature. Nat Prod Rep. 2013,30(1):108-160.

16. Velasquez JE, van der Donk WA. Genome mining for ribosomally synthesized natural products. Curr

Opin Chem Biol. 2011,15(1):11-21.


Microbiol Rev. 2001,25:285-308.


Biochem. 2012,81:479-505.

19. McClerren AL, Cooper LE, Quan C, Thomas PM, Kelleher NL, van der Donk WA. Discovery and in

vitro biosynthesis of haloduracin, a two-component lantibiotic. Proc Natl Acad Sci USA.

2006,103(46):17243-17248.

20. Takami H, Nakasone K, Takaki Y, Maeno G, Sasaki R, Masui N, et al. Complete genome sequence of

the alkaliphilic bacterium Bacillus halodurans and genomic sequence comparison with Bacillus subtilis.

Nucleic Acids Res. 2000,28(21):4317–4331.

21. Begley M, Cotter PD, Hill C, Ross RP. Identification of a novel two-peptide lantibiotic, lichenicidin,

following rational genome mining for LanM proteins. Appl Environ Microbiol. 2009,75(17):5451-5460.


97

22. Garg N, Tang W, Goto Y, Nair SK, van der Donk WA. Lantibiotics from Geobacillus

thermodenitrificans. Proc Natl Acad Sci USA. 2011,109(14):5241-5246.

23. Caetano T, Barbosa J, Moesker E, Sussmuth RD, Mendo S. Bioengineering of lanthipeptides in

Escherichia coli: assessing the specificity of lichenicidin and haloduracin biosynthetic machinery. Res

Microbiol. 2014,165(7):600-604.

24. Khusainov R, van Heel AJ, Lubelski J, Moll GN, Kuipers OP. Identification of essential amino acid

residues in the nisin dehydratase NisB. Front Microbiol. 2015,6:102.

25. Lee H, Kim HY. Lantibiotics, class I bacteriocins from the genus Bacillus. J Microbiol Biotechnol.

2011,21(3):229-235.

26. Stein T, Heinzmann S, Kiesau P, Himmel B, Entian KD. The spa-box for transcriptional activation of

subtilin biosynthesis and immunity in Bacillus subtilis. Mol Microbiol. 2003,47(6):1627-1636.

27. Kleerebezem M. Quorum sensing control of lantibiotic production; nisin and subtilin autoregulate their

own biosynthesis. Peptides. 2004,25(9):1405-1414.

28. Kleerebezem M, Bongers R, Rutten G, de Vos WM, Kuipers OP. Autoregulation of subtilin

biosynthesis in Bacillus subtilis: the role of the spa-box in subtilin-responsive promoters. Peptides.

2004,25(9):1415-1424.

29. Corvey C, Stein T, Düsterhus S, Karas M, Entian KD. Activation of subtilin precursors by Bacillus

subtilis extracellular serine proteases subtilisin (AprE), WprA, and Vpr. Biochem Bioph Res C.

2003,304(1):48-54.

30. Breukink E, Wiedemann I, van Kraaij C, Kuipers OP, Sahl HG, de Kruijff B. Use of the cell wall

precursor lipid II by a pore-forming peptide antibiotic. Science. 1999,286(5448):2361-2364.

31. Parisot J, Carey S, Breukink E, Chan WC, Narbad A, Bonev B. Molecular mechanism of target

recognition by subtilin, a class I lanthionine antibiotic. Antimicrob Agents Chemother. 2008,52(2):612-

618.

32. Bierbaum G, Brötz H, Koller KP, Sahl HG. Cloning, sequencing and production of the lantibiotic

mersacidin. FEMS Microbiol Lett. 1995,127(1-2):121-126.

33. Hao K, He P, Blom J, Rueckert C, Mao Z, Wu Y, et al. The genome of plant growth-promoting

Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601-Y2 contains a gene cluster for

mersacidin synthesis. J Bacteriol. 2012,194(12):3264-3265.


strain BH072, isolated from honey. Genome Announcements. 2015,3(2):e00098–00015.

35. Brötz H, Bierbaum G, Reynolds PE, Sahl HG. The lantibiotic mersacidin inhibits peptidoglycan

biosynthesis at the level of transglycosylation. Eur J Biochem. 1997,246(1):193-199.

36. Hsu ST, Breukink E, Bierbaum G, Sahl HG, de Kruijff B, Kaptein R, et al. NMR study of mersacidin

and lipid II interaction in dodecylphosphocholine micelles. Conformational changes are a key to

antimicrobial activity. J Biol Chem. 2003,278(15):13110-13117.

37. He P, Hao K, Blom J, Ruckert C, Vater J, Mao Z, et al. Genome sequence of the plant growth

promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and expression of mersacidin

and other secondary metabolites. J Biotechnol. 2012,164(2):281-291.

Chapter 2

98

38. Schmitz S, Hoffmann A, Szekat C, Rudd B, Bierbaum G. The lantibiotic mersacidin is an autoinducing

peptide. Appl Environ Microbiol. 2006,72(11):7270-7277.

39. Guder A, Schmitter T, Wiedemann I, Sahl HG, Bierbaum G. Role of the single regulator MrsR1 and

the two-component system MrsR2/K2 in the regulation of mersacidin production and immunity. Appl

Environ Microbiol. 2002,68(1):106-113.

40. Klein C, Kaletta C, Schnell N, Entian KD. Analysis of genes involved in biosynthesis of the lantibiotic

subtilin. Appl Environ Microbiol. 1992; doi: 10.1111/j.1432-1033.1992.tb16605.x.

41. Bouhss A, Al-Dabbagh B, Vincent M, Odaert B, Aumont-Nicaise M, Bressolier P, et al. Specific

interactions of clausin, a new lantibiotic, with lipid precursors of the bacterial cell wall. Biophys J.

2009,97(5):1390-1397.

42. Phelan RW, Barret M, Cotter PD, O'Connor PM, Chen R, Morrissey JP, et al. Subtilomycin: a new

lantibiotic from Bacillus subtilis strain MMA7 isolated from the marine sponge Haliclona simulans.

Mar Drugs. 2013,11(6):1878-1898.

43. He Z, Yuan C, Zhang L, Yousef AE. N-terminal acetylation in paenibacillin, a novel lantibiotic. FEBS

Lett. 2008,582(18):2787-2792.

44. van Belkum MJ, Lohans CT, Vederas JC. Draft Genome sequences of Paenibacillus polymyxa NRRL

B-30509 and Paenibacillus terrae NRRL B-30644, strains from a poultry environment that produce

tridecaptin A and paenicidins. Genome Announcements. 2015,3(2):e00372-00315.

45. Fuchs SW, Jaskolla TW, Bochmann S, Kotter P, Wichelhaus T, Karas M, et al. Entianin, a novel

subtilin-like lantibiotic from Bacillus subtilis subsp. spizizenii DSM 15029T with high antimicrobial

activity. Appl Environ Microbiol. 2011,77(5):1698-1707.

46. Stein T, Borchert S, Conrad B, Feesche J, Hofemeister B, Hofemeister J, et al. Two different

lantibiotic-like peptides originate from the ericin gene cluster of Bacillus subtilis A1/3. J Bacteriol.

2002,184(6):1703-1711.

47. Xin B, Zheng J, Xu Z, Song X, Ruan L, Peng D, et al. The Bacillus cereus group is an excellent

reservoir of novel lanthipeptides. Appl Envrion Microbiol. 2015,81(5):1765-1774.

48. Altena K, Guder A, Cramer C, Bierbaum G. Biosynthesis of the lantibiotic mersacidin: organization of

a type B lantibiotic gene cluster. Appl Envrion Microbiol. 2000,66(6):2565–2571.

49. Herzner AM, Dischinger J, Szekat C, Josten M, Schmitz S, Yakéléba A, et al. Expression of the

lantibiotic mersacidin in Bacillus amyloliquefaciens FZB42. Plos One. 2011,6(7):e22389.

50. Arguelles Arias A, Ongena M, Devreese B, Terrak M, Joris B, Fickers P. Characterization of

amylolysin, a novel lantibiotic from Bacillus amyloliquefaciens GA1. Plos One. 2013,8(12):e83037.

51. Basi-Chipalu S, Dischinger J, Josten M, Szekat C, Zweynert A, Sahl HG, et al. Pseudomycoicidin, a

class II lantibiotic from Bacillus pseudomycoides. Appl Envrion Microbiol. 2015,81(10):3419-3429.

52. Wang J, Zhang L, Teng K, Sun S, Sun Z, Zhong J. Cerecidins, novel lantibiotics from Bacillus cereus

with potent antimicrobial activity. Appl Envrion Microbiol. 2014,80(8):2633-2643.

53. Coburn PS, Gilmore MS. The Enterococcus faecalis cytolysin: a novel toxin active against eukaryotic

and prokaryotic cells. Cell Microbiol. 2003,5(10):661-669.

54. Montalbán-López M, Sánchez-Hidalgo M, Cebrián R, Maqueda M. Discovering the bacterial circular

proteins: bacteriocins, cyanobactins, and pilins. J Biol Chem. 2012,287(32):27007-27013.


99

55. Maqueda M, Sanchez-Hidalgo M, Fernandez M, Montalban-Lopez M, Valdivia E, Martinez-Bueno M.

Genetic features of circular bacteriocins produced by Gram-positive bacteria. FEMS Microbiol Rev.

2008,32(1):2-22.

56. Conlan BF, Gillon AD, Craik DJ, Anderson MA. Circular proteins and mechanisms of cyclization.

Biopolymers. 2010,94(5):573-583.

57. Van Belkum MJ, Martin-Visscher LA, Vederas JC. Structure and genetics of circular bacteriocins.

Trends Microbiol. 2011,19(8):411-418.

58. Gonzalez C, Langdon GM, Bruix M, Galvez A, Valdivia E, Maqueda M, et al. Bacteriocin AS-48, a

microbial cyclic polypeptide structurally and functionally related to mammalian NK-lysin. Proc Natl

Acad Sci USA. 2000,97(21):11221-11226.

59. Scholz R, Vater J, Budiharjo A, Wang Z, He Y, Dietel K, et al. Amylocyclicin, a novel circular

bacteriocin produced by Bacillus amyloliquefaciens FZB42. J Bacteriol. 2014,196(10):1842-1852.

60. Wirawan RE, Swanson KM, Kleffmann T, Jack RW, Tagg JR. Uberolysin: a novel cyclic bacteriocin

produced by Streptococcus uberis. Microbiology. 2007,153(5):1619-1630.

61. Grande Burgos MJ, Pulido RP, Del Carmen Lopez Aguayo M, Galvez A, Lucas R. The cyclic

antibacterial peptide enterocin AS-48: isolation, mode of action, and possible food applications. Int J

Mol Sci. 2014,15(12):22706-22727.

62. Kawai Y, Kemperman R, Kok J, Saito T. The circular bacteriocins gassericin A and circularin A. Curr

Protein Pept Sc. 2004,5(5):393-398.

63. Borrero J, Brede DA, Skaugen M, Diep DB, Herranz C, Nes IF, et al. Characterization of garvicin ML,

a novel circular bacteriocin produced by Lactococcus garvieae DCC43, isolated from mallard ducks

(Anas platyrhynchos). Appl Envrion Microbiol. 2011,77(1):369-373.

64. Azevedo AC, Bento CB, Ruiz JC, Queiroz MV, Mantovani HC. Distribution and genetic diversity of

bacteriocin gene clusters in rumen microbial genomes. Appl Envrion Microbiol. 2015,81(20):7290-

7304.

65. Yang X, van der Donk WA. Ribosomally synthesized and post-translationally modified peptide natural

products: new insights into the role of leader and core peptides during biosynthesis. Chemistry.

2013,19(24):7662-7677.

66. Fluhe L, Marahiel MA. Radical S-adenosylmethionine enzyme catalyzed thioether bond formation in

sactipeptide biosynthesis. Curr Opin Chem Biol. 2013,17(4):605-612.

67. Kawulka K, Sprules T, McKay RT, Mercier P, Diaper CM, Zuber P, et al. Structure of subtilosin A, an

antimicrobial peptide from Bacillus subtilis with unusual posttranslational modifications linking

cysteine sulfurs to alpha-carbons of phenylalanine and threonine. J Am Chem Soc. 2003,125(16):4726-

4727.

68. Flühe L, Knappe TA, Gattner MJ, Schäfer A, Burghaus O, Linne U, et al. The radical SAM enzyme

AlbA catalyzes thioether bond formation in subtilosin A. Nat Chem Biol. 2012,8(4):350-357.

69. Zheng G, Yan LZ, Vederas JC, Zuber P. Genes of the sbo-alb locus of Bacillus subtilis are required for

production of the antilisterial bacteriocin subtilosin. J Bacteriol. 1999,181(23):7346-7355.

70. Zheng G, Hehn R, Zuber P. Mutational analysis of the sbo-alb locus of Bacillus subtilis: identification

of genes required for subtilosin production and immunity. J Bacteriol. 2000,182(11):3266-3273.

Chapter 2

100

71. Noll KS, Sinko PJ, Chikindas ML. Elucidation of the molecular mechanisms of action of the natural

antimicrobial peptide subtilosin against the bacterial vaginosis-associated pathogen Gardnerella

vaginalis. Probiotics Antimicrob. 2011,3(1):41-47.

72. Sutyak KE, Wirawan RE, Aroutcheva AA, Chikindas ML. Isolation of the Bacillus subtilis

antimicrobial peptide subtilosin from the dairy product-derived Bacillus amyloliquefaciens. J Appl

Microbiol. 2008,104(4):1067-1074.

73. Huang T, Geng H, Miyyapuram VR, Sit CS, Vederas JC, Nakano MM. Isolation of a variant of

subtilosin A with hemolytic activity. J Bacteriol. 2009,191(18):5690-5696.

74. Allenby NE, Watts CA, Homuth G, Pragai Z, Wipat A, Ward AC, et al. Phosphate starvation induces

the sporulation killing factor of Bacillus subtilis. J Bacteriol. 2006,188(14):5299-5303.

75. Lee H, Churey JJ, Worobo RW. Biosynthesis and transcriptional analysis of thurincin H, a tandem

repeated bacteriocin genetic locus, produced by Bacillus thuringiensis SF361. FEMS Microbiol Lett.

2009,299(2):205-213.

76. Rea MC, Sit CS, Clayton E, O’Connor PM, Whittal RM, Zheng J, et al. Thuricin CD, a

posttranslationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile.

Proc Natl Acad Sci USA. 2010,107(20):9352-9357.

77. Favret ME, Yousten AA. Thuricin: the bacteriocin produced by Bacillus thuringiensis. J Invertebr

Pathol. 1989,53(2):206-216.

78. Li YM, Milne JC, Madison LL, Kolter R, Walsh CT. From peptide precursors to oxazole and thiazole-

containing peptide antibiotics: microcin B17 synthase. Science. 1996,274(5290):1188-1193.

79. Melby JO, Nard NJ, Mitchell DA. Thiazole/oxazole-modified microcins: complex natural products

from ribosomal templates. Curr Opin Chem Biol. 2011,15(3):369-378.

80. Banala S, Ensle P, Sussmuth RD. Total synthesis of the ribosomally synthesized linear azole-

containing peptide plantazolicin A from Bacillus amyloliquefaciens. Angew Chem Int Edit.

2013,52(36):9518-9523.

81. Scholz R, Molohon KJ, Nachtigall J, Vater J, Markley AL, Sussmuth RD, et al. Plantazolicin, a novel

microcin B17/streptolysin S-like natural product from Bacillus amyloliquefaciens FZB42. J Bacteriol.

2011,193(1):215-224.

82. Davagnino J, Herrero M, Furlong D, Moreno F, Kolter R. The DNA replication inhibitor microcin B17

is a forty-three-amino-acid protein containing sixty percent glycine. Proteins. 1986,1(3):230-238.

83. Heddle JG, Blance SJ, Zamble DB, Hollfelder F, Miller DA, Wentzell LM, et al. The antibiotic

microcin B17 is a DNA gyrase poison: characterisation of the mode of inhibition. J Mol Biol.

2001,307(5):1223-1234.

84. Cox CL, Doroghazi JR, Mitchell DA. The genomic landscape of ribosomal peptides containing thiazole

and oxazole heterocycles. BMC Genomics. 2015,16(1):1-16.

85. Lee SW, Mitchell DA, Markley AL, Hensler ME, Gonzalez D, Wohlrab A, et al. Discovery of a widely

distributed toxin biosynthetic gene cluster. Proc Natl Acad Sci USA. 2008,105(15):5879-5884.

86. Nizet V, Beall B, Bast DJ, Datta V, Kilburn L, Low DE, et al. Genetic locus for streptolysin S

production by group A Streptococcus. Infect Immun. 2000,68(7):4245-4254.


101

87. Liu Z, Budiharjo A, Wang P, Shi H, Fang J, Borriss R, et al. The highly modified microcin peptide

plantazolicin is associated with nematicidal activity of Bacillus amyloliquefaciens FZB42. Appl

Microbiol Biotechnol. 2013,97(23):10081-10090.

88. Just-Baringo X, Albericio F, Alvarez M. Thiopeptide antibiotics: retrospective and recent advances.

Mar Drugs. 2014,12(1):317-351.

89. Bowers AA, Walsh CT, Acker MG. Genetic interception and structural characterization of thiopeptide

cyclization precursors from Bacillus cereus. J Am Chem Soc. 2010,132(35):12182-12184.

90. Wieland Brown LC, Acker MG, Clardy J, Walsh CT, Fischbach MA. Thirteen posttranslational

modifications convert a 14-residue peptide into the antibiotic thiocillin. Proc Natl Acad Sci USA.

2009,106(8):2549-2553.

91. Shoji J, Hinoo H, Wakisaka Y, Koizumi K, Mayama M. Isolation of three new antibiotics, thiocillins I,

II and III, related to micrococcin P. Studies on antibiotics from the genus Bacillus. VIII. J Antibiot

(Tokyo). 1976,29(4):366-374.

92. Stepper J, Shastri S, Loo TS, Preston JC, Novak P, Man P, et al. Cysteine S-glycosylation, a new post-

translational modification found in glycopeptide bacteriocins. FEBS Lett. 2011,585(4):645-650.

93. Hsieh YS, Wilkinson BL, O'Connell MR, Mackay JP, Matthews JM, Payne RJ. Synthesis of the

bacteriocin glycopeptide sublancin 168 and S-glycosylated variants. Org Lett. 2012,14(7):1910-1913.

94. Oman TJ, Boettcher JM, Wang H, Okalibe XN, van der Donk WA. Sublancin is not a lantibiotic but an

S-linked glycopeptide. Nat Chem Biol. 2011,7(2):78-80.

95. Paik SH, Chakicherla A, Hansen JN. Identification and characterization of the structural and transporter

genes for, and the chemical and biological properties of, sublancin 168, a novel lantibiotic produced by

Bacillus subtilis 168. J Biol Chem. 1998,273(36):23134-23142.

96. Bolhuis A, Venema G, Quax WJ, Bron S, van Dijl JM. Functional analysis of paralogous thiol-

disulfide oxidoreductases in Bacillus subtilis. J Biol Chem. 1999,274(35):24531-24538.

97. Serizawa M, Kodama K, Yamamoto H, Kobayashi K, Ogasawara N, Sekiguchi J. Functional analysis

of the YvrGHb two-component system of Bacillus subtilis: identification of the regulated genes by

DNA microarray and northern blot analyses. Biosci Biotech Biochem. 2005,69(11):2155-2169.

98. Weber W, Fischli W, Hochuli E, Kupfer E, Weibel EK. Anantin--a peptide antagonist of the atrial

natriuretic factor (ANF). I. Producing organism, fermentation, isolation and biological activity. J

Antibiot (Tokyo). 1991,44(2):164-171.

99. Hegemann JD, Zimmermann M, Xie X, Marahiel MA. Lasso peptides: an intriguing class of bacterial

natural products. Accounts Chem Res. 2015,48(7):1909-1919.

100. Maksimov MO, Pelczer I, Link AJ. Precursor-centric genome-mining approach for lasso peptide

discovery. Proc Natl Acad Sci USA. 2012,109(38):15223-15228.

101. Maksimov MO, Pan SJ, James Link A. Lasso peptides: structure, function, biosynthesis, and

engineering. Nat Prod Rep. 2012,29(9):996-1006.

102. Maksimov MO, Link AJ. Discovery and characterization of an isopeptidase that linearizes lasso

peptides. J Am Chem Soc. 2013,135(32):12038-12047.

Chapter 2

102

103. Solbiati JO, Ciaccio M, Farías RN, González-Pastor JE, Moreno F, Salomón RA. Sequence analysis of

the four plasmid genes required to produce the circular peptide antibiotic microcin J25. J Bacteriol.

1999,181(8):2659-2662.

104. Yan KP, Li Y, Zirah S, Goulard C, Knappe TA, Marahiel MA, Rebuffat S. Dissecting the maturation

steps of the lasso peptide microcin J25 in vitro. Chembiochem. 2012,13(7):1046-1052.

105. Mukhopadhyay J, Sineva E, Knight J, Levy RM, Ebright RH. Antibacterial peptide microcin J25

inhibits transcription by binding within and obstructing the RNA polymerase secondary channel. Mol

Cell. 2004,14(6):739-751.

106. Helynck G, Dubertret C, Mayaux JF, Leboul J. Isolation of RP 71955, a new anti-HIV-1 peptide

secondary metabolite. J Antibiot (Tokyo). 1993,46(11):1756-1757.

107. Delgado MA, Rintoul MR, Farias RN, Salomon RA. Escherichia coli RNA polymerase is the target of

the cyclopeptide antibiotic microcin J25. J Bacteriol. 2001,183(15):4543-4550.

108. Cotter PD, Ross RP, Hill C. Bacteriocins - a viable alternative to antibiotics?. Nat Rev Microbiol.

2013,11(2):95-105.

109. Le Marrec C, Hyronimus B, Bressollier P, Verneuil B, Urdaci MC. Biochemical and genetic

characterization of coagulin, a new antilisterial bacteriocin in the pediocin family of bacteriocins,

produced by Bacillus coagulans I(4). Appl Environ Microbiol. 2000,66(12):5213-5220.

110. Kjos M, Borrero J, Opsata M, Birri DJ, Holo H, Cintas LM, et al. Target recognition, resistance,

immunity and genome mining of class II bacteriocins from Gram-positive bacteria. Microbiology.

2011,157(12):3256-3267.

111. Cui Y, Zhang C, Wang Y, Shi J, Zhang L, Ding Z, et al. Class IIa bacteriocins: diversity and new

developments. Int J Mol Sci. 2012,13(12):16668-16707.

112. Miller KW, Ray P, Steinmetz T, Hanekamp T, Ray B. Gene organization and sequences of pediocin

AcH/PA-1 production operons in Pediococcus and Lactobacillus plasmids. Lett Appl Microbiol.

2005,40(1):56-62.

113. Hyronimus B, Le Marrec C, Urdaci MC. Coagulin, a bacteriocin-like inhibitory substance produced by

Bacillus coagulans I4. J Appl Microbiol. 1998,85(1):42-50.

114. De Vuyst L, Avonts L, Neysens P, Hoste B, Vancanneyt M, Swings J, et al. The lactobin A and

amylovorin L471 encoding genes are identical, and their distribution seems to be restricted to the

species Lactobacillus amylovorus that is of interest for cereal fermentations. Int J Food Microbiol.

2004,90(1):93-106.

115. Requena T, Yu W, Stoddard GW, McKay LL. Lactococcin A overexpression in a Lactococcus lactis

subsp. lactis transformant containing a Tn5 insertion in the lcnD gene. Appl Microbiol Biotechnol.

1995,44(3-4):413-418.

116. Kyogoku K, Sekiguchi J. Cloning and sequencing of a new holin-encoding gene of Bacillus

licheniformis. Gene. 1996,168(1):61-65.

117. Oki M, Kakikawa M, Nakamura S, Yamamura ET, Watanabe K, Sasamoto M, et al. Functional and

structural features of the holin HOL protein of the Lactobacillus plantarum phage φg1e: analysis in

Escherichia coli system. Gene. 1997,197(1-2):137-145.


103

118. Ziedaite G, Daugelavicius R, Bamford JK, Bamford DH. The Holin protein of bacteriophage PRD1

forms a pore for small-molecule and endolysin translocation. J Bacteriol. 2005,187(15):5397-5405.

119. Anthony T, Chellappa GS, Rajesh T, Gunasekaran P. Functional analysis of a putative holin-like

peptide-coding gene in the genome of Bacillus licheniformis AnBa9. Arch Microbiol. 2010,192(1):51-

56.

120. Young R, Bläsi, U. Holins: form and function in bacteriophage lysis. FEMS Microbiol Rev.1995,17(1-

2):191-205.

121. Young R. Bacteriophage lysis: mechanism and regulation. Microbiol Rev. 1992,56(3):430-481.

122. Aunpad R, Panbangred W. Evidence for two putative holin-like peptides encoding genes of Bacillus

pumilus strain WAPB4. Curr Microbiol. 2012,64(4):343-348.

123. Liu J, Pan N, Chen Z. Characterization of an anti-rice bacterial blight polypeptide LCI. Rice Genet

Newsl. 1990,7:151-154.

124. Gong W, Wang J, Chen Z, Xia B, Lu G. Solution structure of LCI, a novel antimicrobial peptide from

Bacillus subtilis. Biochemistry. 2011,50(18):3621-3627.

125. Liu J, Li Z, Pan N, Chen Z. Purification and partial characterization of an antibacterial protein LCIII.

Chin J Biotechnol. 1992,8(3):187-193.

126. Wang G. Antimicrobial peptides: discovery, design and novel therapeutic strategies. CAB International;

2010.

127. Netz DJA, Bastos MdCdF, Sahl HG. Mode of action of the antimicrobial peptide aureocin A53 from

Staphylococcus aureus. Appl Environ Microbiol. 2002,68(11):5274-5280.

128. Netz DJA, Pohl R, Beck-Sickinger AG, Selmer T, Pierik AJ, Bastos MdCdF, et al. Biochemical

characterisation and genetic analysis of aureocin A53, a new, atypical bacteriocin from Staphylococcus

aureus. J Mol Biol. 2002,319(3):745-756.

129. Von Tersch MA, Carlton BC. Bacteriocin from Bacillus megaterium ATCC 19213: comparative

studies with megacin A-216. J Bacteriol. 1983,155(2):866-871.

130. Zakharov SD, Cramer WA. Colicin crystal structures: pathways and mechanisms for colicin insertion

into membranes. Biochim Biophys Acta. 2002,1565(2):333-346.

131. Michel-Briand Y, Baysse C. The pyocins of Pseudomonas aeruginosa. Biochimie. 2002,84(5-6):499-

510.

132. Bamford CV, Francescutti T, Cameron CE, Jenkinson HF, Dymock D. Characterization of a novel

family of fibronectin-binding proteins with M23 peptidase domains from Treponema denticola. Mol

Oral Microbiol. 2010,25(6):369-383.

133. Grabowska M, Jagielska E, Czapinska H, Bochtler M, Sabala I. High resolution structure of an M23

peptidase with a substrate analogue. Sci Rep. 2015,5:14833.

134. Wang H, Fewer DP, Holm L, Rouhiainen L, Sivonen K. Atlas of nonribosomal peptide and polyketide

biosynthetic pathways reveals common occurrence of nonmodular enzymes. Proc Natl Acad Sci USA.

2014,111(25):9259-9264.

135. Weissman KJ. The structural biology of biosynthetic megaenzymes. Nat Chem Biol. 2014,11(9):660–

670.

Chapter 2

104

136. Aleti G, Sessitsch A, Brader G. Genome mining: prediction of lipopeptides and polyketides from

Bacillus and related Firmicutes. Comput Struct Biotechnol J. 2015,13:192-203.

137. Baltz RH. Combinatorial biosynthesis of cyclic lipopeptide antibiotics: a model for synthetic biology to

accelerate the evolution of secondary metabolite biosynthetic pathways. ACS Synth Biol.

2014,3(10):748-758.

138. Meena KR, Kanwar SS. Lipopeptides as the antifungal and antibacterial agents: applications in food

safety and therapeutics. Biomed Res Int. 2015; doi:10.1155/2015/473050.

139. Ongena M, Jacques P. Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends

Microbiol. 2008,16(3):115-125.

140. Cawoy H, Debois D, Franzil L, De Pauw E, Thonart P, Ongena M. Lipopeptides as main ingredients

for inhibition of fungal phytopathogens by Bacillus subtilis/amyloliquefaciens. Microb biotechnol.

2015,8(2):281-295.

141. Raaijmakers JM, De Bruijn I, Nybroe O, Ongena M. Natural functions of lipopeptides from Bacillus

and Pseudomonas: more than surfactants and antibiotics. FEMS Microbiol Rev. 2010,34(6):1037-1062.

142. Pathak KV, Keharia H. Identification of surfactins and iturins produced by potent fungal antagonist,

Bacillus subtilis K1 isolated from aerial roots of banyan (Ficus benghalensis) tree using mass

spectrometry. 3 Biotech. 2013,4(3):283-295.

143. Zhao X, Han Y, Tan XQ, Wang J, Zhou ZJ. Optimization of antifungal lipopeptide production from

Bacillus sp. BH072 by response surface methodology. J Microbiol. 2014,52(4):324-332.

144. Malfanova N, Franzil L, Lugtenberg B, Chebotar V, Ongena M. Cyclic lipopeptide profile of the plant-

beneficial endophytic bacterium Bacillus subtilis HC8. Arch Microbiol. 2012,194(11):893-899.

145. Abderrahmani A, Tapi A, Nateche F, Chollet M, Leclere V, Wathelet B, et al. Bioinformatics and

molecular approaches to detect NRPS genes involved in the biosynthesis of kurstakin from Bacillus

thuringiensis. Appl Microbiol Biotechnol. 2011,92(3):571-581.

146. Shoji J, Hinoo H. Chemical characterization of new antibiotics, cerexins A and B. (Studies on

antibiotics from the genus Bacillus. II). J Antibiot (Tokyo). 1975,28(1):60-63.

147. Hathout Y, Ho YP, Ryzhov V, Demirev P, Fenselau C. Kurstakins: a new class of lipopeptides isolated

from Bacillus thuringiensis. J Nat Prod. 2000,63(11):1492-1496.

148. Luo C, Liu X, Zhou X, Guo J, Truong J, Wang X, et al. Unusual Biosynthesis and Structure of

Locillomycins from Bacillus subtilis 916. Appl Environ Microbiol. 2015,81(19):6601-6609.

149. Luo C, Liu X, Zhou H, Wang X, Chen Z. Nonribosomal peptide synthase gene clusters for lipopeptide

biosynthesis in Bacillus subtilis 916 and their phenotypic functions. Appl Environ Microbiol.

2015,81(1):422-431.

150. Choi SK, Park SY, Kim R, Kim SB, Lee CH, Kim JF, et al. Identification of a polymyxin synthetase

gene cluster of Paenibacillus polymyxa and heterologous expression of the gene in Bacillus subtilis. J

Bacteriol. 2009,191(10):3350-3358.

151. Huang E, Yousef AE. The lipopeptide antibiotic paenibacterin binds to the bacterial outer membrane

and exerts bactericidal activity through cytoplasmic membrane damage. Appl Environ Microbiol.

2014,80(9):2700-2704.


105

152. Ding R, Wu XC, Qian CD, Teng Y, Li O, Zhan ZJ, et al. Isolation and identification of lipopeptide

antibiotics from Paenibacillus elgii B69 with inhibitory activity against methicillin-resistant

Staphylococcus aureus. J Microbiol. 2011,49(6):942-949.

153. Pichard B, Larue JP, Thouvenot D. Gavaserin and saltavalin, new peptide antibiotics produced by

Bacillus polymyxa. FEMS Microbiol Lett. 1995,133(3):215-218.

154. Huang Z, Hu Y, Shou L, Song M. Isolation and partial characterization of cyclic lipopeptide antibiotics

produced by Paenibacillus ehimensis B7. BMC Microbiol. 2013,13:87.

155. Qian CD, Wu XC, Teng Y, Zhao WP, Li O, Fang SG, et al. Battacin (Octapeptin B5), a new cyclic

lipopeptide antibiotic from Paenibacillus tianmuensis active against multidrug-resistant Gram-negative

bacteria. Antimicrob Agents Chemother. 2012,56(3):1458-1465.

156. Azevedo EC, Rios EM, Fukushima K, Campos-Takaki GM. Bacitracin production by a new strain of

Bacillus subtilis. Extraction, purification, and characterization. Appl Biochem Biotechnol.

1993,42(1):1-7.

157. Ducluzeau R, Dubos F, Raibaud P, Abrams GD. Inhibition of Clostridium perfringens by an antibiotic

substance produced by Bacillus licheniformis in the digestive tract of gnotobiotic mice: effect on other

bacteria from the digestive tract. Antimicrob Agents Chemother. 1976,9(1):20-25.

158. Ozcengiz G, Ogulur I. Biochemistry, genetics and regulation of bacilysin biosynthesis and its

significance more than an antibiotic. New biotechnol. 2015,32(6):612-619.

159. Borisova SA, Circello BT, Zhang JK, van der Donk WA, Metcalf WW. Biosynthesis of rhizocticins,

antifungal phosphonate oligopeptides produced by Bacillus subtilis ATCC6633. Chem Biol.

2010,17(1):28-37.

160. Lee JY, Passalacqua KD, Hanna PC, Sherman DH. Regulation of petrobactin and bacillibactin

biosynthesis in Bacillus anthracis under iron and oxygen variation. Plos One. 2011,6(6):e20777.

161. Tang Y, Frewert S, Harmrolfs K, Herrmann J, Karmann L, Kazmaier U, et al. Heterologous expression

of an orphan NRPS gene cluster from Paenibacillus larvae in Escherichia coli revealed production of

sevadicin. J Biotechnol. 2015,194:112-114.

162. Hansen J, Pschorn W, Ristow H. Functions of the peptide antibiotics tyrocidine and gramicidin.

Induction of conformational and structural changes of superhelical DNA. Eur J Biochem.

1982,126(2):279-284.

163. Kleinkauf H, Gevers W. Nonribosomal polypeptide synthesis: the biosynthesis of a cyclic peptide

antibiotic, gramicidin S. Cold Spring Harb Sym. 1969,34:805-813.

164. Kondejewski LH, Farmer SW, Wishart DS, Kay CM, Hancock RE, Hodges RS. Modulation of

structure and antibacterial and hemolytic activity by ring size in cyclic gramicidin S analogs. J Biol

Chem. 1996,271(41):25261-25268.

165. Krätzschmar J, Krause M, Marahiel MA. Gramicidin S biosynthesis operon containing the structural

genes grsA and grsB has an open reading frame encoding a protein homologous to fatty acid

thioesterases. J Bacteriol. 1989,171(10):5422-5429.

166. Mootz HD, Marahiel MA. The tyrocidine biosynthesis operon of Bacillus brevis: complete nucleotide

sequence and biochemical characterization of functional internal adenylation domains. J Bacteriol.

1997,179(21):6843-6850.

Chapter 2

106

167. Wu XC, Qian CD, Fang HH, Wen YP, Zhou JY, Zhan ZJ, et al. Paenimacrolidin, a novel macrolide

antibiotic from Paenibacillus sp. F6-B70 active against methicillin-resistant Staphylococcus aureus.

Microb Biotechnol. 2011,4(4):491-502.

168. Barsby T, Kelly MT, Andersen RJ. Tupuseleiamides and basiliskamides, new acyldipeptides and

antifungal polyketides produced in culture by a Bacillus laterosporus isolate obtained from a tropical

marine habitat. J Nat Prod. 2002,65(10):1447-1451.

169. Patel PS, Huang S, Fisher S, Pirnik D, Aklonis C, Dean L, et al. Bacillaene, a novel inhibitor of

procaryotic protein synthesis produced by Bacillus subtilis: production, taxonomy, isolation, physico-

chemical characterization and biological activity. J Antibiot (Tokyo). 1995,48(9):997-1003.

170. Moldenhauer J, Chen XH, Borriss R, Piel J. Biosynthesis of the antibiotic bacillaene, the product of a

giant polyketide synthase complex of the trans-AT family. Angew Chem Int Edit. 2007,46(43):8195-

8197.

171. Wu L, Wu H, Chen L, Yu X, Borriss R, Gao X. Difficidin and bacilysin from Bacillus

amyloliquefaciens FZB42 have antibacterial activity against Xanthomonas oryzae rice pathogens. Sci

Rep. 2015,5:12975.

172. Chen XH, Vater J, Piel J, Franke P, Scholz R, Schneider K, et al. Structural and functional

characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42. J

Bacteriol. 2006,188(11):4024-4036.

173. Gustafson K, Roman M, Fenical W. The macrolactins, a novel class of antiviral and cytotoxic

macrolides from a deep-sea marine bacterium. J Am Chem Soc. 1989,111(19):7519-7524.

174. Schneider K, Chen XH, Vater J, Franke P, Nicholson G, Borriss R, et al. Macrolactin is the Polyketide

Biosynthesis Product of the pks2 Cluster of Bacillus amyloliquefaciens FZB42. J Nat Prod. 2007,70

(9):1417-1423.

175. Lipomi DJ, Langille NF, Panek JS. Total synthesis of basiliskamides A and B. Org Lett.

2004,6(20):3533-3536.

176. Yadav JS, Rao PP, Reddy MS, Prasad AR. Stereoselective synthesis of basiliskamides A and B via

Prins cyclisation. Tetrahedron Lett. 2008,49(37):5427-5430.

177. Li S, Zhang R, Wang Y, Zhang N, Shao J, Qiu M, et al. Promoter analysis and transcription regulation

of fus gene cluster responsible for fusaricidin synthesis of Paenibacillus polymyxa SQR-21. Appl

Microbiol Biotechnol. 2013,97(21):9479-9489.

178. Yu WB, Yin CY, Zhou Y, Ye BC. Prediction of the mechanism of action of fusaricidin on Bacillus

subtilis. Plos One. 2012,7(11):e50003.

179. Cochrane SA, Lohans CT, van Belkum MJ, Bels MA, Vederas JC. Studies on tridecaptin B(1), a

lipopeptide with activity against multidrug resistant Gram-negative bacteria. Org Biomol Chem.

2015,13(21):6073-6081.

180. Sood S, Steinmetz H, Beims H, Mohr KI, Stadler M, Djukic M, et al. Iturin family lipopeptides from

the honey bee pathogen Paenibacillus larvae. Chembiochem. 2014,15(13):1947-1955.

181. Luo Y, Ruan LF, Zhao CM, Wang CX, Peng DH, Sun M. Validation of the intact zwittermicin A

biosynthetic gene cluster and discovery of a complementary resistance mechanism in Bacillus

thuringiensis. Antimicrob Agents Chemother. 2011,55(9):4161-4169.


107

182. Kevany BM, Rasko DA, Thomas MG. Characterization of the complete zwittermicin A biosynthesis

gene cluster from Bacillus cereus. Appl Environ Microbiol. 2009,75(4):1144-1155.

183. Garcia-Gonzalez E, Muller S, Hertlein G, Heid N, Sussmuth RD, Genersch E. Biological effects of

paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium

Paenibacillus larvae. Microbiologyopen. 2014,3(5):642-656.

184. Lechner M, Findeiß S, L. S, Marz M, Stadler P, Prohaska S. Proteinortho: Detection of (Co-)Orthologs

in Large-Scale Analysis. BMC Bioinformatics. 2011,12(1):124.

109

Chapter 3

Isolation and identification of antifungal

peptides from Bacillus BH072, a novel

bacterium isolated from honey

Xin Zhao1, Zhijiang Zhou

1, Ye Han

1, Zhanzhong Wang

1, Jie Fan

1, Huazhi Xiao

1*


P. R. China

This chapter has been published in Microbiological Research.

doi: org/10.1016/j.micres.2013.03.001 (2013).

Chapter 3

110

Abstract

A bacterial strain BH072 isolated from a honey sample showed antifungal activity

against molds. Based on the morphological, biochemical, physiological tests, and

analysis of the 16S rDNA sequence, the strain was identified to be a new

subspecies of Bacillus sp.. It had a broad spectrum of antifungal activity against

various molds such as Aspergillus niger, Pythium, and Botrytis cinerea. Six pairs of

primers of antifungal genes were designed and synthesized, and ituA, hag and tasA

genes were detected by PCR analysis. The remarkable antifungal activity could be

corresponding to the above-mentioned genes. One of these three antifungal

peptides was purified by 30%-40% ammonium sulfate precipitation, Sephadex G-

75 gel filtration and anion exchange chromatography on D201 resin. The purified

peptide was estimated to be 35.615 kDa and identified to be flagellin by

micrOTOF-Q II. By using methanol extraction, another substance was isolated

from fermentation liquor, and determined to be iturin with liquid chromatograph-

mass spectrometer (LC-MS) method. The third possible peptide encoded by tasA

was not isolated in this study. The culture liquor displayed antifungal activity in a

wide pH range (5.0-9.0) and at 40 °C-100 °C. The result of the present work

suggested that Bacillus BH072 might be a bio-control bacterium of research value.

Keywords: Bacillus, antifungal peptide, purification, identification

Antifungal peptides from Bacillus BH072

111

1. Introduction

Fungi are widespread in nature. It frequently contaminates food crops, food raw

materials and processed products. Fungal contamination causes not only huge

economic losses, but also food safety issues, some of which result in human and

animal diseases [1]. Prevention and control of fungal contamination is an important

issue in the field of industry, agriculture and medicine. By the food

industry, chemical preservatives are generally used to control the growth and

reproduction of fungi. Due to the chemical residue, food safety issues become more

and more serious. Some microbes can produce antimicrobial metabolites which can

inhibit or kill other microorganisms. Antifungal peptides are one of the most

important natural defenses against the invading of most fungal pathogens.

Some have been developed to be the food preservatives and bio-pesticides, which

has provided a new choice to prevent and control the fungal contamination of

agricultural products.

Through the research of bio-control against fungi, antifungal peptides play an

important role. According to the Antimicrobial Peptide Database (APD), 756

different antifungal peptides were isolated from different organisms, such as

humans, animals, reptiles, birds, insects and microbes

(http://aps.unmc.edu/AP/main.php). By blocking its synthesis or destroying the

synthesis of fungal cell wall or forming holes in lipid membranes leading to

leakage of the important contents of the fungi that cause death. Some peptides

reacted to fungal mitochondria and nucleic acid within cells causes death, too.

According to reports, Pseudomonas, Bacillus, Aspergillus, Streptomyces, edible

fungi and other microorganisms can produce different antifungal substances, such

as antifungal polypeptide. Among them, the Bacillus species are widely used [2].

Therefore, the study of the unknown bacteria and their antibiotic substances is of

great significance.

http://aps.unmc.edu/AP/main.php

Chapter 3

112

Most bacteria of the genus Bacillus are Gram-positive, aerobic endospore-forming

and rod-shaped bacteria, which are found in diverse environments such as soil and

clays, rocks, dust, aquatic environments, vegetation, food and the gastrointestinal

tracts of various insects and animals [2]. Commercial products including enzymes,

antibiotics, amino acids and insecticides are produced by Bacillus sp.. The potential

of Bacillus species to secrete various peptides which have shown distinct capacities

to inhibit plant pathogens, such as fungi and bacteria with high concentrations,

have been known for more than 50 years. To date, a lot of antimicrobial peptides

produced by Bacillus sp. were reported. A Bacillus amyloliquefaciens CCMI 1051

strain was isolated which had strong inhibition capacity on both Rhizopus sp. L-

122 and Trichoderma harzianum CCMI 783 [3, 4]. Arrebola et al. reported that B.

amyloliquefaciens PPCB004 could inhibit Penicillium crustosum hyphal extension

[5]. Lee et al. discovered Botrytis cinerea was inhibited by Bacillus WJ5

(Paenibacillus lentimorbus) and its antifungal substances were extracted [6]. Quan

et al. and Zhang et al. isolated B. amyloliquefaciens Q-12 and NK10.B and

displayed a strong inhibitory effect on Fusarium oxysporum, Fusarium solani and

other fungi [7, 8]. Many researches indicated that the Bacillus sp. strains

themselves and their antimicrobial substances had huge application potential in

bio-control of plant diseases. Some antibiotics have been a certain degree of

application. The United States has 4 bio-control B. subtilis strains including GBO3,

MBI600, QST713 and B. subtilis var. amyloliquefaciens FZB24, obtained the

Environmental Protection Agency (EPA) approval, which can be applied to

commercial production (http://www.epa.gov/pesticides/biopesticides).

Antifungal materials produced by Bacillus strains have the following two kinds of

molecules. Ribosomal synthesized antimicrobial proteins contain bacteriocins [9,

10], cell wall degrading enzymes (such as proteases, chitinase, β-1, 3-glucan) as

well as some unidentified inhibitory proteins [11, 12]. The non-ribosomal

synthesized antibiotics primarily include lipopeptide antibiotics, such as surfactin,

http://www.epa.gov/pesticides/biopesticides


113

iturin and fengycin [13-20]. Lipopeptide antibiotics with antimicrobial activity

against filamentous fungi and yeasts are mostly D-type and L-type amino acid

cyclic peptides, with a fatty acid chain.

According to literature, most strains of Bacillus sp. produced only one or two

antimicrobial substances. Mora et al. cloned six antimicrobial peptide genes from

Bacillus strains of environment origin, and determined that they encoded different

lipopeptides [21]. Large molecular antimicrobial proteins have rarely been

reported. Hammami et al. pointed out that B. subtilis 14B produced a novel

bacteriocin (Bac 14B) weighted 31 kDa that was highly effective as a bio-control

agent against crown gall disease [22, 23]. Most of the references reported that

TasA and flagellin were obtained through genetic engineering method. Yang et al.

cloned and expressed the tasA gene, and the expressed product showed antifungal

activity against cucumber gray mold [24]. Asano et al. cloned the hag gene, the

antifungal activity of its expressed product flagellin explained the inhibitory

appearance of Bacillus strains B-3, NK-330 and NK-C-3 [25]. By now, TasA and

flagellin have not been purified directly by normal protein extract methods from

Bacillus strains fermentation liquor. The novel bacterium BH072 isolated from

honey showed strong antifungal activity against a lot of molds. In order to explain

the antifungal activity, the peptides of fermentation broth were isolated and

identified by a combination of several purification methods, and their genes were

retrieved and analyzed. We try to elucidate the nature of antifungal substances and

explore the possibility of their further application.

2. Materials and methods

2.1. Microbial strains and culture medium

The microorganism BH072 used in this study was isolated from a honey sample.

Three Bacillus strains B. subtilis BH121, B. licheniformis BH122 and B. subtilis

app:ds:fermentation

app:ds:liquor

app:ds:fermentation

app:ds:broth

Chapter 3

114

Natto BH123 and the indicator strains of Escherichia coli, Staphylococcus aureus,

Pythium, Penicillium, Colletotrichum orbiculare and Saccharomyces cerevisiae

were preserved at Food biotechnology laboratory of Tianjin University. The

indicator Aspergillus niger CGMCC3.03928, B. cinerea CGMCC3.4584 and F.

oxysporum CGMCC3.2830 were purchased from China General Microbiological

Culture Collection Center. All the medium components used in this study were

reagent pure grade purchased from Jiangtian Chemical Technology Co., Ltd.

(Tianjin, China). Solid media used in the antifungal study consisted of potato

dextrose agar for fungi (PDA: potato, 200 g; glucose, 20 g; agar, 18 g; and distilled

water, 1L) and Luria-Bertani agar for bacteria (LBA: peptone, 10 g; yeast extracts,

5 g; NaCl, 10 g; agar, 18 g; and distilled water, 1L). Liquid media, the same agar-

lacking LBA, were used for fermentation test. The strain BH072 was activated by

transferring single colonies of the strain from plates to 10 mL activation LB

medium extract in 50-mL flasks. The flasks were shaken at 37 °C, 150 rpm for 16

h.

2.2. Microscopic examination and Physiological-biochemical identification

According to Deng et al., the sample was prepared and applied to scanning electron

microscope (XL-30 TMP, Philips, the Netherlands) [26]. Physiological-

biochemical tests include sugar fermentation experiments, acid yield experiment,

optimum growth temperature and pH measurement, salt tolerance test, resistance to

organic acid experiment, gelatin puncture, casein and starch hydrolysis.

2.3. 16S Ribosomal DNA sequence analysis

The genomic DNA of strain BH072 was used as a template. The 16S ribosomal

DNA sequence was amplified and sequenced using universal primers 8F:5'-

AGAGTTTGATCATGGCTCAG-3' and 1492R: 5'-ACGGTTACCTTGTTACG

ACTT-3' [27]. The amplification was conducted by polymerase chain reaction in a

app:ds:cerevisiae


115

PCR thermal cycler (MyCycler, Bio-Rad Laboratories Inc., USA). The PCR

amplification system was 25 µL, including 0.2 µL Taq enzyme (0.5 U/mL), 2.5 µL

10× Buffer, 1.8 µL Mg2+

, 1 µL dNTPs Mixture, 1 µL template DNA, 0.5 µL

forward primer (10 µM), 0.5 µL reverse primer (10 µM) and 17.5 µL ddH2O.

Amplification factor: 95 °C, 3 min; 95 °C, 30 s, 55 °C, 60 s, 72 °C 90 s, 30 cycle;

72 °C, 5 min; 4 °C termination reaction. The amplified products were purified and

sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).

2.4. Phylogenic tree construction

According to 16S rDNA sequencing results, combined with GenBank in the genus

Bacillus in 16S rDNA sequences, using MEGA 4.0 [28] software by the neighbor-

joining analysis [29], phylogenetic tree was constructed.

2.5. Cloning of antifungal genes by PCR analysis

DNA was extracted respectively from an overnight culture of Bacillus BH072, B.

subtilis BH121, B. licheniformis BH122 and B. subtilis Natto BH123. Specific

primers for the functional genes of the peptides [30]: ituA (iturin A), hag

(flagellin), tasA (TasA), srf (surfactin), spaS (subtilin) and mrsA (mersacidin)

genes are listed in Table1. The amplification system was the same as 16S rDNA

sequences amplification system. Amplification factor: 95 °C, 3 min; 95 °C, 30 s, 51

°C, 60 s, 72 °C, 90 s, 30 cycle; 72 °C, 5 min; 4 °C termination reaction. The PCR

product was gel-purified and ligated to pUCm-T vector (Sangon Biotech Co., Ltd.,

Shanghai, China) to facilitate DNA sequencing. After transformation into

competent cells of E. coli DH5α, the recombinants were selected on LB agar plates

supplemented with ampicillin. By a colonial PCR reaction using the corresponding

primers, further identification was conducted. And the aimed plasmid was

sequenced by Sangon Biotech Co., Ltd. (Shanghai, China). Sequencing data were

applied to retrieve for homologous sequences with the BLAST algorithm in

app:ds:plasmid

Chapter 3

116

GenBank (National Center for Biotechnology Information [http://www.ncbi. nlm.

nih.gov]).

Table 1. Specific primers for the functional genes of the peptides

Genes Primers

ituA (D21876.1) ituAF: 5’- atgaaaatttacggagtatatatg - 3’

ituAR: 5’- ttataacagctcttcatacgtt - 3’

hag (AB033501.1) hagF: 5’- atgagaatcaaccacaatatcgc - 3’

hagR: 5’- ttaacctttaagcaattgaagaac - 3’

tasA (JF791687.1) tasAF: 5’- atgggtatgaaaaagaaattaag - 3’

tasAR: 5’- ttagtttttatcctcactgtga - 3’

srf (EU882341.1) srfF: 5’- atgaagatttacggaatttatatg - 3’

srfR: 5’- ttataaaagctcttcgtacgag- 3’

spaS (DQ452514.1) spaSF: 5’- atgtcaaagttcgatgatttcga - 3’

spaSR: 5’- ttatttagagattttgcagttaca - 3’

mrsA (Z47559.1) mrsAF: 5’- atgagtcaagaagctatcattcg - 3’

mrsAR: 5’- ttaacaaatacattcagaagttag - 3’

2.6. Purification and identification of flagellin

For the production of flagellin, the strain Bacillus BH072 was grown in 500 mL

LB medium at 37 °C in a shaker at 150 rpm for 24 h from a seed culture medium.

After cultivation, the cells were harvested by centrifugation at 4200 rpm for 20

min. The culture supernatant was sterilized by filtration with 0.22 µm membranes

(Millipore, USA). The filtrate was precipitated with ammonium sulfate at 30%-

40% (w/v) saturation and the resulting pellet was dissolved in 10 mM Tris-HCl

buffer of pH 9.0 (buffer A). This solution was further purified by gel filtration

chromatography using a 2.5 cm×25 cm Sephadex G-75 column eluted with buffer

A. The peak with antifungal activity was collected to anion exchange

chromatography on D201 resin eluted using a linear NaCl gradient (0-1.0 M in

buffer A). Fractions were also monitored for A280 nm using a spectrophotometer


117

(HD-3 Ultraviolet Detector, shanghai, China). The antifungal activity peak was

freeze-dried and suspended in buffer A. During purification, the arbitrary activity

units (AU) was quantified as described elsewhere using A. niger CGMCC3.03928

as indicator organism [31].

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) [32] was

performed to determine the molecular weight of the peptide showing antifungal

activity. The agents used in SDS-PAGE were all purchased from Dingguo

Chemical Technology Co., Ltd. (Beijing, China). The electrophoresis was

accomplished with a 5% stacking gel, 12% running gel, and a sample buffer

containing 1.0 M Tris-HCl (pH 6.8), 20% glycerol, 4% SDS, 10% 2-

mercaptoethanol, and 0.4% bromophenol blue. After electrophoresis at 120 V and

30 mA for 0.5 h in the spacer gel, 180 V and 60 mA for 1 h in the separation gel,

the gel was stained with a solution composed of 0.25% Coomassie Brilliant Blue

R-250, 5% methanol, 7.5% acetic acid, and distilled water and was destained using

a solution of methanol: acetic acid: ddH2O (4.5:4.5:1 v/v/v). The electrophoretic

band was cut off, enzymolyzed and analyzed by mass spectrometry in a

micrOTOF-Q II mass spectrometer (Autoflex tof/tof III, Bruker Daltonic Inc.,

USA). Then the antifungal substance was identified through searching the Protein

Data Base (PDB).

2.7. Isolation and identification of iturin A

Strain BH072 was incubated from a seed culture medium in 500 mL shake flask

with 200 mL LB medium, at 30 °C, 150 rpm for 60 h. After cultivation, the culture

was centrifuged at 4200 rpm for 20 min. In order to adjust to pH of 2.0, 6 M HCl

was added to cell-free supernatant, then stored at 4 °C overnight [33]. The

precipitate was collected by centrifugation at 4200 rpm for 20 min at 4 °C and

dried by freeze-drying, and the residue was extracted with 200 mL of methanol

under shaking for 24 h at room temperature. The crude product was obtained by

app:ds:spacer

app:ds:gel

app:ds:separation

app:ds:gel

app:ds:electrophoretic

app:ds:band

Chapter 3

118

centrifugation at 4200 rpm for 20 min and applied to liquid chromatograph-mass

spectrometer (Thermo Fisher Corporate, USA). The iturin A in filtrate was purified

with a reverse-phase high-performance liquid chromatography (RP-HPLC) column

C18 (Venusil XBP, 5 μm，2.1 mm×150 mm, Agela Corporate, USA) operated at a

flow rate of 1.0 mL/min. A mixture of acetonitrile and 0.1% methane acid was used

as the eluent and the elution was monitored by MS through 600 m/z-1300 m/z, and

determined its molecular weight [34].

2.8. Inhibitory spectrum of the strain BH072

To test antifungal activity, the strain was inoculated into 10 mL of LB liquid

medium at 37 °C, 150 rpm for 12 h, and then transferred to 500 mL shake flask.

The obtained culture was centrifuged at 4200 rpm at 0 °C for 30 min. The cell-free

supernatant was extracted drastically at room temperature as crude extract. The

ability of the strain BH072 to produce antifungal substances was assessed using the

Oxford cup method [35], which was briefly described as followed. 1 mL fungal

spore suspension was uniformly added into 100 mL PDA medium at 40 °C-50 °C,

which coated on solid beef extract peptone plate with oxford cup in. Then 5 μL

crude extract was added in the midpoint of the oxford cup, cultivated at 30 °C for

48 h, and antimicrobial circle diameter was measured. The spectrum of

antimicrobial activity was determined by screening against cultures of A. niger

CGMCC3.03928, B. cinerea CGMCC3.4584, F. oxysporum CGMCC3.2830, E.

coli, S. aureus, Pythium, Penicillium, C. orbiculare, S. cerevisiae. In order to

certify the wide antifungal property of the strain BH072, the spectrum of

antimicrobial activity of B. subtilis BH121, B. licheniformis BH122 and B. subtilis

Natto BH123 was also detected by antimicrobial assays as control.

2.9. Effects of enzymes, pH and heat on antifungal activity

A. niger CGMCC3.03928 was used as the indicator to detect the antifungal

app:ds:methane

app:ds:acid

app:ds:crude

app:ds:extract

app:ds:cerevisiae


119

activity. The cell-free supernatant was treated at 37 °C for 1 h with 2 mg/mL final

concentration of proteinase K. To analyze thermal stability, the supernatant

exposed to temperatures ranging 20 °C to 100 °C for 30 min respectively, and 121

°C for 20 min. The pH stability was determined by adding a series of solutions (pH

2 to 12) and assaying the activity after 2 h at 37 °C. The antifungal activity was

checked using the oxford cup method. Then antimicrobial circle diameter was

measured.

3. Results

3.1. Characteristics of morphology, physiology and biochemistry

The colony of the strain on LBA plate was flat, slightly rough, nearly circular,

white (approximate candle color) and displayed as Gram-positive Bacillus under

microscopy. As is shown in the strain scanning electron micrographs (Fig. 1), the

cells were rod-shaped and have a length of (0.8-1.5) µm. Based on the

physiological and biochemical character of Bacillus sp. [36], biochemical tests

(Table 2) indicated that the most probable identity of the isolate was B. subtilis and

B. amyloliquefaciens. The optimum culture condition was at 37 °C, pH 7.4.

Fig. 1. Scanning electron micrograph of strain BH072 cultivated in LB liquid

Chapter 3

120

medium at 37 °C, 150 rpm for 24 h.

Table 2. Biochemical tests used to identify Bacillus BH072

Physiological and biochemical

tests

Results

Bacillus BH072 B. subtilis B. amyloliquefaciens

glucose + + +

fructose + + +

maltose + + +

lactose - - +

Splitting of urea - + +

Amylolysis test + + +

Gelatin liquefaction test + + +

Caseinde composition test + + +

Growth in 5% NaCl + + +

Growth in 10% NaCl + + +

Growth in 5% CH3COOH - - -

‘+’ indicates reaction-positive, ‘-’ indicates reaction-negative.

3.2. 16S Ribosomal DNA sequence analysis and phylogenic tree construction

The 16S rDNA sequence of the amplified PCR product was determined. Sequences

of 992 bp fragments showed similarity (minimum identity 98%) with the Bacillus

sp.. The phylogenetic tree (Fig. 2) inferred from the 16S rDNA sequences showed

that the strain formed a monophyletic clad, which was closest to but could be

clearly distinguished from B. subtilis and B. amyloliquefaciens. Both molecular and

phenotypic characterization showed that the Bacillus BH072 might belong to a new

subspecies of Bacillus sp..

app:ds:fructose

app:ds:maltose


121

Fig. 2. Phylogenetic tree based on the 16S rDNA sequences showing the

position of strain BH072. The type strains of Bacillus sp. and representatives of

some other related taxa. Scale bar represents 0.001 substitutions per nucleotide

position.

3.3. Inhibitory spectrum of the antifungal peptides

Spectrum of antifungal activity of Bacillus strains was determined based on the

degree of growth inhibition of some fungi and other microbes by direct antagonism

on agar plates using Oxford cup method [35]. In this study, strain BH072 showed

inhibition against A. niger CGMCC3.03928 (inhibition zone >10 mm), F.

oxysporum CGMCC3.2830 (inhibition zone >10 mm), Pythium (1 mm < inhibition

zone <10 mm) and B. cinerea CGMCC3.4584 (1 mm < inhibition zone <10 mm),

but it had no inhibition on E. coli, S. aureus, Penicillium, C. orbiculare and S.

cerevisiae. B. subtilis BH121 had antifungal activity against F. oxysporum

app:ds:cerevisiae

Chapter 3

122

CGMCC3.2830 (1 mm < inhibition zone <10 mm) and B. cinerea CGMCC3.4584

(1 mm < inhibition zone <10 mm). B. licheniformis BH122 could inhibit F.

oxysporum CGMCC3.2830 (1 mm < inhibition zone <10 mm) and B. subtilis Natto

BH123 had no inhibition on all the indicators.

3.4. Detection of genes related to antifungal peptides

Six pairs of primers of antifungal genes were designed and synthesized and three of

them including ituA, hag and tasA genes were detected by PCR analysis and

sequenced, but srf, spas and mrsA genes were not. The first sequence possesses 675

bp in length was 99% homology with gene ituA, and 10 point mutations were

observed. The second sequence of 786 bp showed a 99% similar identify to gene

tasA, and 6 point mutations were observed. The third 1002 bp fragment showed

elevated similarity (96%) with the gene hag, and 37 point mutations were

observed. An agarose gel is shown in Fig. 3. The detection of genes related to

antifungal peptides about B. subtilis BH121, B. licheniformis BH122 and B. subtilis

Natto BH123 was listed in Table 3.

Table 3. Detection of genes related to antifungal peptides

Strains Genes

tasA ituA hag

B. subtilis BH121 + - +

B. licheniformis BH122 - + +

B. subtilis Natto BH123 - - -

Bacillus BH072 + + +

‘+’ indicates reaction-positive, ‘-’ indicates reaction-negative.

app:ds:homology


123

Fig. 3. Agarose gel electrophoresis of aimed DNA detected from strain BH072;

Lane 1, PCR product generated by primer hagF and hagR; Lane 2, PCR product

generated by primer ituAF and ituAR; Lane 3, PCR product generated by primer

tasAF and tasAR; Lane M 5000bp DNA marker SGM03.

3.5. Purification and identification of flagellin

Proteins present in the cell-free supernatant were collected by ammonium sulfate

precipitation (30%-40%, w/v) (fraction I) followed by Sephadex G-75 column

chromatography (Fig. 4A peak 1, fraction II) and anion exchange chromatography

on D201 resin (Fig. 4B peak 1, fraction III). Peak 1 in anion-exchange

chromatography graph and peak 1 in gel chromatography diagram showed

antifungal activity against A. niger. To obtain a highly purified peptide, fraction III

was freeze-dried and dissolved in buffer A, which was subjected to SDS-PAGE. It

also revealed a single monomeric protein band with a molecular mass estimated to

be 35 kDa (Fig. 5). MicrOTOF-Q II analysis indicated that this peptide had a

molecular mass of 35.615 kDa and identified as flagellin. The purification process

was summarized in Table 4 and the antifungal peptide purity was estimated to be

approximately 69-fold greater than that of the crude extract. The yield of the

purified peptide preparation was approximately 40% based on total activity, while

its specific activity was 7168.5 AU/mg.

app:ds:ion-exchange

app:ds:chromatography

Chapter 3

124

Fig. 4. (A) Gel filtration chromatography of the active fractions from gel

column chromatography on Sephadex G-75. Column size, 2.5 cm×25 cm; flow

rate, 1 mL/min; eluent, buffer A; fraction size, 2 mL; absorbance, 280 nm. (B)

Anion-exchange chromatography of the active fraction (peak 1 in A) from anion-

exchange column chromatography on D201 resin. Column size, 2.5 cm×25 cm;

flow rate, 1 mL/min; eluent, a linear NaCl gradient (0-1.0 M in buffer A); fraction

size, 2 mL; absorbance, 280 nm.

Fig. 5. Molecular weight and SDS-PAGE of the purified peptide. Lane M,

molecular mass standard (Protein Molecular Weight Marker BM524), Lane 1,

crude peptide, fraction I, Lane 2, purified peptide, fraction III.

app:ds:ion-exchange

app:ds:chromatography


125

Table 4. Purification summary of flagellin produced by Bacillus BH072

Purification step Total activity

(AU) ×103

Total protein

(mg)

Specific

activity(AU/mg)

Yield

(%)

Purification

(factor)

Crude extract 500 ± 11 4745.1 ± 13 105.3 100 1

(NH4)2SO4

Fractionation

(30%-40%)

360 ± 9 250.8 ± 4 1435.4 72 14

Sephadex G-75 220 ± 4 73.2 ± 3 3005.4 44 29

Ion Exchange

chromatography 200 ± 1 27.9 ± 3 7168.5 40 68

3.6. Determination of antifungal product iturin A with LC-MS

LC-MS of total methanol extract fraction was used to confirm and analyze the

composition of the total active fraction. Fig. 6 showed the current chromatograms

obtained at different corresponding molecular weights (2-8). The first peak was

stood for the solvent. Seven compounds designated as 2, 3, 4, 5, 6, 7 and 8 were

visualized at 4.72 min (M = 1057.6 Da), 6.80 min (M = 1071.5 Da), 14.00 min (M

= 1016.7 Da), 16.34 min (M = 1030.5 Da), 19.67 min (M = 1044.8 Da), 21.72 min

(M = 1034.7 Da) and 22.41 min (M = 1058.9 Da) respectively. Compounds

corresponding to a mass 1016 Da-1071 Da might actually be isomers. The species

B. amiloliquefaciens has been reported to produce lipopeptides with antifungal

activity. Hiradate et al. isolated iturin A2-A8 (m/z values 1043-iturin A2; 1057-

iturin A3-A5; 1071-iturin A6 and A7; 1085-iturin A8) from B. amiloliquefaciens

RC-2 [37]. Yu et al. demonstrated that the antifungal compounds produced by the

strain B94 of B. amiloliquefaciens (m/z values 1044.3, 1047.9 and 1069.5) were

isomers of iturin A [38]. Caldeira et al. using LS-ESI-MS also identified 2 iturin

isomers (m/z values 1031.5 and 1045.5) [39]. The results suggested that the

compounds between 1000 Da and 1100 Da produced by Bacillus BH072 were

iturin.

Chapter 3

126


127

Fig. 6. (A) RP-HPLC Chromatogram corresponding to LC-MS of the

methanolic fraction. A C18 semi-preparative column (2.1 mm×150 mm) was used

with flowing phase, a mixture of acetonitrile and 0.1% methane acid, and eluted at

a flow rate of 1.0 mL/min. (B) Chromatogram corresponding to LC-MS of mass

spectra of the compounds(1-8). (1) Mass spectra corresponding to the peak 1 m/z

1067.7. (2) Mass spectra corresponding to the peak 2 m/z 1057.6. (3) Mass spectra

corresponding to the peak 3 m/z 1071.5. (4) Mass spectra corresponding to the

peak 4 m/z 1016.7. (5) Mass spectra corresponding to the peak 5 m/z 1030.8. (6)

Mass spectra corresponding to the peak 6 m/z 1044.8. (7) Mass spectra

corresponding to the peak 7 m/z 1034.7. (8) Mass spectra corresponding to the

peak 8 m/z 1058.9.

3.7. Effect of enzymes, pH and temperature

The antifungal activity was stable in the pH range from 5.0 to 9.0 (Fig. 7A),

resistant to heating at temperatures higher than 100 °C (Fig. 7B) and treating with

protease K.

Fig. 7. (A) Antifungal activity of the supernatant in different pH solutions

against Aspergillus niger. (B) Antifungal activity of the heat-treated

supernatant against Aspergillus niger.

app:ds:methane

app:ds:acid

Chapter 3

128

4. Discussion

The genus Bacillus sp. was a kind of Gram-positive organism which can produce

spores in the environment. Among them, the most important value of Bacillus sp. is

that, it can secrete a variety of peptides and bacteriocins with antimicrobial activity.

For the result of identification of BH072 strain, the sequence of 16S rDNA had

98% homologous with B. subtilis, but according to the phylogenetic tree, it showed

that the strain formed a monophyletic clad, which was closest to but could be

clearly distinguished from B. subtilis and B. amyloliquefaciens. Both molecular and

phenotypic characterization indicated that the Bacillus BH072 might belong to a

new subspecies of Bacillus sp..

The genes ituA, tasA and hag, related to production of antifungal peptides iturin A,

Tas A and flagellin were identified in the same Bacillus strain BH072. However, it

showed a negative PCR for sfp, spaS and mrsA. The co-production of antifungal

substances by the same strain consists of macromolecular proteins flagellin, TasA

and micromolecular lipopeptides iturin A had never been reported before. Co-

production of three or more antibiotics is not usual, but it has been described that

two or three lipopeptides simultaneously produced by the same strain. Kim et al.

demonstrated the production of iturin, fengycin, and surfactin by B. subtilis

CMB32 [40], similar to that observed in strain P7 [41, 42]. The co-production of

different lipopeptides by Bacillus spp. may worsen the purification, and the huge

structural variability makes it complicated to definitively identify different

lipopeptides and their homologs [4, 43]. For the purpose of demonstrating that the

co-production of these three antifungal peptides is really new in Bacillus strains

isolated from honey, three other Bacillus strains stored in our laboratory were

tested to observe whether they have these three antifungal genes or not. The result

showed that the genes ituA, tasA and hag could be detected only in strain BH072

simultaneously.


129

Bacillus BH072 simultaneously has ituA, tasA and hag genes and it is supposed to

produce these three peptides theoretically. Iturin A and flagellin have been purified

and identified in this study. TasA is difficult to be isolated and purified for the

possibility that it might only be produced in spore generation phase. Iturin A was

extracted by methanol from fermentation liquor after cultivated at 30 °C for 60 h.

Flagellin was isolated and purified by a combination of antifungal tests and

chromatography assays from fermentation liquor after cultivated at 37 °C for 24 h.

The specific methods were used to the purification and identification according to

the properties of the peptides. MicrOTOF-Q II [44] has been used as an efficient

tool for identification of high molecular weight peptides, because of its excellent

quality and accuracy, true isotopic distribution pattern with Sigma Fit algorithm

and incomparable quality resolution. The data of the mass spectra of antifungal

peptides from Bacillus sp. was analyzed and blasted to search the homologous

protein from PDB. A combined use of purification methods and antifungal tests

allowed a rapid identification of antifungal peptides.

These three antifungal peptides have their own characteristics and antifungal

spectrum. The iturin family is a kind of cyclic lipopeptide containing 7 amino

acids, with strong antifungal activity. The antifungal mechanism of iturin is putting

its hydrophobic tails insert into the plasma membrane of indicator cells, and

automatically gathering to form ion Channel, thereby enabling cytoplasm leakage.

In addition, iturin A can release electrolyte and polymer aggregate, increase the

electric conductivity and permeability of biomass membrane which results in cell

membrane surface tension effects, inhibiting pathogenic spore formation. Chen et

al. recently isolated the active substance from B. subtilis JA by reversed phase

HPLC separation, identified two iturin A homologs through ESI-CID mass

spectrometry analysis and their molecular weight respectively is 1042 Da and 1056

Da [10]. Antifungal activity test showed that B. subtilis JA could inhibit wheat scab

(F. graminearum), rice sheath blight (R. solani), watermelon fusarium wilt (F.

app:ds:fermentation

app:ds:liquor

app:ds:fermentation

app:ds:liquor

Chapter 3

130

oxysporum), Pythium irregulare, B. cinerea and other various plant pathogenic.

Flagella is bacterial movement organ, composed of basal body, hook sheath and

flagellar filament. The flagellar filament covered 98% of the total length of the

flagellum, were formed by a single protein subunit - flagellin [45, 46]. Flagellin is

a highly conserved sequence, used as bacterial classification mark [47, 48]. Asano

et al. used flagellin as molecular markers to isolate 60 strains of B. subtilis, based

on flagellin central district (FCD) sequence differences. B. subtilis strains can be

divided into 2 subgroups [3]. A strain DB9011 was the representative of the first

subgroup, in which flagellin generally had antifungal activity, and some strains can

secrete lipopeptide antibiotics similar to the iturin family. Hu et al. isolated B.

subtilis B-FS01 from rape stem which had inhibitory on wheat scab (F.

graminearum) [49]. TasA (translocation-dependent antimicrobial spore protein) is

a kind of spore binding protein of B. subtilis, synthesized from early sporulation to

the cell stationary phase, and then secreted into the culture medium [50, 51, 52].

TasA had a broad spectrum of antimicrobial activity against Gram-positive, Gram-

negative bacteria and some pathogen fungi, such as B. cinerea [53]. According to

the literature, iturin A, flagellin and TasA have their specific antimicrobial

spectrum. Iturin A showed inhibition mainly against F. oxysporum, Bipdaris

maydis and A. niger. TasA had strong antifungal activity against B. cinerea and

flagellin against Fusarium. Based on the antimicrobial assays results of Bacillus

BH072, B. subtilis BH121, B. licheniformis BH122 and B. subtilis Natto BH123,

the new strain Bacillus BH072 possessed a combination of these three peptide

genes and might have a broader antimicrobial spectrum than that occurred in the

previously reported strains.

To sum up, this study identified a novel bacterium isolated from honey sample

which showed significant antifungal activity. The genes of iturin A, flagellin and

TasA were cloned and sequenced. Flagellin and iturin A were purified and

identified by a combined use of several purification methods. The characteristics of

app:ds:basal

app:ds:body


131

these antifungal proteins were primarily tested. The antifungal spectrum needs to

be determined and the antifungal mechanisms should be explored in the future

study. We expect that the strain or its antimicrobial products would contribute to

the bio-control of agricultural pathogens and be used in the field of food safety.

References

1. Hawksworth DL. The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycol

Res. 2001,105(12):1422-1432.

2. Nicholson WL. Roles of Bacillus endospores in the environment. Cell Mol Life Sci. 2002,59(3):410-

416.

3. Caldeira AT, Feio SS, Arteiro JMS, Roseiro JC. Bacillus amyloliquefaciens CCMI 1051 in vitro activity

against wood contaminant fungi. Ann Microbiol. 2007,57(1):29-33.

4. Caldeira AT, Feio SS, Arteiro JMS, Coelho AV, Roseiro JC. Environmental dynamics of Bacillus

amyloliquefaciens CCMI 1051 antifungal activity under different nitrogen patterns. J Appl Microbiol.

2008,104(3):808-816.

5. Arrebola E, Sivakumar D, Korsten L. Effect of volatile compounds produced by Bacillus strains on

postharvest decay in citrus. Biol Control. 2010,53(1):122-128.

6. Lee YK, Senthilkumar M, Kim JH, Swarnalakshmi K, Annapurna K. Purification and partial

characterization of antifungal metabolite from Paenibacillus lentimorbus WJ5. World J Microbiol

Biotechnol. 2008,24:3057-3062.

7. Quan CS, Wang JH, Xu HT, Fan SD. Identification and characterization of

a Bacillus amyloliquefaciens with high antifungal activity. Acta Microbiologica Sinica. 2006,46(1):7-12.

8. Zhang YS, Wang J, Hao JA, Zhang XZ, Cheng Y. Flocculating activity of Penicillium purpurogenum

EL-02 and its flocculating activity. Acta Microbiologica Sinica. 2010,50(7):917-922.

9. Oscáriz JC, Pisabarro AG. Characterization and mechanism of action of cerein 7, a bacteriocin

produced by Bacillus cereus BC7. J Appl Microbiol. 2000,89(2):361-369.

10. Zheng G, Slavik MF. Isolation, partial purification and characterization of a bacteriocin produced by a

newly isolated Bacillus subtilis strain. Lett. Appl Microbiol. 1999,28(5):363-367.

11. Manjula K，Kishore GK，Podile AR. Whole cells of Bacillus subtilis AF1 proved more effective than

cell-free and chitinase-based formulations in biological control of citrus fruit rot and groundnut rust.

Can J Microbiol. 2004,50(9):737-744.

12. Simi K. The chitinase encoding to based chiA gene endows Pseudornonas fluorescens with the capacity

to control plant pathogens in soil. Gene. 1994,147(1):81-83.

13. Bonmatin JM, Laprévote O, Peypoux F. Diversity among microbial cyclic lipopeptides: iturins and

surfactins. Activity-structure relationships to design new bioactive agents. Comb Chem High T Scr.

2003,6(6):541-556.

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=1DAL546giag1ldJ2hlG&field=AU&value=Caldeira,%20AT&ut=11434633&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=1DAL546giag1ldJ2hlG&field=AU&value=Feio,%20SS&ut=11230569&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=1DAL546giag1ldJ2hlG&field=AU&value=Roseiro,%20JC&ut=13917686&pos=%7b2%7d

http://emuch.net/bbs/journal.php?view=detail&jid=624

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=1DAL546giag1ldJ2hlG&field=AU&value=Arrebola,%20E&ut=16167663&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=1DAL546giag1ldJ2hlG&field=AU&value=Sivakumar,%20D&ut=14496366&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=1DAL546giag1ldJ2hlG&field=AU&value=Korsten,%20L&ut=16202153&pos=%7b2%7d


http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Lee,%20YK&ut=15750819&pos=%7b2%7d&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Senthilkumar,%20M

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Kim,%20JH

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Swarnalakshmi,%20K

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Annapurna,%20K

http://apps.webofknowledge.com/full_record.do?product=UA&search_mode=GeneralSearch&qid=21&SID=3EKOpIJ6GFFh@dfk541&page=1&doc=1

http://apps.webofknowledge.com/full_record.do?product=UA&search_mode=GeneralSearch&qid=21&SID=3EKOpIJ6GFFh@dfk541&page=1&doc=1

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=3EKOpIJ6GFFh@dfk541&field=AU&value=Zhang%2C+Yushan

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=3EKOpIJ6GFFh@dfk541&field=AU&value=Wang%2C+Jing

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=3EKOpIJ6GFFh@dfk541&field=AU&value=Hao%2C+Jianan&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=4ELMm871o@Il6B4M53g&field=AU&value=Zhang%2C+Xiuzhi

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=4ELMm871o@Il6B4M53g&field=AU&value=Cheng%2C+Yu

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Osc%C3%A1riz%20JC%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Pisabarro%20AG%22%5BAuthor%5D

http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1365-2672

http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1365-2672

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Zheng%20G%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Slavik%20MF%22%5BAuthor%5D


http://www.ncbi.nlm.nih.gov/pubmed?term=%22Bonmatin%20JM%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Lapr%C3%A9vote%20O%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Peypoux%20F%22%5BAuthor%5D

Chapter 3

132

14. Huszcza E, Burczyk B. Surfactin isoforms from Bacillus coagulans. Z Naturforsch C. 2006,61(9-

10):727-733.

15. Jacques P, Hbid C, Destain J, Razafindralambo H, Paquot M, De Pauw E, Thonart P. Optimization of

biosurfactant lipopeptide production from Bacillus subtilis S499 by Plackett-Burman design. Appl

Biochem Biotech. 1999,77(1):223-233.

16. Kim PI, Bai H, Bai D, Chae H, Chung S, Kim Y, Park R, Chi YT. Purification and characterization of a

lipopeptide produced by Bacillus thuringiensis CMB26. J Appl Microbiol. 2004,97(5):942-949.

17. Koumoutsi A , Chen XH, Henne A, Liesegang H, Hitzeroth G, Franke P, Vater J, Borriss R. Structural

and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic

lipopeptides in Bacillus amyloliquefaciens strain FZB42. J Bacteriol. 2013,29(12):177-184.

18. Mukherjee AK, Das K. Correlation between diverse cyclic lipopeptides production and regulation of

growth and substrate utilization by Bacillus subtilis strains in a particular habitat. FEMS Microbiol

Ecol. 2005,54(3):479-489.

19. Peypoux F, Bonmatin JM, Wallach J. Recent trends in the biochemistry of surfactin. Appl Microbiol

Biot. 1999,51(5):553-563.

20. Tsuge K, Ano T, Hirai M, Nakamura Y, Shoda M. The genes degQ, pps, and Ipa-8 (sfp) are responsible

for conversion of Bacillus subtilis 168 to plipastatin production. Antimicrob Agents Chemother.

1999,43:2183-2192.

21. Mora I, Cabrefiga J, Montesinos E. Antimicrobial peptide genes in Bacillus strains from plant

environments. Int Microbiol. 2011,14(4):213-224.

22. Jia S, Kang YP, Park JH, Lee J, Kwon SW. Determination of biogenic amines in Bokbunja (Rubus

coreanus Miq.) wines using a novel ultra-performance liquid chromatography coupled with

quadrupole-time of flight mass spectrometry. Food Chem. 2012,132(3):1185-1190.

23. Hammami I, Rhouma A, Jaouadi B, Rebai A, Nesme X. Optimization and biochemical characterization

of a bacteriocin from a newly isolated Bacillus subtilis strain 14B for bio-control of Agrobacterium spp.

strains. Lett Appl Microbiol. 2009,48(2):253-260.

24. Yang LR, Wang ZJ, Xue BG, Liu HY, Ma JG, Zheng YP. Clonging of antagonistic protein TasA gene in

Bacillus amyloliquefaciens YN-1 and its prokaryotic expression. Genom Appl Biol. 2010,29(5):823-

828.

25. Asano Y, Onishi H, Tajima K, Shinozawa T. Flagellin as a biomarker for Bacillus subtilis strains:

application to the DB9011 strain and the study of interspecific diversity in amino-acid sequences.

Biosci Biotech Bioch. 2001,65(5):1218-1222.

26. Deng HH, Han Y, Liu YY, Jia W, Zhou ZJ. Identification of a newly isolated erythritol-producing yeast

and cloning of its erythritol reductase genes. J Ind Microbiol Biotechnol. 2012,39(11):1663-1672.

27. Maiwald M, Kappe R, Sonntag HG. Rapid presumptive identification of medically relevant yeasts to

the species level by polymerase chain reaction and restriction enzyme analysis. Med Vet Mycol.

1994,32(32):115-122.

28. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA)

software version 4.0. Mol Biol Evol. 2007,24(8):1596-1599

29. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees.

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Jacques,%20P&ut=12128424&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Hbid,%20C&ut=11671160&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Destain,%20J&ut=11510616&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Razafindralambo,%20H&ut=13692767&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Paquot,%20M&ut=13048871&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=De%20Pauw,%20E&ut=11501507&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Thonart,%20P&ut=13944899&pos=%7b2%7d



http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Kim,%20PI&ut=2307233&pos=%7b2%7d&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Bai,%20H

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Bai,%20D

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Chae,%20H

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Chung,%20S

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Kim,%20Y

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Park,%20R

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Chi,%20YT


http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Koumoutsi,%20A&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Chen,%20XH

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Henne,%20A&ut=11792973&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Liesegang,%20H&ut=12876596&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Hitzeroth,%20G&ut=5363801&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Franke,%20P&ut=4028055&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Vater,%20J&ut=14993106&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Borriss,%20R&ut=10531730&pos=%7b2%7d


http://www.ncbi.nlm.nih.gov/pubmed?term=%22Peypoux%20F%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Bonmatin%20JM%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Wallach%20J%22%5BAuthor%5D

http://www.refdoc.fr/?traduire=en&FormRechercher=submit&FormRechercher_Txt_Recherche_name_attr=listeTitreSerie:%20(Applied%20microbiology%20and%20biotechnology)

http://www.refdoc.fr/?traduire=en&FormRechercher=submit&FormRechercher_Txt_Recherche_name_attr=listeTitreSerie:%20(Applied%20microbiology%20and%20biotechnology)

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Tsuge%20K%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Ano%20T%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Hirai%20M%22%5BAuthor%5D

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Nakamura,%20Y&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Shoda,%20M&ut=14419641&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Mora,%20I&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Cabrefiga,%20J

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Montesinos,%20E

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Jia,%20S&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Kang,%20YP

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Park,%20JH

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Park,%20JH

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Kwon,%20SW


http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Nesme,%20X&ut=12704321&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Kumar,%20S&ut=16143700&pos=%7b2%7d


133

Mol Biol Evol. 1987,4(6):406-425.

30. Abriouel H, Franz CMAP, Ben Omar N, Galvez A. Diversity and applications of Bacillus bacteriocins.


31. Motta AS, Brandelli A. Characterization of an antibacterial peptide produced by Brevibacterium linens.

J Appl Microbiol. 2002,92(1):63-70.

32. Lim JH, Jeong HY, Kim SD. Characterization of the bacteriocin J4 produced by Bacillus

amyloliquefaciens J4 isolated from Korean traditional fermented soybean paste. J Korean Soc Appl Biol

Chem. 2011,54:68-474.

33. Yao DH, Ji ZX, Wang CJ, Qi GF, Zhang LL, Ma X, Chen SW. Co-producing iturin A and poly-c-

glutamic acid from rapeseed meal under solid state fermentation by the newly isolated Bacillus subtilis

strain 3-10. World J Microbiol Biotechnol. 2012,28(3):985-991.

34. Chen H, Wang L, Yuan CL, Zheng ZM, Yu ZL. Isolation and identification of lipopeptides produced

by Bacillus subtilis using high performance liquid chromatography and electrospray ionization mass

spectrometry. Chin J Chromatogr. 2008,26:343-347.

35. Zhang Y, Zhang QJ, Feng XH, Li S, Xia J, Xu H. A novel agar diffusion assay for qualitative and

quantitative estimation of epsilon-polylysine in fermentation broths and foods. Food Res Int.

2012,48(1):49-56.

36. Buchanan RE, Gibbons NE. Bergey's Manual of Determinative Bacteriology, translated by Institute of

Microbiology of Chinese Academy of Sciences. Beijing, China; 1984.

37. Hiradate S, Yoshida S, Sugie H, Yada H, Fujii Y. Mulberry anthracnose antagonists (iturins) produced

by Bacillus amyloliquefaciens RC-2. Phytochemistry 2002,61(6):693-698.

38. Yu GY, Sinclair JB, Hartman GL, Bertagnolli BL. Production of iturin A by Bacillus amylolequefaciens

suppressing Rhizoctonia solani. Soil Biol Biochem. 2002,34(7):955-963.

39. Caldeira AT, Arteiro JMS, Coelho AV, Roseiro JC. Combined use of LC–ESI-MS and antifungal tests

for rapid identification of bioactive lipopeptides produced by Bacillus amyloliquefaciens CCMI 1051.

Process Biochem. 2011,46(9):1738-1746.

40. Kim PI, Ryu J, Kim YH, Chi YT. Production of biosurfactant lipopeptides Iturin A Fengycin and

Surfactin A from Bacillus subtilis CMB32 for control of Colletotrichum gloeosporioides. J Microbiol

Biotechnol. 2010,20(1):138-145.

41. Stein T. Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Microbiol.

2005,56(4):845-857.

42. Yao S, Gao X, Fuchsbauer N, Hillen W, Vater J, Wang J. Cloning, sequencing, and characterization of

the genetic region relevant to biosynthesis of the lipopeptides iturin A and surfactin in Bacillus subtilis.

Curr Microbiol. 2003,47(4):272-277.

43. Chen H, Wang L, Su CX, Gong GH, Wang P, Yu ZL. Isolation and characterization of lipopeptide

antibiotics produced by Bacillus subtilis. Lett Appl Microbiol. 2008,47(3):180-186.

44. Hammami I, Jaouadi B, Ben Bacha A, Rebai A, Bejar S, Nesme X, Rhouma A. Bacillus subtilis

Bacteriocin Bac 14B with a Broad Inhibitory Spectrum: Purification, Amino Acid Sequence Analysis,

and Physicochemical Characterization. Biotechnol Bioproc E. 2012,17(1):41-49.

45. Chang JY, Delange RJ, Shaper JH, Glazer AN. Amino acid sequence of flagellin of Bacillus subtilis 16

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Abriouel,%20H&ut=11000401&pos=%7b2%7d&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Franz,%20CMAP&ut=11372723&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Ben%20Omar,%20N&ut=3721446&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Galvez,%20A&ut=11732103&pos=%7b2%7d


http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Lim,%20JH

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Jeong,%20HY

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Kim,%20SD

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Zheng%2C+Zhiming&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Yu%2C+Zengliang

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Li,%20S

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Xia,%20J

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Xu,%20H

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=1DAL546giag1ldJ2hlG&field=AU&value=Roseiro,%20JC&ut=13917687&pos=%7b2%7d&cacheurlFromRightClick=no


http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Hammami,%20I

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Jaouadi,%20B

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Ben%20Bacha,%20A

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Rebai,%20A

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Bejar,%20S&ut=10395279&pos=%7b2%7d

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Nesme,%20X

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Rhouma,%20A

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Chang%2C+J+Y&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=DeLange%2C+R+J

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Shaper%2C+J+H

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Glazer%2C+A+N

Chapter 3

134

8. I. Cyanogen bromide peptides. J Biol Chem. 1976,251(3):695-700.

46. Delange RJ, Chang JY, Shaper JH, Martinez RJ, Komatsu SK, Glazer AN. On the amino-acid sequence

of flagellin from Bacillus subtilis168: comparison with other bacterial flagellins. Proc Natl Acad Sci.

USA 1973,70(12):3428-3431.

47. Denning N, Morgan JAW, Whipps JM, Saunders JR, Winstanley C. The flagellin gene as a stable

marker for detection of Pseudomonas fluorescens SBW25. Lett Appl Microbiol. 1997,24(3):198-202.

48. Winstanley C, Morgan JAW. The bacterial flagellin gene as a biomarker for detection, population

genetics and epidemiological analysis. Microbiology. 1997,143(10):3071-3084.

49. Hu LB, Shi ZQ, Zhang T, Yang ZM. Fengycin antibiotics isolated from B-FS01 culture inhibit the

growth of Fusarium moniliforme Sheldon ATCC38932. FEMS Microbiol Lett. 2007,272(1):91-98.

50. Stover AG, Driks A. Control of synthesis and secretion of the Bacillus subtilis protein YqxM. J

Bacteriol. 1999,181(22):7065-7069.

51. Stover AG, Driks A. Regulation of synthesis of the Bacillus subtilis transition-phase, spore-associated

antimicrobial protein TasA. J Bacteriol. 1999,181(1):5476-5481.

52. Tamehiro N, Okamoto-Hosoya Y, Okamoto S, Ubukata M, Hamada M, Naganawa H, Ochi K.

Bacilysocin, a novel phospholipid antibiotic produced by Bacillus subtilis 168. Antimicrob Agents

Chemother. 2002,46(2):315-320.

53. Stover AG, Driks A. Secretion, localization and antimicrobial activity of TasA, a Bacillus subtilis spore-

associated protein. J Bacteriol. 1999,181(5):1664-1672.

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Delange%2C+R+J&cacheurlFromRightClick=no

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Chang%2C+J+Y

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Shaper%2C+J+H

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Martinez%2C+R+J

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Komatsu%2C+S+K

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Glazer%2C+A+N

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Saunders%2C+J+R

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=MEDLINE&SID=1DAL546giag1ldJ2hlG&field=AU&value=Winstanley%2C+C

http://apps.webofknowledge.com/OneClickSearch.do?product=UA&search_mode=OneClickSearch&colName=WOS&SID=4ELMm871o@Il6B4M53g&field=AU&value=Yang,%20ZM&ut=869904&pos=%7b2%7d

135

Chapter 4

Complete genome sequence of Bacillus

amyloliquefaciens strain BH072 isolated

from honey

Xin Zhao1,2

, Anne de Jong1, Zhijiang Zhou

2, Oscar P. Kuipers

1*




P. R. China

This chapter has been published in Genome Announcements.

doi: 10.1128/genomeA.00098-15 (2015).

Chapter 4

136

Abstract

The genome of Bacillus amyloliquefaciens strain BH072, isolated from a honey

sample, and showing strong antimicrobial activity against plant pathogens, is

4.07Mb in size and harbors 3,785 coding sequences (CDS). Several gene clusters

for non-ribosomal synthesis of antimicrobial peptides and a complete gene cluster

for biosynthesis of mersacidin were detected.

Complete Genome Sequence of Bacillus amyloliquefaciens Strain BH072

137

Among bio-control microorganisms, Bacillus amyloliquefaciens subsp. strains have

the ability to enhance the yield of crop plants and to suppress microbial plant

pathogens [1]. Recently, B. amyloliquefaciens subsp. strain DSM7 [2] and plant-

associated B. amyloliquefaciens subsp. plantarum group strain FZB42, YAU

B9601-Y2, CAU B946 [3-6] have been completed sequenced. All these strains

contain 7 or more gene clusters for either ribosomally encoded bacteriocins or non-

ribosomal antimicrobial polyketides or lipopeptides. Here, we report the genome

sequence of the B. amyloliquefaciens strain BH072 that also contains similar gene

clusters as the 4 strains mentioned above, but in a different combination.

Strain BH072, a novel bacterium isolated from a honey sample, was identified as

being B. amloliquefaciens by 16S rDNA gene and gyrA gene sequencing [7],

physiological and biochemical analysis. It had a broad spectrum of antifungal

activity against various molds, such as Aspergillus niger, Pythium, Fusarium

oxysporum and Botrytis cinerea. The ituA, hag and tasA genes, encoding iturin A,

flagellin and TasA, were detected by PCR analysis and flagellin and iturin A were

purified and identified by Zhao et al. [8].

Genomic DNA prepared from strain BH072 was sequenced using Pacific

Biosciences RS sequencing technology (Pacific Biosciences, Menlo Park, CA),

yielding >100× average genome coverage. The sample was prepared as a 10-kb

insert library and sequenced on a SMRT v.2.3. cell. The Hierarchical Genome

Assembly Process (HGAP3) workflow (PacBio DevNet; Pacific Biosciences) was

used to perform a de-novo assembly. The genome was annotated at the NCBI

(National Center for Biotechnology Information) using the Annotation pipeline 2.9

(rev. 452132).

The complete genome sequence of BH072 was composed of one circular contig of

4,069,641-bp chromosome with a G+C value of 46.4%. The genome was larger

than strain FZB42, CAU B946 and DSM7, but smaller than strain YAU B9601-Y2.

Chapter 4

138

The chromosome consisted of 3,943 genes, 3,785 CDS’s, 44 pseudo-genes, 27

rRNAs (5S, 16S, 23S) and 86 tRNAs. Phylogenetically the strain YAU B9601-Y2

is the closest neighbor of B. amyloliquefaciens strain BH072. Remarkably, based

on BAGEL3 mining [9], the whole mersacidin operon was detected in BH072,

making it the third mersacidin producer strain till now, the other two being YAU

B9601-Y2 and HIL Y-85 [6, 10].

Nucleotide sequence accession number

The genome sequence of B. amyloliquefaciens BH072 has been deposited in

Genbank, under the accession number of CP009938.

References

1. Borriss R. Use of plant-associated Bacillus strains as biofertilizers and biocontrol agents. In:

Maheshwari, D.K. (Ed.), Bacteria in Agrobiology: Plant Growth Responses. Springer Heidelberg,

Heidelberg, Germany, 2011, pp. 41-76.

2. Rueckert C, Blom J, Chen XH, Reva O, Borriss R. Genome sequence of Bacillus amyloliquefaciens

type strain DSM7 reveals differences to plant-associated Bacillus amyloliquefaciens FZB42. J

Biotechnol. 2011,155(1):78-85.

3. Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, Morgenstern B, Voss B,

Hess WR, Reva O, et al. Comparative anaylsis of the complete genome sequence of the plant growth-

promoting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol 2007,25(9):1007-1014.

4. Hao K, He P, Blom J, Ruckert C, Mao Z, Wu YX, He YQ, Borriss R. The genome of plant growth-

promoting Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601–Y2 contains a gene cluster


5. Blom J, Rueckert C, Niu B, Borriss R. The complete genome of Bacillus amyloliquefaciens subsp.

Plantarum CAU B946 contains a gene cluster for nonribosomal synthesis of iturin A. J Bacteriol.

2012,194(7):1845-1846.

6. He PF, Hao K, Blom J, Rückertc C, Vaterd J, Mao ZC, Wu YX, Hou MS, He PB, He YQ, et al.

Genome sequence of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum

B9601-Y2 and expression of mersacidin and other secondary metabolites. J Biotechnol.

2012,164(2):281-291.

7. Borriss R, Chen XH, Rueckert C, Blom J, Becker A, Baumgarth B, Fan B, Pukall R, Schumann P,

Spröer C, et al. Relationship of Bacillus amyloliquefaciens clades associated with strains DSM7 and

FZB42: a proposal for Bacillus amyloliquefaciens subsp. amyloliquefaciens subsp. nov. and Bacillus

Complete Genome Sequence of Bacillus amyloliquefaciens Strain BH072

139

amyloliquefaciens subsp. plantarum subsp. nov. based on complete genome sequence comparisons. Int

J Syst Evol Microbiol. 2011,61(8):1786-1801.

8. Zhao X, Zhou ZJ, Han Y, Wang ZZ, Fan J, Xiao HZ. Isolation and identification of antifungal peptides

from Bacillus BH072, a novel bacterium isolated from honey. Microbiol Res. 2013,168(9):598-606.

9. van Heel AJ, de Jong A, Montalbán-López M, Kok J, Kuipers OP. BAGEL3: Automated identification


Acids Res. 2013,41:448-453.

10. Chatterjee S, Lad SJ, Phansalkar MS, Rupp RH, Ganguli BN, Fehlhaber HW, Kogler H. Mersacidin, a

new antibiotic from Bacillus: fermentation, isolation, purification and chemical characterization. J

Antibiot. 1992,45(6):832-838.

141

Chapter 5

Production of class I and II hybrid

lantibiotics using the nisin modification

machinery NisBTC together with GdmD in

Lactococcus lactis

Xin Zhao1,2

, Manuel Montalbán-López1, Oscar P. Kuipers

1*




P. R. China

Chapter 5

142

Abstract

The nisin modification machinery can successfully dehydrate serines and

threonines, and introduce lanthionine rings in diverse core peptides that are fused

to the nisin leader sequence. Moreover, different lanthipeptide modification

enzymes can work together in an in vivo system, which extends the possibilities to

produce and engineer a wide range of antimicrobial peptides. Here, we employ the

production machinery of the class I lantibiotic nisin (composed of the dehydratase

NisB, the cyclase NisC and the transporter NisT) with an additional C-terminal

decarboxylase (GdmD) to generate, modify, and secrete biologically active class I

and II hybrid lantibiotics. These are genetically engineered by fusing coding

sequences of the first three (methyl-)lanthionine rings of class I nisin, the second

methyl-lanthionine ring of class II mersacidin and the C-terminal S-[(Z)-2-

aminovinyl]-D-cysteine (AviCys) of gallidermin, fused to the nisin leader-

encoding sequence. Modified prepeptides were secreted by Lactococcus lactis,

purified and further characterized. Chemical derivatization and mass spectrometry

analyses demonstrated the presence and localization of multiple dehydrated serines

and threonines and (methyl-)lanthionines in the hybrid prepeptides. After cleavage

of the leader peptide from the prepeptides by trypsin, modified hybrid peptides

containing the decarboxylated C-terminus were shown to have a more potent

antimicrobial activity against Micrococcus flavus than the ones without C-terminal

AviCys.

Key words: lantibiotics, hybrid peptide, nisin, mersacidin, S-[(Z)-2-aminovinyl]-D-

cysteine

Production of Class I and II Hybrid Lantibiotics

143

1. Introduction

Lanthipeptides are peptides defined by the presence of posttranslational

modifications (PTMs), namely the thioether-linked amino acid lanthionine and

methyl-lanthionine. Lanthipeptides with antimicrobial activity are referred to as

lantibiotics. In fact, the term lantibiotic is derived from lanthionine-containing

antibiotics [1, 2]. They show inhibitory activity against a variety of (mostly) Gram-

positive bacteria at nanomolar levels, which demonstrates promising

chemotherapeutic potential. Lanthipeptides can be subdivided into 4 classes [3].

The main differences between them are the PTM enzymes involved. Class I

lantibiotics are modified by two distinct enzymes that carry out the PTM process (a

dehydratase LanB and a cyclase LanC), while class II lantibiotics are modified by a

bifunctional enzyme termed LanM. The remaining classes established for

lanthionine-containing peptides are modified by other multifunctional synthetases

(LanKC or LanL), and commonly lack significant antimicrobial activity [4].

One of the most studied and best characterized lantibiotics is nisin (Fig. 1), a class I

lantibiotic produced by certain Lactococcus, Streptococcus and Enterococcus

strains, displaying a broad activity spectrum against Gram-positive pathogens [5-

7]. It has been used commercially, with a 50-year history, as a preservative in food

products. The nisin dehydratase NisB dehydrates serines and threonines of the nisin

core peptide [8-10]. Subsequently, the nisin cyclase NisC couples the dehydrated

residues dehydroalanine (Dha) or dehydrobutyrine (Dhb) with cysteines to form

lanthionine or methyl-lanthionine, respectively [8, 10]. Subsequently, the ABC-

transporter NisT exports the modified prenisin, and the peptidase NisP cleaves off

the leader peptide [8, 9, 11].

Mersacidin (Fig. 1) is a potent class II lantibiotic produced by several Bacillus

amyloliquefaciens strains, showing in vivo activity against Gram-positive bacteria,

Chapter 5

144

such as methicillin-resistant Staphylococcus aureus [12]. The gene clusters of

mersacidin possess a bifunctional MrsM enzyme which catalyzes dehydration as

well as thioether formation, while the MrsD enzyme (same function as

GdmD/EpiD of gallidermin/epidermin) catalyzes the oxidative decarboxylation of

the C-terminal cysteine residue of MrsA to a S-[(Z)-2-aminovinyl]-3methyl-D-

cysteine (AviMeCys) (Fig. 1), and a MrsT transporter with an associated cysteine

protease domain secretes the final modified peptide precursor [13, 14]. By genome

mining of bacteriocin gene clusters of B. amyloliquefaciens BH072, a complete

mersacidin biosynthetic gene cluster was found [15]. However, no mersacidin

could be detected in the supernatant by direct production by B. amyloliquefaciens

BH072.

Previous studies demonstrated that the nisin production machinery can be used to

produce and posttranslationally modify silent lantibiotics [16, 17]. It was shown

that designed peptides fused to the nisin leader peptide can be successfully

modified by NisB and NisC and exported out of Lactococcus lactis by NisT [16-

20]. In addition, there is already experimental proof that different lantibiotic

modification enzymes can work together in an in vivo production system including

NisBTC and GdmD/LtnJ [20]. The combination of the nisin synthetic machinery

with additional modification enzymes brings a new opportunity to use them as a

tool to produce more lantibiotics with various modifications and improve their

stability [21].

Here, we present a successful application of the lantibiotic nisin expression system

(NisBTC) with the additional oxidative decarboxylase GdmD to produce, modify,

and secrete class I and II hybrids designed by fusing the nisin leader sequence to

the N-terminal (methyl-)lanthionine rings of nisin (nisin part) and a large globular

methyl-lanthionine ring of class II mersacidin (mersacidin part), including a C-

terminal S-[(Z)-2-aminovinyl]-D-cysteine (AviCys) ring. Moreover, we assess


145

their antimicrobial actvities and compare the production and modification between

strains containing either GdmD or MrsD.

Fig. 1. Primary structures of nisin, mersacidin and gallidermin. Dha:

dehydroalanine; Dhb: dehydrobutyrine; Abu: aminobutyric acid; Ala-S-Ala:

lanthionine, Abu-S-Ala: methyl-lanthionine; Structure in orange dotted line: S-

[(Z)-2-aminovinyl]-D-cysteine/S-[(Z)-2-aminovinyl]-3methyl-D-cysteine.

2. Materials and methods

2.1. Bacterial strains, plasmids and growth conditions

Strains and vectors used in this work are given in Table 1. L. lactis NZ9000 [22]

was used for expression of the modification enzymes and hybrid peptides and

cultured in M17 medium supplemented with 0.5% glucose at 30 °C for genetic

manipulation or a minimal expression medium (MEM) for protein expression and

purification assays [21]. Micrococcus flavus B423 was grown in LB medium with

shaking at 30 °C. Chloramphenicol and/or erythromycin were used at 5 μg/mL

Chapter 5

146

when necessary. Plasmids pIL3EryBTC and pIL3BTC encoding the nisin

modification machinery were used to produce and modify prepeptides [20, 21].

2.2. Molecular cloning

Molecular cloning techniques were performed according to Sambrook and Russell

[23]. Fast digest restriction enzymes and ligase were purchased from Thermo

Scientific and used according to the manufacturer’s instructions. Preparation of L.

lactis NZ9000 competent cells and transformation was performed as described

previously [24]. The plasmid was transformed into L. lactis NZ9000, isolated using

a commercial plamid extraction kit (Macherey-Nagel), and checked by sequencing

(Macrogen).

Table 1. Strains and vectors used in this work

Strains/Vectors Characteristic Purpose References

L. lactis NZ9000 pepN::nisRK expression host 22

B. amyloliquefaciens

BH072

mrs operon mersacidin source 15

Micrococcus flavusB423 sensitive strain 20

pNZ8048 CmR expression vector 22

pNZnisA-E3 EryR, nisA nisin expression 11

pNZnisA CmR, nisA nisin expression 20

pNZnisA-ltnJ CmR, nisA attenuator source 20

pIL3BTC nisBTC under the control

of PnisA, CmR

modification and transport of

lantibiotics

21

pIL3EryBTC nisBTC under the control

of PnisA, EryR

modification and transport of

lantibiotics

20

pNZE-nisA(Δ23-34)-

SFNSYCC-gdmD

EryR, nisA(Δ23-34)-

SFNSYCC

expression of hybrid peptide with

GdmD

20

pNZE-nisA(Δ23-34)-

SFNSYCC

EryR, nisA(Δ23-34)-

SFNSYCC

expression of hybrid peptide 20

pNZE-nisleader-mrsA’ EryR, mrsA’ mersacidin expression this work

pNZE-nisleader-mrsA’-

gdmD

EryR, mrsA’ mersacidin expression with GdmD this work

pNZE-nisleader-nis(1-7)- EryR, nis(1-7)-mrsA’(4- expression of hybrid peptide this work


147

mrsA’(4-20) 20)

pNZE-nisleader-nis(1-7)-

mrsA’(4-20)-gdmD

EryR, nis(1-7)-mrsA’(4-

20)


GdmD

this work


mrsA’(4-20)


20)

expression of hybrid peptide this work


mrsA’(4-20)-gdmD


20)


GdmD

this work


mrsA’(4-20)


20)



mrsA’(4-20)-gdmD


20)


GdmD

this work


mrsA’

EryR, nis(1-22)-mrsA’ expression of hybrid peptide this work


mrsA’-gdmD

EryR, nis(1-22)-mrsA’ expression of hybrid peptide with

GdmD

this work


mrsA’(3-20)


20)



mrsA’(3-20)-gdmD


20)


GdmD

this work


mrsA’(4-12)-ASFNSYCC


12) -ASFNSYCC



mrsA’(4-12)-ASFNSYCC-

gdmD


12) -ASFNSYCC


GdmD

this work


mrsA’(4-12)-TLTSYCC


12)-TLTSYCC



mrsA’(4-12)-TLTSYCC-

gdmD


12)-TLTSYCC


GdmD

this work


mrsA’(4-12)


12)



mrsA’(4-12)-gdmD


12)


GdmD

this work

pNZ-nisleader-nis(1-22)-

mrsA’(4-20)

CmR, nis(1-22)-mrsA’(4-

20)



mrsA’(4-20)-mrsD


20)

expression of hybrid peptide with MrsD this work


mrsA’(4-12)-ASFNSYCC


12)-ASFNSYCC


Chapter 5

148


mrsA’(4-12)-ASFNSYCC-

mrsD


12)-ASFNSYCC

expression of hybrid peptide with MrsD this work


mrsA’(4-12)-TLTSYCC


12)-TLTSYCC



mrsA’(4-12)-TLTSYCC-

mrsD


12)-TLTSYCC expression of hybrid peptide with MrsD this work


mrsA’(4-12)-mrsD


12) expression of hybrid peptide with MrsD this work

Fig. 2. Organization of gene expression for the hybrid peptides. (A) pNZE-

derived vectors harboring nisin/mersacidin hybrid genes, with/without gdmD. (B)

pNZE-derived vectors harboring nisin/mersacidin hybrid genes containing different

C-terminal tails (green arraow head), with/without gdmD. (C) pNZ8048-derived

vectors harboring nisin/mersacidin hybrid genes adding different C-terminal tails,

with/without mrsD. PnisA denotes the nisin inducible promotor gene; RBS stands

for ribosome binding site.


149

2.3. Construction of expression vectors

2.3.1. Construction of vectors harboring nisin/mersacidin hybrid genes

Vectors harboring different nisin and mersacidin hybrid peptides, namely pNZE-

nisleader-nis/mrsA’ and the counterpart constructs containing gdmD, namely

pNZE-nisleader-nis/mrsA’-gdmD listed in Table 1 were obtained as described

below. Primers and templates of PCR used in this study with the corresponding

amplified products are listed in Table S1. The nisin inducible promotor gene,

ribosome binding site (RBS) and leader sequence of nisin were amplified from

plasimid pNZnisA-E3 [11], using the primers P-nisl-for (5’ BglII) and one of the P-

nisl-rev series. The mersacidin core peptide encoding gene mrsA’ was amplified

from genomic DNA of B. amyloliquefaciens BH072 [15] using the primers P-mrsa-

for series and P-mrsA-rev (5’ PstI). In addition, a DNA sequence with a

transcription attenuator function was amplified from pNZnisA-ltnJ [20], using the

primers P-att-for (5’ PstI) and P-att-rev (5’ HindIII). By a 2-step overlap PCR (last

step primers: P-nisl-for (5’ BglII)/P-att-rev (5’ HindIII)), the three DNA fragments

were sequentially connected. After amplification, the fused DNA sequences were

digested using BglII and HindIII, and ligated into pNZE-empty and pNZE-gdmD

[20] digested with the same enzymes, resulting in pNZE-nisleader-nis/mrsA’ series

and pNZE-nisleader-nis/mrsA’-gdmD series (Fig. 2A).

2.3.2. Construction of vectors by changing the C-terminus of hybrid substrates

In order to get the construction of the gallidermin tail (-SFNSYCC) replacing the

C-terminus of mersacidin, first, we used the primers P-nisl-for (5’ BglII)/P-gtail1-

rev (5’ PstI) and P-nisl-for (5’ BglII)/P-gtail2-rev (5’ PstI), respectively, with

pNZE-nisleader-nis(1-22)-mrsA’(4-20)-gdmD as the template.Subsequently, by

digestion with BglII and PstI and ligation into pNZE-nisleader-nis(1-22)-mrsA’(4-

20) and pNZE-nisleader-nis(1-22)-mrsA’(4-20)-gdmD digested with the same

Chapter 5

150

restriction enzymes, respectively, pNZE-nisleader-nis(1-22)-mrsA’(4-12)-

ASFNSYCC and pNZE-nisleader-nis(1-22)-mrsA’(4-12)-ASFNSYCC-gdmD;

pNZE-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC and pNZE-nisleader-nis(1-22)-

mrsA’(4-12)-TLTSYCC-gdmD were constructed. Similarly, pNZE-nisleader-nis(1-

22)-mrsA’(4-12) and pNZE-nisleader-nis(1-22)-mrsA’(4-12)-gdmD were

constructed as a control lacking C-terminal AviCys using the primer P-nisl-for (5’

BglII)/P-deltail-rev (5’ PstI), with pNZ-nisleader-nis(1-22)-mrsA’(4-20) as the

template, and then cloning as a BglII and PstI fragment into pNZE-nisleader-nis(1-

22)-mrsA’(4-20) and pNZE-nisleader-nis(1-22)-mrsA’(4-20)-gdmD (Fig. 2B).

2.3.3. Construction of vectors by changing the LanD encoding gene

The mersacidin LanD enzyme gene mrsD and its RBS sequences were amplified

from genomic DNA of B. amyloliquefaciens BH072 with the primers P-mrsD-for

(5’ KpnI)/P-mrsD-rev (5’ XhoI) and cloned as a KpnI and XhoI fragment into

pNZ8048 [25], generating pNZ8048-mrsD. Moreover, after amplification (primers:

P-nisl-for (5’ BglII)/P-att-rev (5’ KpnI); templates: plasmid of pNZE-nisleader-

nis(1-22)-mrsA’(4-20), pNZE-nisleader-nis(1-22)-mrsA’(4-12)-ASFNSYCC and

pNZE-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC) and digestion of the PCR

products with BglII and KpnI, the substrate fragments were inserted into pNZ8048-

mrsD and pNZ8048 vectors between the restriction sites BglII and KpnI to obtain

pNZE-nisleader-nis(1-22)-mrsA’(4-20)-mrsD, pNZ-nisleader-nis(1-22)-mrsA’(4-

12)-ASFNSYCC-mrsD and pNZ-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC-

mrsD; and the counterpart constructs pNZE-nisleader-nis(1-22)-mrsA’(4-20), pNZ-

nisleader-nis(1-22)-mrsA’(4-12)-ASFNSYCC and pNZ-nisleader-nis(1-22)-

mrsA’(4-12)-TLTSYCC (Fig. 2C).

2.4. Protein expression and purification

The vectors containing the structural gene and the additional modification enzyme


151

GdmD or MrsD, either derived from pNZE-empty or pNZ8048, were transformed

into NZ9000 (pIL3BTC) or NZ9000 (pIL3EryBTC), respectively. MEM medium

was inoculated at 2% from an overnight culture of the producer strain grown in

GM17. When the culture reached an OD (600 nm) of 0.4-0.6, nisin was added at a

final concentration of 10 ng/mL. Cells were harvested after 3 h of induction by

centrifugation at 4 °C for 15 min at 5000 rpm, and the supernatant was kept for the

isolation of the peptides. To concentrate protein from supernatant, trichloroacetic

acid (TCA) precipitation was performed according to Sambrook et al. [23].

Prepeptides were analyzed on Tricine SDS-PAGE gels and stained with Coomassie

(Fermentas) [26, 27].

Alternatively, when higher amounts of prepeptide were required, larger volumes of

supernatant were concentrated by fast flow cationic exchange chromatography.

Thus, 1 L cell-free supernatant was mixed 1:1 with a 100 mM lactic acid solution

and applied to a 5 mL HiTrap SP-Sepharose (GE Healthcare) column equilibrated

with 50 mM lactic acid pH 4.0. Peptides were washed with 50 mM lactic acid pH

4.0, and then eluted with 50 mM lactic acid 1 M NaCl pH 4.0 [28]. Subsequently a

PD-10 Desalting Column (GE Healthcare) was used to desalt the sample. The

desalted peptides were freeze-dried and dissolved in 0.05% acetic acid.

2.5. MALDI-TOF mass spectrometry

A 1-μL sample of TCA precipitated supernatant was spotted, dried, and

subsequently washed with Milli-Q water on the target. Afterwards, 1 μL of matrix

solution (5 mg/mL α-cyano-4-hydroxycinnamic acid from Sigma-Aldrich dissolved

in 50% acetonitrile and 0.1% trifluoroacetic acid) was spotted on top of the washed

sample. A Voyager DE PRO MALDI-TOF mass spectrometer (Applied

Biosystems) was used to obtain mass spectra using conditions previously

established [20]. Data were analyzed with “Data Explorer” software version 4.0.0.0

(Applied Biosystems).

Chapter 5

152

2.6. CDAP labeling for the assignment of free cysteines

1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) was used to react

with free cysteine residues. The reactions with CDAP were performed as described

previously [16, 29]. Purified samples were collected, freeze-dried, and resuspended

in 9 μL of 0.5 M HCl at pH 3.0 and reduced with 1 μL of 100 mg/mL Tris [2-

carboxyethyl] phosphine (TCEP). After 10 min incubation at room temperature, 2

μL of 100 mg/mL CDAP was added, followed by 15 min of incubation at room

temperature. Then samples were collected and analyzed by MALDI-TOF.

2.7. Antimicrobial activity assays

A culture of M. flavus OD (600 nm) = 0.5 was added at 1% (v/v) into melted LB-

agar at 45 °C and poured in plates. Once the agar was solid, wells of 8 mm were

created and filled with 50 μL of the lantibiotic solution. Lantibiotics were activated

with 2 μL of 1 mg/mL trypsin stock solution added directly to the well [16].

3. Results

3.1. Production, secretion and purification of prepeptides

To investigate the production and secretion of mersacidin in L. lactis NZ9000, we

first tried heterologous expression of mersacidin fused directly to the nisin leader

peptide. Either pNZE-nisleader-mrsA’ or pNZE-nisleader-mrsA’-gdmD was

introduced into L. lactis NZ9000 containing pIL3BTC. Cultures of L. lactis

NZ9000 transformed with pIL3BTC and either pNZE-derivative were induced with

subinhibitory amounts of nisin. Subsequently, the supernatants were collected and

the prepeptides were concentrated by TCA precipitation. We checked the

production with Tricine SDS-PAGE and MALDI-TOF mass spectrometry.

However, no expression product was obtained (data not shown). NisB and NisC


153

can form lanthionine/methyl-lanthionine rings in non-cognate peptides but so far

only when serines/threonines are positioned N-terminally of the cysteines to be

coupled. However, the first ring of mersacidin is formed by cysteine and threonine

with the position of cysteine before threonine, which is unnatural for NisBC-

modified peptides. In addition, mersacidin contains a negatively charged residue

typical of the lipid II-binding motif of class II lantibiotics and a globular structure

that might not be correctly processed by the NisBC system.

van Heel et al. [17, 20] showed that peptides with an N-terminus similar to nisin

can be modified by NisBC even when the C-terminus is different to that of nisin. A

hybrid peptide consisting of the first three lanthionine rings of nisin and its so-

called hinge region (NMK) followed by the C-terminal motif of gallidermin

(SFNSYCC) was successfully expressed, and native nisin ABC fragments and the

rest of the peptides were separately obtained via enzymatic digestion. Thus, the

following hybrids were designed containing a native nisin N-terminal part and a

mersacidin part in order to test its activity as a full-length hybrid [20, 30]. We

considered removing the first ring of mersacidin (CTF) and replacing it by the first

ring of nisin (ITSISLC) in the construct pNZE-nisleader-nis(1-7)-mrsA’(4-20), the

first three rings of nisin (ITSISLCTPGCKTGALMGCNMK) using the construct

pNZE-nisleader-nis(1-22)-mrsA’(4-20) and all the five rings of nisin

(ITSISLCTPGCKTGALMGCNMKTATCHC) in the mutant pNZE-nisleader-

nis(1-28)-mrsA’(4-20) to help driving expression of the mersacidin part. An

overview of all hybrid molecules with the expected modifications is presented

below in Fig. 3. As expected, constructs with three and five rings of nisin promoted

the production of mersacidin and nisin hybrids (data not shown). Next, we repeated

the expression assays of full mersacidin fused to the first 22 amino acids of nisin

on pNZE-nisleader-nis(1-22)-mrsA’ and avoiding the first ring (CT) of mersacidin

maintaining the phenylalanine (F) on pNZE-nisleader-nis(1-22)-mrsA’(3-20). The

product with F and lacking the first ring of mersacidin was detected, while that

Chapter 5

154

with CTF was not (data not shown). It was confirmed that the first ring of

mersacidin (CT) inhibited the production of nisin and mersacidin hybrids using the

nisin synthetic machinery and leader sequence.

To test whether the nisin and mersacidin hybrid peptides were modified or not,

they were analyzed by MALDI-TOF mass spectrometry. Supernatants of induced

L. lactis NZ9000 (pIL3BTC) transformed with pNZE-nisleader-nis(1-22)-mrsA’(4-

20) or pNZE-nisleader-nis(1-22)-mrsA’(4-20)-gdmD were purified on a HiTrap SP

cation exchange column. The same procedure was applied for prenisin as positive

control. All prepeptides were produced, secreted and analyzed by MALDI-TOF

mass spectrometry. Table 2 presents a summary of the obtained masses. Nis(1-

22)Mrs(4-20) showed at most 7 dehydrations, most likely 5 of them in the nisin

part and 2 in the mersacidin part. There was no C-terminal decarboxylation by

GdmD observed in any of the constructs.

3.2. Class I and II hybrid lantibiotics are modified by nisin modification

enzymes and GdmD

The dehydration state and recognition by the decarboxylase play a significant role

on the C-terminal AviMeCys formation. To investigate this point, we designed

various hybrids and investigated their modification. Two designed hybrid peptides

with the gallidermin C-terminal tail (i.e. providing the natural recognition

sequence), replacing the intertwined terminal rings of mersacidin, were

constructed: Nis(1-22)Mrs(4-12)G1 and Nis(1-22)Mrs(4-12)G2. L. lactis NZ9000

harboring pIL3BTC and pNZE-nisleader-nis(1-22)-mrsA’(4-12)-ASFNSYCC-

gdmD yielded a class I and II hybrid peptide termed Nis(1-22)Mrs(4-12)G1 which

was 7-fold dehydrated and decarboxylated at the C-terminus. CDAP treatment of

the sample revealed that one of the cysteines had an available thiol group. The

control strain NZ9000 harboring pIL3BTC and pNZE-nisleader-nis(1-22)-

mrsA’(4-12)-ASFNSYCC, which does not contain a decarboxylase, only produced


155

the 7-fold dehydrated fusion peptide without the decarboxylated C-terminus (Table

2 and Fig. 4).

In addition, L. lactis NZ9000 harboring pIL3BTC and pNZE-nisleader-nis(1-22)-

mrsA’(4-12)-TLTSYCC-gdmD yielded another class I and II hybrid peptide

designated Nis(1-22)Mrs(4-12)G2 carrying up to 9 dehydrations and a

decarboxylation of the C-terminus. However, the yield of fully modified product

containing both dehydrations and decarboxylation was low. The strain NZ9000

harboring pIL3BTC and pNZE-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC, with

no decarboxylase co-expressed, only produced the dehydrated fusion peptide

(Table 2 and Fig. 4).

In order to assess which serine or threonine is dehydrated in the hybrids, we

constructed a pNZE-nisleader-nis(1-22)-mrsA’(4-12) and transformed it into L.

lactis NZ9000 containing pIL3BTC. Hybrid Nis(1-22)Mrs(4-12) with no C-

terminal AviCys tail was fully dehydrated (6-fold), and the CDAP test indicated

that there was no free cysteine in the peptides. Therefore, we concluded that the

large mersacidin methyl-lanthionine ring was correctly formed (Table 2). Looking

back at the hybrid Nis(1-22)Mrs(4-20), the mass results indicated that there were at

most 2 dehydrations in the mersacidin part. It is supposed that if only one

dehydration exists, it might be T4 (wild-type mersacidin amino acid order, number

marked in Fig. 1) to allow the formation of the large mersacidin ring. If there are

two dehydrations, T13 or S16 might be dehydrated. CDAP treated Nis(1-22)Mrs(4-

20) produced from the strain with GdmD showed a 50 Da shift compared to the

one without CDAP reaction, indicating that the two cysteines at the C-terminus are

free, because formation of one isothiocyanate part from free cysteine will result in

a mass increase of 25 Da. In the designed hybrid Nis(1-22)Mrs(4-12)G1, the two

dehydrations in the mersacidin part most likely come from T4 (as in the mutant

Nis(1-22)Mrs(4-12)) and S17 (resembling the wild-type configuration of the

Chapter 5

156

gallidermin decarboxylated C-terminus) (Fig. 4), and 1 free cysteine was detected.

Moreover, analysis of hybrid peptide Nis(1-22)Mrs(4-12)G2 indicated that T4,

T13, T15 and S16 could be dehydrated and form the intertwined rings with

cysteine downstream (Fig. 4). Further structural analyses of the hybrids are needed

to confirm the exact modification pattern. Therefore, the two designed class I and

II lantibiotic hybrids Nis(1-22)Mrs(4-12)G1 and Nis(1-22)Mrs(4-12)G2 (Table 2

and Fig. 4) were modified by the nisin modification enzymes NisBC and GdmD.

Nis(1-22)Mrs(4-12)G2 sometimes showed a non-decarboxylated mass weight

when co-expressed with GdmD, which can be due to a sequence different from the

typical gallidermin C-terminus that might be more poorly recognized by the

decarboxylase.

Fig. 3. Overview of all hybrid molecules with the expected (left in substrate)

and detected (right in result) modifications. Putative dehydratable amino acids

in the wild type sequence are in red. Putative (methyl-)lanthionine are in black, and

C-terminal AviCys/AviMeCys are in orange.


157

Table 2. NisBC-mediated dehydration and GdmD/MrsD-mediated

decarboxylation of prepeptides and CDAP alkylated prepeptides analyzed by

MALDI-TOF mass spectrometry

Peptide

(fragmen

t)

Amino acid

sequence

Modification

enzyme

No. of

observed

dehydratio

ns

No. of

observed

decarboxylat

ions

Mass (M+H+) without Met1

(Da)

Observed Calculat

ed

CDAP-

reacted

Nis(1-

22)Mrs(4

-20)

Nisleader

ITSISLCTPGCK

TGALMGCNMK

TLPGGGGVCTL

TSECIC

NisBC,

GdmD

7, 6 0 6030.83,

6048.63

6030.17,

6048.17

6080.7

4

(+50)

NisBC, MrsD 6 0 6047.69 6048.17

NisBC 6 0 6047.41 6048.17

Nis(1-

22)Mrs(4

-12)G1

Nisleader

ITSISLCTPGCK

TGALMGCNMK

TLPGGGGVCAS

FNSYCC

NisBC,

GdmD

7 1 6007.05 6009.14 6034.2

5

(+25)

NisBC, MrsD 7 0 6055.27 6055.15

NisB 7 0 6054.32 6055.14

Nis(1-

22)Mrs(4

-12)G2

Nisleader

ITSISLCTPGCK

TGALMGCNMK

TLPGGGGVCTL

TSYCC

NisBC,

GdmD

9, 8 1 5871.23,

5886.06,

5929.51

5869.07,

5887.07

5874.8

0,

5933.3

0

NisBC, MrsD 9, 8 0 5910.49,

5929.23

5915.07,

5933.07

NisBC 9, 8, 7 0 5916.06,

5951.52

5915.07,

5933.07,

5951.07

Nis(1-

22)Mrs(4

-12)

Nisleader

ITSISLCTPGCK

TGALMGCNMK

TLPGGGGVC

NisBC,

GdmD

6 0 5197.50 5197.17 5195.5

0

NisBC 6 0 5196.89 5197.17

Nisleader: mstkdfnldlvsvskkdsgaspr

Chapter 5

158


159

Fig. 4. Comparison of the mass spectra of class I and II hybrid prepeptides

with/without GdmD modification and CDAP reaction. A clear mass shift of

approximately 46 Da is visible indicating that GdmD has modified the substrates;

also a clear mass shift of approximately 25 Da is visible indicating that Nis(1-

22)Mrs(4-12)G1 has a free cysteine.

We tried the functional expression of MrsD to replace GdmD by co-expression of

pNZ-nisleader-nis(1-22)-mrsA’(4-20)-mrsD, pNZ-nisleader-nis(1-22)-mrsA’(4-

12)-ASFNSYCC-mrsD, pNZ-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC-mrsD,

respectively with pIL3EryBTC in L. lactis NZ9000. The constructs without mrsD

were also tested for production as control. All the expressed propeptides were

visible on Coomassie-blue stained Tricine SDS-PAGE (Fig. 5). The MS results

showed that there was no difference between constructs with MrsD and without

MrsD (data not shown), as well as those without GdmD (Table 2). MrsD did not

modify the C-terminal sequences (-SECIC/-SFNSYCC/-TLTSYCC) in the

conditions tested. Even fully dehydrated Nis(1-22)Mrs(4-12)G2 also showed no

decarboxylation at the C-terminus, which suggests that unlike GdmD, MrsD might

be a leader dependent enzyme [14].

Chapter 5

160

Fig. 5. Coomassie-blue stained Tricine SDS-PAGE. Each well contained TCA-

precipitated prepeptides from 600μL supernatant. M: protein marker; nisA: positive

control NisA as substrate; Mrs(4-20): Nisin leader-Nis(1-22)-Mrs(4-20); Mrs(4-

12): Nisin leader-Nis(1-22)-Mrs(4-12); G1: -ASFNSYCC; G2: -TLTSYCC; NC1:

negative control with no substrate on pNZE-empty; NC2: negative control with no

strain but nisin induced.

3.3. The modified hybrids have significant antimicrobial activity

To investigate the antimicrobial activity of the modified class I and II hybrids, the

prepeptides were incubated with trypsin to cleave the nisin leader peptide.

Leaderless peptides were released and tested for antimicrobial activity against M.

flavus. In the activity assay, we tested the peptides Nis(1-22)Mrs(4-12)G1, Nis(1-

22)Mrs(4-12)G2, Nis(1-22)Mrs(4-20) and Nis(1-22)Mrs(4-12) without the C-

terminal AviCys motive. Hybrid peptides are active with and without

GdmD/MrsD. However, samples containing the decarboxylated C-terminus

showed larger zones of inhibition of growth of indicators (see Fig. 6). The radius of

the growth inhibition zone suggests that the decarboxylated tail improves the

activity when compared to the non-decarboxylated tail, although the test is only

qualitative. The observed growth inhibition suggests that nisin synthetic machinery


161

with additional GdmD produced more active class I and II lantibiotic hybrids in L.

lactis.

Fig. 6. Antimicrobial activity of hybrids against M. flavus. 1:NisA; 2: Nis(1-

22)Mrs(4-12)G1(no LanD); 3: Nis(1-22)Mrs(4-12)G1 (GdmD);4: Nis(1-22)Mrs(4-

12)G1 (MrsD); 5: Nis(1-22)Mrs(4-12)G2(no LanD); 6: Nis(1-22)Mrs(4-12)G2

(GdmD); 7: Nis(1-22)Mrs(4-12)G2 (MrsD); 8: Nis(1-22)Mrs(4-20) (no LanD); 9:

Nis(1-22)Mrs(4-20) (GdmD); 10: Nis(1-22)Mrs(4-20) (MrsD); 11: Nis(1-

22)Mrs(4-12) (no LanD)

Chapter 5

162

4. Discussion

Due to the crisis of antibiotic-resistance, a larger collection of novel antimicrobials

is needed to be explored for possible application. The development of strategies to

engineer lantibiotics has provided researchers with the means to access powerful

antimicrobials with a widening array of structures and functions. By rational

designing of fusing different core peptides found in lantibiotics, with the help of

various lantibiotic modification enzymes, novel molecules with hybrid structures

can be obtained to potentially increase the antimicrobial activity of lantibiotics

[31]. Recently, van Heel et al. presented the successful additional modification

enzymes GdmD and LtnJ in combination with the nisin production machinery,

which could produce lantibiotics containing either AviCys or D-alanines,

respectively [20]. Zhou et al. improved the activity of lantibiotics against Gram-

negative bacteria by fusion of anti-Gram-negative peptides tails [32]. The major

advantages of bioengineering approaches include relatively high possible product

yields and easy downstream processing steps. Moreover, many lantibiotic gene

clusters, either silent or active, have been identified through the in silico inspection

of bacterial genomic DNA. Several of them were heterologously produced using

the nisin modification machinery [17]. In this study, we successfully used the nisin

modification system with the additional enzyme GdmD in vivo to modify and

produce active class I and II hybrid lantibiotics with the N-terminal structure of

nisin, the C-terminal structure of mersacidin and additional AviCys.

The class I lantibiotics (e.g. nisin and epidermin in Fig. 1) are screw-shaped,

positively charged, amphipathic molecules that exert their primary bactericidal

action by the formation of pores in the cytoplasmic membrane [4]. The class II

lantibiotics, as defined so far (e.g. mersacidin), usually possess a globular shape

and are described as inhibitors of peptidoglycan biosynthesis on the level of

transglycosylation by binding to lipid II [12]. In addition, the thickness of the cell


163

wall of treated cells is markedly reduced. Thus this makes mersacidin an

interesting tool for the investigation of peptidoglycan biosynthesis of Gram-

positive bacteria. The N-terminal segment of nisin is essential for binding, whereas

the C-terminal part translocates across the membrane, in accordance to pore

formation in the absence of lipid II. The molecular target site of mersacidin on lipid

II differs from that of nisin, which binds to lipid II pyrophosphate; in contrast,

mersacidin rather interacts with the disaccharide-pyrophosphate moiety of lipid II

and its C-terminal structure seems to be important for activity [2]. Previous studies

showed that designed peptides formed by the first three rings of nisin carrying the

gallidermin C-terminal decarboxylated tail (-SFNSYCC) show improved the

activity when compared to the non-decarboxylated tail [20]. This is also observed

in our class I and II lantibiotic hybrids, which might inhibit various processes of

cell wall biosynthesis by synergetic functions, such as inhibiting

transglycosylation. We suggest that when the nisin N-terminus and C-terminal

AviCys are combined, the overall activity is improved.

The so-called LanD enzyme is responsible for catalyzing the oxidative

decarboxylation of C-terminal cysteines in several lantibiotics (e.g. mersacidin,

epidermin, microbisporicin). MrsD shows 26% sequence identity to EpiD and 29%

identity to GdmD. Despite this low sequence identity, it was assumed that MrsD is

involved in the formation of the C-terminal S-[(Z)-2-aminovinyl]-3-methyl-D-

cysteine residue of mersacidin [14]. GdmD showed high similarity with EpiD.

MrsD differs significantly from the prototype EpiD/GdmD by its substrate

specificity and coenzyme requirement. Previous study on the substrate specificity

of EpiD indicated that the C-terminal consensus sequence of the EpiD substrates is

[V/I/L/(M)/F/Y/W]-[A/S/V/T/C/(I/L)]-C which is not present at the C-terminus of

MrsA (-TLTSECIC) and, therefore, it is not surprising that the C-terminal peptide -

TLTSECIC was not a substrate for GdmD [33]. Nothing is known about the

substrate specificity of MrsD untill now. But according to our study, MrsD is

Chapter 5

164

unable to oxidize and decarboxylate the precursor peptide with a C-terminal tail of

gallidermin/epidermin. We suggest there are two possible reasons explaining this:

MrsD only recognizes substrates with the MrsA leader sequence; or the lack of

dehydrations abolishes the decarboxylation.

NisB dehydrates specific serine and threonine residues in prenisin, whereas the

cyclase NisC catalyzes the (methyl-)lanthionine formation [8, 9]. LanM enzymes

show no similarity to LanB, but the C-terminal domain of LanM keeps the LanC-

like cyclase domain [34]. There are several functional differences between MrsM

and NisB and NisC found in this study. We demonstrate that NisB and NisC could

not recognize the precursor peptide with the position of cysteine before threonine,

and this even abolished the production. NisB was able to dehydrate the threonines

or serines in the C-terminal tail -SYCC/-TLTSYCC, but not in C-terminal part of

MrsA (-TLTSECIC), which can be caused by the presence of the negative residue,

which is detrimental for NisB modification. It has already been demonstrated that

EpiD does not react with a C-terminal meso-lanthionine structure [33]. Considering

that the C-terminal sequence of -TLTSYCC is dehydrated by NisB, it is still an

open question whether lanthionine or methyl-lanthionine might be formed prior to

AviCys or not.

In conclusion, our results show that it is possible to extend the in vivo nisin

production system consisting of NisBTC with the additional enzymes GdmD, for

production of class I nisin and class II mersacidin hybrid lantibiotics. These

molecules show it is possible to extend the diversity of lantibiotics, achieving

unique structures and constitute a potential starting point for engineering hybrid

lantibiotics with improved activity against important pathogens.


165

References

1. Willey JM, van der Donk WA. Lantibiotics: peptides of diverse structure and function. Ann. Rev

Microbiol. 2007,61(1):477-501.


Microbiol Rev. 2001,25(3):285-308.

3. Knerr PJ, van der Donk WA. Discovery, biosynthesis, and engineering of lantipeptides. Ann Rev

Microbiol. 2012,81(1):479-505.

4. Yu Y, Zhang Q, van der Donk WA. Insights into the evolution of lanthipeptide biosynthesis. Protein

science : a publication of the Protein Society. 2013,22(11):1478-1489.

5. Hurst A. Nisin and other inhibitory substances from lactic acid bacteria. In A. L. Branen and P. M.

Davidson (ed.), Antimicrobials in foods. Marcel Dekker, Inc., New York. 1983. p. 327-351.

6. Perin LM, Todorov SD, Nero LA. Investigation of genes involved in nisin production in Enterococcus

spp. strains isolated from raw goat milk. Antonie Van Leeuwenhoek. 2016. Doi:10.1007/s10482-016-

0721-6

7. Hirsch A. Growth and nisin production of a strain of Streptococcus lactis. J Gen Microbiol.

1951,5(1):208-21.

8. Kuipers OP, Beerthuyzen MM, Siezen RJ, De Vos WM. Characterization of the nisin gene cluster

nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and nisI genes for

development of immunity. Eur J Biochem. 1993,216(1):281-91.

9. Kluskens LD, Kuipers A, Rink R, de Boef E, Fekken S, Driessen AJ, Kuipers OP, Moll GN. Post-

translational modification of therapeutic peptides by NisB, the dehydratase of the lantibiotic nisin.

Biochem. 2005,44(38):12827-12834.

10. Lubelski J, Rink R, Khusainov R, Moll GN, Kuipers OP. Biosynthesis, immunity, regulation, mode of

action and engineering of the model lantibiotic nisin. Cell Mol Life Sci. 2008,65(3):455-476.

11. Kuipers A, de Boef E, Rink R, Fekken S, Kluskens LD, Driessen AJ, Leenhouts K, Kuipers OP, Moll

GN. NisT, the transporter of the lantibiotic nisin, can transport fully modified, dehydrated, and

unmodified prenisin and fusions of the leader peptide with non-lantibiotic peptides. J Biol Chem.

2004,279(21):22176-22182.

12. Chatterjee S, Lad S, Phansalkar M, Rupp R, Ganguli B, Fehlhaber H, Kogler H. Mersacidin, a new

antibiotic from Bacillus. Fermentation, isolation, purification and chemical characterization. J Antibiot.

(Tokyo) 1992,45(6):832-838.

13. Altena K, Guder A, Cramer C, Bierbaum G. Biosynthesis of the Lantibiotic Mersacidin: Organization

of a type B lantibiotic gene cluster. Appl Environ Microbiol. 2000,66(6):2565-2571.



J Bacteriol. 2002,184(5):1234-1243.


strain BH072, isolated from honey. Genome Announcements. 2015,3(2):e00098–00015.

Chapter 5

166

16. Majchrzykiewicz JA, Lubelski J, Moll GN, Kuipers A, Bijlsma JJ, Kuipers OP, Rink R. Production of

a class II two-component lantibiotic of Streptococcus pneumoniae using the class I nisin synthetic

machinery and leader sequence. Antimicrob Agents Chemother. 2010,54(4):1498-1505.

17. van Heel AJ, Kloosterman TG, Montalbán-López M, Deng J, Plat A, Baudu B, Hendriks D, Moll GN,

Kuipers OP. Discovery, production and modification of five novel lantibiotics using the promiscuous

nisin modification machinery. ACS Synth Biol. 2016. DOI: 10.1021/acssynbio.6b00033.

18. Kuipers A, Meijer-Wierenga J, Rink R, Kluskens LD, Moll GN. Mechanistic dissection of the enzyme

complexes involved in biosynthesis of lacticin 3147 and nisin. Appl Environ Microbiol.

2008,74(21):6591-6597.

19. Khusainov R, van Heel AJ, Lubelski J, Moll GN, Kuipers OP. Identification of essential amino acid


20. van Heel AJ, Mu D, Montalbán-López M, Hendriks D, Kuipers OP. Designing and producing


lantibiotic modification enzymes. Acs Synth Biol. 2013,2(7):397-404.

21. Rink R, Kuipers A, de Boef E, Leenhouts KJ, Driessen AJ, Moll GN, Kuipers OP. Lantibiotic

structures as guidelines for the design of peptides that can be modified by lantibiotic enzymes.

Biochem. 2005,44(24):8873-8882.

22. Kuipers OP, de Ruyter PG, Kleerebezem M, de Vos WM. Controlled overproduction of proteins by

lactic acid bacteria. Trends Biotechnol. 1997,15(4):135-140.

23. Sambrook J, Russell D. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor

Laboratory Press; 2001.

24. Holo H, Nes IF. Transformation of Lactococcus by Electroporation. Methods Mol Biol. 1995,47:195-

199.

25. De Ruyter P, Kuipers OP, De Vos W. Controlled gene expression systems for Lactococcus lactis with

the food-grade inducer nisin. Appl Environ Microbiol. 1996,62:3662−3667.

26. Schägger H. Tricine-SDS-PAGE. Nat Protoc. 2006,1(1):16-22.

27. Schägger H, von Jagow G. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the

separation of proteins in the range from 1 to 100 kDa. Anal Biochem. 1987,166(2):368-379.

28. Lubelski J, Khusainov R, Kuipers OP. Directionality and coordination of dehydration and ring

formation during biosynthesis of the lantibiotic nisin. J Biol Chem. 2009,284(38):25962-25972.

29. Pipes GD, Kosky AA, Abel J, Zhang Y, Treuheit MJ, Kleemann GR. Optimization and applications of

CDAP labeling for the assignment of cysteines. Pharm Res. 2005,22(7):1059-1068.

30. Slootweg JC, Peters N, Quarles van Ufford HL, Breukink E, Liskamp RM, Rijkers DT. Semi-synthesis

of biologically active nisin hybrids composed of the native lanthionine ABC-fragment and a cross-

stapled synthetic DE-fragment. Bioorg Med Chem. 2014,22(19):5345-53.

31. Kuipers OP, Rollema HS, Bongers R, van den Bogaard P, Kosters H, de Vos WM, Siezen RJ. Structure-

function relationships of nisin studied by protein engineering. In: 2 nd Int. Workshop Lantibiotics.

Arnhem, the Netherlands; 1994.

32. Zhou L, van Heel AJ, Montalbán-López M, Kuipers OP. Potentiating the Activity of Nisin against

Escherichia coli. Front Cell Dev Biol. 2016,4:7.


167



J Biol Chem. 1995,270(19):111282-111289.

34. Zhang Q, Yu Y, Velasquez JE, van der Donk WA. Evolution of lanthipeptide synthetases. Proc Natl

Acad Sci USA. 2012,109(45):18361-18366.

Chapter 5

168

Table S1. Primers and templates used in this work

No. Product Template Primer (forward) Primer (reverse)

Name Sequence Name Sequence

1 PnisA+nislead

er

plasmid

pNZnisA

E3 [11]

P-nisl-for (5’BglII) GCGCAGATCTAGTCTTATAACTATAC

TG

P-nisl-

rev

series

P-nisl-

rev

CCAGGCAATGTAAAAGTACAGCGTGGT

GATGCACCTGAATC

2 PnisA+nislead

er+nis(1-7)

P-

nis1rin

g-rev

CCGCCGCCACCAGGCAATGTACATAGC

GAAATACTTGTAATG

3 PnisA+nislead

er+nis(1-22)

P-

nis3rin

g-rev

CCGCCGCCACCAGGCAATGTTTTCATGT

TACAACCCATCAG

4 PnisA+nislead

er+nis(1-28)

P-

nis5rin

g-rev

CCGCCGCCACCAGGCAATGTACAATGA

CAAGTTGCTGTTTTC

5 PnisA+nislead

er+nis(1-

22)+CTF

P-

nis3rin

gctf-

rev

CCAGGCAATGTAAAAGTACATTTCATGT

TACAACCCATCAGAG


169

6 PnisA+nislead

er+nis(1-

22)+F

P-

nis3rin

gf-rev

CCGCCACCAGGCAATGTAAATTTCATGT

TACAACCCATCAGAG

7 mrsA’(core

peptide)

genomic

DNA of

strain

BH072

[15]

P-mrsa-

for

series

P-mrsa-

for

ATTCAGGTGCATCACCACGCTGTACT

TTTACATTGCCTGGTGGCGGCGGTG

P-mrsa-rev

(5’PstI)

ATCCTTTGATTTGGCTGCAGTTAACAAA

TACATTCAGAAGTTAG

8 mrsA’(4-20) P-

mrsa(nis

1ring)-

for

TTACAAGTATTTCGCTATGTACATTG

CCTGGTGGCGGCGGTG

9 mrsA’(4-20) P-

mrsa(nis

3ring)-

for

TGATGGGTTGTAACATGAAAACATT

GCCTGGTGGCGGCGGTG

10 mrsA’(4-20) P-

mrsa(nis

5ring)-

for

AAACAGCAACTTGTCATTGTACATTG

CCTGGTGGCGGCGGTG

11 mrsA’ P-

mrsactf(

nis3ring)

-for

GTAACATGAAATGTACTTTTACATTG

CCTGGTGGCGGCGGTG

Chapter 5

170

12 mrsA’(3-20) P-

mrsaf(nis

3ring)-

for

TGGGTTGTAACATGAAATTTACATTG

CCTGGTGGCGGCGGTG

13 attenuator plasmid

pNZnisA-

ltnJ [20]

P-att-for (5’PstI) AATGTATTTGTTAACTGCAGCCAAAT

CAAAGGATAGTATTTTGTTAG

P-att-rev

(5’HindIII)

GCGCAAGCTTCTCTTTATTTTTATAAGC

14 PnisA+nislead

er+mrsA’+att

enuator

product

1+7+13

P-nisl-for (5’BglII) GCGCAGATCTAGTCTTATAACTATAC

TG

P-att-rev

(5’HindIII) or P-

att-rev (5’KpnI)

GCGCAAGCTTCTCTTTATTTTTATAAGC

or

ATATGGTACCAAGCTTCTCTTTATTTTTA

TAAGC

15 PnisA+nislead

er+nis(1-

7)+mrsA’(4-

20)+attenuato

r

product

2+8+13

16 PnisA+nislead

er+nis(1-

22)+mrsA’(4-

20)+attenuato

r

product

3+9+13

17 PnisA+nislead

er+nis(1-

product

4+10+13


171

28)+mrsA’(4-

20)+attenuato

r

18 PnisA+nislead

er+nis(1-

22)+mrsA’+at

tenuator

product

5+11+13

19 PnisA+nislead

er+nis(1-

22)+mrsA’(3-

20)+attenuato

r

product

6+12+13

20 PnisA+nislead

er+nis(1-

22)+mrsA’(4-

12)+ASFNSY

CC

product

16

P-gtail1-rev

(5’PstI)

GCGCCTGCAGTTAACAACAATATGAATT

AAATGAAGCACAAACACCGCCGCCACC

21 PnisA+nislead

er+nis(1-

22)+mrsA’(4-

12)+TLTSYC

C

product

16

P-gtail2-rev

(5’PstI)

GCGCCTGCAGTTAACAACAATAAGAAG

TTAGAGTACAAACACCGCCGCCAC

Chapter 5

172

22 PnisA+nislead

er+nis(1-

22)+mrsA’(4-

12)

product

16

P-deltail-

rev(5’PstI)

GCGCCTGCAGTTAACAAACACCGCCGC

CACCAGGCAATG

23 mrsD genomic

DNA of

strain

BH072

[15]

P-mrsD-for (5’KpnI) ATATGGTACCAGGAGGCGGAGGATG

AGTATTTCAATATTAAAAG

P-mrsD-rev

(5’XhoI)

GCGCCTCGAGTTATGTTAGTGAGGGGTG

TTTTG

173

Chapter 6

Summary and discussion

Chapter 6

174

The ongoing increase of antibiotic-resistance among pathogenic bacteria reduces

the efficacy of most conventional antimicrobial drugs and threatens global health

care [1, 2]. The development of novel antimicrobial alternatives is one of the needs

to combat this problem. Among these diverse compounds, those produced by

bacteria have been most successfully applied as agents in the fields of food,

medicine and agriculture [3]. Antimicrobials produced by members of the genus

Bacillus have been shown to have a broad spectrum of antimicrobial activity

against pathogenic microbes [4, 5]. This thesis addresses different strategies

employed to discover new antimicrobials of Bacillus strains (Fig. 1), including

genome mining and bioinformatics analysis of reported Bacillus species for

antimicrobials, screening and isolating microbes able to produce antimicrobial

compounds from natural sources, and genetic engineering to obtain novel

antimicrobial compounds.

Fig. 1. Scheme of different strategies for discovery of new antimicrobials from

Summary and Discussion

175

Bacillus. Genome mining represents a core activity for discovery of new

antimicrobials: 1. giving a guideline for isolation of antimicrobials from potential

microbes; 2. providing a reference for future Bacilli to be sequenced; 3. offering

valuable sequencing information for genetic engineering.

By genome-based mining, a large number of putative antimicrobial gene clusters

are predicted and identified, which has made it possible to isolate new

antimicrobial compounds [6-9]. The central part of this approach is not only to

identify the product but also to predict the gene clusters for biosynthesis. One of

the advantages of such in silico approaches is that a large variety of gene clusters,

either known or novel, active or cryptic, encoding putative antimicrobial

compounds can be uncovered. We point out another advantage of this strategy,

which is that the post-genome mining analysis includes a number of potential

species never considered to be antimicrobial producers before and which provides

hints for future Bacilli to be sequenced. The challenge that this strategy poses, is

that several uncharacterized gene clusters, predicted to encode putative

antimicrobials, need to be further experimentally confirmed and characterized.

A combined application of BAGEL3 and antiSMASH as shown in chapter 2,

successfully enabled the discovery of novel antimicrobial gene clusters and

allowed for a new classification of putative and known antimicrobial compounds of

a wide variety of Bacillus species. This study highlights the specific ability of

Bacillus sp. to produce a wider variety of putative antimicrobial compounds,

relative to other bacterial genera. Novel information found by this genome mining

study includes 3 types of novel class I bacteriocins: 1. with either a new leader

sequence or new core sequence; 2. known antimicrobial compounds previously

identified in other microorganisms; and 3. completely novel gene clusters

(uncharacterized) encoding potential antimicrobials that need experimental

confirmation. Mining for bacteriocin clusters in genomic DNA sequences mainly

Chapter 6

176

considers the properties of the putative structural gene and the surrounding ORFs

and their homology to modification enzymes, such as lanthionine synthetases

(LanBC, LanM, LanKC or LanL) [10]. We reported several novel class I

bacteriocins by genome mining and further analysis. Two subtilin-like lantibiotics

and a gallidermin/nisin-like lantibiotic were discovered, all sharing the conserved

F(N/D)LD motif in the leader sequence [11], as well as available serine and

cysteine residues for (methyl-)lanthionine formation, and the presence of lanBC

genes in their gene clusters involved in their production [12]. Due to the existence

of a lanM gene, a novel gene cluster of a two-component peptide was found in the

genome of Bacillus cereus Q1 and it was predicted to be a type II lanthipeptide.

Moreover, an amylocyclicin-like circular bacteriocin gene cluster was found in the

genomes of several Bacillus coagulans strains. The core peptide sequence is totally

identical to that of amylocyclicin of Bacillus amyloliquefaciens FZB42, but the

leader peptide sequence is quite different. There are also gene clusters of

antimicrobial peptides not previously reported to be produced by Bacillus, but by

other classes of bacteria. For instance, a gene cluster of an uberolysin-like peptide

was detected in the genome of Bacillus sp. 1NAL3E and gene clusters of circularin

A/bacteriocin AS-48 like peptides were detected in several Geobacillus sp., while

uberolysin was known to be produced by Streptococcus uberis, circularin A is

produced by Clostridium beijerinckii and bacteriocin AS-48 is produced by

Enterococcus faecalis [13-16]. Several new members of Bacillus class II and III

bacteriocins were detected by BAGEL3, in particular holins and holin-like peptide

BhlA, antimicrobial peptide LCI, and leaderless bacteriocin aureocin A53; and

some class III bacteriocins, respresented by colicin, M23 peptidase and pyocin

AP41[17-24]. We also found a lactobin A family protein and a lactococcin A1

family protein known to be produced by lactic acid bacteria belonging to class II

bacteriocins, now detected in Anoxybacillus flavithermus WK1 [25, 26]. These

results indicate a relatively high occurrence of horizontal gene transfer between

these rather unrelated species. These efforts for identification of novel


177

antimicrobial peptides also helps to improve annotation of novel genomes, because

small ORFs are easily overlooked using existing automated genome annotation

tools.

Genome mining results of biosynthetic gene clusters of NRPs and PKs in various

Bacilli indicated that they have a high potential to produce these antimicrobial

compounds and that more attentions should be paid to these newly sequenced

genomes to discover novel antimicrobials. Whether these will provide real potent

antimicrobials or not, needs to be further investigated experimentally.

Most of the known antimicrobial compounds have been discovered using

traditional microbiology isolation and screening techniques [27, 28]. The first step

in that process is to screen for potential producer-bacteria showing antimicrobial

activity. Antimicrobial activity might be associated with the co-production of more

than one type of antimicrobial compound, thus, further in-depth purification and

characterization are necessary to identify the specific nature of the compound(s)

and to ascertain their novelty. By application of mass spectrometry, particularly

MALDI-TOF, the mass of peptides produced can be easily assessed. The

advantage of using compounds that are identified in this way is that they are wild-

type and have already been selected for appropriate expression and activity levels

under standard laboratory conditions, unlike ‘sleeping’ compounds that need

specific inducers or elicitors to be expressed [29]. The main disadvantage of this

strategy is that a wide screening spectrum has to be covered, and that it is only

suitable to isolate compounds that are expressed under laboratory conditions.

Moreover, the success of this strategy is limited by the nature of the antimicrobial

activity test during the screening, since many compounds might have a relatively

narrow target specificity.

In chapter 3, we isolated and identified a B. amyloliquefaciens strain BH072 from a

honey sample, which showed significant antifungal activity. The co-production of

Chapter 6

178

antifungal substances by the same strain involving the macromolecular proteins

flagellin, TasA and the lipopeptide iturin A had never been reported before. Co-

production of three or more antibiotics is not common, but it has been described

that two or three lipopeptides can be simultaneously produced by the same strain

[30-32]. According to the genome mining study of Bacillus species, it was found

that most of the B. amyloliquefaciens strains contain 7 or more gene clusters for

either ribosomally encoded bacteriocins or non-ribosomal antimicrobial

polyketides or lipopeptides [33, 34]. In chapter 4 we showed that the genome

sequence of the B. amyloliquefaciens strain BH072 also contains gene clusters

similar to those of the reported strains, but in a different combination. Further

analysis of the BH072 genome demonstrates that 3 gene clusters of bacteriocins, 5

gene clusters of NRPs and 3 gene clusters of PKs are present. According to the

literature, the presence of unique gene clusters responsible for the synthesis of the

antibacterial polyketides difficidin and macrolactin is a typical feature of most

representatives of the subspecies “plantarum” investigated sofar. In addition, the

presence of enzymes (encoded by the kdg operon) catalyzing formation of triose

from 2-keto-3-deoxygluconate by a pathway different from the Entner-Doudoroff

pathway, were also detected in the genome of BH072, which was a special feature

of the subspecies “plantarum”, distinguishing their representatives from the closely

related subspecies “amyloliquefaciens” and other representatives of the Bacillus

subtilis species group [34]. In conclusion, B. amyloliquefaciens BH072 might

belong to the B. amyloliquefaciens subsp. plantarum and is likely of plant-

associated biocontrol value.

The entire type II lantibiotic mersacidin operon is perfectly conserved in the

genome of BH072. Unfortunately, the mersacidin product could not be detected

directly from the culture of BH072, so the mersacidin encoding gene cluster might

be cryptic or need specific elicitors.


179

Because bacteriocins are directly encoded by genes (often more amenable to

engineering than classical antibiotics), the development of strategies to engineer

bacteriocins has also provided researchers with the means to access the many

apparently silent bacteriocin gene clusters that have been identified through the in

silico inspection of bacterial genomic DNA. The major advantages of the

bioengineering approach include relatively high product yields and easy

downstream processing steps. Rational exploiting the structure-function

relationship contributes to the possibility of artificial production of novel

antimicrobials. Structural characterization of these compounds including net

charge, molecular size and structure determinations, which are known to affect

antimicrobial activity, may enable the design of novel peptides with an improved

therapeutic index. In addition, to address the crisis of antibiotic resistance,

scientists should pay keen attention to the construction of new antimicrobials by

bioengineering, with the goal of obtaining molecules with unique antimicrobial

modes of action [29, 35, 36].

Various approaches have been employed to optimize the original sequence of

lantibiotics, such as site-directed mutagenesis, random mutagenesis and ring

shuffling [37, 38, Montalbán-López, Kuipers et al., manuscript in preparation]. The

possibility of fusing different modifications found in lantibiotics to form novel

modified molecules with rational designed structures opens up new avenues for

obtaining powerful antimicrobials [39]. It is noteworthy that co-expression of

lantibiotic modification enzymes functioning on various lantibiotic substrates can

increase the potency of lantibiotics by making hybrid structures. In chapter 5, We

designed novel hybrid class I and II hybrid lantibiotics with the goal of increasing

the antimicrobial activity, by combining the activities of individual

transglycosylation inhibitor domains and lipid II binding, by using hybrids

consisting of the N-terminal region of nisin and the C-terminal region of

mersacidin [40]. It has been possible to heterologously express the silent lantibiotic

Chapter 6

180

genes of Bacillus in Lactococcus lactis which leads to the improvement of the

production yield. These hybrid compounds might inhibit various processes of cell

wall biosynthesis, generated by lipid II-targeting moieties and synergetic functions,

such as inhibiting transglycoylation. Antimicrobial activity tests suggest that when

the nisin N-terminus and the C-terminal AviCys are combined, the activity of the

hybrid is improved relative to the wildtype molecules. With the first trials of hybrid

biosynthetic lipid II-targeting moieties in hand, a variety of compounds known to

inhibit different aspects of cell wall biosynthesis will be designed, such as

transglycosylase inhibitors, transpeptidase inhibitors, and synthetic pore forming

peptides [41]. In addition to cell envelope inhibitors, there are other mechanisms of

action that are affecting gene expression and protein production within the cell

[42]. Furthermore, the structure-activity relationship of each hybrid, especially the

lipid II binding properties, will in the future be investigated by a number of

structural and functional analyses. Antimicrobial peptides have attracted

considerable attention because of their broad-spectrum antimicrobial activity which

can be either antibacterial, antifungal or even antiviral. The method to design

hybrid peptide integrating different functional domains of peptides together with

antibacterial and antifungal regions will greatly extend the engineering

possibilities.

Type II lantibiotic LanM enzymes are bifunctional proteins that catalyze both the

dehydration and cyclization of LanA substrates. The N-terminal domain of LanM

is responsible for dehydration of Ser and Thr residues and the C-terminal domain

for cyclization, while showing low sequence homology with the type I lantibiotic

cyclase LanC [43]. Since LanM enzymes show no similarity to LanB dehydratases,

this suggests that LanM might have another mode of action for the dehydratase

reaction, independent of glutamylation [44]. There are several functional

differences discovered in this study (chapter 5) between MrsM and NisB and NisC.

We demonstrate that NisB and NisC cannot recognize and modify the precursor


181

peptide when the position of cysteine is upstream of threonine, which even

abolishes the production. However, NisB was able to dehydrate the threonines or

serines at the C-terminus (-SYCC/-TLTSYCC), but not in the C-terminal part of

MrsA (-TLTSECIC). It has already been demonstrated that EpiD does not react

with a C-terminal meso-lanthionine structure [45]. Considering that the C-terminal

sequence of -TLTSYCC is dehydrated by NisB, it is still an open question whether

lanthionine or methyl-lanthionine might be formed prior to AviCys or not. LanD

catalyzes the oxidative decarboxylation of a C-terminal cysteine residue to a

reactive thio-enol intermediate, which then cyclises with a Dha or Dhb residue,

respectively, yielding AviCys or AviMeCys [45]. The decarboxylase MrsD differs

significantly from the prototype EpiD/GdmD by its substrate specificity and

coenzyme requirement [46]. Previous studies on the substrate specificity of EpiD

[45] indicated that the C-terminal consensus sequence of the EpiD substrates is

[V/I/L/(M)/F/Y/W]-[A/S/V/T/C/(I/L)]-C which is not present at the C-terminus of

MrsA (-TLTSECIC) and, therefore, it is not surprising that the C-terminal peptide -

TLTSECIC is not a substrate of GdmD. According to our study, MrsD is unable to

oxidize and decarboxylate the precursor peptide with a dehydrated C-terminal tail

of gallidermin/epidermin. The substrate specificity of MrsD needs to be further

experimentally investigated.

In summary, a combination of screening and isolation of bacteria from natural

sources to obtain potential antimicrobial producers has great strength. Genome

mining procedures to detect novel antimicrobial gene clusters, followed by genetic

engineering and heterologous production of novel antimicrobial compounds, offers

a promising strategy (Fig 1). The extended classification of antimicrobial

compounds suggests that the genus Bacillus provides a rich source of novel

antimicrobials that can now be readily tapped experimentally, since many new

gene clusters will be identified. Other applications of in silico analysis, more

oriented into microbial ecology, can give valuable information about which

Chapter 6

182

environments to screen for novel antimicrobials producers and elicitors

Considering the current prevalence of antibiotic-resistant pathogens, there is

obviously an immediate need to discover and develop novel classes of potent

antibiotics with new inhibitory mechanisms.

References

1. Spellberg B, Guidos R, Gilbert D, Bradley J, Boucher HW, Scheld WM, Bartlett JG, Edwards J, Jr,

Infectious Diseases Society of America. The epidemic of antibiotic-resistant infections: a call to action

for the medical community from the infectious diseases society of America. Clin Infect Dis.

2008,46(2):155-164.

2. Ventola CL. The Antibiotic Resistance Crisis: Part 1: Causes and Threats. J Clin Pharm Ther.

2015,40(4):277-283.

3. Demain AL, Sanchez S. Microbial drug discovery: 80 years of progress. J Antibiot (Tokyo).

2009,62(1):5-16.



5. Sumi CD, Yang BW, Yeo IC, Hahm YT. Antimicrobial peptides of the genus Bacillus: a new era for

antibiotics. Can J Microbiol. 2015,61(2):93-103.

6. Krzyżanowska DM, Ossowicki A, Rajewska M, Maciąg T, Jabłońska M, Obuchowski M, Heeb S, Jafra

S. When genome-based approach meets the “Old but Good”: revealing genes involved in the

antibacterial activity of Pseudomonas sp. P482 against soft rot pathogens. Front Microbiol.

2016,7:782.

7. Weber T, Kim HU. The secondary metabolite bioinformatics portal: Computational tools to facilitate

synthetic biology of secondary metabolite production. Synth Sys Biotechnol. 2016,1(2):69-79.

8. Huang C, Leung RK, Guo M, Tuo L, Guo L, Yew WW, Lou I, Lee SM, Sun C. Genome-guided

investigation of antibiotic substances produced by Allosalinactinospora lopnorensis CA15-2(T) from

lop nor region, China. Sci Rep. 2016,6:20667.

9. Bonacina J SN, Saavedra L HEM. Genome mining and transcriptional analysis of bacteriocin genes in

Enterococcus faecium CRL1879. J Data Mining in Genomics Proteomics. 2015,06(03).

10. Goto Y, Okesli A, van der Donk WA. Mechanistic studies of Ser/Thr dehydration catalyzed by a

member of the LanL lanthionine synthetase family. Biochemistry. 2011,50(5):891-898.

11. Plat A, Kluskens LD, Kuipers A, Rink R, Moll GN. Requirements of the engineered leader peptide of

nisin for inducing modification, export, and cleavage. Appl Environ Microbiol. 2011,77(2):604-611.


Biochem. 2012,81(1):479-505.

13. Montalbán-López M, Sánchez-Hidalgo M, Cebrián R, Maqueda M. Discovering the bacterial circular


183

proteins: bacteriocins, cyanobactins, and pilins. J Biol Chem. 2012,287(32):27007-27013.

14. Wirawan RE, Swanson KM, Kleffmann T, Jack RW, Tagg JR. Uberolysin: a novel cyclic bacteriocin

produced by Streptococcus uberis. Microbiol. 2007,153(5):1619-1630.

15. Grande Burgos MJ, Pulido RP, Del Carmen Lopez Aguayo M, Galvez A, Lucas R. The cyclic

antibacterial peptide enterocin AS-48: isolation, mode of Action, and possible food applications. Int J

Mol Sci. 2014,15(12):22706-22727.

16. Kawai Y, Kemperman R, Kok J, Saito T. The circular bacteriocins gassericin A and circularin A. Curr

Protein Pept Sci. 2004,5(5):393-398.

17. Young RB, Bläsi U. Holins: form and function in bacteriophage lysis. FEMS Microbiol Rev.1995,17(1-

2):191-205.

18. Anthony T, Chellappa GS, Rajesh T, Gunasekaran P. Functional analysis of a putative holin-like

peptide-coding gene in the genome of Bacillus licheniformis AnBa9. Arch Microbiol. 2010,192(1):51-

56.

19. Aunpad R, Panbangred W. Evidence for two putative holin-like peptides encoding genes of Bacillus

pumilus strain WAPB4. Curr Microbiol. 2012,64(4):343-348.

20. Liu J, Pan N, Chen Z. Characterization of an anti-rice bacterial blight polypeptide LCI. Rice Genet

Newsl.1990,7:151-154.

21. Netz DJA, Pohl R, Beck-Sickinger AG, Selmer T, Pierik AJ, Bastos MdCdF, Sahl HG. Biochemical

characterisation and genetic analysis of aureocin A53, a new, atypical bacteriocin from Staphylococcus

aureus. J Mol Biol. 2002,319(3):745-756.

22. Zakharov SD, Cramer WA. Colicin crystal structures: pathways and mechanisms for colicin insertion

into membranes. Biochim Biophys Acta. 2002,1565(2):333-346.

23. Bamford CV, Francescutti T, Cameron CE, Jenkinson HF, Dymock D. Characterization of a novel

family of fibronectin-binding proteins with M23 peptidase domains from Treponema denticola. Mol

Oral Microbiol. 2010,25(6):369-383.

24. Sano Y, Kageyama M. Purification and properties of an S-type pyocin, pyocin AP41. J

Bacteriol.1981,146(2):733-739.

25. Contreras BG, De Vuyst L, Devreese B, Busanyova K, Raymaeckers J, Bosman F, Vandamme

EJ.Isolation, purification, and amino acid sequence of lactobin A, one of the two bacteriocins produced

by Lactobacillus amylovorus LMG P-13139. Appl Environ Microbiol.1997,63(1):13-20.

26. Requena T, Yu W, Stoddard GW, McKay LL. Lactococcin A overexpression in a Lactococcus lactis

subsp. lactis transformant containing a Tn5 insertion in the lcnD gene. Appl Microbiol

Biotechnol.1995,44(3-4):413-418.

27. Ananthanarayanan L, Dubhashi A. Characterization of Bacillus species isolated from natural sources

for probiotic properties. Int J Curr Biotechnol. 2015,3(8):22-27.

28. Amin M, Rakhisi Z, Zarei Ahmady A. Isolation and identification of Bacillus Species from soil and

evaluation of their antibacterial properties. Avicenna J Clin Microb Infec. 2015,2(1).

29. Montalbán-López M, Zhou L, Buivydas A, van Heel AJ, Kuipers OP.Increasing the success rate of

lantibiotic drug discovery by synthetic biology. Expert Opin Drugs Dis. 2012,7(8):695-709.

30. Jeukens J, Kukavica-Ibrulj I, Freschi L, Jabaji S, Levesque R. Draft Genome Sequences of Two

Chapter 6

184

Lipopeptide-Producing Strains of Bacillus methylotrophicus. Genome Announcements.

2015,3(5):e01176-01115.

31. Roongsawang N, Thaniyavarn J, Thaniyavarn S, Kameyama T, Haruki M, Imanaka T, Morikawa M,

Kanaya S. Isolation and characterization of a halotolerant Bacillus subtilis BBK-1 which produces

three kinds of lipopeptides: bacillomycin L, plipastatin, and surfactin. Extremophiles. 2002,6(6):499-

506.

32. Koumoutsi A, Chen XH, Henne A, Liesegang H, Hitzeroth G, Franke P, Vater J, Borriss R. Structural

and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic

lipopeptides in Bacillus amyloliquefaciensstrain FZB42. J Bacteriol. 2004,186(4):1084-1096.

33. Hao K, He P, Blom J, Rueckert C, Mao Z, Wu Y, He Y, Borriss R. The genome of plant growth-

promoting Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601-Y2 contains a gene cluster


34. He P, Hao K, Blom J, Ruckert C, Vater J, Mao Z, Wu Y, Hou M, He P, He Y. et al. Genome sequence

of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and

expression of mersacidin and other secondary metabolites. J Biotechnol. 2012,164(2):281-291.

35. Field D, Cotter PD, Hill C, Ross RP. Bioengineering lantibiotics for therapeutic success. Front

Microbiol. 2015,6:1578-1592.

36. Nagao J, Asaduzzaman SM, Aso Y, Okuda K, Nakayama J, Sonomoto K: Lantibiotics. insight and

foresight for new paradigm. J Biosci Bioeng. 2006,102(3):139-149.

37. Khusainov R, van Heel AJ, Lubelski J, Moll GN, Kuipers OP.Identification of essential amino acid


38. Yuan J, Zhang ZZ, Chen XZ, Yang W, Huan LD. Site-directed mutagenesis of the hinge region of

nisinZ and properties of nisinZ mutants. Appl Microbiol Biotechnol. 2004,64(6):806-815.

39. van Heel AJ, Mu D, Montalbán-López M, Hendriks D, Kuipers OP.Designing and producing


lantibiotic modification enzymes. ACS Synth. Biol. 2013,2(7):397-404.

40. Hoffmann A, Pag U, Wiedemann I, Sahl H. Combination of antibiotic mechanisms in lantibiotics.

Farmaco. 2002,57(8):685-691.

41. Bauer R, Dicks LM. Mode of action of lipid II-targeting lantibiotics. Int J Food Microbiol.

2005,101(2):201-216.

42. Cotter PD, Ross RP, Hill C. Bacteriocins - a viable alternative to antibiotics? Nat Rev Microbiol.

2013,11(2):95-105.

43. Siezen RJ, Kuipers OP, de Vos WM.Comparison of lantibiotic gene clusters and encoded proteins.

Antonie Van Leeuwenhoek. 1996,69(2):171-184.

44. Ortega MA, Hao Y, Zhang Q, Walker MC, van der Donk WA, Nair SK. Structure and Mechanism of

the tRNA-Dependent Lantibiotic Dehydratase NisB. Nature. 2015,517(7535):509-512.



J Biol Chem.1995,270(19):111282-111289.



185


J Bacteriol. 2002,184(5):1234-43.

Abbreviations

186

Abbreviations

LAB- lactic acid bacteria

LAP(s)- linear azole-containing peptide(s)

LPs- lipopeptides

MRSA- methicillin-resistant Staphylococcus aureus

NRPs -non-ribosomally synthesized peptides

NRPS- non-ribosomal peptide synthetases

PKs- polyketides

PKS- polyketide synthetases

PTM(s)- posttranslational modification(s)

RiPPs- ribosomally produced and posttranslationally modified peptides

SAM- S-adenosylmethionine

SKF- sporulation killing factor

Nederlandse Samenvatting

187


De voortdurende toename van resistentie bij pathogene bacteriën vermindert de

effectiviteit van de meeste conventionele antibiotica en bedreigt een goed

functionerende wereldwijde gezondheidszorg. De ontwikkeling van nieuwe

antimicrobiële alternatieven is een van de manieren om dit probleem te bestrijden.

Van deze groep verschillende verbindingen zijn de stoffen die geproduceerd zijn

door bacteriën het meest succesvol toegepast als antimicrobiële middelen op het

gebied van voeding, medicijnen en landbouw. Antimicrobiële stoffen die door vele

soorten van het genus Bacillus worden geproduceerd, laten een breed spectrum van

antimicrobiële activiteit tegen pathogene microben zien. Dit proefschrift beproeft

verschillende strategieën om nieuwe antimicrobiële stoffen uit Bacillus stammen te

verkrijgen. Hierbij zijn genoomdata onderzocht, zijn bio-informatica analyses

uitgevoerd aan genomen van van Bacillus soorten die antimicrobiële stoffen

produceren, zijn micro-organismen gescreend en geïsoleerd die in staat zijn om

antimicrobiële stoffen te produceren uit natuurlijke bronnen en is genetische

modificatie toegepast om nieuwe antimicrobiële verbindingen te verkrijgen.

Een gecombineerde toepassing van BAGEL3 en antiSMASH zoals beschreven in

hoofdstuk 2, heeft geleid tot de succesvolle ontdekking van nieuwe antimicrobiële

genclusters en maakt een aangepaste classificatie mogelijk van voorspelde en

bekende antimicrobiële verbindingen in een groot aantal Bacillus soorten. Deze

studie wijst op het specifieke vermogen van Bacillus sp. om een grotere

verscheidenheid aan potentiële antimicrobiële verbindingen te produceren, in

vergelijking met andere bacteriële genera. Nieuwe informatie gevonden door dit

genoomonderzoek omvat 3 typen van klasse I bacteriocins: 1. met ofwel een

nieuwe leadersequentie of een nieuwe mature sequentie; 2. bekende antimicrobiële

verbindingen eerder geïdentificeerd in andere micro-organismen; en 3. volledig

nieuwe genclusters (nog niet gekarakteriseerd) die mogelijk voor antimicrobiële


188

stoffen coderen en die experimenteel bevestigd dienen te worden.

Genoomonderzoeksresultaten van biosynthetische genclusters van NHP's en PK's

in diverse Bacilli geven aan dat zij een groot potentieel hebben om deze

antimicrobiële stoffen te produceren. Om deze reden zou meer aandacht besteed

moeten worden aan deze genomen die recent zijn gesequenced om nieuwe

antibiotica te ontdekken. Of deze zoektocht werkelijk krachtige nieuwe

antimicrobiële middelen zal opleveren of niet, zal verder experimenteel moeten

worden onderzocht.

In hoofdstuk 3 is uit honing de B. amyloliquefaciens stam BH072 geïsoleerd en

geïdentificeerd, die een aanzienlijke antischimmel activiteit laat zien. De

coproductie van antischimmel stoffen door dezelfde stam met betrekking tot de

macromoleculaire eiwitten flagellin, TasA en het lipopeptide iturin A was nog

nooit eerder gerapporteerd. Coproductie van drie of meer antibiotica is niet

gebruikelijk, maar het is wel beschreven dat twee of drie lipopeptiden gelijktijdig

geproduceerd kunnen worden door dezelfde stam. Met behulp van het

genoomonderzoek aan diverse Bacillus soorten werd vastgesteld dat de meeste van

de B. amyloliquefaciens stammen 7 of meer genclusters bevatten, voor zowel

ribosomaal gecodeerde bacteriocines als niet-ribosomale antimicrobiële

polyketiden of lipopeptiden. In hoofdstuk 4 wordt aangetoond dat de

genoomsequentie van B. amyloliquefaciens stam BH072 genclusters bevat die

vergelijkbaar zijn met die van de vermelde stammen, maar in een andere

combinatie. Nader onderzoek van het genoom BH072 toont aan dat er 3

genclusters van bacteriocines, 5 genclusters van NRP’s en 3 genclusters van PK's

aanwezig zijn. Het volledige operon van het type II lantibioticum mersacidine is

volledig geconserveerd in het genoom van BH072. Helaas is het product

mersacidine niet rechtstreeks gedetecteerd in het cultuur supernatant van BH072.

Mogelijk is het mersacidine coderende gencluster cryptisch of zijn specifieke

activators noodzakelijk.


189

Omdat bacteriocines rechtstreeks door genen zijn gecodeerd (en daardoor

gemakkelijker te modificeren dan de klassieke antibiotica), kunnen ook strategieën

worden ontwikkeld om bacteriocines te produceren vanuit in silico voorspelde

genclusters die blijkbaar niet of nauwelijks tot expressie komen. In hoofdstuk 5

ontwierpen we nieuwe klasse I en II hybride lantibiotica met als doel het verhogen

van de antimicrobiële activiteit, door het combineren van de activiteiten van

individuele transglycosylering inhibitiedomeinen en lipide II binding, door

hybriden te construeren bestaande uit het N-terminale deel van nisine en het C-

terminale deel van mersacidine. Het was mogelijk om de niet tot expressie

komende lantibioticum genen van Bacillus heteroloog tot expressie te brengen in

Lactococcus lactis. Dit leidde tot een verbetering van het productieniveau. Deze

hybride verbindingen kunnen verschillende processen van de celwand biosynthese

remmen, bijvoorbeeld door aan te grijpen op lipid II en synergistische functies

zoals het remmen van transglycosylatie. Antimicrobiële activiteitstesten suggereren

dat indien het N-terminale deel van nisine gecombineerd is met het C-terminale

AviCys, de activiteit van de hybride verbeterd is ten opzichte van de wildtype

moleculen.

Samenvattend geeft een combinatie van screening en de isolatie van bacteriën uit

natuurlijke bronnen om potentiële antimicrobiële producenten te verkrijgen veel

mogelijkheden. Software om genomen te doorzoeken op nieuwe antimicrobiële

genclusters, gevolgd door genetische engineering en heterologe productie van

nieuwe antimicrobiële verbindingen, levert een veelbelovend resultaat op. De

uitgebreide classificatie van antimicrobiële verbindingen laat zien dat het genus

Bacillus een rijke bron vormt van nieuwe antimicrobiele stoffen, vormt die nu

gemakkelijk experimenteel kunnen worden benut omdat veel nieuwe genclusters

zijn geïdentificeerd. Andere toepassingen van deze in silico analyses, meer

georiënteerd naar de microbiële ecologie, kunnen waardevolle informatie

verschaffen over welke omgevingen gescreend moeten worden om nieuwe

producenten en activators van antibiotica te vinden. Gezien de huidige prevalentie


190

van antibioticaresistente pathogenen, is er een urgente behoefte om nieuwe klassen

van krachtige antibiotica met nieuwe mechanismen te ontdekken en te

ontwikkelen.

Acknowledgment

191

Acknowledgment

Groningen is early winter turning cold again in November, the sky is blue, the

clouds are white and the grass in accordance with the rain is still green. I am sitting

in Linnaeusborg sixth floor office, recalling my doctoral thesis writing process as

well as 5 years of research life - edge of love and pain.

I started my successive postgraduate and doctoral programs of study in September

2011, in Tianjin University, P. R. China. Afterwards, I got the qualification of

Chinese Scholarship Council (CSC) and came to Molgen, University of Groningen,

the Netherlands in September 2014, to finish my PhD study. During this period,

many people have given me helps and I would like to thank you all sincerely.

My deepest gratitude goes first and foremost to my supervisor in the Netherlands,

Prof. Oscar P. Kuipers, for his constant encouragement and guidance. I am grateful

to have had this opportunity to do research as his PhD student. He has taken me

into the genetic world of antimicrobials and walked me through all the stages of the

writing of this thesis. Without his consistent and insightful instruction, this thesis

could not have reached its present form.

I also would like to express my heartfelt gratitude to my co-supervisor in China,

Prof. Zhijiang Zhou. He not only gave patient instruction and expert guidance, but

also offered me valuable suggestions in the academic studies. In addition, I deeply

appreciate the contribution to the chapter 3 of this thesis made in China together

with him and his support of my study in the Netherlands.

I also owe a special debt of gratitude to Prof. Jan Kok, Prof. Jan-Willem Veening

and Prof. Gert Moll for all the suggestions.

Grateful acknowledgment is made to my daily supervisor dear Manolo who gave

me considerable help by means of experimental suggestion and manuscript

Acknowledgment

192

revising. His encouragement and unwavering support has sustained me through

frustration and depression. He is always pushing me ahead till the completion of

this thesis.

I also want to thank Dr. Anne de Jong. From the genome sequencing to data

analyzing, he gave me valuable bioinformatics advice and help.

I would like to thank Maike and Chunxu for devoting their valuable time to read

my thesis and provide comments.

My gratitude also goes to Sjoerd for his help on the Dutch abstract and summary of

this thesis and Zhibo for his help on the thesis layout.

To my officemates Elrike, Tonia, Robyn, Clement, Lance and Stefano, I really

enjoy sitting in the same office with them. They are always very kind and provide a

lot of help and encouragement in my study. I appreciate all the happy time with

you.

My grateful thanks go to Molgen Bacillus group Lab 0651, Mirjam, Barbara, Ard

Jan, Luiza, Marielle, Jason, Yi and Zhibo. I really enjoy working in the same lab

with them. They are always very kind and provide a lot of technical help in the lab.

I would like to thank all the members of Molgen Lanti group. They always provide

a lot of theoretical and technical help on lantibiotics and Lactococcus lactis in my

study. Especially, I would like to express my deepest gratitude to Auke, Maike,

Dongdong, Qian, Jingjing, Ana and Andrius. They are always willing to help me

with smiles.

I would like to thank our Chinese Molgen group: Dongdong, Liang, Yi, Jason,

Qian, Jingjing, Xue, Chenxi, Chunxu, Zhibo, Lu; and all the other Molgeners:

Manon, Jannet, Klazien, Anne, Siger, Harma, Angel, Lieke, Ruben, Tomas, Yoshi,

Takato, Arnau, Rieza, Jeroen, Ruud, Jhonatan, Renske, Jelle, Morten, Katrin,

Acknowledgment

193

Robin, Dimitra, Amanda, Jakob, David, Santiago, Baptiste, Alexandros, Arnoldas

and so on for working, eating, playing and sharing together during these years.

Furthermore, I would like to thank all my Chinese friends met in Groningen, Xinyu

Li, Huatang Cao, Zhenchen Tang, Xiaoming Miao, Xiaodong Cheng, Yanan

Wang, Si Chen, Fangfang Guo, Yingfen Wei, Min Wu, Boqun Liu, Yuanze Wang,

Bin Jiang, Lianghui Cheng, Wei Qin, Lei Lv, Xiangfeng Meng, Yuxiang Bai,

Huifang Yin, Gang Huang, Weichao Jing, Liying Tuo, Yuchen Du, Jing Chang,

Chen Li, Lu Han and Qing Zhang.

I am greatly indebted to the CSC for offering me the one year and a half support to

study in the Netherlands.

I also would like to thank professors, teachers and classmates at the Department of

Food Science, Tianjin University, who have instructed and helped me a lot in the

past ten years.

Special thanks should go to my roommates Yu Qi (Yuki), Ke Zheng (Coco) and

Anton Eskenazi, who have put considerable time with me in Groningen as family. I

was very happy traveling with them to many European cities, large and small.

To my beloved Nan, I cannot thank him enough for trusting and supporting me.

Even though we are far from each other, he always understands me.

Last but not the least, my gratitude also extends to my parents who have been

assisting, supporting and caring for me all my life. Mom and Dad, I am always

loving you. All my best wishes to you!

谢谢爸爸妈妈，我爱你们。

Publications

195

List of publications

1. Zhao X, Kuipers OP. Identification and classification of known and

putative antimicrobial compounds produced by a wide variety of Bacillales

species. BMC Genomics, 2016,17:882. (chapter 2)

2. Zhao X, de Jong A, Zhou Z, Kuipers OP. Complete genome sequence of

Bacillus amyloliquefaciens strain BH072, isolated from honey. Genome

announcements, 2015,3:e00098-15. (chapter 4)

3. Wang J, Li L, Zhao X, Zhou Z. Partial characteristics and antimicrobial

mode of pediocin produced by Pediococcus acidilactici PA003. Annals of

Microbiology, 2015,2:1-10.

4. Han Y, Fan J, Zhou Z, Tan X, Zhao X. Cloning and efficient expression of

Bacillus sp. BH072 tasA gene in Escherichia coli. Transactions of Tianjin

University, 2015,21:26-31.

5. Zhao X, Han Y, Tan X, Wang J, Zhou Z. Optimization of antifungal

lipopeptide production from Bacillus sp. BH072 by response surface

methodology. Journal of Microbiology, 2014,52:324-332.

6. Ren L, Han Y, Yang, Tan X, Wang J, Zhao X, Fan J, Dong T, Zhou Z.

Isolation, identification and primary application of bacteria from putrid

alkaline silica sol. Frontiers of Chemical Science and Engineering,

2014,8:330-339.

7. Fan J, Zhou Z, Zhao X, Tan X, Han Y. Isolation and identification of

yeasts in honey. Science and Technology of Food Industry, 2014,35:165-

168.

Publications

196

8. Zhao X, Zhou Z, Han Y, Wang Z, Fan J, Xiao H. Isolation and

identification of antifungal peptides from Bacillus BH072, a novel

bacterium isolated from honey. Microbiological Research, 2013,168:598-

606. (chapter 3)

9. Fan J, Zhou Z, Zhao X, Han Y. Research progress on production of sugar

alcohols by microbial fermentation. Sichuan Food and Fermentation,

2013,49:94-98.

10. Zhou Z, Zhao X, Han Y. A high-yielding strain of antimicrobial peptide

and its preparation methods (CN103773712 A). Patent application No.

201310662193.2.

university of groningen antimicrobials of bacillus species ... · amylocyclicin b....

Documents