understanding the molecular basis of cotton leaf curl...

Rahim Ullah

2015

Department of Biotechnology Pakistan Institute of Engineering and Applied Sciences

Nilore, Islamabad, Pakistan

Understanding the Molecular Basis of Cotton Leaf Curl Disease Resistance in

Cotton Germplasm

Abstract

The production and processing of cotton is a major source of foreign exchange for the

economy of Pakistan. The majority of cotton fiber produced in the region comes from

the tetraploid Gossypium hirsutum, although some is still produced from the cotton

species native to the region, the diploid G. arboreum. Since the early 1990s, cotton

production in Pakistan and northwestern India has been adversely affected by cotton

leaf curl disease (CLCuD). The disease is caused by single-stranded DNA viruses of

the genus Begomovirus (family Geminiviridae) in association with a specific satellite,

Cotton leaf curl Multan betasatellite (CLCuMuB). At this time only a single virus,

Cotton leaf curl Burewala virus (CLCuBuV), is associated with CLCuD across most

of Pakistan. This virus is resistance breaking, overcoming resistance to the previous

begomoviruses/satellite complex that was introduced into cotton by conventional

breeding.

At this time there are no commercially available G. hirsutum lines that are

resistant to CLCuBuV/CLCuMuB. However, all lines of G. arboreum are “immune”

to CLCuD and plant breeders have long been trying to introduce the “resistance” from

this species into the more desirable G. hirsutum lines. In addition, recently two lines

of G. hirsutum originating from France (cvs. Dominique and Haiti) have shown

promise in field screening for resistance against CLCuD.

The study described here was designed to investigate the nature of the

resistance of G. arboreum cv. Ravi and the French G. hirsutum cultivars, Dominique

and Haiti, using whitefly-mediated and graft inoculation of the CLCuD virus

complex. Additionally the possibility of using biolistic inoculation of viral DNA was

investigated as a possible means of experimentally introducing the virus complex

causing CLCuD into cotton.

In large scale field screening of G. arboreum cv. Ravi over a period of two

years, no symptoms of virus infection were detected under inoculation pressure

conditions where 79-89% of the susceptible control (G. hirsutum cv. CIM 496) plants

were symptomatic. Rolling circle amplification/polymerase chain reaction

xiii

(RCA/PCR) diagnostics, the most sensitive diagnostic method available to detect

geminiviruses in plants, did not detect either CLCuBuV or CLCuMuB in field grown

G. arboreum cv. Ravi plants; consistent with the idea that G. arboreum is immune to

the virus complex. However, graft inoculation with scions from CLCuD affected G.

hirsutum showed firstly that the virus complex can move systemically in the plant and

that G. arboreum can respond to virus infections by the production of symptoms.

Surprisingly, in a few cases, the disappearance of established symptoms was seen

following removal of the graft. In all graft inoculated Ravi plants, after removal of the

graft, newly emerging tissues were non-symptomatic and no virus could be detected.

These results show that, rather than being immune, G. arboreum is highly resistant to

the CLCuD complex and has a high virus/satellite threshold for the induction of

symptoms, which whitefly inoculation likely is not able to achieve. The low virus

levels detected in G. arboreum suggest that possibly the resistance targets

virus/satellite replication and, without a continual source (such as from a graft), the

virus/satellite complex is rapidly lost.

In small-scale, glasshouse-based insect transmission studies, plants of G.

hirsutum cvs. Dominique and Haiti remained symptomless under conditions where all

G. hirsutum cv. CIM 496 plants became infected. Graft inoculation showed the

Dominique and Haiti plants to be susceptible but showing only mild symptoms,

slightly higher than in grafted G. arboreum cv. Ravi plants. The virus/satellite levels

in such plants were lower than in the susceptible control but higher than detected in G.

arboreum cv. Ravi. Upon removal of the graft, newly developing leaves did not show

symptoms and no virus/satellite could be detected. The response to infection seen in

G. hirsutum cvs. Dominique and Haiti very much mirrors what was seen for G.

arboreum cv. Ravi. Recovery from infection has, for other viruses, been shown to be

an RNA interference phenomenon and the results are discussed in light of this

possibility.

G. hirsutum cvs. Dominique, Haiti, Coker and S-12, as well as G. arboreum

cv. Ravi plants were biolistically inoculated with cloned CLCuBuV/CLCuMuB,

Cotton leaf curl Kokhran virus (CLCuKoV; a begomovirus prevalent in cotton in

Pakistan in the 1990s)/CLCuMuB and with RCA products from field- infected G.

hirsutum cv. CIM 496 plants shown to be infected with CLCuBuV/CLCuMuB. Only

a small number of Coker and S-12 plants, inoculated with cloned

xiv

CLCuKoV/CLCuMuB, became infected and showed the typical symptoms of

CLCuD.

Overall the findings indicate that G. hirsutum cvs. Dominique and Haiti harbor

a useful resistance to the virus(es) causing CLCuD which should be used for

introgression into elite cotton varieties. The results obtained with G. arboreum cv.

Ravi indicate that, rather than being a non-host, this harbors extreme resistance to the

viruses causing CLCuD and further efforts should be made to characterize the

molecular basis for the resistance. Finally the biolistic studies indicate that this can

potentially be a useful method for experimentally introducing

begomoviruses/satellites into which should be investigated further.

xv

CHAPTER 1 Introduction and Review of

Literature

1 Introduction and Review of Literature

Archaeologists for the first time, 7,000 years ago, searched out cotton in the caves of

Mexico very similar to the present day cotton. Some 5,000 years ago at Moenjodaro

people in Pakistan and the Egyptian were making and wearing cotton clothes. About

800 AD traders from Arab introduced cotton cloth to Europe. With the discovery of

America in 1492, Columbus found cotton growing in Bahamas. The first machine

spinning of cotton was made in England in 1730 with the invention of cotton gin by

Eli Whitney.

Gossypium hirsutum, the highly domesticated Upland cotton, was introduced

to India in two phases in 1818 and 1840, respectively through the East Indian

Company. With the inception of the Agriculture Department in 1905, Mr. Milne,

started working on cotton improvement, released the first improved and approved

variety of G. hirsutum, 4F, for cultivation in Punjab in 1914. The Punjab Government

in 1925 conjointly with Indian Central Cotton Committee started the Punjab Botanical

Research Scheme. Cotton varieties with improved produce, such as 24F, 289F, 199F,

238F, 289/43F and LSS were successfully introduced for cultivation.

The genus Gossypium is classified into 50 species including 45 diploids and 5

tetraploids [1, 2]. However, agronomically important species in the genus Gossypium

is represented by four vital species entitled G. hirsutum, G. barbadense, G. arboreum

and G. herbaceum [3] with a common origin of approximately 5-15 million years old.

1.1 Viruses Virus, word with Latin origin, meaning poison, slimy liquid or stench, is defined as an

intracellular obligate parasite with RNA or DNA genome enclosed in the virus

encoded protective protein coat. The geneticist, Hermann Muller in 1922, proposed a

hypothesis declaring viruses as potential genes. The idea was later recommenced in

1923 by Joanne Karrer Armstrong and Benjamin Duggar, who reflected Tobacco

mosaic virus (TMV) as a biocolloidal reproducible protein just like the genes seemed

to be. The idea, even if rejected by the virologists, was predicted by some decades as

1


the functional nature of viruses and signified the first conceptual reply to the virus

paradox. According to Luria et al. [4] viruses are small entities with genomes

comprising of elements of nucleic acid that require the synthetic cellular machinery of

the host for their replication resulting in the synthesis of particular elements

obligatory for the transmission of viral genome to new cells. Every single cellular

form of life studied so far is either having the viruses on its own or, if not, at least,

genetic elements with a close resemblance to viruses [5]. Viruses, particularly

bacteriophages, based on the recent environmental studies, are the most abundant

biological units on this planet [6]. Because of their lively and vigorous movement

between biomes, viruses are believed to be crucial agents of evolution due to their

capability to function as a mean of horizontal gene transfer [7]. Human beings are

under the threat of more than a 1000 different viruses [8].

1.2 Plant Viruses Plant viruses, similar to other viruses, are obligate intracellular parasites using the

host cellular machinery for their replication. Plant viruses, amongst the most

dangerous and taxing, are causing alarming threats to the crops of high economic

value in the form of different types of diseases [9, 10]. Martinus Beijerinck, in 1898,

squeezed out sap from the leaves of tobacco infected with mosaic disease and

determined that the sap remains infectious even after passing through porcelain filter

[11] in contrast to bacteria which were retained on the porcelain filter. This

contagious filtrate was named as a "contagium vivum fluidum", from which the

current term "virus" was coined. This work resulted in the discovery of the first ever

plant virus, TMV, attributed to Martinus Beijerinck. The first rational system of plant

virus classification was presented by James Johnson [12], who also revealed that

plants can be infected by a number of distinct viruses. Smith [13] published the first

ever textbook of plant virology in 1937. Wendell Stanley [14], the “Nobel Prize”

winner for his contribution in the field of virology, was the first one to carry out the

crystallization (purification) of TMV in 1935, though he was unable to find out that

RNA is an encapsidated nucleic acid. Based on the present classification viruses are

placed into 6 orders, 94 families, 22 subfamilies, 395 genera, and ~2500 species of

which the plant viruses are represented by 20 families, 90 genera and ~800 species

[15]. More than 90% of the plant viruses are RNA viruses with single-stranded (ss)

RNA genomes while less than 10% of the plant viruses are DNA viruses. DNA

2


viruses with circular double-stranded DNA (dsDNA) or circular ssDNA genomes are

further grouped into two Caulimoviridae, comprised of caulimoviruses and

badnaviruses with dsDNA genome which replicate through RNA intermediates by

reverse transcription, represents the first group whereas the families Nanoviridae

(nanoviruses) and Geminiviridae (geminiviruses), comprised of ssDNA viruses using

dsDNA intermediates for replication through the rolling circle mechanism, represent

the second group [16, 17].

1.3 Geminiviruses Description of disease caused by geminiviruses might have been recognised anciently

in the classical anthology of Japanese poetry, Man’syoshu, as yellow vein disease of

Eupatorium plants, as early as 752 AD [18]. With the passage of time, almost 23

years later, it was confirmed that yellow vein disease in Eupatorium was caused by

geminivirus/betasatellite [19]. The name ‘‘geminivirus’’, from Gemini, symbol of

zodiac signified for twins [20], was assigned to these viruses possessing the

distinctive geminate (twinned) morphology (Figure 1.1), with genomes represented by

one or two circular ssDNA components of 2.5–3.1 Kb [21]. The availability of vector

free inoculation techniques, easy tackling through molecular procedures and

manageable small sizes of their genomes present them to be the best studied plant

viruses so far [22]. Geminiviruses were upgraded to the family Geminivirdae in1995

[23] including the widely distributed plant viruses infecting both monocots, such as

wheat and maize, and dicots, such as tomato and cotton [24]. Geminiviruses evolves

continuously extending their circle of infection and have been recently reported in

some new weeds [25-29]. The economically important crops not only in most of the

tropical and subtropical regions but very recently in some of the temperate regions

also, are severely hampered by these viruses owing to the changes in the

environmental conditions and most importantly due to human trade, spreading the

infectious materials and insect vectors [30, 31].

3


Figure 1-1 Three-dimensional cryoelectron microscopy image reconstruction of a geminate particle (reproduced from [32]).

1.4 Classification of Geminiviruses Based on genome organization, host range and the insect vectors, the family

Geminiviridae has been categorised into four genera, named Curtovirus, Mastrevirus,

Begomovirus and Topocuvirus [33]. However recently three more genera, namely

Becurtovirus, Turncurtovirus and Eragrovirus, have been proposed [15, 34,

35].About 300 species of geminiviruses are officially recognized of which ~ 200

belongs to largest genus Begomovirus and more than 800 completely sequenced

genomes have been submitted to the database [35], showing how much diverse and

economically important this family is.

1.4.1 Mastrevirus

The leafhopper-transmitted monopartite mastreviruses, exclusively confined to the

Old World (OW), infect monocotyledonous or dicotyledonous plants [36-39]. Wheat

dwarf virus (WDV) and Maize streak virus (MSV) are the two thoroughly

investigated members of monocot- infecting while Tobacco yellow dwarf virus

(TbYDV) is an important dicot- infecting mastrevirus. The unique features of ~ 2.6-

2.8Kb viruses from this genus is the presence of non-coding large and short intergenic

regions (LIR; large intergenic region and SIR; small intergenic region) separating the

virion-sense (V-sense) and complementary-sense (C-sense) open reading frames

4


(ORF), comprehend the regulatory components (Figure 1.2), and two ‘‘replication

associated proteins’’ (Rep). Mastreviruses encode four conserved proteins [40]. The

two proteins associated with the replication of these viruses, Rep and Rep A, needed

early in the establishment of a successful viral infections are encoded from the C-

sense transcripts. The spliced mRNA of Rep and Rep A genes produces the full length

Rep while Rep A protein is encoded from Rep A gene. The other two proteins,

required for the encapsidation and movement of these viruses within and between the

host cells (coat protein [CP] and movement protein [MP]), are deciphered from the V-

sense transcripts.

Figure 1-2 Genome organizations of mastreviruses and leafhopper vector of Maize streak virus (MSV), Cicadulina mbila. The position and orientation of genes are

indicated by specific arrows. The genes encoded in the V-sense are coat protein (CP) and the movement protein (MP) genes. The C-sense encodes the replication-

associated protein (Rep) which is translated from a spliced mRNA product of the Rep and Rep A genes. The position of the intron is indicated. The unspliced messenger RNA translates to Rep A protein. The intergenic regions (non-coding region), the

large intergenic region (LIR), including a predicted hairpin structure with the nonanucleotide sequence (TAATATTAC) forming part of the loop, and small

intergenic region (SIR), are indicated.

The bidirectional expression of C-sense and V-sense genes is controlled by the

promoter elements present in the LIR which in addition have plant nuclear factors

binding sites mandatory for expression and DNA replication. The LIR in addition also

5


possesses the Rep binding sites (iterons) and an expected stem loop structure acting as

the origin of virion-strand DNA replication [41].

1.4.2 Curtovirus

The dicot- infecting curtoviruses, monopartite with circular ssDNA genomes of ~ 3.0

kb, uses leafhoppers for their transmissions to host plants [42]. A recently included

species Spinach severe curly top virus (SSCTV), in addition to the first described and

most important member Beet curly top virus (BCTV), is one of the key members of

genus Curtovirus. The transcription of the seven open reading frames (ORFs) of these

viruses is under the control of a single bidirectional promoter positioned in the IR

region (~ 450nt) which also possesses the origin of (V)-strand DNA replication

(Figure 1.3; [43-47]). V1, V2 and V3 genes are transcribed from the V-sense strand

encoding coat protein (CP), ss/dsDNA regulators (V2) and the putative movement

protein (V3; [21, 46]) while the most divergent C1, C2, C3 and C4 genes are

transcribed from the C-sense strand encoding replication associated protein (Rep),

protein involved in the recovery of phenotype, homolog of begomovirus-encoded

transcriptional-activator protein (C2), replication enhancer protein (REn) and a

protein involved in the development of symptom (C4), respectively [48-51]. The IR is

highly divergent among different species of curtoviruses possessing species-specific

cis-acting elements (iterons) playing a major role in replication and control of gene

expression, however, inadequate to regulate the expression of its own Rep protein

[42].

1.4.3 Topocuvirus

Topocovirus, the most recently documented genus of Geminiviridae family, is

represented by the only dicot- infecting specie of Tomato pseudo-curly top virus

(TPCTV) isolated from Florida [52]. This monopartite virus uses Micrutalis

malleiffera (treehopper) for transmission to the host plants and is prevalent, as much

is known till now, to the New World (NW). Encoding a total of six, four (Rep, C2, C3

and C4) are encoded from the C-sense and two from the V-sense (Figure 1.4). TPCTV

genes, although not investigated, are considered to have similar functions based on

their homology to other dicot- infecting viruses. Based on the genomic analysis

TPCTV is considered as a natural recombinant of mastreviruses and begomoviruses

[52] that can trans-complement the DNA-A components of

6


Figure 1-3 Leafhopper vector, Circulifer tenellus, and typical genome arrangements of curtoviruses. Position and orientation of genes are indicated by specific arrows.The

genes, encoding the coat protein (CP), a ss/dsDNA regulator (V2) and putative movement protein (V3), are present in the V-sense strand. The replication-associated

protein (Rep), a homolog of the begomovirus-encoded transcriptional-activator protein (C2), a replication enhancer protein (REn) and a protein involved in symptom expansion (C4) are encoded in the C-sense. The intergenic region contains a putative hairpin structure with the nonanucleotide sequence (TAATATTAC) forming part of

the loop.

African cassava mosaic virus (ACMV) and Tomato golden mosaic virus (TGMV)

regarding their movement when their cognate DNA-B components are absent [53].

1.4.4 Becurtovirus, Turncurtovirus and Eragrovirus

Becurtovirus, a very recently added genus to the family of Geminiviridae is

transmitted by leafhopper [54, 55]. The symptoms induced in plants by Beet curly top

Iran virus (BCTIV), first ascribed becurtovirus from Iran, and by BCTV, a curtovirus,

are very similar [56-58]. Spinach curly top Arizona virus (SCTAV), a recently added

second species to the genus Becurtovirus, has been ascribed from United States [59].

Transmission of BCTIV from plants-to-plants is vectored by Circulifer hematoceps

[56, 60]. Circulifer tenellus, found in the NW, vectoring curtoviruses, is thought to be

the possible vector of SCTAV. Regarding the genome organization both members are

found to encode three genes in the V-sense, V1 (CP), V2 (MP) and V3, and two in the

C-sense, C1 (Rep) and C2 (Figure 1.5; on the right), owning a unique nonanucleotide

sequence (TAAGATTCC; [59]). Genes products encoded in the V-sense are similar to

7


Figure 1-4 Treehopper, Micrutalis malleifera, and genome organization of Tomato pseudo-curly top virus encoding four genes (Rep, C2, C3 and C4) on C-sense strand and two genes (CP, V2) on V-sense strand. The position and orientation of genes are

indicated by specific arrows. The intergenic region contains the putative hairpin structure with the nonanucleotide sequence (TAATATTAC) forming part of the loop.

the corresponding genes products of curtoviruses while the genes products encoded in

C-sense are comparable to the corresponding genes products of mastreviruses. Two

intergenic regions, in common with mastreviruses, have been found in the genome of

becurtoviruses; named LIR and SIR. The unique nonanucleotide sequence

(TAAGATTCC) is found in the hairpin- loop structure of LIR. Splicing, apparently an

expected feature with a possible involvement in the expression of the C-sense genes

of becurtoviruses, has not yet being evident [59].

The leafhopper transmitted (Circulifer haematoceps) genus, Turncurtovirus, is

another recent addition to the family of Geminiviridae [34]. Turncurtovirus is

represented by the sole species of Turnip curly top virus (TCTV) first ascribed in

Fars, a province in Iran [61]. The virus is hosted by a number of weeds, sugarbeet,

cowpea and turnip [62]. Genome of TCTV is represented by four overlapping genes

in the C-sense, comparable to curtoviruses encoding Rep, C2, REn and C4 proteins,

and two genes in the V-sense strand encoding CP and V2 proteins (Figure 1.5; on the

left), dissimilar to the ones in curtoviruses. The V2 protein of TCTV, except the CP

protein slightly identical to the CPs of curtoviruses, does not share a slight bit of

sequence identity to any such V2s in the databases [61].

8


The genus Eragrovirus, represented by the sole species of Eragrostis curvula

streak virus (ECSV) is another new entry to the family of Geminiviridae [34]. The

insect vector for the plant-to-plant transmission of ECSV, quarantined for the first

time in South Africa from a monocotyledonous weed [63], has not yet been known.

Four genes, CP, V2, Rep and C2, have been identified in the genome of ECSV

arranged in a similar way to that of mastreviruses (Figure 1.5; down). The V-sense

genes of ECSV, CP and V2, are closely related to similar genes in mastreviruses.

However the products of genes encoded in the C-sense are closely related to the Rep

and C2 proteins of curto-, topocu- and begomoviruses [61]. Two IRs, with the smaller

one having becurtoviruses like nonanucleotide-containing stem-loop structure [63],

unlike mastreviruses, named IR-1 (smaller one) and IR-2 (larger one), have also been

identified in the genome of ECSV.

1.4.5 Begomovirus

Begomovirus is the largest dicot-infecting genus of family Geminiviridae in both OW

and NW with more than 230 documented species so far [35]. Begomoviruses are

spreading continuously, expanding their host range and causing threats to the

production of crops. They were held responsible for the massive economic

impairment to the economically important crops such as bean, cassava, squash,

tomatoes and cotton [64-66].

Begomoviruses, highly recalcitrant to mechanical transmission, are

transmitted exclusively by the whitefly (Bemisia tabaci), with single or two circular

ssDNA genomes. Based on phylogenetic studies begomoviruses are grouped in OW,

instigated from Asia, Australia, Africa and Europe, and NW viruses, originated from

South America [67-69]. Bipartite begomoviruses require both DNA-A and DNA-B

components to induce a symptomatic infection in the host plants [31, 70]. The single

genomic component of a monopartite begomovirus is homologous to the DNA-A

component of the bipartite begomovirus. Most of the monopartite begomoviruses are

often linked with symptoms modulating and trans-replicating circular ssDNA

satellites recognized as betasatellites and self- replicating satellites- like particles

identified as alphasatellites [71-73]. The OW is heavily dominated by the satellite-

associated begomoviruses overtaking both the bipartite and truly monopartite

begomoviruses. The symptoms associated with begomovirus infected plants are

9


Figure 1-5 Genome organizations of Becurtovirus (on the right), Turncurtovirus (on the top left) and Eragrovirus (bottom). The position and orientation of genes in each

of the virus are indicated by specific arrows. Becurtovirus encode three genes; V1 (CP), V2 (MP) and V3, in the V-sense and two genes; C1 (Rep) and C2, on the C-

sense. The intergenic regions (non-coding region), the large intergenic region (LIR), including a predicted hairpin structure with a unique nonanucleotide sequence

(TAAGATTCC) forming part of the loop, and small intergenic region (SIR), are also indicated. Turncurtovirus encodes four genes; Rep, C2, REn and C4, on the C-sense and two genes; CP and V2, on the V-sense strand. Eragrovirus encodes two genes; CP and V2, in the V-sense strand and two; Rep and C2, in the C-sense strand. The intergenic regions (non-coding region), the small intergenic region (IR-1), with a

unique nonanucleotide sequence (TAAGATTCC) forming part of the loop and large intergenic region (IR-2) are also indicated.

10


characterised by upward and downward leaf rolling, enations on the underside of the

leaves, stunting of plants following sever infestations and a significantly low yield

[71-74].

Bipartite Begomoviruses

The Bipartite begomoviruses, native to the NW, are represented by two genomic

components (DNA-A and DNA-B) of ~ 2.6-3.1Kb each. Almost all of the bipartite

begomoviruses are confined to the NW except Corchorus yellow vein virus (CoYVV)

and Corchorus golden mosaic virus (CoGMV), originated from the OW (Vietnam),

possessing attributes of the NW begomoviruses with a suggestion that they might be

the preceding leftovers of diverse descents of OW begomoviruses introduced to the

NW [75, 76]. There is not significant sequence similarity between the DNA-A and

DNA-B components except for a sequence of ~ 200nt, called the common region

(CR), almost identical in both of the components [61]. CR is the most significant

portion comprising the origin of V-strand DNA replication, iterons (sequences needed

for replication) and bidirectional promoter needed for the transcription of genes in

both components of begomovirus-complex [77, 78].

The DNA-A component of bipartite virus like the monopartite genome

encodes six genes. Two of these genes are transcribed from the V-sense strand

encoding the CP and AV2 protein, and four from the C-sense strand; encoding Rep,

transcriptional-activator protein (TrAP), replication enhancer protein (REn) and the

AC4 protein (Fig 1.6, on the right). The movement of virus within and between the

host plants is mediated by CP [79, 80], while the AV2 protein, in addition to be

involved in the movement of virus in plants, also play a key role to overcome host

plant defences activated by dsRNA (a phenomenon called post-transcriptional gene

silencing [PTGS]) in some of the species [81, 82]. Unlike all of the monopartite

begomoviruses from the OW, the DNA-A components in most of the NW bipartite

begomoviruses lack the AV2 gene suggesting their probable evolution from a single

parent [76].

The genes on the C-sense strand, called the early genes, encodes Rep, the only

virus encoded gene essential for the replication of virus, hamper host cell cycle and

initiate rolling-circle replication, TrAP, holds the key to up-regulate the V-sense (in

some cases), so called late genes, alongside host encoded genes and overpowers

11


PTGS [83-85]. The REn protein, in combination with Rep, plays a key role in the

replication of virus and correlation with host plants components [86]. The AC4

protein may have a role in the movement of virus, severity of the disease symptoms,

determination of host range and as a probable suppressor of PTGS [87-90]. The DNA-

A components of some of the begomoviruses encodes a non conserved AC5 gene, as

has been the case in Mungbean yellow mosaic Indian virus (MYMIV), with a

probable role in the replication of virus [91]. The DNA-B components of all the

bipartite begomoviruses encode BV1, a nuclear shuttle protein (NSP), and BC1, a

movement protein (MP), from the V-sense and C-sense strands respectively (Figure

1.6; on the left [22]).

Monopartite Begomoviruses

The monopartite begomoviruses, with identity to the DNA-A component of bipartite

begomoviruses, are represented by a single circular genomic component of ~ 2.6-

2.8Kb. At present majority of the monopartite begomoviruses, except Tomato leaf

curl virus (ToLCV), a true monopartite begomovirus that can induce symptoms of

disease in the field without being augmented by satellites, are associated with

satellites called betasatellites (as DNA β previously; [53, 92]) and satellite- like

molecules, alphasatellites (as DNA 1 earlier; [93-95]). The betasatellites are

indispensable for some of the monopartite begomoviruses to infect the host plants.

The monopartite begomovirus isolated for the first time ever from the NW was found

not to be associated with satellites [96].

Monopartite Begomovirus Associated Satellites

Satellites are the subviral agents or nucleic acids acting as pathogenicity determinant

or dampeners dependent (betasatellites) or independent (alphasatellites) on helper

viruses (HV) for their replication without significant nucleic acid identities to the

helper virus [97].

Betasatellites

These are small circular ssDNA component of ~ half of the size of the HV which are

associated with monopartite begomoviruses in the OW. Betasatellites, symptoms

modulating nucleic acids totally dependent on the helper virus for insect transmission,

encapsidation and most importantly replication, augment the level of HV and take

over host plants defences [98-100]. With an exception of the invariant nonanucleotide

12


sequence (TAATATTAC), the most important part of the origin of replication,

begomoviruses and betasatellites do not share any considerable sequence similarity

with each other [97]. Betasatellites, almost half the size of their HVs (~1351nt in

length; Figure 1.6; on the top), are characterised by an adenine rich region (A-rich), a

C-sense strand encoded solitary βC1 gene and a highly conserved region of ~ 200nt

among all the betasatellites (named satellite conserved region [SCR]; [97]). The βC1

encoded protein, being a major symptom determinant [71, 99] and as a suppressor of

PTGS [98, 101, 102], may also have a role in the movement of HV in host plants

[103].

The satellite molecule discovered for the first time ever associated with a

monopartite begomovirus, was Tomato leaf curl virus-satellite (ToLCV-sat), isolated

from ToLCV (a monopartite virus) infected tomatoes in Australia [104]. Sequence

analysis later confirmed it to be a vestigial betasatellite of ~ 682nt, encoding no

proteins and with very little sequence identity to its HV except for the TAATATTAC

motif of geminivirus and Rep binding motif of ToLCV within the two stem-loop

structures [105]. The infectivity analysis showed that ToLCV-sat, dependent on HV

for replication and encapsidation (hallmark of betasatellites), does not play any role in

the induction of symptoms. The betasatellite associated with Tobacco curly shoot

virus (TbCSV) may have a role in the augmentation of the severity of HV infection

but is not an obligation representing an evolutionary changeover between betasatellite

demanding and true monopartite begomoviruses [106]. Following the identification of

betasatellite in the last decade till now more than 400 full length versions of

betasatellites have been submitted and this number is increasing day by day [35],

suggesting how much prevalent they are, particularly in the OW [94].

Alphasatellites

Some of the monopartite begomovirus-betasatellite complexes were found linked with

small circular alpahsatellites with ssDNA genomes, previously known as DNA 1 [93-

95]. In common with betasatellites, they also require HV for the encapsidation and

movement within the host plants. Ageratum yellow vein disease (AYVD) in

Ageratum conyzoides, weed species from south-eastern parts in Asia, was found

associated with a unique begomovirus-complex comprising DNA-A from Ageratum

yellow vein virus (AYVV), betasatellite and DNA 1 [92]. TGMV, a bipartite virus,

13


and BCTV, a curtovirus, were found associated with the movement of alphasatellites

in planta. The leafhopper in association with BCTV was also found responsible for

the movement of alphasatellite within plants [107]. They encode a single Rep protein

identical to the one encoded by nanoviruses (Figure 1.6; on the bottom;[93, 94, 108])

and are capable of autonomous replication in host plants with no apparent role in the

induction of disease symptoms [94]. Being capable of autonomous replication, they

are precisely described as ‘‘satellites- like’’ molecules as satellites by definition are

dependent on HV for replication.

The hypothesis put forward, suggesting a close link of begomoviruses-

associated alphasatellites with Rep encoding sequence of nanoviruses, might have

been apprehended following a mixed infection with a nanovirus [109], was reasoned

observing the high levels of sequence similarity between them [110]. The

alphasatellites are not required for the begomoviruses to develop an infection in the

host plants [94] and it remains a mystery about the exact role of alphasatellites in

begomovirus-betasatellite complexes. However, the work done recently showing the

involvement of Rep proteins encoded by two different alphasatellites in PTGS

activity, suggests its probable role in overpowering host plant defences [111]. The

first ever cloned alphasatellite, Cotton leaf curl Multan alphasatellite [93], when

analysed, was shown to encode a Rep protein with no RNA suppression activity (Q.

Abbas; unpublished results), suggested two different classes of alphasatellites not

very significant in suppressing host plant defences at least in some cases of the

begomovirus-betasatellite complexes. However, work done recently have shown that

Rep proteins encoded by two different alphasatellites exhibit PTGS activity,

suggested its probable role in overpowering host plant defences [111]. Another

recently conducted study has shown a reduction in the accumulation of betasatellites

and ultimately virus- induced symptoms to guarantee the endurance of the host plant

[112].

1.5 Transmission of Begomoviruses Bemisia tabaci (Gennadius), the whitefly vector of begomoviruses, was described for

the first time in Aleyrodes (Homoptera) in 1889 [113] and as a pest for the first time

in India in 1919 [114]. Viruses of the families Potyviridae and Comoviridae and

genera Begomovirus, Carlavirus and Closterovirus are transmitted by Bemisia tabaci.

14


Figure 1-6 The photograph (centre) shows the vector of all begomoviruses (mono- and bipartite viruses), Bemisia tabaci. Genomes of bipartite begomoviruses are

represented by two modules known as DNA-A and DNA-B (right and left). Products involved in the replication (Rep), enhancement of replication (REn), activation of

transcription (TrAP), pathogenesis and suppression of RNA silencing (AC4), encapsidation (CP), and movement/pathogenicity (AV2) of begomoviruses are

encoded by their respective genes on DNA-A. However genes needed for the local and systemic movement (movement protein [MP] and nuclear shuttle protein [NSP]) are encrypted on DNA-B. Genome of monopartite begomoviruses, homologous to the

DNA-A of the bipartite begomoviruses, are usually associated with satellites molecules designated as betasatellites and alphasatellites. Betasatellites (top),

depending on their helper virus for encapsidation, movement and replication, encode a single pathogenicity determinant protein known as βC1. Alphasatellites (bottom) on

the other hand, encoding their own Rep, are capable of autonomous replication.

15


Herbaceous plants are most predominantly targeted by the whitefly- transmitted viral

diseases but very rarely testified on trees and shrubs. Cotton, tomato, bean, pepper,

beet, tobacco, squash and cassava are the main targets of whitefly-transmitted

geminiviruses [115].

To get transmitted begomoviruses, gulped through the stylets of whiteflies,

find their way to salivary glands, moving through oesophagus and digestive tract

breaching gut membranes into the haemolymph, from where they are delivered to the

host plants with the saliva during feeding. When Tomato yellow leaf curl virus

(TYLCV) specific antiserum was processed through immunosorbent electron

microscopy, immunogold label was found in the stylets of whitefly associated

predominantly with lumen of the food canal. The same label was also found in the

proximal and descending parts of midgut and in microvilli- rich gut wall epithelial

cells [116]. Immunolocalization of TYLCV was also reported in the filter chamber

and distal parts of midgut [117] suggesting microvilli to be the locations rich in

receptors for begomovirus acting as the main sites of virus internalization. Insect

vectors dose not facilitate the replication of geminiviruses [118]. CP is the only

begomovirus encoded protein that establishes a close link with factors of whitefly for

their circulative transmission to the host plants. However, the specific transmission of

a geminivirus from the insect to the specific host plants is governed by the CP as

replacing ACMV specific CP with that of BCTV modifies its insect specificity [79].

A mutant Abutilon mosaic virus (AbMV) capable of being transmitted by whitefly

was obtained by mutating two amino acids of the CP of a non-whitefly-transmissible

AbMV at positions 124 and 149 [119]. Whitefly insets its stylet and nourishes on the

sap in the phloem by tracing the conducting tissue [120]. Acquisition access period

(AAP) of 15 to 30 minutes, to a minimum, was signposted following whitefly

mediated TYLCV transmission and disease symptoms observation in tomato plants.

Following 24 h AAP a single insect (whitefly) can successfully transfer TYLCV to

tomato plant. However, as early as 5-10 minute after the commencement of the AAP,

TYLCV DNA can be detected through polymerase chain reaction (PCR) in a single

insect [121-123]. After a 5 minute inoculation access period (IAP) viral DNA can be

detected at the site of inoculation in tomato [121]. Transmission efficiency reaches

100% using 5 to 15 insects per plant [124-126]. The gender and age of whitefly plays

a role in the acquisition and conduction of TYLCV to the host plant. Following a 48h

16


IAP nearly all of the 7-14 days old female whiteflies were capable of causing an

infection in tomato compared to only about 20% of the males of the same age to

produce an infection. The efficiency of inoculation decreases with the age of insect as

observed with TYLCV-transmitting whiteflies; 60% of three and only 20% of the six

weeks old females retain the capacity to infect tomato plants. Even though the

frequency of translocation of TYLCV is analogous in both males and females,

indicating the possibility that the amount of virus translocated in both the genders is

different [122], and there is a difference in the presumed receptors of begomoviruses

in both of the male and female whiteflies. However this situation is completely

contrasting, with the reasons very much unclear, in case of Squash leaf curl virus

(SqLCV) transmitted by both male and female whiteflies with the same efficiency

[127].

1.6 Proteins Encoded by Geminiviruses

1.6.1 Replication-Associated Protein (Rep)

Rep is encoded by ORF C1 (also named AC1 or AL1) in the C-sense by all of the

geminiviruses. Owing to the similarity of this protein, almost 41kDa, to some of the

prokaryotic plasmids encoded replication initiator proteins obligatory for rolling circle

DNA replication [128], called “replication associated protein” [129]. Rep is known to

possess modular functions [130, 131]. Both the N- and C-termini of Rep are

characterised by DNA-binding, nicking- ligation and oligomerization domains and

ATP-binding domain along with ATPase activity, respectively [91, 132, 133]. Rep is

a sequence specific DNA binding protein vital for the replication of viral genome that

starts replication of virus in the (V)-strand [134-136] and is self- regulatory [137, 138].

Rep binds to iterons (repeated elements) during the course of rolling circle replication

(RCR) and creates a site-specific nick at the nonanucleotide motif TAATATT↓AC in

the stem loop region of the V-sense strand to start replication and then via a tyrosine

residue binds to the 5′ end of the nicked DNA. Acting as a replicative helicase Rep

forms a large oligomeric complex as the helicase activity is dependent on the

oligomeric conformation (~ 24 mer) of Rep [139]. The leafhopper-transmitted

mastreviruses encode two Rep proteins (Rep A and Rep) translated from the spliced

messenger RNA of C1 and C2 genes. Begomovirus encoded Rep is functionally

homologous to the Rep protein of mastreviruses [140].

17


The three dimensional structure of the catalytic domain of Rep protein of

TYLCV elucidated by nuclear magnetic resonance (NMR; [131]) predicted a well-

conserved architecture of this domain in Rep proteins of eukaryotes and prokaryotes,

and also in a number of proteins with different functions. Through the induction of the

replication machinery Rep proteins enable the replication of virus in differentiated

cells of host plants [141, 142]. The binding of Rep protein of TGMV using the linker

sequence of 80 amino acids (aa) with two predicted α-helices to the retinoblastoma

related proteins (RBR), is involved in cell-cycle regulation and by sequestering the

transcription factors can prevent the entry of cells to the S-phase [143, 144]. The

activity of Rep to bind pRBR and TGMV infection, capable of overpowering E2F-

mediated repression of the proliferating cell nuclear antigen (PCNA; [145]) promoter,

is very much in support of pRBR/E2F pathway controlled host gene expression by the

Rep protein of geminiviruses. According on this model, E2F binds to the PCNA

promoter in mature plant cells and recruits RBR, which in response recruits chromatin

remodeling factors to create a repressor complex [146], activating host gene

expression that leads to the production of required host DNA replication machinery.

1.6.2 Transcriptional Activator Protein (TrAP)

Transcriptional activator protein (TrAP) of ~ 134aa, encoded by curto-, begomo- and

topocuviruses, is a multifunctional protein localizes in the nuclei of host cells [147].

TrAP bear resemblance to a typical transcription factor in several esteems represented

by three main domains; a nuclear localization signal (NLS), a zinc finger- like domain

comprise of cysteine and histidine residues and an acid activation domain [147-150].

The begomoviruses encoded TrAP is a silencing suppressor, transcriptional activator,

and a suppressor of a basal defence. Being a nuclear protein [151] TrAP, at the level

of transcription, transactivates the expression of V-sense genes [83, 152, 153]. TrAP

is functionally interchangeable among begomoviruses [152]. TrAP as a transcriptional

activator is proved to be associated with the conserved structure of TrAP domains in

bipartite begomoviruses as mutations in any of these three domains can result in the

loss of this function [154]. Similarly TrAP as silencing suppressor loses this activity

in case of mutation in any of the three TrAP domains [82, 147, 154]. C2 protein in

curtoviruses and some of the monopartite begomoviruses (BCTV and Cotton leaf curl

Multan virus [CLCuMuV]) does not up-regulate the expression of V-sense genes

[155, 156], however, with respect to all other functions C2 protein is similar to TrAP.

18


In most cases TrAP/C2 has been reported to be lethal to plants when over

expressed [82, 153]. Suppression of PTGS has been shown to be associated with both

TrAP and C2 [82, 147, 157]. TrAP of TYLCV was studied for its in vitro binding

activity and was found to prefer the binding of ssDNA in comparison to dsDNA in a

sequence independent manner [158]. Adding to its foremost role in viral transcription,

TrAP/C2 also acts as a pathogenicity factor suppressing more than one of the host

defence pathways [159]. A universal metabolic regulator, SNF1 kinase, responding to

cellular energy balance, was found to be interacted and inactivated by TrAP/C2

proteins [160]. TrAP of begomovirus and C2 of BCTV are suppressors of an antiviral

defence, RNA silencing [161-164]. TrAP expressed from an RNA virus vector such

as Potato virus X (PVX) can reverse silencing and can also impede silencing when

expressed from plasmids by agroinfiltration or particle bombardment into plants [154,

157, 165, 166].

TrAP interacts with and inactivates adenosine kinase (ADK), a cellular

enzyme producing methyltransferase cofactor S-adenosylmethionine, needed for the

salvation of adenosine and conservation of methyl cycle [157]. TrAP/C2 is involved

in transcriptional gene silencing (TGS) by reducing transmethylation activity [85,

167], upsurges the expression of genes mandatory for cytokinin response [168] and to

up-regulate genes involved in cell-cycle [169]. TrAP/C2 was reported as a counter of

NSP induced hypersensitivity response (HR) leading to cell death and mutagenesis

analysis have shown the necessity of zinc finger domain and NLS, central region of

TrAP/C2, in the inhibition of HR and ultimately cell death [170, 171]. Most of the

developmental micro (mi) RNAs (non-coding small endogenous RNAs) are up-

regulated by TrAP/C2 [172], modulating the expression of host genes [154]. Self-

interaction of TrAP needs zinc finger- like motif (CCHC) but is not enough for this

interaction. Bimolecular fluorescence complementation have shown the accumulation

of TrAP: TrAP complexes in nucleus and TrAP: ADK complexes in cytoplasm

suggesting a correlation of TrAP: TrAP with nuclear localization and activation of

transcription, and that of TrAP: ADK with suppression of local silencing [173].

1.6.3 Replication Enhancer Protein (REn)

A small protein of ~ 132aa, the replication enhancer protein (REn), with no

significant role in replication, is a key to augment viral DNA as much as 50 folds

19


[174, 175], possibly due to the amendment in the activity of Rep protein or

recruitment of enzymes used by the host plant replication machinery [145, 176]. With

an exception of mastreviruses, the highly conserved REn protein is encoded by curto-,

begomo-, and topocuviruses [57, 145]. Nanoviruses, following rolling circle strategy

for their replication, do not encode REn protein [16, 110], nullifying the role of REn

not only in the binding of DNA by Rep but also in cleavage/ligation, topoisomerase

activities and Rep-facilitated deliverance of monomeric viral DNAs [177].

REn protein, at levels very much similar to Rep protein, is localized to the

nuclei of diseased plant cells [178] suggests its role as an initiator of viral DNA

replication by increasing the Rep binding affinity to the origin [179] unlike

mastreviruses, with no REn protein, where the role of REn protein is complemented

by their distinctive Rep A protein [129, 132]. The domains of REn protein mediate its

homo-oligomerization and interaction with host-encoded PCNA and pRBR overlap

[86, 176]. The polar residues of REn at both C- and N- termini were implicated in

REn-RBR interaction, whereas the central hydrophobic residues were playing a key

role in its interaction with itself as well as Rep and PCNA, indicating the importance

of REn-Rep, REn-REn, and REn-PCNA interactions for the replication of

geminiviruses. Whereas the REn-RBR complex, not needed for the replication of

viruses, plays a key role during the infection of host plants in their differentiated cells

[86].

1.6.4 (A)C4

A small gene symbolised as the AC4 (AL4 or C4), encoded by all the dicot- infecting

geminiviruses except mastreviruses, shows a sizeable variation in sequence and size.

The gene, completely embedded within Rep gene, is encoded in a different reading

frame [77]. The exact function of bipartite encoded AC4 protein still remains unclear.

The introduction of a stop codon at two different locations in C4 gene without

disturbing the amino acid sequence of Rep protein resulted in a mutant producing

yellowing of leaves, downward leaf curling and stunting when inoculated into

Nicotiana benthamiana [180]. C4 functioning as a pathogenicity determinant was

shown by the mutational analysis of C4 gene [87, 159, 181]. The C4 protein

expressing transgenics produced phenotypes similar to the ones produced by these

viruses further confirmed its role in the development of symptoms [51, 90], though

20


AC4 as a determinant of symptoms in bipartite geminiviruses still remains enigmatic

[182, 183]. In common with the MP of bipartite begomoviruses, the C4 of BCTV and

TYLCV were found confined to the cell periphery [80]. The AC4 protein of ACMV

and Sri Lankan cassava mosaic virus (SLCMV), capable of binding with non-coding

small (s)RNAs, might be acting as suppressors of PTGS to control gene expression

[166, 184]. This suppressor activity was also shown by the C4 protein of monopartite

begomoviruses with a high affinity for sRNAs [82].

1.6.5 Pre-Coat Protein (A)V2

The unique V-sense encoded (A)V2 gene, absent in begomoviruses from the NW, is

found in begomoviruses from the OW. However, CoYVV and CoGMV, two of the

bipartite begomoviruses recently discovered from the OW, lack this gene [75, 76].

Studies conducted to find out the function of about 118aa long pre-coat protein have

shown its involvement in movement and systemic infection of begomoviruses in host

plants [159, 185, 186]. Following a pattern somewhat similar to the localization of

MP [80], this begomoviruses encoded protein localizes in cell periphery and around

the nucleus and co- localizes with endoplasmic reticulum (ER; [187, 188]). The AV2

mutants induced either no or very mild symptoms with a very low level of the

accumulation of viral DNA on inoculation [185, 189], showing the importance of this

protein in the induction of symptoms and movement of virus in plants [185].

Acting as a suppressor of PTGS the V2 protein of CLCuMuV was found to

suppress PTGS by interacting with long RNAs preferring the ds forms while the short

RNAs were found showing no interaction with this protein [82]. However, the V2

protein encoded by TYLCV was found to bind siRNAs [190] and interact with

SISGS3, tomato homolog of SGS3 protein from Arabidopsis thaliana (AtSGS3),

involved in RNA silencing pathway [81]. The V2 protein, actively involved in the

movement of virus in host plant without binding the viral DNAs, is known as MP in

mastreviruses [191]. The identification of MP-CP complexes in MSV infected

extracts suggested an interaction between CP and MP directing CP-DNA complexes

from nucleus to cell periphery needed for the cell- to-cell movement of virus in host

plant [191]. Mutated AV2 had a very mild effect on the intensity of symptoms

implying that it did not played a significant role in the infection of cassava by East

African cassava mosaic Zanzibar virus (EACMZV). The mutations in AV1 and AV2

21


resulted in the loss/or alteration of CP production proposing a close functional and/or

structural association between these proteins [189].

1.6.6 Coat Protein (CP)

A multifunctional protein encoded by coat protein (CP) gene on the V-sense strand

by all of the geminiviruses is involved in a series of events associated with the

accumulation and encapsidation of ss viral DNAs, insect transmission and movement

of virus both inside the cell and between the adjacent cells. The CP is absolutely

indispensable for the long distance movement and systemic infection of monopartite

begomoviruses [159, 186], but in case of bipartite begomoviruses, augmenting the

efficiency of their long distance movement, the role of CP is highly redundant. The

CP, confined to the nucleolus and nucleus, facilitates the transport of DNA between

cytoplasm and nucleus [80]. The titre of viral DNA condenses when the host plant is

inoculated with a mutated CP. The spread of virus was impaired in the host plant

when inoculated with a CP mutated ToLCV [192]. CP confined to the secondary

plasmodesmata is associated with the appearance of lesions which shows how much

significant this protein is for monopartite geminiviruses to move systemically in the

host plant [193]. GUS assay showing the transport of CP to the nuclei of insect and

plant cells was another confirmatory report of the localization of CP to the nucleus

[194]. While studying the role of CP in the transport of viral genomes to the nuclei of

the host cells two nuclear localization signals (NLS) identified at the N-terminus,

described in the CPs of MSV [195], ACMV [196] and in TYLCV [80, 194], were

thought to be involved in transporting geminiviruses to the nuclei. Mungbean yellow

mosaic virus (MYMV) CP interacting with importin α (a nuclear import factor)

suggested the involvement of importin α-dependent pathway in the transport of CP to

the nuclei of host cells [197]. However, recent findings mapped NLS and nuclear

export signal (NES) for the CP of Tomato leaf curl Java virus (TLCJV; [198]).

The transmission of geminiviruses by specific insect vectors is associated with

the CP. CP determines the vector specificity of geminiviruses; when CP of ACMV

was replaced with that of BCTV it resulted in the change of whitefly to leafhopper as

a transmission vector [79]. The interaction of virion with a protein homologous to

GroEL within the insect/vector not only protects them from degradation but also

ensure their safe transmission to the host plants [199].

22


1.6.7 Nuclear Shuttle Protein (NSP)

Following the replication of geminiviruses in the nucleus there is a need to translocate

these viruses to cytoplasm and also to the neighboring cells. Nuclear shuttle protein

(NSP) encoded on the V-sense strand of the DNA-B component is involved in the

intracellular and intercellular movement of bipartite begomoviruses. NSP in

association with MP has been implicated in the determination of host range, systemic

spread and development of symptoms in the infected plants. Mutation in MP or NSP

does not have any influence on the replication or encapsidation but obliterates the

infectivity of virus [200, 201]. NSP as a target of the host defence response was

shown by the expression of this protein in plants causing curling and HR [170, 202].

Strong evidences were provided regarding the highly efficient binding of NSP with

ssDNA [203] with a limited sequence independent affinity towards the dsDNA as

well [204] localized in the nuclei. Co-expression of NSP with MP resulted in the

localization of this protein to the periphery of cells [146]. NSP is a basic protein

possessing two possible NLSs and a mutation in any one of them can severely hamper

the infectivity of virus. The C-terminus of NSP is required for interaction with MP

[205].

Cell-to-cell movements of bipartite begomoviruses follow a two model theory,

“relay-race model” and “couple-skating model”. According to “relay-race model”

intracellular movement of viruses from the nucleus to the cytoplasm is mediated by

NSP, where it is switched by MP which through plasmodesmata transports the viruses

to adjacent cells [206, 207]. According to “couple-skating model” intracellular export

of viruses from the nucleus to cytoplasm is mediated by NSP and later through

endoplasmic reticulum (ER) derived tubules the NSP coupled DNA is transported to

the adjacent cells [151, 204, 205, 208].

The movement of viral DNA can be regulated either by phosphorylating NSP

using kinase or inactivating the virus induced defence response of the host by

blocking the synthesis of protein [209]. TrAP has been reported to regulate NSP at the

level of transcription [83].

1.6.8 Movement Protein (MP)

The movement protein (MP), encoded by the DNA-B component of bipartite

begomoviruses on the C-sense strand, plays a key role in the intercellular movement

23


of bipartite geminiviruses. Being a mediator of the viral movement in the form of

dsDNA through plasmodesmata [206, 210], MP in a size- and form-specific manner

binds cooperatively with both ss- and ds-DNA [206, 207]. According to the “relay

race model theory” the cytoplasmic trafficking of viral dsDNA from nucleus is

mediated by NSP which then through plasmodesmata is carried out by MP. However,

according to the “couple-skating model theory” the ssDNA of virus is shuttled from

nucleus to cytoplasm and then intracellularly by MP. The intracellular movement of

NSP-containing ss- and ds-DNA of virus is mediated by MP [151, 204, 205, 208].

While studying the role of NSP and MP in the intracellular movement of Bean dwarf

mosaic virus (BDMV) by mutagenesis, the mutated NSP and MP were found to

hamper the movement of viral DNA [210]. At the C-terminus of MP three

phosphorylated sites, found vital for the development of symptoms and accumulation

of viral DNAs, were documented [211]. Two of the MP’s domains implicated in the

intracellular movement are from amino acids 117-160 and amino acids 1-49. The

domain (amino acids 117-180) implicated in the efficient targeting of reporter protein

to cell’s periphery, is known as an anchor domain [212].

1.7 Replication of Geminiviruses Replication of geminiviruses follow two mechanisms, the rolling circle replication

mechanism (RCR; [213-215]) and recombination dependent replication mechanism

(RDR; [17, 216]), in the nuclei of the infected cells from a ds-DNA intermediate

exploiting host plant machinery to utilize host cell polymerases for their replication

[16, 217, 218]. The role of both iterons/cis elements, positioned in the IR/CR of the

origin of replication [130, 217] and well-preserved nonanucleotide sequence (5′-

TAATATTAC-3′) in the loop of the hairpin structure [134], is unavoidable by the Rep

to recognize the origin of replication [136, 219].

1.7.1 Rolling Circle Replication (RCR)

The mechanism of RCR in geminiviruses is analogous to the mechanism found in ss-

DNA replicons; some of the bacteriophages and also in prokaryotic plasmids [213,

214, 220, 221]. RCR succeeds in three phases [16]. The first phase is initiated by the

conversion of the V-sense strand (known as genomic ss-DNA) into a ds-DNA

intermediate, primed by a short RNA, to produce the C-sense strand [222, 223]. The

host DNA primases, in most of the cases, synthesize this short primer on the V-sense

24


strand, however, this short RNA primer of ~ 80nt is already hybridized inside the SIR

on the encapsidated viral ss-DNA for mastreviruses [224]. The second phase begins

with the binding of iterons in the origin of replication by Rep [136] nicking the well-

preserved nonanucleotide sequence (TAATATT/AC) on the V-sense strand [214].

Tyrosine-103, a physical link between Rep and the origin of replication, is responsible

for this cleavage [88]. Rep, via a tyrosine residue, remains covalently attached to the

exposed 5′-terminus of the sliced strand [129] and the 3′ end, using the host encoded

polymerases, is stretched using the C-sense strand as a template. In the final phase the

unit length virion strand is produced by nicking and ligation to shape a circular V-

sense ss-DNA. After RCR the newly formed close circular ss-DNA genome can either

serve as template for further replication or can be encapsidated into virions for

transportation between plants or other parts of the same plant.

1.7.2 Recombination-Dependent Replication (RDR)

Based on analysing the replication intermediates of TGMV, ToLCV, BCTV, ACMV,

AbMV and a betasatellite, using electron microscopy and two dimensional gel

electrophoresis, an additional method of replication, RDR, was proposed [216, 225].

This model, leading to the repair of damages or breaks produced during RCR [226], is

not well studied. RDR model, more companionable with the RDR of a bacteriophage,

is based on the presence of certain replication intermediates [17, 225]. The

observation of both types of DNA intermediates in the naturally virus infected leaves

were showing the compatibility of virus with both RCR and RDR [17] unlike the

agroinoculated leaf discs, producing only the RDR compatible virus intermediates

[17]. The RDR model, named ‘join-copy’ pathway [17], ‘bubble-migration synthesis’

[227] and ‘break- induced replication’ [228], also proceeds in three phases [17, 226].

RDR begins with the processing of fragmented ds-DNA generating 3′-end ssDNA

needed for the invasion of the DNA followed by the formation of displacement loop

(D-loop) structure by the invasion of a homologous duplex using the 3′-end of ssDNA

serving as a potential primer for replication. The RDR finishes with the extension of

the heteroduplexed DNA (branch migration). The protein directed branch migration

proceeds at the back end of the D-loop due to the extension of the leading strand by

DNA polymerases in the front end of D-loop.

25


1.8 Cotton Leaf Curl Disease, Introduction of Resistant Cotton Varieties and Current Status of the Disease

Cotton leaf curl disease (CLCuD) is the most momentous biotic constraint to the

production of cotton in north-western parts of India and throughout Pakistan [72]. The

monopartite begomoviruses, augmented by a single symptom modulating

betasatellite, are the main players responsible for the induction of the disease [229,

230]. Symptoms of CLCuD in cotton starts within 2-3 weeks post- inoculation by B.

tabaci with initial downward cupping of the newly emerging leaves followed by

upward or downward curling, vein thickening and darkening and budding out of

enations (leaf like small outgrowths) from the underside of the leaf [74]. In 1967

CLCuD was observed for the first time ever in Pakistan [231]. However CLCuD as

first epidemic appeared in 1989 over a limited area and was ignored until 1992 when

the disease seriously hampered the production of cotton in Punjab. The CLCuD

epidemic, in Pakistani Punjab, was much more severe in the first three years regarding

the yield losses. The disease at that time, as compound infection, was shown to be

triggered by seven distinct monopartite begomoviruses [109] associated with a single

Cotton leaf curl Multan betasatellite (CLCuMuB) to augment the severity of disease

[72, 229].

Owing to the losses of 5 billion dollars (US), Pakistan has suffered since 1992

to 1997 regarding the production of cotton [53], plant breeders started to search for

the sources of resistance in the available germplasm of G. hirsutum on urgent basis.

The promising varieties were exposed to field trials in search for resistance against

CLCuD, if there is any, but except from the different ratings of tolerance exhibited by

some of these varieties, none was found to be completely resistant to the disease. CIM

70, S-12 and Rehmani (a variety from Sindh), severely hampered by CLCuD, were

found to be most highly susceptible in comparison to the varieties CIM 109, BH-36,

FH-87, MNH-93, SLH-41, CIM-240 and MNH-147 which were least affected by

CLCuD. The exotic germplasm were also carefully studied for the existence of

resistance and the varieties CP-15/2 and LRA-5166 (imported from India) were

discovered to resist CLCuD. The cross 492/87 × CP-15/2 produced progenies 1098

and 1100 as the first product of resistant lines against CLCuD in the cropping season

of 1992-93. Crosses conducted between the exotic cultivars resistant to the virus and

local susceptible cultivars in Multan at CCRI were successful in releasing two virus

26


resistant cultivars (CIM-448 and CIM-1100) which were approved for general

cultivation in Punjab by Punjab Seed Council in 1996. Later on in 1998 the crosses

CIM-109 × LRA-5166 and LRA-5166 × S-12 resulted in the release of two new

resistant cultivars named CIM-443 and CIM-446 (Anonymous).

The introduction of these CLCuD tolerant/resistant cotton varieties by

conventional breeding/selection methods were showing promise to manage the

disease. However, the resistance offered by these varieties was not long lasting and

was breached by the reappearance of CLCuD, second epidemic, on these varieties in

the year 2001 in district Vehari, (Burewala city), Pakistan in the form of a resistance

breaking species, the “Burewala species” [232]. The species named Cotton leaf curl

Burewala virus (CLCuBuV) after the city where the disease reappeared was found,

when analysed, to lack an intact TrAP gene [156]. Further analysis showed CLCuBuV

to be a recombinant of CLCuKoV and CLCuMuV triggering pre-resistance breaking

CLCuD. Origin of replication along with most of the sequences in the V-sense was

donated by CLCuKoV, first parent, while the C-sense sequences were donated by

CLCuMuV, the second parent [156].

Isolates of CLCuBuV dominating most areas in Pakistan with a recent

annexation to some parts of India [233, 234], sequenced mostly from different

accessions of G. hirsutum, clearly depict the prevailing nature of CLCuBuV playing

havoc with cotton production in these regions since 2001 till now. The emergence and

re-emergence of CLCuD, each time when the threat was slightly relieved using

resistant sources of cotton germplasm, has drawn us to search for durable sources of

resistance against the disease. These sources of resistance, before being utilized in

breeding for resistance, need to be analysed to understand the nature of their

resistance. An infectivity system to introduce cloned viruses into cotton would allow

us to investigate directly the exact mechanism of resistance breaking, the most

important question yet to be answered. Unfortunately an efficient infectivity system in

cotton is still lacking. The work described here is an attempt to get an insight into the

resistance mechanism of CLCuD resistance in cotton, specifically in the resistant

germplasm of cotton.

27


1.9 Aims of the Study

Graft-Inoculation to Investigate

• The mechanism of resistance in G. arboreum cv. Ravi.

• Two of the French imported G. hirsutum cvs. Dominique [AS0039] and Haiti

[AS0099].

Biolistic-Inoculation to Investigate

• The use of bioballistic/biolistic as a means of studying the mechanism of

resistance in cotton germplasm.

28

CHAPTER 2 General Methods

2 General Methods

2.1 Preparation of Gold Particles For 240 bombardments (using 250µg of gold per bombardment), gold (INBIO Gold,

Victoria), with a diameter of 1μm, was prepared by weighing 30mg of gold powder in

1.5ml microfuge tube and suspended in 1ml of 70% ethanol. Gold particles were

vigorously vortexed for 2-3 minutes and then allowed to settle for 5-10 minutes.

Microparticles were pelleted by spinning in microfuge for 5-10 seconds and the

supernatant was discarded, washed thrice with 1ml of sterile water. After the final

wash gold particles were resuspended in 500µl of 40% glycerol to bring the final

concentration to 60mg/ml. Following the final resuspension in sterile glycerol, 50μl

aliquots were transferred to 1.5ml microfuge tubes and stored at 40C.

2.2 Precipitation of Viral DNAs onto Gold and Biolistic Inoculation

To precipitate viral DNA onto the gold particles 1μg of the corresponding viral DNA

(0.5μg each of DNA-A [CLCuBuV and CLCuKoV] and their cognate betasatellites as

well as RCA products of CLCuBuV/CLCuMuBBur) was added to a 50μl aliquot and

vortexed for 30 seconds. During vortexing 50μl of 2.5M CaCl2 was added and the

mixture in the tube was vortexed for 30 seconds. 20μl of 0.1M spermidine was added

to the tube during vortexing and the mixture was vortexed for 3 minutes. The particles

(with coated DNAs) were pelleted by centrifugation at 10,000rpm for 10 seconds. The

pellet, after discarding the supernatant, was resuspended first in 250μl of 70% and

then in 250μl of 100% ethanol and again pelleted by centrifugation at 10,000rpm for

10 seconds and the supernatant was discarded. As a final step the pellet was

resuspended in 72μl of 100% ethanol and 6μl of the particle suspension was loaded

onto the centre of the macrocarrier for bombardment (protocol for 12 shots). Particles

(DNA/gold mixture) were delivered into cotton seedlings placed directly under the

outlet, at ~ 3-4cm beneath it, using a helium pressure based apparatus (Figure 2.1,

Helios Biolistic PDS-1000; Bio-Rad, Hercules, CA) with 28mm Hg of vacuum. The

rupture discs used were in the pressure range of 450psi.

29

2 General Methods

Figure 2-1 The image, front view of the components of Biolistic® PDS-1000/He system, is reproduced from Biolistic® PDS-1000/He Particle Delivery System Bio-

Rad Laboratories Hercules, California (USA), Catalog Numbers165-2257.

2.3 Plant Growth Conditions All the cotton plants used for grafting and biolistic inoculation were grown in

controlled aseptic growth rooms with 16 hours light period, 8 hours dark period and

optimum temperature, at the early stage during sowing and development of seedlings

the daytime temperature between 220C and 280C and night-time temperature between

180C and 200C was set but when the plants gets adopted following inoculation

(grafting and biolistic) temperature in the range of 380C and 450C (380C at most) at

daytime and 250C and 300C at night-time was maintained. Plants (for grafting) were

grown in big clay pots containing a combination of compost, silt and sand. All plants

were properly watered and given Hoagland solution (0.75mM MgSO4.7H2O, 1.5mM

Ca(NO3)2.4H2O, 0.5mM KH2PO4, 1.25mM KNO3, micro nutrients [50μM H3BO3,

15μM MnCl2.4H2O, 2.0μM ZnSO4.7H2O, 0.5μM Na2MoO4.2H2O, 1.5μM

CuSO4.5H2O] and Fe-EDTA [30μM FeSO4.7H2O, 1mM KOH, 30μM EDTA.2Na]

once a week.

30

2 General Methods

2.4 Collection of Samples The grafted as well as bombarded plants were photographed and samples were

collected on ice, leaves from the rootstocks and scions of grafted as well as

bombarded plants, respectively, from Nuclear Institute for Agriculture and Biology

(NIAB) 31025 North 7305 East Faisalabad. Samples collected both from the

symptomatic and non-symptomatic plants were marked with permanent markers and

stored at -710C.

2.5 Extraction of Plant Genomic DNA The method described by Doyle and Doyle [235], Cetyl trimethylammonium bromide

(CTAB) method, was used to extract DNA from the leaf samples. Plant leaves, ~

1gram, were frozen in liquid nitrogen and ground into fine powder with the help of

chilled, sterile mortars and pestles in the presence of liquid nitrogen. With the aid of

sterile and chilled spatula the powder was equally divided into three microfuge tubes.

An equal volume of hot (650C) 2% (w/v) CTAB buffer (2% [w/v] cetyl

trimethylammonium bromide,100mM Tris, [pH 8.0], 20mM EDTA [pH 8.0], 1.4M

NaCl and 1% [w/v] polyvinylpyrrolidone [PVP; MW 40,000]) was added, incubated

at 650C for ~ 45 minutes and thoroughly mixed by inverting the tubes. An equal

volume of chloroform: isoamyl alcohol (24:1) was added, mixed well by inversion of

tube forming an emulsion and centrifuged at 13,000rpm for 10 minutes. The upper

(aqueous) phase was carefully transferred to a new microfuge tube without touching

the lower phase, using an autoclaved wide bore white tip. DNA was precipitated by

adding 0.8 volume ice cold isopropanol, mixed well, put at -700C for 30 minutes and

centrifuged at 13,000rpm for 10 minutes at 40C. The supernatant was discarded

without disturbing the pellet. The pellet was washed with 70% cold ethanol for 5

minutes. The supernatant was discarded; pellet was dried at 370C in the incubator and

dissolved in 150µl of sterilized distilled water (SDW).

2.6 DNA Quantification Concentration of DNA, extracted from leaves of plants, and purified plasmids was

measured using spectrophotometer (Smartspec Plus, Bio-Rad). The samples to be

quantified were diluted 50 folds in SDW and at 260nm (OD260 of 1= 50 µg/mL) the

absorbance was measured after zeroing the machine against SDW. The quality of the

31

2 General Methods

extracted DNA was tested by running on 1% agarose gel and then checking under UV

light in gel documentation instrument.

2.7 DNA Amplification

2.7.1 Rolling Circle Amplification (RCA)

To amplify the circular DNA molecules rolling circle amplification (RCA; [236-239])

was used. A total of 20μl reaction mixture was prepared containing 100 to 200ng of

genomic DNA from cotton acting as a template, 2μl of 10X ɸ 29 DNA polymerase

reaction buffer (330mM Tris-acetate [pH 7.9 at 370C], 100mM magnesium acetate,

660mM potassium acetate, 1% [v/v] Tween 20, 10mM DTT), 1mM dNTPs and 50μM

random hexamer primer (RHP). To denature the double stranded DNA the reaction

mixture was placed at 940C in a thermal cycler/PCR machine for 5 minutes, cooled at

room temperature and mixed well with an enzyme mix, 5-7 units of ɸ 29 DNA

polymerase and 0.02 units of pyrophosphatase (to exclude pyrophosphate). After

mixing the reaction mixture was incubated at 280C for 17-19 hours. The next day the

reaction mixture was incubated at 650C in PCR machine for 10 minutes to inactivate ɸ

29 DNA polymerase. Running 2μl of the RCA product along with the control samples

on 1% agarose gel the amplification was confirmed.

2.7.2 Polymerase Chain Reaction

Depending on the purpose of PCR 25μl and 50µl, for diagnosis and cloning

respectively, of the reaction mixture was prepared. The reaction mixture containing ~

10pg-150ng of template DNA, 2.5-5μl of 10X Taq polymerase buffer (Fermentas,

USA), 2.5-5μl of 2mM dNTPs, 1.5mM of MgCl2, 0.25 to 0.50μM of each of the

primer and 0.50-1.25 units of Taq DNA polymerase (Fermentas) was prepared in a

0.25ml thin walled PCR tube. The DNA was amplified in the PCR machine

(Eppendorf, Germany). Machine was programmed for preheat treatment at 940C for 5

minutes followed by 38-40 cycles of 940C for 1 minute, primer annealing at 500C-

550C for 1 minute and extension of primer at 720C for varying times (depending upon

the length of the template to be amplified) and final extension at 720C for ~ 10

minutes. To amplify the begomovirus-complex from either genomic DNA of the

cotton plant or RCA amplified DNA primers pairs CLCV1/CLCV2

32

2 General Methods

(Begomodiagnostic primer pair; [240]), Beta01/Beta02 [241] and Begom-F/Begomo-

R [242] were used.

2.8 Purification of DNA

2.8.1 Gel Extraction and PCR Product Purification

The PCR amplified or endonuclease digested DNA was resolved on 1% ethidium

bromide containing agarose gel (Discussed in section 2.16) and the desired fragments

were cut out with sterile surgical blades under UV light, using Wizard SV Gel and

PCR Clean-Up System (Promega, USA), following manufacturer’s instructions.

Membrane binding solution, at the rate of 10μl per 10mg of gel slice and equal in

volume to the PCR product, was added, mixed well and incubated at 60-650C until the

gel slice is completely dissolved. The dissolved gel mixture was transferred into a

minicolumn assembly, incubated at room temperature for 1-2 minutes and centrifuged

in the microfuge for 1 minute at 13,000rpm. After discarding the flowthrough the

minicolumn was washed with 700μl of membrane wash solution (MWS). The

flowthrough was discarded and the column received another wash but this time with

500μl of MWS. Following the removal of MWS the empty column was centrifuged

for an additional 2 minutes with lid kept open to allow evaporation of any residual

ethanol left. The column was placed in a clean microfuge tube and 40-50μl of SDW

was added. Following an incubation period of 2 minutes at room temperature the

column was centrifuged for 1 minute to collect the purified DNA product, quantified

and stored at -200C.

2.8.2 Phenol-Chloroform Purification of DNA

Phenol: chloroform purification was carried out to exclude protein and other

impurities from DNA. By adding SDW the DNA solution was diluted to 200μl,

phenol: chloroform (1:1) was added to it in equal volume, well mixed till the solution

turned creamy and then centrifuged in a microfuge for ~ 5 minutes at 13,000rpm.

Without disturbing the interface between the two phases the upper aqueous phase was

moved to a new clean microfuge tube. Sodium acetate (3M, pH 5.4) and chilled

absolute ethanol at the rate of 1/10 and 2.5 volumes, respectively, was thoroughly

mixed with the supernatant and placed at -200C for 30 minutes. By centrifugation at

13,000rpm for ~ 4-5 minutes in the microfuge tube the precipitated DNA was

33

2 General Methods

pelleted. Following a wash with 70% ethanol the pellet was air dried to remove the

residual ethanol and stored at -200C after being dissolved in SDW.

2.9 Cloning of PCR Products The PCR amplified DNA was cloned in TA cloning vector using InsTAclone PCR

Cloning Kit (Fermentas, USA) according to the manufacturer’s instructions. Briefly,

the reaction mixture of 20μl in total contained 90 to 540ng of PCR product

(depending upon the length of DNA fragment), 1.5μl (120ng) of vector (pTZ57R/T),

4μl of 5X ligation buffer and 1μl (5 units) of T4 DNA Ligase. The reaction mixture

was prepared in 1.5ml microfuge tube and incubated at 160C overnight. Following

day the ligation mixture was transformed to competent Escherichia coli (E. coli) cells

(DH5α) by heat-shock method, incubated at 370C in a shaking incubator for an hour

and spread on solid Lauria bertani (LB) media plates (0.5% yeast extract, 1% tryptone

and 1% NaCl) and incubated at 370C overnight. The plates contain ampicillin

(100μg/ml) as a selection, X-Gal (20μl, 50mg/ml) and IPTG (100μl, 24mg/ml). The

recombinant white colonies, picked out from those plates with the help of sterile tooth

picks, were inoculated in sterilized culture tubes having 3-5ml of the liquid LB media

and grown overnight at 370C on vigorous shaking. Following day plasmid DNAs,

extracted from selected E. coli cells, were screen out for the presence of desired DNA

fragments by restriction analysis.

2.10 Extraction of Plasmid DNA (Miniprep) Single bacterial colony was picked from solid LB plate using sanitized tooth pick,

inoculated into a 5-6ml LB medium containing culture tube with an appropriate

antibiotic selection and placed at 370C on vigorous shaking overnight. Next day 1ml

from the culture tube was transferred to a microfuge tube and spanned at 13,000rpm

for 2-3 minutes to pellet down the cells. The bacterial pellet, through vortexing, was

resuspended in 100μl of Re-suspension solution (10mM EDTA, 50mM Tris-HCl [pH

8.0] and 100μg/ml RNase A). Following the addition and mixing of 150μl of Lysis

solution (1% [w/v] SDS, 0.2M NaOH) 200μl of Neutralization solution (3.0M

potassium acetate [pH 5.5]) was added, mixed and spanned at 13,000rpm for 12

minutes. The supernatant was carefully transferred to fresh microfuge tube without

touching the cell debris and DNA was pelleted with ~ 900μl of chilled absolute

ethanol. Pelleted DNA was washed twice, once each with 70 and 100% ethanol, air

34

2 General Methods

dried and dissolved in 100-150μl of SDW depending on concentration and amount of

the pellet.

Extraction of the plasmid DNA for sequencing was done by using Pure

YieldTM Plasmid Miniprep System (Promega, USA). The overnight cultures of E. coli

were shifted to microfuge tubes (~ 1.5ml) and centrifuged for ~ 1 minute. Added to it

was 100μl of Cell Lysis Buffer, mixed by inverting, and 350μl of cold (4-80C)

Neutralization Solution. Following centrifugation for 3 minutes at 13,000rpm, the

supernatant from the microfuge tube was transferred into PureYield™ Minicolumn

placed in PureYield™ Collection Tube (provided with the kit). After being

centrifuged for 15 seconds at 13,000rpm the flowthrough was discarded and

minicolumn was placed again in the same collection tube. 200μl of Endotoxin

Removal Wash buffer was added to the minicolumn and centrifuged again for the

same period at 13,000rpm. Finally the minicolumn was washed for 30 seconds with

400μl of Column Wash Solution. The minicolumn was inserted into a fresh

autoclaved microfuge tube and plasmid DNA, eluted in 30-50μl of elution

buffer/SDW by centrifugation at 13,000rpm for ~ 15-30 seconds, was stored at -200C.

2.11 Restriction Analysis Restriction digestion of RCA products and plasmids was done using specific

restriction endonucleases and their corresponding buffers in accord with provider’s

(Fermentas) recommendations. To screen out for the expected insert size, a reaction

mixture of 10μl (containing 0.5-1µg DNA, 3 units of restriction endonucleases,

corresponding buffer and SDW) was prepared. However, for the purpose of cloning, a

reaction mixture of 20μl for digestion was prepared and incubated at 370C (optimum

temperature) for 1-2 hours. Ethidium bromide stained agarose gel combined with a

suitably co-electrophoresed DNA marker was used to determine size of expected

DNA fragment(s) from the digestion mixture.

2.12 DNA Sequencing and Sequence Analysis Plasmids with the desired constructs were extracted using Pure YieldTM Plasmid

Miniprep System (Promega, USA) and sequenced commercially by Macrogen (Seoul,

South Korea) using the M13 Forward (-20) and M13 Reverse (-20) primers. The

complete begomoviruses of ~ 2.752 kb were sub-sequenced by designing specific

35

2 General Methods

internal primers based on the M13 Forward and M13 Reverse sequenced data. The

sequenced data was assembled and analysed using the Lasergene package of sequence

analysis software (DNAStar Inc., Madison, WI, USA). BLAST, a sequence similarity

search, was performed to compare the sequenced data to the already available

begomovirus sequences in the database (http://www.ncbi.nlm.nih.gov/BLAST/) and

using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), open reading frames

were located. The final sequences of viruses and their cognate betasatellites were

submitted to European Molecular Biology Laboratory (EMBL) sequence database.

Using ClustalX [243] and MegAlign program of the Lasergene package multiple

sequence alignments were performed. Based on the matrices of the aligned sequences

phylogenetic analysis were conducted using the Neighbor Joining and bootstrap

options.

2.13 Microbiological Techniques

2.13.1 Preparation of Heat-Shock Competent Escherichia coli Cells

The method described by Cohen et al. [244] was followed for the preparation of heat-

shock competent E. coli cells. A single colony from a freshly grown plate of E. coli

(Top 10) was picked with a sterile tooth pick, inoculated into 20 ml LB medium in a

50ml sterile flask and incubated overnight with vigorous shaking at 370C. The

following day 2ml of the overnight culture was taken and diluted up to 250ml in LB

media in 1 litre autoclaved flask and shaken vigorously at 370C until attaining an

OD600 of 0.5-1. After being ice-cold for 30 minutes, the culture was transferred

aseptically to sterile disposable 50ml propylene tubes and centrifuged at 4000rpm for

6-8 minutes at 40C to pellet down the cells. The pellet, after discarding the

supernatant, was re-suspended in 20ml of 0.1 M MgCl2and centrifuged again. The

Pellet was re-suspended but this time in 20ml of 0.1M CaCl2, incubated on ice for 30

minutes and centrifuged at 4000rpm. The pellet was re-suspended in an appropriate

amount of 0.1M CaCl2and filter-sterilized cold 30% (v/v) glycerol (200μl per 1ml of

CaCl2). The cells were stored in small aliquots of 100-150μl in 1.5 ml microfuge

tubes at -710C.

36

2 General Methods

2.13.2 Transformation of Heat-Shock Competent E. coli Cells

The method described by Sambrook et al. [245] was followed for the transformation

of competent E. coli cells. The ligation mixture (2-4µl) was added to ~ 100µl of the

thawed competent E. coli cells in 1.5ml microfuge tube, gently mixed and incubated

on ice for 30 minutes. After ice incubation the cells were heat-shocked at 420C on dry

bath/water bath for 2 minutes and then incubated again on ice for 2 minutes. Each of

the microfuge tube was added with 1ml of LB liquid medium and grown at 370C for 1

hour. The transformed cells were spread on solid LB media plates with an appropriate

antibiotic selection and put upside down at 370C in incubator overnight for ~ 16

hours.

2.14 Storage of Bacterial Cultures Glycerol stocks were prepared for the long term preservation of bacterial cultures. For

this purpose 300μl of filter sterilized glycerol was mixed with 700μl of bacterial cell

culture in an autoclaved microfuge tube and stored at -700C. To recover bacterial

culture from glycerol stocks small amount of culture was streaked on solid LB culture

plate, containing suitable antibiotic, with the help of a sterile wire loop and incubated

at suitable temperature for a proper period of time.

2.15 Agarose-Gel Electrophoresis DNA, mixed with loading dye (Fermentas), was analysed by electrophoresis in 1%

(w/v) agarose gels using 0.5X TAE buffer (40mM Tris-acetate and 1mM EDTA [pH

8.4]). Agarose was dissolved in TAE buffer by heating in microwave oven for ~ 2

minutes; ethidium bromide (0.5μg/mL) was added, cooled to ~ 550C and decanted

into casting tray with suitable combs. After getting solidified at room temperature, the

gel was transferred to gel tank with TAE buffer and the combs were removed

carefully. DNA, properly loaded into the wells, was resolved on the gel by applying ~

90-110 volts for a short period of 30-50 minutes. Ethidium bromide stained DNA

fragments were viewed and compared when co-electrophoresed with 1kbp of DNA

marker (Fermentas) under ultraviolet (UV) transilluminator (Eagle Eye-Stratagene).

37

2 General Methods

2.16 Southern Hybridization

2.16.1 Preparation of Probe

Digoxigenin labelled probes for DNA fragments were synthesized using the

instructions provided by DIG DNA labelling kit (Roche, Germany). A reaction

mixture of 25μl for each of the DIG and normal PCR was prepared. DIG PCR mixture

was comprised of 2.5μl (10-100pg in case of plasmid and 5-50ng in case of genomic

DNA) of the template DNA, 2.5μl of 10X Taq polymerase buffer with MgCl2

(Fermentas), 2.5μl of 2mM DIG dNTPs, 1μl (0.5μM) of each primer, 0.5-1μl of Taq

DNA polymerase provided with the kit and SDW to make up the volume. However,

the composition of normal PCR was the same (briefly discussed in section 2.8.2). The

reagents (for both DIG and normal PCR) were mixed and incubated in PCR machine

with an initial denaturation of 940C for 5 minutes followed by 32-35 cycles each with

a second denaturation at 940C for 30 seconds, primer annealing at 520C

(CLCV1/CLCV2) and 550C (Beta01/Beta02) for 30 seconds, extension of primer at

720C for 30 seconds (CLCV1/CLCV2) and 45 seconds (Beta01/Beta02), and a final

extension at 720C for ~ 10 minutes. Introduction of DIG dNTPs was confirmed by

loading both the DIG and normal PCR products on 1% ethidium bromide stained

agarose gel and comparing its size with 1kbp DNA marker under UV light

transilluminator. The DIG PCR product was transferred to a 1.5ml and stored at -200C

after adding 500µl of DIG Easy Hyb (Roche Applied Science, Germany) to it. When

needed the probe was denatured at 950C for five minutes and immediately cooled on

ice for two minutes and then added to the blot in the hybridization bottle having 10-

15ml of the fresh prehybridization solution depending on the concentration of the

probe.

2.16.2 Electrophoresis and Gel Treatment

Agarose gel (1.2% [w/v]) stained with ethidium bromide (discussed in detail in

section 2.16) was cast and DNA samples were loaded on to it. The samples were

electrophoresed at 50 volts in a 0.5X TAE buffer in the gel tank up for a period of ~

3-4 hours. The gel, after photographing under UV illumination in the gel

documentation instrument, was washed in ~ 500ml of the depurination solution

(0.25M HCl) for ~ 30 minutes or until the colour of the DNA loading dye changes to

yellow on a rocker platform in a gel tray. Following depurination the gel was treated

38

2 General Methods

with same amount of denaturation solution (1.5M NaCl and 0.5M NaOH) in a glass

tray and gently shaken for 30 minutes on a rocker platform changing the colour from

yellow to light blue again. The gel was washed twice with SDW (300ml each time)

and treated with 500ml of the neutralization buffer [1M Tris (pH 7.4) & 1.5M NaOH]

and again gently shaken for 30 minutes on a rocker platform. Finally the gel was

equilibrated in 10X SSC for 10minutes.

2.16.3 Blotting

The gel after treatment was laid on the paper wick facing upward after setting the

transfer apparatus (Figure 2.2) that contains ~ 300-500ml of 10X SSC (3M NaCl and

0.3M sodium citrate). Whatman 3MM paper wick was placed on a platform in such a

way that the ends were dipping well in the 10X SSC. The paper wick was wetted with

10X SSC and air bubbles were removed with the help of thermometer, gently rolled

over the gel. A piece of positively charged Hybond-N nylon membrane (Roche,

Germany) equal to size of the gel, wetted in 10X SSC, was laid over the gel avoiding

air bubbles. The top right corner of the membrane was marked with a pencil. A few

wet Whatman No. 3 filter papers equal to gel size followed by tissue papers were

placed on the top (Figure 2.2). A weight of ~ 0.5kg was placed on the top so that the

DNA from the gel is transferred to membrane by capillary action and left overnight.

After 12-18 hours the membrane was removed and the DNA was cross linked to the

membrane by exposing it to UV light in UV cross linker (CL-1000 Ultraviolet

Crosslinker-UVP) and immediately used for hybridization. In case of later use the

membrane was air dried and stored in a plastic bag at room temperature.

2.16.4 Hybridization and X-ray Film Development

The nylon membrane was placed inside a hybridization bottle with the help of sterile

forceps and prewarmed (550C) DIG Easy Hyb (Roche Applied Science, Germany)

was added to it and placed in the hybridization oven for 2-3 hours. The DIG labelled

probes were denatured in a boiling water bath at 950C for 5 minutes and cooled

immediately on ice for 5 minutes. DIG Easy Hyb solution was removed and fresh,

prewarmed (550C) DIG Easy Hyb solution (~ 8 to 13 ml) was added to the bottle. The

denatured probe was added to the hybridization bottle, mixed well gently and

incubated overnight at 55C for 12 to 15 hours in the hybridization oven on gentle

shaking. The probe was removed and the membrane was given stringency washes

39

2 General Methods

Figure 2-2 Assembly of southern hybridization to transfer DNA from agarose gel to nylon membrane by upward capillary action.

twice with each of the following prewarmed (550C) solutions, 2X SSC, 0.1% [w/v]

SDS, 1X SSC, 0.1% [w/v] SDS and 0.5X SSC, 0.1% [w/v] SDS, for 15 minutes each.

After the stringency washes the membrane was briefly rinsed with SDW and treated

with Blocking solution for 30 minutes at room temperature to block the nonspecific

blocking sites on the membrane. Then membrane was treated with the Antibody

solution (anti-digoxigenin-AP) for 30 minutes at room temperature in the

hybridization Oven. Then the membrane was twice washed with washing buffer

[(0.1M Maleic acid, 0.15M NaCl; pH 7.5 (+15 to +250C); 0.3% (v/v) Tween 20] for

12 minutes each in the hybridizer. Finally the membrane was treated with Detection

buffer (0.1M Tris-HCl, 0.1M NaCl, pH 9.5 (+15 to +250C) for 3 minutes in the

hybridizer at room temperature to adjust pH to 9.5. The membrane was removed from

the hybridization bottle and treated with DIG CDP-Star (Disodium 2-chloro-5-(4-

methoxyspiro (1, 2-dioxetane-3, 2-{(5'-chloro) tricyclo (3.3.1.1) decan}-4-yl] phenyl

phosphate). CDP-Star was prepared as ~ 5ml of detection buffer and 7µl of CDP-Star.

The blot was covered in the cling film and developed on the X-ray film in the dark

40

2 General Methods

room. Multiple exposures of the membrane on the X-ray films were taken to get good

and clear images.

41

CHAPTER 3 An analysis of the Resistance of Gossypium arboreum to Cotton Leaf Curl Disease (CLCuD) by

Grafting

3 An Analysis of the Resistance of Gossypium arboreum to Cotton Leaf Curl Disease (CLCuD)

by Grafting

3.1 Introduction Plants resistance against a disease has been categorized as non-host and host-plant

resistances [246]. Non-host resistance (NHR) happens when genetic polymorphism

for susceptibility has not been observed, all the available genotypes within a particular

species are resistant, against a particular virus [247]. NHR, exhibited by all genotypes

in a plant species against all known genetic variants of a non-adopted pathogen

species, is the most durable form of resistance in nature [248, 249]. Despite being

very promising in the field of agriculture and also for natural plant populations, NHR

has remained extensively unexploited and very much at the beginning to know about

the underlying mechanism of its resistance [250, 251].

The successful infection of a plant by pathogen needs a compatible interaction

between the two to induce the required physical and chemical signals differentiating

host-plant cells to express the genes involved in pathogenesis [252, 253]. To eradicate

non-host pathogens plants have developed refined mechanisms. The first line of

defence (passive defence mechanisms), preventing the entry of pathogen at the

preinvasive stage, include physical and chemical barriers in the form of cell wall,

plant antimicrobial surface enzymes and secondary metabolites [252]. Constitutive

barriers, also as the first line of defence, instead of contributing to NHR of related

plant species, are more likely to induce NHR against pathogens of other plant species

[254]. Inducible defences (active defence mechanisms), second line of defence, are

activated against the pathogen at the inner surface when the constitutive barriers are

breached by forming local papillae (cell wall apposition), rich in lignin, hydrogen

peroxide and callose.

How non-host resistance operates against viruses and other pathogens is very

diverse and still a mystery [255]. However plants exhibiting NHR against oomycetes,

42

3 Analysis of Resistance in G. arboreum by Grafting

fungi and bacteria have been divided into type I and type II non-host resistances.

Similarities have been reported between gene-for-gene and non-host resistance but

with no clear evidence that the underlying mechanisms between both of these two

responses are the same [255].

Type I Non-Host Resistance

Non-host resistance characterized by the absence of any visible symptoms of the

disease is called the type I which in comparison to Type II is dominating in nature

against most of the non-host pathogens [255]. Type I non-host resistance, ignored

mostly in the previous few years, has been reported in few cases only; exemplified by

the defence no death (dnd) mutant of Arabidopsis offering NHR, non-hypersensitive

response (HR) mediated resistance, against avirulent bacteria [256]. A non-host

pathogen cannot get through the first and second line of defence in non-host-plants

results in the complete arrest of penetration and ultimate multiplication of the

pathogen. The type I non-host-plants, inspite of enormous changes happening at the

molecular level, look normal. Arabidopsis, a non-host against Pseudomonas syringae

pv. phaseolicola, activates pathogenesis related (PR) genes without any visible

symptoms of the disease when challenged against that pathogen [257]. In addition to

the PR genes Arabidopsis plants challenged against P. syringae pv. Phaseolicola

produces an array of defence related genes [258].

Type II Non-Host Resistance

Type II response, producing HR with an immediate cell death, is one of the most

frequently debated phenomenon showing a phenotypically compatible interaction

with gene-for-gene interaction [255]. The HR in plants is activated when certain

pathogenic elicitors, also called avirulence (Avr) proteins, have been recognized in

the cytoplasms or cell memebranes of plants. However in case the Avr proteins are

not recognized it can result in an increased virulence of the pathogen in the target

plant species [259]. An activated HR will arrest further spread of infection from the

site of infection/inoculation to the neighboring cells to alleviate systemic infection in

plants. INF1 (an elicitor from Phytophthora Infestans), an extracellular protein,

produced by several quarantines of oomycets, P. infestans, produces an HR in N.

benthamiana, a non-host [260]. Type III secretion system (TTSS), encoded by hrp

gene of bacteria, induces HR in non-hosts by delivering pathogenic elicitors [261].

43


Species from both plants and pathogen will determine the type of non-host

response activated when challenged against a pathogen. In some cases a non-host-

plant will display type I non-host resistance against species of one pathogen and type

II response against species of another pathogen; exemplified by Nicotiana

benthamiana displaying type II non-host resistance against P. syringae pv. Tomato

and type I non-host resistance against Xanthomonas campestris pv. Campestris [262].

Pathogen, in a similar way, can also activate both type I and type II responses on

different plant species; exemplified by P. syringae pv. Phaseolicola that can activate

type II non-host resistance against tobacco and type I against Arabidopsis [257, 263].

Plants exhibiting RNA silencing against viruses can also be considered as a non-host

resistance [264].

RNA interference (RNAi), a homology based degradation phenomenon, is

triggered by double stranded RNAs (dsRNA). During viral infection cycle the self-

complementary full or partial viral RNA transcripts are diced by RNAse III enzymes

of dicer- like family (DCL) into 21 to 24nt long dsRNAs [265, 266]. These siRNAs,

recruited to an RNA-induced silencing complex (RISC), guide the sequence-specific

degradation of homologous viral RNAs [267]. The RNAi, termed “co-suppression”,

was discovered for the first time in plants [268].The mechanism of RNAi leading to

repression of transcription, termed transcriptional gene silencing (TGS;[269]), is akin

with methylation of the promoter sequences showing a change in chromatin structure

[269]. TGS, RNA directed DNA methylation (RdDM), leads to methylation of

cytosine residues in the target or endogenous gene sequence and repression of histone

modification, epigenetic changes ensuring the stability of genomes and silencing of

the target transgene [270]. RdDM pathway is mediated by three DNA-dependent

RNA polymerases; Pol II [271], Pol IV and Pol V [272]. In addition components like

DNA methyltransferases (MET1, CMT3 and DRM1⁄ 2), histone deacetylase HDA6,

histone methyltransferases KYP (SUVH4) and DRD1, chromatin-remodeling factor,

are also playing a decisive role in TGS [273]. The mechanism of RNAi leading to

RNA degradation or translational arrest is known as post transcriptional gene

silencing (PTGS). The phenomenon is also known as quelling in fungi and RNA

interference in animals [274], serving as a natural defence response in many

organisms [264, 286]. PTGS, triggered by dsRNA, results in a sequence-specific

44


degradation of mRNA. The small RNAs, produced from the cleavage of dsRNAs by

dicer- like enzymes, either cleave or repress the translation of the target RNAs [275].

CLCuD, a sporadic nuisance in the mid-1980s and as a first major problem

occurred in the vicinity of the city of Multan (Pakistan) in 1989, is caused by whitefly

(genus Begomovirus, family Geminiviridae; reviewed by Sattar et al. [72]) and rapidly

spread across most of Pakistan and north-western parts in India. The development of

CLCuD-resistant G. hirsutum lines in the late 1990s through conventional breeding

methods which overcame losses to the disease at most and unfortunate breakdown of

that resistance in Burewala (Pakistan) in 2001, caused by a single Cotton leaf curl

Burewala virus (CLCuBuV) species and a recombinant form of CLCuMuB [156,

276], has drawn the present study to investigate durable sources of CLCuD resistant

cotton germplasm.

G. arboreum, diploid in nature, is one of the four cotton species producing

spinnable fibres. G. arboreum, named tree cotton, is cultivated in Pakistan since 6000

B.C [277]. Owing to the well adaptive features, such as deep rooting system,

resistance to pests/diseases and presence of indehiscent bolls, G. arboreum is

reflected as the top source of introducing diversity to the Old World (OW) cotton

[278]. Isolation of different important genes from these species substantiates their

worth [279].

Recently Akhtar et al. [280] have provided the first evidence that mild CLCuD

symptoms can be induced in G. arboreum by graft inoculation using scions from G.

hirsutum plants infected with CLCuBuV. The study presented here has extended this

work to provide an initial analysis of the nature of the resistance of G. arboreum to

the begomoviruses causing CLCuD.

45


3.2 Materials and Methods

3.2.1 Origin of Germplasm and Field Evaluation of G. arboreum cv. Ravi

Seeds of G. hirsutum (CIM 496 and S-12) and G. arboreum (Ravi) were kindly

provided by the Nuclear Institute for Agriculture and Biology (NIAB, Faisalabad,

Pakistan). In May 2011 and 2012, 2000 seeds each of CIM 496 and Ravi were sown

in the fields of NIAB. No whitefly control procedures were applied, and plants were

screened weekly for the appearance of CLCuD symptoms.

3.2.2 Grafting and Maintenance of Plants

Grafting of cotton was conducted by the improved “bottle shoot” grafting technique

described by Akhtar et al. [281]. This grafting technique places the graft (scion) in a

tube of water, which is refreshed daily, to support the graft in the high temperatures

under which cotton is grown, until a graft union is established. Typically the tube of

water was removed at ~ 7–9 days after grafting. Scions for grafting were obtained

from severely infected, glasshouse-maintained CIM 496 plants that were inoculated

by whitefly transmission. Plants were grown in large earthenware pots in an insect-

free glasshouse with a daytime temperature of between 38 0C and 45 0C and a night-

time temperature of between 25 0C and 30 0C. Plants were watered daily and sprayed

with insecticide (Confidor, Bayer) at regular intervals.

3.2.3 Molecular Diagnostics

DNA was extracted from leaf samples using the CTAB method [235].Viruses and

betasatellites were detected in DNA extracts by PCR with primer pairs

CLCV1/CLCV2 (5′-CCGTGCTGCTGCCCCCATTGTCCGCGTCAC-3′/5′-

CTGCCACAACCATGGATTCA CGCACAGGG-3′) and Beta01/Beta02 [241],

respectively. For samples where PCR was not successful, circular DNA molecules

were first amplified by rolling circle amplification (RCA; [239]) and the resulting

concatameric product was used as a template for PCR (this procedure will henceforth

be referred to as RCA/PCR). RCA was performed according to the manufacturer’s

instructions (Fermentas).

46


3.2.4 Amplification, Cloning and Sequencing of Begomovirus Components

Circular DNA molecules in DNA samples extracted from plants were amplified by

rolling circle amplification (RCA; [239]) according to the manufacturer’s instructions

(Fermentas). Begomoviruses and betasatellites were amplified from RCA products by

polymerase chain reaction (PCR) using primer pairs Begomo-F/Begomo-R [242] and

Beta01/Beta02 [241], respectively. The PCR amplified products were purified and

cloned into the pTZ57R/T vector (Fermentas). The inserts of clones were sequenced

commercially (Macrogen, South Korea). Sequences were assembled using SeqMan,

part of the Lasergene sequence analysis package (DNAStar) and compared with

sequences available in the databases by BLAST analysis

(http://www.ncbi.nlm.nih.gov/BLAST/). The sequences were aligned and

phylogenetic dendrograms were constructed using the Geneious software (Geneious

version 7.1 created by Biomatters, http://www.geneious.com).

3.2.5 Southern Blot Hybridization

DNA samples extracted from plants were electrophoresed on 1 % (w/v) agarose gels,

blotted onto positively charged nylon membranes (Roche) and UV cross- linked.

Probes of virus fragment (coordinates 378– 1,474) and full length betasatellite were

PCR amplified using specific primers CLCV1/CLCV2 and Beta01/ Beta02 [241],

respectively, and labeled with digoxigenin (DIG) using a DIG DNA labelling kit

(Roche). Hybridization was performed at 55 0C for 12– 15h followed by high

stringency washing. Hybridization signals were detected on X-ray film after treatment

with CDP-Star (Roche).

47


3.3 Results

3.3.1 Field Evaluation of the Susceptibility of G. arboreum cv. Ravi to CLCuD

The susceptibility of G. hirsutum CIM 496 and G. arboreum Ravi to CLCuD was

assessed in the field in 2011 and 2012 (Figure 3.1a and b). For CIM 496 the first

symptoms of infection were evident 50 and 54 days after sowing in 2011 and 2012,

respectively, with ultimately 78.9% (1577 plants symptomatic out of 2000 sown) in

2011 and 89.5% (1789 plants symptomatic out of 2000 sown) in 2012 showing severe

symptoms of CLCuD. In contrast, none of the 4000 Ravi plants developed symptoms

over the 12 weeks of the study.

Southern blot hybridization of total DNA samples extracted from the field

samples of Ravi plants collected at various time intervals (2, 4, 6, 8, 10 and 12 weeks

after the appearance of first symptoms in CIM 496), probed for the presence of

begomoviruses and betasatellites, did not show the presence of either component; a

total of six blots were produced, an example is shown in Figure 3.7a. In contrast,

samples extracted from symptomatic CIM 496 plants showed hybridisation to both

the virus and betasatellite probes.

All PCR and RCA/PCR diagnostic amplifications with DNA extracted from

field collected Ravi plants were negative (600 plants examined by pooling samples

from 10 plants). In contrast, both PCR and RCA/PCR for all symptomatic CIM 496

samples (12 samples from single plants examined) yielded the expected DNA

fragments (~ 1100nt for virus and ~ 1350nt for betasatellite). All field collected, non-

symptomatic CIM 496 plants were negative by both PCR and RCA/PCR.

3.3.2 Double Graft-Inoculation of G. arboreum cv. Ravi

To determine whether the resistance of Ravi to CLCuD is due to an inability of the

begomovirus-complex to move systemically in this plant, we adopted a double graft

inoculation method. In this assay, a symptomatic CIM 496 scion (scion 1 in Figure

3.3a) was grafted onto a Ravi plant (the rootstock), followed by grafting of a healthy

CIM 496 scion (scion 2 in Figure 3.3a) above the initial graft 10-14 days later. The

ability of the viral complex to move systemically through the Ravi rootstock was then

indicated by the presence or absence of symptoms/virus in the second graft. Of the

48


two repetitions of 30 Ravi plants each, tested in this assay in 2011 and 2012, 22 and

27, respectively, developed CLCuD symptoms on scion 2. The first mild symptoms in

scion 2 were evident at ~ 25 days post-grafting of the second graft. These symptoms

were typical of the initial symptoms of CLCuD and consisted of mild leaf curling

(downward cupping) and small patches of vein darkening which progressed to form

enations. Symptoms became progressively more severe over the following two to

three weeks to become full CLCuD symptoms consisting of either upward or

downward leaf curling, leaf rolling, vein darkening, vein thickening and enations from

the undersides of the leaves. In contrast, none of the double grafted Ravi plants

showed visible symptoms of infection.

Figure 3-1 Field evaluation of the susceptibility of G. hirsutum CIM 496 (a) and G. arboreum Ravi (b) to cotton leaf curl disease (CLCuD). Note that there are no

symptoms of infection in the Ravi plants but the CIM 496 plants were showing severe infection characterised by leaf curling. Photographs were taken 3 months after

sowing.

Southern blot hybridisation of DNA samples extracted from non-scion tissue

(indicated as branches 1 and 2 in Figure 3.3a) of double grafted Ravi plants after

symptoms appeared on scion 2 (30 days after the appearance of symptoms) was

unable to detect either virus or betasatellite DNA, although both components were

readily detected in both of the scions, scion 1 and symptomatic scion 2, and field

collected infected CIM 496 (Figure 3.7b). Similarly, neither virus or betasatellite

DNA could be detected in samples extracted from non-scion tissue of grafted Ravi

plants or scion 2, at the time of attaching the second graft, by either PCR or

49


RCA/PCR (one sample each from the 30 Ravi plants and scion 2 were examined in

2011 and 2012, respectively). However, both components were readily detected by

PCR in the DNA samples extracted from the infected graft (scion 1). After the

appearance of symptoms on scion 2 (25 days after attachment of scion 2) both virus

and betasatellite could be detected in DNA samples extracted from Ravi leaves

between the two grafts (indicated as branch 1 in Figure 3.3a; 22 and 27 plant samples

examined in 2011 and 2012, respectively) and from leaves above the second graft

(indicated branch 2 in Figure 3.3a; 22 and 27 plant samples examined in 2011 and

2012 respectively) by RCA/PCR but not by PCR.

For the 8 and 3 Ravi plants (in 2011 and 2012, respectively) in which the CIM

496 second (healthy) scions did not develop symptoms of infection, removal of the

tube of water supporting the graft at 7 to 9 days after grafting resulted in death of the

grafted scions in 4 and 2 cases, respectively, indicating that no successful graft union

was established. For the remaining plants (4 in 2011 and 1 in 2012) RCA/PCR was

unable to detect either virus or betasatellite in the Ravi rootstock in tissues above the

first graft.

3.3.3 Single Graft-Inoculation of G. arboreum cv. Ravi

A total of 60 Ravi plants (30 each in 2011 and 2012) were graft- inoculated with single

scions from CIM 496 plants with severe CLCuD symptoms. Of these, 21 (70%) and

24 (80%), respectively, developed very mild symptoms of CLCuD which became

evident at ~ 26-28 days post-grafting respectively, with a late onset of the disease

compared to graft-inoculated CIM 496 control plants where the symptoms of the

disease started ~ 9-10 days post-grafting. The symptoms consisted of only a few

small, dispersed darkened and swollen primary and secondary veins but no such

deformity in tertiary veins (Figure 3.2a and b). These symptoms very much resemble

the initial symptoms of CLCuD in G. hirsutum. However, unlike G. hirsutum, the

symptoms in graft- inoculated Ravi did not progress further to yield the full symptoms

of CLCuD. Surprisingly, the symptoms in grafted Ravi initiated not on the youngest,

newly developing leaves but rather on the leaves that were developing at the time of

grafting on the branch immediately above the graft (branch 1 in Figure 3.3b), The

youngest newly developing leaves (at the time of appearance of first symptoms) on

50


Figure 3-2 Foliar symptoms of single graft-inoculated Ravi plants. The symptoms appeared as small, dispersed greening of veins (a) which developed into small areas of

vein swelling/enations (b).

the branches above this (indicated as branches 2 and 3 in Figure 3.3b) did not at any

time show symptoms and, after the first few leave with symptoms, no further growth

showed symptoms.

Southern blot analysis of DNA samples extracted from symptomatic leaves of

single graft- inoculated Ravi plants (35 days post-appearance of symptoms in Ravi

plants) showed weak hybridisation with both the virus and the betasatellite probes

(Figure 3.7c). The levels of hybridisation were significantly lower than those of both

infected, field collected CIM 496 plants and of the infected scion, indicative of very

low virus and betasatellite titres. These DNA forms are indicative of virus replication

in G. arboreum tissue. No hybridisation was detected in samples extracted from non-

symptomatic leaves of grafted Ravi plants (leaves developing after the appearance of

symptoms; indicated as branches 2 and 3 in Figure 3.3b) or in any of the control, non-

grafted Ravi plants.

PCR and RCA/PCR diagnostics for virus and betasatellite from DNA samples

extracted from young, upper leaves of Ravi plants prior to grafting were uniformly

negative (samples from all of the thirty plants each in 2011 and 2012, respectively,

were examined by both PCR and RCA/PCR). In contrast, PCR-mediated

51


amplification for both virus and betasatellite were positive for both the infected scions

(samples from all of the scions, thirty each in 2011 and 2012, respectively) and the

symptomatic leaves of grafted Ravi plants (indicated as branch 1 in Figure 3.3b;

samples from 21 and 24 plants, respectively, in 2011 and 2012). However, RCA/PCR

from young leaves of grafted Ravi plants developing after appearance of symptoms

(indicated as branches 2 and 3 in Figure 3.3 panel b) showed the presence of both

virus and betasatellite (in samples from all of the 21 and 24 symptomatic plants of

Ravi, respectively, in 2011 and 2012). Neither component was detected in these

samples by PCR. RCA/PCR diagnostic with samples extracted from healthy, non

graft- inoculated Ravi plants were uniformly negative.

For the 9 and 6 single grafted Ravi plants (in 2011 and 2012, respectively) that

did not develop symptoms, removal of tube of water supporting the grafts in 5 and 3

cases, respectively, resulted in wilting and death of the graft – indicating that no graft

union was established. For the remaining plants (4 in 2011 and 3 in 2012) RCA/PCR

was unable to detect either virus or betasatellite in leaves above the graft.

3.3.4 Identification of the Virus and Betasatellite Infecting G. hirsutum cv. CIM 496 and G. arboreum cv. Ravi Plants

Full- length clones of begomovirus and betasatellite were obtained from samples by

PCR-mediated amplification from RCA products using universal primers and were

sequenced in their entirety. A total of 4 begomovirus clones were obtained; 2 from

DNA samples extracted from infected G. hirsutum CIM 496 plants which were used

for grafting (acc nos. HF569171 in 2011 and HG428699 in 2012) and 2 from

symptomatic leaves (indicated as branch 1 in Figure 3.3b) of single graft- inoculated

G. arboreum Ravi plants (acc nos. HF569046 in 2011 and HG428698 in 2012).

Similarly 4 betasatellite clones were obtained, 2 from CIM 496 plants which were

used for grafting (acc nos. HF912232 in 2011 and HG428701 in 2012) and 2 from

symptomatic, graft- inoculated Ravi plants (acc nos.HF912231 in 2011 and HG428700

in 2012).

Comparison of the 4 virus sequences showed them to share 98.4 to 100%

identity and to have the highest levels of nucleotide sequence identity to isolates of

CLCuBuV available in the databases, with the highest (98.4 to 99.3%) to two isolates

of CLCuBuV (AM774303 and FR750320) originating from the Punjab, Pakistan.

52


Figure 3-3 Diagrammatic representations of double (a) and single graft (b) inoculations of G. arboreum Ravi plants with scions from infected G. hirsutum CIM

496 plants. In each case the G. arboreum Ravi rootstock and the infected/symptomatic G. hirsutum CIM 496 graft (scion 1) is shown. The tubes of water, used to prevent the graft wilting whilst a union was established, were removed at 7-9 days after grafting.

The branches indicated as 1 to 3 are discussed in the text.

These results show the virus which was inoculated to G. arboreum, and infecting this

species, to be CLCuBuV. All 4 isolates were shown to lack a full- length C2 gene, a

characteristic of CLCuBuV [156].

Phylogenetic analysis, based on the complete alignment of sequenced clones

with the selected sequences of CLCuD associated begomoviruses, showed their

segregation with different isolates of CLCuBuV followed by CLCuShV, CLCuKoV

and CLCuMuV, well supported by bootstrapping (Figure 3.4). The phylogenetic

dendrogram further confirmed that the begomovirus inoculated to G. arboreum Ravi

indeed was CLCuBuV.

The sequences of the 4 betasatellite clones showed 91.9 to 97.7% nucleotide

sequence identity to different clones of CLCuD associated betasatellite, CLCuMuB,

with the highest (91.9 to 97.3) being to 4 CLCuMuB clones (AJ316035, AM774307,

53


AM084379 and AM774306). A closer analysis of the sequences showed them to

contain the recombinant fragment, within the satellite conserved region, originating

from Tomato leaf curl betasatellite first identified by Amin et al. [276]. This

recombinant betasatellite first appeared in cotton in Pakistan after resistance breaking.

Phylogenetic analysis, based on the complete alignment of sequenced clones

with selected full length betasatellite sequences from the database showed their

segregation with CLCuD associated betasatellite, CLCuMuB, especially with

different isolates of the recombinant betasatellite prevalent in sub-continent (Figure

3.5).

3.3.5 Effects of Removal of Graft on Graft-Inoculated G. arboreum cv. Ravi Plants

The 21 and 24 of the mildly symptomatic plants of Ravi, from each of the 30 plants

grafted with infected scions from symptomatic CIM 496 plants in 2011 and 2012,

respectively, were chosen for further analysis. At ~ 26-28 days post appearance of the

first symptoms in those Ravi plants, the grafts were removed from 10 and 12 plants,

respectively. The remaining plants were maintained as controls. In most of the control

plants (8 and 9 plants of Ravi in 2011 and 2012, respectively), plants in which the

grafts were maintained, there was a slight increase in the severity of symptoms in the

symptomatic leaves over a period of 4 to 8 weeks (Figure 5b); specifically additional

areas of vein darkening/enations developed on already symptomatic leaves in

comparison to all of those graft-removed plants of Ravi. Further spread of symptoms

in all of the control Ravi plants from the initially symptomatic leaves into newly

developing leaves slightly above the first symptomatic leaves was observed compared

to all of the graft-removed plants of Ravi where no further spread of symptoms from

the initially symptomatic leaves into newly developing leaves was observed.

However, for one plant (in 2011) from which the graft was removed,

established symptoms on leaves became milder; specifically areas of vein darkening

and swelling disappeared at between 4 and 8 weeks after removal of the graft (Figure

5a). Both virus and betasatellite were detected in symptomatic Ravi leaves from

plants in which the graft was removed at 8 weeks after removal of the graft and plants

in which the graft was maintained by PCR (results not shown).

54


Figure 3-4 Phylogenetic dendrogram created using Geneious software (Geneious version 7.1 created by Biomatters, http://www.geneious.com) is based on the

alignment of selected complete genomes of OW begomoviruses and new isolates of CLCuBuV (identified in this study) from G. arboreum (Ravi, highlighted in light

green) and G. hirsutum (CIM 496, highlighted in pink) with isolate acronyms [282] and their allocated accession numbers. The statistics at nodes represents bootstrap scores in percentage (1000 replicates). The alignment is arbitrarily rooted on the DNA-A component of Tomato golden mosaic virus (TGMV), a distantly related

bipartite begomovirus from the New World (NW).

55


Figure 3-5 Phylogenetic analysis of Cotton leaf curl Multan betasatellites (CLCuMuB) isolated from G. arboreum (Ravi, highlighted in purple) and G. hirsutum

(CIM 496, highlighted in blue) with accession numbers. Using Geneious software (Geneious version 7.1 created by Biomatters, http://www.geneious.com) phylogenetic

dendrogram was produced based on the alignment of complete sequences of CLCuMB isolates mentioned above with available selected sequences of CLCuMB in

the database. The tree is arbitrarily rooted on a distantly related sequence of Cotton leaf curl Burewala alphasatellite (CLCuBuA). Comprehensive depiction with

acronyms and accession numbers are given for each of the sequence [283]. The numbers at nodes (1000 replicates) indicates the bootstrap confidence values in

percentages.

3.3.6 Back-Indexing of Graft-Inoculated Ravi Plants to G. hirsutum cv. S-12

The mildly symptomatic branches of (single) graft-inoculated Ravi plants were

grafted on G. hirsutum S-12 plants. Of the 20 plants grafted in 2011 and 30 plants

grafted in 2012, 15 and 26 plants, respectively, ultimately showed CLCuD symptoms.

Grafted plants showed the initial symptoms of CLCuD, consisting of dark spots on the

veins in the youngest newly developing leaves. The symptoms increased in severity

over the next 40 days to yield full CLCuD symptoms, consisting of upward or

downward leaf curling, thickening of the veins and enations on the veins on the

undersides of leaves that sometimes developed into leaf- like out growths. The

56


remaining grafted S-12 plants (5 in 2011 and 4 in 2012) did not develop any visible

symptoms and remained symptomless for the duration of the experiment (12 weeks

after grafting). Of the plants that did not develop symptoms, 3 and 1 in 2011 and

2012, respectively, the scions wilted and died when the tube of water was removed,

indicating that no graft union was established. In the remaining 5 plants, 2 and 3 in

2011 and 2012, respectively, the grafts survived but were non-symptomatic.

Additionally healthy/non graft-inoculated S-12 plants remained asymptomatic

throughout the experiment. Virus and betasatellite was detected in all symptomatic

grafted plants by both PCR and Southern blot hybridisation (results not shown).

However, all of the grafted non-symptomatic S-12 plants showed no amplification of

either virus or betasatellite following PCR and RCA/PCR.

Figure 3-6 Effects of the removal of the graft on the symptomatic leaves of single graft- inoculated G. arboreum Ravi plants. The leaf in the upper panel (a) was

photographed at the time of removal of the graft (left), 4 (middle) and 8 weeks (right) after removal of the graft. The photos in the lower panel (b) were taken at the same time but of a leaf of a plant on which the graft was maintained. The arrows denote

feature discussed in the text.

57


3.4 Discussion At this time no CLCuD-resistant G. hirsutum lines resulting from interspecific crosses

with G. arboreum have become available to farmers, and it remains unclear whether

this approach will be successful. One problem is that there is no information on the

nature of resistance of G. arboreum. The resistance would appear to be a generalized

resistance against all geminiviruses, not just the begomoviruses causing CLCuD,

since there are no reports in the literature of any geminivirus infecting this species.

The field evaluation of G. arboreum Ravi conducted here indicates that it is not

susceptible to CLCuD; consistent with numerous previous studies which have shown

that no varieties of G. arboreum are susceptible to the disease [284-288]. Situations

where all varieties of a species are resistant to a pathogen are commonly referred to as

“non-host resistance” [289].

Analysis of the sequences of virus and betasatellite clones obtained here

indicate that, in the area and the period that this study was conducted, the disease was

associated with only CLCuBuV and the recombinant CLCuMuBBur. This is consistent

with what is known about the present geographic distribution of viruses associated

with CLCuD – only CLCuBuV having been identified in cotton in the Punjab

province of Pakistan [156, 290]but other viruses also being identified in cotton in

Sindh province (Pakistan; [291]) and north-western parts in India [233, 234].

In the absence of a mechanism to introduce cloned viruses into G. arboreum,

such as Agrobacterium-mediated inoculation or biolistic inoculation, grafting

provides an efficient means of introducing virus without requiring a vector. The

bottle-graft method was used in this study to investigate the resistance of G. arboreum

to the viruses causing CLCuD. Some previous studies have grafted G. arboreum cv.

Ravi but reported no symptomatic response [287, 288]. There are two possible

reasons for the difference between these studies and the work reported here. The

earlier studies were conducted prior to resistance breaking (in G. hirsutum) and this

may indicate that G. arboreum responds differently to the earlier begomovirus-

complex than to CLCuBuV/CLCuMuB. Also the earlier studies used bud grafting,

which uses much less tissue for grafting than bottle grafting and possibly does not

deliver sufficient virus to the grafted plant to induce symptoms. Furthermore, the

earlier studies used only PCR and did not detect virus in Ravi.

58


The finding that by insect transmission in the field no G. arboreum plants

became symptomatically infected and no virus could be detected, yet by graft

inoculation mild symptoms were exhibited and virus could be detected, might suggest

that the resistance to CLCuD is due to a mechanism that affects the delivery of the

virus to the plant by the vector insect. Although the results obtained here cannot

entirely rule out this being the case, it is unlikely to be a major factor in the resistance

of G. arboreum to the CLCuBuV/CLCuMuB complex. However, a major difference

between graft inoculation and whitefly inoculation is in the amount of virus that is

delivered to the plant. Whiteflies deliver minute amounts of virus, and the delivery is

discontinuous and dispersed (each insect delivering virus at a different site); for the

monopartite begomovirus Tomato yellow leaf curl virus (TYLCV), single whiteflies

are estimate to harbour at most 1.6ng of virus [292] and only a tiny fraction of this is

likely to be delivered to plants during a feed. In contrast, graft inoculation delivers

more virus, and does so in a continual manner, once a graft union has been

established. The results presented here thus indicate that G. arboreum has a high

threshold level for establishment of (symptomatic) infection, higher than that of G.

hirsutum varieties. For several other virus-host systems, symptomatic infection has

been shown to be dose dependent [293, 294].

In G. arboreum both CLCuBuV and CLCuMuB DNA levels were low. In

symptomatic tissues the virus and betasatellite could be detected by Southern blot

hybridisation but were significantly lower than in symptomatic G. hirsutum. In non-

symptomatic G. arboreum tissues the components could only be detected by either

PCR or RCA/PCR – indicating that virus/betasatellite DNA levels were below the

threshold for detection by Southern hybridisation. Low virus/betasatellite levels can

indicate either low virus replication or fewer cells infected supporting virus

replication. Although the tissue specificity of CLCuBuV/CLCuMuB has not been

investigated, monopartite begomoviruses are generally phloem limited [80, 295].

Nevertheless, all viruses that use phloem long-distance movement must establish new

infection sites by exiting the phloem into companion cells and spreading into vascular

parenchyma (and beyond for non-phloem-limited viruses; [296]). The low virus levels

in G. arboreum could thus be due to either a resistance that interferes with virus

replication or that interferes with local spread of the virus, limiting the numbers of

cells infected. However, the results do show that G. arboreum can support

59


CLCuBuV/CLCuMuB replication since viral DNA forms indicative of geminivirus

replication were detected in tissues distal to the graft.

For G. hirsutum the betasatellite CLCuMuB has been shown to be essential for

efficient, symptomatic infection of begomoviruses causing CLCuD; in the absence of

the betasatellite the virus is poorly infectious, and does not induce typical symptoms

[53, 229]. Betasatellites encode a single protein, the βC1 protein, which is a dominant

symptom determinant [99, 100]. The βC1 of CLCuMuB has been shown to be capable

of inducing all the symptoms typical of CLCuD in tobacco when expressed from a

Potato virus X vector [297]. The symptoms of CLCuBuV/CLCuMuB infection in G.

arboreum are typical of early CLCuD symptoms in G. hirsutum and are more than

likely induced by CLCuMuB βC1. The analysis of Qazi et al. [297] showed βC1 to

induce cell proliferation and cell enlargement (hyper- and hypoplasia) immediately

adjacent to the vascular bundle.

The fact that the second, healthy, graft becomes infected and ultimately

develops full CLCuD symptoms indicates that the virus is able to move freely in the

phloem of G. arboreum. Many phytopathogenic viruses spread systemically in their

hosts using the phloem [296, 298]. This would seem to rule out a mechanism of

interference with long-distance spread in the phloem being involved in G. arboreum

resistance to the viruses causing CLCuD. However, the lack of visible symptoms on

double grafted G. arboreum plants (as opposed to single graft plants) is perplexing. A

possible explanation is that, in double grafted plants, the second, healthy graft acts as

sink for virus spreading in the phloem from the first graft, reducing virus titre in other

tissues to below the threshold for symptomatic infection.

Also perplexing is the apparent recovery from symptoms seen on the leaves of

a small number of symptomatic G. arboreum Ravi plants once the graft was removed.

Invariably geminivirus infected tissue does not revert to a healthy, non-symptomatic

state. In plants that do recover from infection, the initially symptomatic tissues

(leaves) remain symptomatic, but subsequent growth does not show symptoms.

Recovery phenomena have, in many cases, been shown to be due to RNA interference

[299-301]. This indicates that the plant can reverse some of the changes induced by

the begomovirus-complex, at least early during initiation of symptoms, and that a

continual supply of virus is required until symptoms are fully/irreversibly established.

60


In view of the importance of the betasatellite-encoded βC1 protein, it is tempting to

suggest that it is the supply of βC1 that is required.

Figure 3-7 Southern blot hybridization of DNAs samples extracted from the leaves of cotton plants probed for the presence of Cotton leaf curl Burewala virus (CLCuBuV,

left blot in each case) and Cotton leaf curl Multan betasatellite (CLCuMuB, right blot). (a) Analysis of field grown G. hirsutum CIM 496 and G. arboreum Ravi plants.

The DNA samples electrophoresed in lanes 3 to 8 were extracted from Ravi plants two, four, six, eight, ten and twelve weeks after the first appearance of cotton leaf curl

disease (CLCuD) symptoms in CIM 496, respectively. The sample in lane 1 was extracted from an infected (symptomatic) CIM 496 plant, whereas the sample in lane

2 was extracted from a non-symptomatic CIM 496 plant. (b) Analysis of double grafted Ravi plants. The samples were extracted from scion 1 (infected CIM 496

61


scion; lane 1), healthy/non graft- inoculated Ravi plant (lane 2), leaves of Ravi between the two grafts collected 30 days after the first appearance of symptoms in the

second graft (scion 2; lanes 3 and 6), leaves of Ravi above the second graft were collected 30 days after the first appearance of symptoms in the second graft (lanes 4 and 7) and scion 2 after appearance of symptoms (lane 8). A sample extracted from a symptomatic, field- infected CIM 496 plant was run as a control (lane 5). (c) Analysis of the single grafted Ravi plants. The samples were extracted from the graft (infected

CIM 496 scion; lane 1), healthy non graft- inoculated plants of Ravi (lane 2), symptomatic leaves of single graft- inoculated plants of Ravi collected 35 days post-

appearance of the first symptoms of the disease (lane 3 and 5), non-symptomatic leaves of single graft- inoculated plants of Ravi collected 35 days post-appearance of

the initial symptoms of the disease (lane 4 and 6). A sample extracted from a symptomatic, field infected CIM 496 was run as a control (lane 7). Approximately 10 µg of DNA was loaded in each case with a photograph of the genomic DNA bands on

the ethidium bromide stained agarose gel shown below each blot to confirm equal loading. The virus and satellite DNA forms are labelled as open-circular (oc), super-

coiled (sc) and single-stranded (ss).

The resistance of G. arboreum to CLCuBuV/CLCuMuB shows many

similarities to the resistance of tomato varieties carrying the Ty-1 resistance gene

against the monopartite begomovirus TYLCV. In both cases the resistance does not

provide immunity, but reduces virus levels in plants, and is not associated with a

hypersensitive response (HR; [302]). Recently Ty-1 has been shown to encode an

RNA-dependent RNA polymerase which is likely involved in RNAi [303]. RNAi is a

conserved eukaryotic gene regulation mechanism that plays a part in protecting plants

from pathogens [304].

Although it is tempting to speculate that the resistance of G. arboreum is due

to RNAi, which the suppressors of gene silencing encoded by the begomovirus-

complex [82] are unable to effectively counter, the results do not rule out the possible

involvement of other resistance mechanisms including resistance (R) gene-mediated

resistance [305, 306]. However, R gene-mediated resistance tends to be virus species,

or even strain, specific, whereas the resistance of G. arboreum appears to be against a

whole family of viruses. Furthermore, when they are not sufficient to completely stop

viral spread R genes tend to induce a spreading HR phenotype [307], which was not

apparent in infected G. arboreum. Alternatively the resistance could be mediated by

other host-encoded proteins. The resistance of certain Arabidopsis thaliana ecotypes

to various potexviruses has been shown to be due to lectin proteins (JAX1; [308])

whereas Tm-1 provides resistance against the tobamovirus Tomato mosaic virus in

tomato [309]. Both these resistances interfere with virus replication.

62


The results obtained here show that resistance of G. arboreum to CLCuD,

likely does not involve a mechanism that interferes with virus inoculation to the plant

by the insect vector, or virus long-distance spread in the phloem. Instead the

resistance would appear to interfere either with virus replication or with local cell- to-

cell movement of virus. Evidently G. arboreum has a higher threshold for infection

than G. hirsutum, requiring a higher virus titre (inoculum) to achieve symptomatic

infection; a threshold that whitefly-mediated virus inoculation is unable to cross and

unable to maintain. Identifying the mechanism(s) for these responses will be the

subject of future studies.

63

CHAPTER 4 Analysis of Host-plant

Resistance in French Imported Gossypium hirsutum Lines,

Dominique and Haiti, Against Cotton Leaf Curl Disease

(CLCuD) by Grafting

4 Analysis of Host-plant Resistance in French Imported Gossypium hirsutum Lines, Dominique

and Haiti, Against Cotton Leaf Curl Disease (CLCuD) by Grafting

4.1 Introduction Genetic resistance including the control of vectors, use of virus-free seeds and cultural

practices is amongst a number of approaches used for the protection of crops against

viral infections [310]. Resistant crops varieties, with proved, useable, appropriate

ranges of durable resistances if available, are still the most reliable and cost-effective

choices to control losses to agriculturally important crops.

Plants species are continuously under threats by various pathogens in the

fields and protect themselves by displaying resistance. The resistance can be

categorised into host-plant resistance (HPR) and non-host resistance (NHR) based on

the plant response to the invading pathogen. HPR, easily approached genetically,

termed genotypic resistance, specific resistance, or cultivar resistance [246], happens

when the same gene pool is exhibiting genetic polymorphism for susceptibility, some

of the genotypes are resistant while the others are susceptible, to a particular virus

[247]. The virus is either not replicating at all or replicate to some extent with

localized or masked symptoms in resistant genotypes compared to the susceptible

ones [247]. The work done earlier by Ali [311]to study HPR proposed that a single

dominant R gene control the resistance of G. hirsutum to CLCuD. Later on Rahman et

al. [288] proposed a three gene model including the involvement of suppressor gene

in resistance against CLCuD.

Resistance to the disease and to the pathogen needs to be clearly delineated. In

case of resistance to the disease the virus/pathogen either does not produce phenotypic

symptoms or produce localized symptoms (not evident at most). The virus though,

may or may not replicate, moves systemically in a manner looks restricted in

comparison to its movement in susceptible hosts [247]. The response is highly

64

4 Analysis of Resistance in Dominique and Haiti by Grafting

predominant in nature and used in some crops to a substantial benefit; for example,

the resistance in cucumber against Cucumber mosaic virus (CMV; [312, 313]).

However host-plants exhibiting resistance to the pathogen ultimately results in

resistance to the disease [247]. In some cases this response can be very severe or even

deadly, for example, the response of I gene and N gene against Bean common mosaic

virus (BCMV) and Tobacco mosaic virus (TMV) in Phaseolus vulgaris and tobacco

[293, 314], respectively.

Whitefly, Bemisia tabaci (Gennadius) Biotype B, has gradually increased and

is an important pest in major cotton growing countries [315]. Whitefly is resistant to

neonicotinoid [316], pyrethroids [316, 317] and organophosphates [318, 319] so it is

very difficult to control whiteflies. Growth regulators like pyriproxifen, diafenthiuron

and the most recently used spirotetramat [315] are heavily used for the control of

whiteflies in Australia but with an emerging risk of selecting for resistant spider mites

and cotton aphids as the latter two are used for controlling other insect pests also.

Host-plants resistance is one of the key prerequisites in cotton plants against

whitefly (carrier of the disease) and ultimately cotton leaf curl disease (CLCuD)

aiming to either reduce or completely eradicate the use of hazardous pesticides.

Constitutive, (plant morphology and biochemical components) permanently present

depending on the phenotype and growth conditions, and induced defence responses,

changes initiated in host-plants following a pathogen attack to be immune to further

attack [320],are the two broad sub-categories of host-plant resistance. Compounds

like tannins, flavonols, sugars, gossypol and phenols as constitutive biochemical

defences have also been reported to halt the population of whiteflies [321, 322].

Induced host-plant responses to whiteflies and phloem feeding species in general,

with limited host damage instead of the sustained presence, have not been studied

extensively [323]. Nevertheless, Kempema et al. [324] and Zarate et al. [325], with no

reports in cotton as yet, has reported whitefly infestation induced salicylic acid in

Arabidopsis thaliana.

Keeping an eye on the highly susceptible nature of upland cotton, G. hirsutum,

continuously threatened by CLCuD, efforts were made and still going on to find out

environment friendly and long- lasting sources of resistance. Two imported French

lines (Dominique [AS0039] and Haiti [AS0099], the wild relatives of G. hirsutum),

65


found naturally resistant to CLCuD in the field (Khalid Pervez Akhtar, unpublished

reports and personal observations), can be the potent sources of resistance to improve

the cultivars of G. hirsutum.

The work presented here is envisioned to explore the nature of resistance,

level of resistance, identity of begomovirus-complex and behaviour of infection

during grafting, graft removal and back- indexing assay, offered by both Dominique

and Haiti plants against CLCuD causing begomoviruses.

66



4.2.1 Grafting in Dominique and Haiti, and Maintenance of Plants

The improved “bottle shoot” grafting technique [281] was used to carry out grafting

in Dominique [AS0039] and Haiti [AS0099]. Details of the procedure are provided in

chapter 3 (section 3.2.2). The scions for grafting were obtained from severely

infected, glasshouse-maintained CIM 496 plants that were inoculated by whitefly

transmission. The plants were maintained in insect-proof greenhouse under the same

conditions detailed in Chapter 3 (section 3.2.2) following grafting.

4.2.2 Whitefly Transmission Assay in Dominique and Haiti

Non-viruliferous adult whiteflies were nurtured on greenhouse maintained accession

of G. arboreum (Ravi). These adult whiteflies were allowed an ~ 72 hours (h)

acquisition access period (AAP) on G. hirsutum (CIM 496) severely infected with

Cotton leaf curl Burewala virus (CLCuBuV)/CLCuMuB-complex (HF569171 and

HF912232, chapter 3, section 3.3.4). Following the AAP the whiteflies were

immediately transferred onto ~ 4-5 weeks old Dominique, Haiti and control plants

(glass-house maintained healthy CIM 496 plants) with an inoculation access period

(IAP) for 72h. Fifteen plants of each type were used for whitefly infestation. The

number of whiteflies varied using 50, 100 and 150 viruliferous whiteflies per plant

(five plants each of each type were caged with 50, 100 and 150 whiteflies). Following

the IAP for 72 H the whiteflies were slayed using Confidor (an insecticide, Bayer)

and the plants were shifted to insect free greenhouse.

4.2.3 Molecular Diagnostics in Dominique and Haiti

Molecular diagnostics for the presence of virus and betasatellite was performed in a

similar way described in Chapter 3 (section 3.2) using primer pairs CLCV1/CLCV2

[240] and Beta01/Beta02 [241].

4.2.4 Amplification, Cloning and Sequencing of Begomovirus Components from Dominique and Haiti

Amplification, cloning and sequencing of begomoviruses and their cognate

betasatellites was performed as described in Chapter 3 (section 3.3).

67


4.2.5 Southern Blot Hybridization in Dominique and Haiti

Southern blot hybridization was also performed as described in Chapter 3 (section

3.3) using the same probes for begomovirus and betasatellite.

68


4.3 Results

4.3.1 Analysis of the Susceptible Nature of Dominique and Haiti by Whitefly Transmission Assay

The French lines (Dominique [AS0039] and Haiti [AS0099]) along with CIM 496, as

a positive control, were observed for the appearance of CLCuD daily. The symptoms

of CLCuD initiated in all of the CIM 496 plants (12 plants) at ~ 10-14 days post

inoculation in the form of minor vein thickening. However, no such signs of the

disease were observed in any plant of Dominique and Haiti at the specified period of

time. The plants were observed for ~ 3 months following IAP. Excluding all of the 12

CIM 496 plants, showing full blown symptoms of CLCuD, characterized by leaf

rolling (both upward and downward), vein thickening and plants stunting (results not

shown), no such or even mild symptoms of the disease were observed in any plant of

either Dominique or Haiti throughout till the end of the experiment (3 months post-

IAP). The experiment was repeated twice in 2011 and 2012 using the same number of

plants but each time with similar results.

Diagnostic PCR and most sensitive RCA/PCR was carried out from all 15

plants of the Dominique and Haiti using Beta01/Beta02 [241] and CLCV1/CLCV2

[240] primer pairs to yield expected products (~1355nt for betasatellite and ~1100nt

for virus) if there is any at 15, 30 and 60 days post inoculation. All 12 plants of CIM

496 yielded the expected products for both begomovirus and betasatellite with

diagnostic PCR without even needed for enrichment of the begomovirus-complex by

RCA. However, none of the 15 plants each of Dominique and Haiti yielded the

expected products with either direct PCR or indirect PCR following an initial

enrichment of the circular begomoviral and betasatellite components in those DNA

samples by RCA, termed RCA/PCR, at each time interval the plants were tested.

4.3.2 Graft-Inoculation of Dominique and Haiti

Unlike G. arboreum Ravi where both single and double graft inoculation procedures

were followed, single graft inoculation procedure was used for both Dominique and

Haiti to investigate the behaviour of begomovirus and its cognate betasatellite. Forty

plants each of Dominique and Haiti (20 each in the years 2011 and 2012) were graft-

inoculated with scions from CIM 496 plants with severe symptoms CLCuD. Of these,

69


15 (75%) and 17 (85%) plants of Dominique and 13 (65%) and 16 (80%) plants of

Haiti, in 2011 and 2012, respectively, developed mild symptoms of CLCuD. The first

symptoms of infection became evident at ~ 25 days post-grafting in Dominique and

almost at the same time, 26-27 days post-grafting in Haiti, respectively, with a late

onset of the disease compared to graft- inoculated CIM 496 control plants where the

symptoms of the disease started ~ 9-10 days post-grafting, just like in G. arboreum

Ravi. However, unlike G. arboreum Ravi where only the primary and secondary veins

were showing mild symptoms, swelling and thickening, ‘‘besides primary and

secondary veins’’, were also seen in the tertiary veins of both Dominique and Haiti

plants (Figure 4.1). The disease initiated in almost a similar fashion, as slight vein

thickening and darkening, in both of the graft-inoculated French lines, Dominique and

Haiti, and CIM 496 plants. However, unlike the graft- inoculated CIM 496 plants

where the symptoms developed uniformly yielding full blown symptoms of CLCuD,

the symptoms in these wild genotypes, just like G. arboreum Ravi, did not yield full

blown symptoms of the disease (results not shown).

Figure 4-1 Foliar symptoms of graft- inoculated Dominique and Haiti plants. The symptoms appeared as pronounced thickening and darkening of primary, secondary

and tertiary veins in both Dominique (a) and Haiti (b).

Symptoms initiated on the leaves that were developing at the time of grafting

on the branch immediately above the graft (branch 1 in Figure 4.2) as well as on

leaves on the branches away from the graft (branch 2 and 3 in Figure 4.2) with the

passage of time. The top most leaves in all of the graft- inoculated plants of

70


Dominique and Haiti, just like in Ravi, remained symptomless (indicated as branch 4

in Figure 4.2).

Southern blot analysis of DNA samples extracted from symptomatic leaves

(indicated as branch 1, 2 and 3 in Figure 4.2) of graft- inoculated Dominique and Haiti

plants (30 days post-appearance of symptoms in Dominique and Haiti plants) just like

Ravi plants showed weak hybridisation signals with both virus and betasatellite

specific probes (Figure 4.5). The levels of hybridisation in those French lines,

Dominique and Haiti, were significantly lower than those of both infected, field

collected CIM 496 plants and of the infected scions, suggestive of very low virus and

betasatellite titres. Replicative forms of DNA, suggestive of virus replication, were

seen in both of those French lines. Hybridisation signals were not detected in samples

extracted from non-symptomatic leaves of graft- inoculated Dominique and Haiti

plants (the uppermost leaves; indicated as branch 4 in Figure 4.2) or in any of the

control, non-grafted Dominique and Haiti plants.

Prior to grafting DNA samples extracted from leaves of each of the

Dominique and Haiti plants were found uniformly negative for the presence of virus

and betasatellite by PCR and RCA/PCR diagnostics (samples from all of the 20 plants

each of Dominique and Haiti in 2011 and 2012, respectively, were tested by PCR and

RCA/PCR). However, both of the infected scions (DNA samples from all of the

scions, 20 each from Dominique and Haiti, in 2011 and 2012, respectively prior to

and after grafting) and the symptomatic leaves of Dominique and Haiti plants after

grafting (labeled as branches 1, 2 and 3 in Figure 4.2; samples from 15 and 17, and 13

and 16 plants of Dominique and Haiti in 2011 and 2012, respectively) were found

positive for the presence of virus and betasatellite by the above mentioned diagnostic

technique. Only RCA/PCR from uppermost leaves of grafted Dominique (samples

from 15 and 17 plants in 2011 and 2012, respectively) and Haiti (samples from 13 and

16 plants in 2011 and 2012, respectively) plants (indicated as branch 4 in Figure 4.2)

showed the presence of both virus and betasatellite. While the direct PCR without

being first enriched by RCA was not successful in detecting virus and betasatellite in

any single DNA sample from the uppermost leaves (branch 4 in Figure 4.2) of above

mentioned plants. RCA/PCR diagnostic with samples extracted from healthy, non

grafted Dominique and Haiti plants were also uniformly negative.

71


The remaining 5 and 3, and 7 and 4 of the grafted Dominique and Haiti plants

in the years 2011 and 2012, respectively, were unable to develop symptoms of the

disease. Of these 3 and 2, and 5 and 1 plants of Dominique and Haiti, respectively, in

the following two years, were unable to develop a successful union with their

respective grafts (infected scions of CIM 496). The tubes of water, supporting the

Figure 4-2 Diagrammatic representation of graft- inoculation in Dominique and Haiti (rootstock) using scion from infected G. hirsutum CIM 496 plants. The rootstock

(representing both Dominique and Haiti) and the infected/symptomatic scion from G. hirsutum CIM 496 is shown. The tube of water, used to prevent the graft wilting

whilst a union was established, was removed at 7-9 days after grafting. The branches indicated as 1 to 4, are discussed in the text.

72


grafts in these plants just like the rest of the successfully grafted plants, when

removed resulted in wilting and ultimate death of the grafts in these plants showing an

unsuccessful union between the plant and graft. RCA/PCR diagnostic with samples

from the rest of Dominique and Haiti plants (2 and 1 of Dominique and 2 and 3 of

Haiti plants in the years 2011 and 2012, respectively) were found negative for both

virus and betasatellite with the reasons very much unknown.

4.3.3 Identification of the Begomovirus-Complex in Dominique, Haiti and their Respective Scions/CIM 496

Begomoviruses and their cognate betasatellites were amplified by PCR using

universal primer pairs Begomo-F/Begomo-R [242] and Beta01/Beta02 [241],

respectively, and cloned. A total of 8 begomovirus clones, sequenced in their entirety,

were obtained; 4 from DNA samples extracted from infected G. hirsutum CIM 496

plants which were used as scions for grafting (acc nos. HF952157 and HG428705 in

2011, and LK995396 and LK995397 in 2012) and 4 from symptomatic leaves of

graft- inoculated Dominique and Haiti plants used as the rootstocks (acc nos.

HF952154 and HG428704 from Dominique, and acc nos. HF952155 and HG428706

from Haiti, in 2011 and 2012, respectively).

When nucleotide sequences of all 8 full length viral clones were compared

they showed 99 to 100% nucleotide sequence identity. These clones showed the

highest level of nucleotide sequence identity to different isolates of CLCuBuV

available in the databases, with the highest (99.4%) to an isolate of CLCuBuV

(AM774303) originating from Punjab, Pakistan and lowest (95.7%) to an isolate

(JF502353) originating from Fazilka, India . All isolates when analysed using ORF

finder (results not shown) showed a lack of full- length C2 gene, just like the case in

G. arboreum Ravi where all the sequenced isolates were also lacking the full length

C2 gene, which is a distinguishing feature of CLCuBuV, a resistance breaking strain

[156]. These results confirmed that the begomovirus graft- inoculated to Dominique

and Haiti which induced mild symptoms of CLCuD in these species was CLCuBuV.

Phylogenetic analysis, based on the complete sequence alignment of

begomovirus clones with the selected sequences of CLCuD causing monopartite

begomoviruses, showed their segregation with different isolates of CLCuBuV

followed by CLCuShV, CLCuKoV and CLCuMuV, well supported by bootstrapping

73


(Figure 4.4). These results confirmed the identity of begomovirus species in mild

symptomatic plants of both Dominique and Haiti to be isolates of CLCuBuV.

Figure 4-3 Phylogenetic dendrogram created using Geneious software (Geneious version 7.1 by Biomatters, http://www.geneious.com) is based on the alignment of selected complete genomes of Old World (OW) begomoviruses and new isolates of

CLCuBuV from French lines (Dominique and Haiti, highlighted in light gray colour) and G. hirsutum (CIM 496, highlighted in orange colour) with isolate acronyms [282]

and their accession numbers. The statistics at nodes represents bootstrap scores in percentage (1000 replicates). The alignment is arbitrarily rooted on the DNA-A

component of Tomato mottle virus (ToMoV), a distantly related bipartite begomovirus from the New World (NW).

Similarly 8 betasatellite clones, sequenced in their entirety, were also

obtained; 4 from CIM 496 plants which were used as scions for grafting on French

lines (acc nos. HF952156 and LK995398, and HG428707 and LK995399 in 2011 and

2012, respectively) and 4 from symptomatic leaves of graft- inoculated French lines,

Dominique and Haiti (acc nos.HF952152 and HG428703, and HF952153 and

HG428702 in 2011and 2012, respectively).

74


Sequence comparison of those betasatellite clones showed 92.5 to 100%

nucleotide sequence identity with each other. These clones showed very high

sequence identity to different clones of betasatellite associated with CLCuD,

CLCuMuB. The 2 betasatellite specific clones isolated from CIM 496 (acc nos.

HG428707 and LK995399, scions on Haiti) had the highest level of nucleotide

sequence identity (99.9%) to clones AM712314, AM712311, AM712315 and

FN432359 from Punjab, Pakistan and lowest (89.3 %) to clone GQ259599 from Siri-

Ganganagr, India. However the rest of the 6 betasatellite clones, 2 each from

Dominique, Haiti and CIM 496 (scions on Dominique), had the highest level of

nucleotide sequence identity (99%) to an isolate AM774309 from Punjab, Pakistan

and lowest (89.2%) to an isolate HM461864 from Bihar, India.

Phylogenetic analysis, based on the complete alignment of betasatellite clones

with selected full length betasatellite sequences from the database, showed their

segregation with CLCuD associated betasatellite, CLCuMuB (Figure 4.5), further

confirmed the presence of CLCuMuB in both of the scions/grafts (clones from CIM

496) and rootstocks (clones from Dominique and Haiti).

4.3.4 Effects of Removal of Grafts on Graft-Inoculated Dominique and Haiti Plants

The mildly symptomatic plants of Dominique and Haiti like Ravi were also chosen

for further analysis of the infection. The analysis was carried out with the 15 and 17,

and the 13 and 16 of the mildly symptomatic plants of Dominique and Haiti in the

years 2011 and 2012, respectively. At ~ 5-10 days post-appearance of the initial

symptoms of the disease the grafts were removed from 7 and 8, and 6 and 7 of the

Dominique and Haiti plants, respectively. The remaining plants, 8 and 9, and 7 and 9,

respectively, were maintained as controls for comparison. A systemic spread of the

disease from the initial point of infection to the next leaves was observed in all of the

controls, Dominique and Haiti plants, just like Ravi, in which the grafts were upheld

over a period of almost two months (8 weeks). However, in the controls of Ravi the

disease was spreading only to few leaves slightly above the initial point of infection

but here the disease was spreading even farther away from the initial point of

infection (indicated as branches 2 and 3 in Figure 4.2). The newly emerging leaves at

75


Figure 4-4 Phylogenetic analysis of Cotton leaf curl Multan betasatellites (CLCuMuB) isolated from French lines (Dominique and Haiti, highlighted in leaf

green) and G. hirsutum (CIM 496, highlighted in yellow) with accession numbers by using Geneious software (Geneious version 7.1 created by Biomatters,

http://www.geneious.com). Phylogenetic dendrogram was created based on the alignment of complete sequences of CLCuMuB isolates mentioned above with

available selected sequences of CLCuMuB in the database. The tree is arbitrarily rooted on a distantly related sequence of an alphasatellite (symptomless alphasatellite from G. darwini). Comprehensive depiction with acronyms and accession numbers are given for each of the sequence [283]. The numbers at nodes (1000 replicates)

indicates the bootstrap confidence values in percentages.

the top (indicated as branch 4 in Figure 4.2) in all of the controls, Dominique and

Haiti, remained symptomless, just like the case in Ravi plants. On the other hand the

systemic spread of symptoms of the disease from the initial point of infection to the

newly emerging leaves was restrained in all of the graft removed plants of Dominique

and Haiti, but it was not exactly like the case as in G. arboreum cv. Ravi. In both of

76


these French lines with the removal of grafts the systemic spread of disease symptoms

was seen in some leaves on branch 2 only, but not in the leaves on branch 3 and 4,

following the initial point of infection (branch 1 in Figure 4.2, at the time of removing

the grafts) which were very mild in comparison to the control plants where the grafts

were upheld (results not shown). However, in case of G. arboreum cv. Ravi with the

removal of grafts systemic spread of the disease to the next leaves following the initial

point of infection was completely arrested in comparison to their control plants. The

symptomatic leaves, those before the removal of grafts and those that became very

mildly symptomatic after the removal of grafts at branch 2 only in both cases,

remained symptomatic in all of graft removed Dominique and Haiti plants over a

period of almost two months (8 weeks) and no single graft removed plant in both of

the genotypes was found where the already established symptoms became milder

unlike the case in G. arboreum Ravi. Both virus and betasatellite was detected in

symptomatic leaves of all graft removed and graft-maintained plants of Dominique

and Haiti by direct PCR using CLCV1/CLCV2 [240] and Beta01/Beta02 [241],

respectively, tested at the end of the experiment (8 weeks post-graft removal).

4.3.5 Back Indexing of Graft-Inoculated Dominique and Haiti Plants onto G. hirsutum cv. Coker

In this experiment the mildly symptomatic branches from graft-inoculated Dominique

and Haiti plants were grafted on G. hirsutum cv. Coker plants. Back indexing was

done by selecting 10 each plants of Coker for both Dominique and Haiti in the year

2011 and also in 2012. Of the 10 each plants of Coker, graft-inoculated with mild

symptomatic branches of Dominique and Haiti (used as scions) in 2011 and 2012, 6

and 8, and 7 and 8 plants, respectively, showed symptoms of CLCuD~ 15-17 days

post-grafting. The symptoms were initiated as mild vein thickening and darkening in

the newly emerging leaves. The symptoms became severe over the next ~ 45 days

post-grafting developing full blown symptoms of CLCuD, characterised by curling of

the leaves, both upward and downward, enhanced vein thickening and enations on the

veins on the underside of the leaves (results not shown). The remaining graft-

inoculated Coker plants (7 in 2011 and 4 in 2012) did not develop any visible

symptoms of CLCuD and remained symptomless throughout the experiment (~ 10

weeks). Wilting of scions was observed, when the tubes of water supporting the grafts

were removed, in 4 and 2 of these plants in the years 2011 and 2012, respectively,

77


showing that no successful graft union was established in these plants. The remaining

graft- inoculated Coker plants (3 and 2 in the years 2011 and 2012, respectively), in

spite of developing a successful graft union, remained symptomless with the reasons

very much unknown throughout the experiment. Similarly the healthy/non graft-

inoculated Coker plants also remained asymptomatic throughout the experiment. All

the symptomatic graft- inoculated plants of Coker were found positive for the presence

of virus and betasatellite each time they were tested throughout the experiment.

However, all of the healthy/non graft- inoculated along with graft- inoculated non-

symptomatic Coker plants showed no amplification of virus and betasatellite

following direct PCR as well as RCA/PCR.

78


4.4 Discussion Up until now no single accession resistant to CLCuBuV, resistance breaking strain,

have been identified in cultivated upland cotton species of G. hirsutum [72]. Cotton

being a major foreign exchange earning crop in India and, most prominently, in

Pakistan is under severe stress of CLCuD. It is feared that the disease could spread to

areas where, at present, it does not occur [72]; as obvious from the recent incidence of

the disease from China showing that the threat is not baseless [326]. The whitefly

transmission studies conducted on both of these French lines (Dominique [AS0039]

and Haiti [AS0099]), wild relatives of G. hirsutum showed a highly resistant response

against CLCuD with no detectable levels of either virus or betasatellite by the

molecular diagnostics used irrespective of the number of whiteflies being used,

although with an increase in the number of whiteflies per plant there was a slightly

early start of infection (10-11 days post inoculation using 100 and 150 whiteflies per

plant) compared to the less number of whiteflies being used (14 days post inoculation

using 50 whiteflies per plant) in control, CIM 496 plants, to augment the number of

begomovirus-complex being delivered. These results are consistent with the work

done by Akhtar et al. [284] showing that both of these genotypes are highly resistant

to the whitefly transmission of CLCuD. This is a case of host-plant resistance as

situations where genetic polymorphism for susceptibility has been observed within the

same gene pool, some of the genotypes are susceptible while the others are resistant

against a particular virus (pathogen), is referred to as “Host-plant resistance” [247].

The sequenced clones of begomvirus-complex obtained here in the present

work when analyzed were found isolates of CLCuBuV thus show that, in the time and

region where the study was conducted, CLCuBuV and its cognate betasatellite

CLCuMuBBur was responsible for disease incidence. These results are very much

consistent knowing about the current distribution of CLCuD associated

begomoviruses in the subcontinent; only CLCuBuV complex is responsible for the

disease incidence of cotton crops in the Punjab province of Pakistan [156, 290].

However begomovirus other than CLCuBuV have also been identified in the Sindh

province of Pakistan [291] and north-western regions of India [233, 234].

79


Figure 4-5 Southern blot hybridization of DNAs samples extracted from the leaves of cotton plants probed for the presence of Cotton leaf curl Burewala virus (CLCuBuV,

blot a) and Cotton leaf curl Multan betasatellite (CLCuMuB, blot b). The DNA samples were extracted from the graft (infected CIM 496 used as scions on

Dominique and Haiti; lanes 1 and 12 in both blots a and b), healthy non-graft-inoculated plants of Dominique and Haiti (lanes 2 and 7 in both blots a and b),

symptomatic leaves of graft- inoculated plants of Dominique and Haiti collected 40 days post-appearance of the first symptoms of the disease (lanes 4,5 and 6, and lanes 9,10 and 11, respectively, in both blots a and b), non-symptomatic leaves of graft-inoculated plants of Dominique and Haiti collected 40 days post-appearance of the

initial symptoms of the disease (lanes 3 and 8, respectively, in both blots a and b). A sample extracted from a symptomatic, field infected CIM 496 was run as a control

(lane 13 in both blots a and b). Approximately 10 µg of DNA was loaded in each case with a photograph of the genomic DNA bands on the ethidium bromide stained

agarose gel shown below each blot to confirm equal loading. The virus and satellite DNA forms are labelled as open-circular (oc), super-coiled (sc) and single-stranded

(ss).

80


Graft inoculation has been found to be an efficient mean of introducing a virus

(pathogen) to plant species where efficient means of introducing cloned viruses

(pathogens), the most important of which is agrobacterium mediated inoculations, and

biolistic inoculation to an extent, are absent. The improved bottle graft inoculation

technique was used here to investigate the mechanism of resistance of these French

lines against CLCuD causing viruses. Similar work has also been reported earlier

[284] which was different from the present work. The previous study regarding graft

inoculation in both Dominique and Haiti reported mild symptoms of CLCuD but were

not studied at the molecular level, PCR and most importantly the highly sensitive

RCA/PCR diagnostics, Southern blot hybridization and sequencing. However, in the

present study not only the presence and replication of the begomovirus-complex have

been ensured but also these viral components have been cloned and sequenced to

confirm the begomovirus-complex inoculated through the infected scion (CIM 496)

and recovered from these mildly symptomatic Dominique and Haiti plants to be

CLCuBuV and its cognate betasatellite. Similar technique was also used to investigate

resistance of G. arboreum cv. Ravi against CLCuD causing begomoviruses [240]. In

both cases the symptoms of the disease initiated from the older leaves close to the

symptomatic scions. However, in case of G. arboreum cv. Ravi the symptomatic

spread of the disease was restricted to very few leaves slightly away from the site of

inoculation (symptomatic scions) while in case of both of these French lines the

disease spread symptomatically to distal parts of the plants farther away from the site

of inoculation (symptomatic scions). However the top most leaves, just like the case

in G. arboreum cv. Ravi, remained asymptomatic with no detectable level of the

begomovirus-complex through direct PCR showing the importance of these

germplasm for breeders.

Graft inoculation on the other hand induced mild symptoms of CLCuD,

slightly severe in comparison to the mild symptoms induced in G. arboreum cv. Ravi

[240], along with molecular detection of the begomovirus-complex in both of these

French lines shows that the resistance in both of these lines is due to the mechanism

of the delivery of the begomovirus-complex to the plant species i.e. by the insect

vector (Bemisia tabaci). Similar results have also been reported in case of G.

arboreum Ravi where graft inoculation induced mild symptoms of the disease with

molecular detection of begomovirus-complex and the insect vector failed to do so

81


[240]. The difference between the two techniques, graft inoculation and whitefly

inoculation, mainly is the amount (number of begomovirus-complex) of virus being

delivered by both. Graft inoculation, once the union between the symptomatic scion

and rootstock has been established; continuously deliver a much higher amount of

begomovirus-complex to the plant. In contrast whiteflies deliver comparatively much

smaller amount of virus and also in a discontinuous and dispersed manner (each insect

delivering virus at a different site). In case of Tomato yellow leaf curl virus (TYLCV),

a monopartite begomovirus, single whiteflies are estimated to harbour 1.6ng of virus

at most [292] and deliver an even smaller amount of this virus to plants during a

single feed. Symptomatic infections have been found to be dose dependent in most of

the host virus systems [293, 294].

The levels of begomovirus-complex, CLCuBuV and CLCuMuB, detected by

Southern blot hybridization in the symptomatic tissues only of both of these lines,

Dominique and Haiti, were significantly lower than in symptomatic G. hirsutum CIM

496. On the other hand only RCA/PCR have successfully amplified begomovirus-

complex from the non-symptomatic tissues in both of these genotypes where direct

PCR amplification was not possible; signifying an even further low titre of the

begomovirus-complex to be detected by Southern blot hybridization. From the

comparatively low titre of begomovirus-complex in both of these lines it can be

deduced that either the virus was restrained and only a small amount of the

begomovirus-complex infected few cells only or these genotypes are supporting the

virus replication but to a very limited extent just like the graft inoculation studies in

G. arboreum cv. Ravi which showed extremely low level of virus accumulation [240].

The very limited replication of begomovirus-complex in these genotypes indicate that

host-plant resistance is operating limiting the number of begomovirus-complex and

ultimately the number of cells being infected as was also reported in G. arboreum cv.

Ravi [240]. However, the replicative forms obtained here through Southern blot

hybridization suggest that both of these genotypes support the replication of the

begomovirus-complex as was also the case in G. arboreum cv. Ravi [240].

Betasatellite is the key to induce and augment the characteristic symptoms of

disease in the primary hosts and this function is attributed to βC1 protein which is a

dominant symptom determinant [99, 100]. The βC1 protein is attributed to be

involved in the movement of virus, as an inducer of disease symptoms and as a

82


suppressor of gene silencing [82, 103]. The begomoviruses causing CLCuD needs

CLCuMuB to efficiently induce the symptomatic infection in G. hirsutum without

which the virus is poorly infectious [53, 229]. The βC1 protein expressed from Potato

virus X vector induced the symptoms typical of CLCuD in tobacco [297]. The

symptoms induced in both of these genotypes are more likely to be induced by the

βC1 protein, which are very much typical of the symptoms of CLCuD induced in G.

arboreum cv. Ravi reported recently [240] and also in susceptible genotypes of G.

hirsutum.

None of the graft removed plants in both of the French lines showed recovery

from the already established symptoms, unlike the case in some of the graft removed

plants from G. arboreum cv. Ravi where the already established symptoms in some of

their leaves recovered [240]. The systemic spread of the disease, though very mild in

comparison to the initial point of infection (symptomatic leaves on branch 1 in Figure

4.2) in both of the genotypes, Dominique and Haiti plants, to the leaves on the

following branch (branch 2 in Figure 4.2) and ultimate recovery in subsequent

growths (branch 3 and 4 in Figure 4.2 ) shows that host-plant resistance, with the most

possible involvement of RNA interference [299, 300], is involved overcoming the low

titer of the begomovirus-complex when its continuous supply is blocked by the

removal of the grafts. Almost a similar recovery of disease phenotype was also

observed in G. arboreum cv. Ravi plants when the grafts were removed. The

difference between the two is that in G. arboreum cv. Ravi plants the recovery of the

disease phenotype was immediate with no subsequent growth showing any visible

symptoms of disease when the grafts were removed contrasting the case in both of

these French lines where the recovery of disease phenotype was slightly delayed

showing that the level of resistance in the former is stronger than the later. However,

the involvement of other mechanisms of resistance such as R-gene-mediated [306] or

non-R-gene-mediated (other host-protein mediated) can also be the case in both of

these genotypes. Several ecotypes in Arabidopsis thaliana have been found to resist

potexviruses by expressing lectin proteins (JAX1) interfering with the replication of

virus [308].

The resistance response incited by resistant tomato lines, with introgression of

resistance genes (Ty-1, Ty-2, Ty-3, Ty-4 and Ty-5) from wild accessions of Solanum

chilense [302, 327], against Tomato yellow leaf curl virus (TYLCV) infestation is not

83


associated with hypersensitive response (HR), classical Resistance (R) genes

mediated response, contrasting the involvement of R genes [303]. In addition nearly

all of the TYLCV resistant lines of tomatoes were reported to support its replication

[328, 329]. Although the results produced here cannot entirely rule out the possible

involvement of R genes, it is very much unlikely to be the major factor involved in

the resistance of Dominique and Haiti against CLCuBuV complex.

From the results obtained here it is evident that the resistance in both of these

French lines, host-plants, impede either with cell-to-cell movement or replication of

begomovirus-complex in a very similar fashion reported in G. arboreum cv. Ravi, non

host-plant [240], and has nothing to do with either long distance systemic spread of

the begomovirus-complex through phloem or the mechanism by which insect vector

deliver/inoculate begomovirus-complex to the plant. To attain a symptomatic

infection in both of these French lines a threshold titre of the begomovirus-complex is

required, which is probably beyond the reach of whitefly mediated virus inoculation

to induce symptoms in glasshouse or field condition. To identify the mechanism of

these responses, difference in the level of resistance between these French lines

(tetraploid) and G. arboreum cv. Ravi (diploid) and incorporation of resistance in

cultivated varieties of G. hirsutum will be the subject of future interest.

84

CHAPTER 5 Investigation of Resistance to Cotton Leaf Curl Disease in

Cotton Using Biolistic Inoculation

5 Investigation of Resistance to Cotton Leaf Curl Disease in Cotton Using Biolistic

Inoculation

5.1 Introduction One of the major biotic hurdles, causing a substantial loss to cotton industry in

Pakistan and India, is CLCuD [330]. The disease with first noticeable epidemic in

Pakistan during the 1980s occurred frequently as multiple infections of monopartite

begomoviruses (seven distinct species identified) coalescing with cotton leaf curl

Multan betasatellite (CLCuMuB), a symptom modulating betasatellite [109]. The

deployments of resistant cotton varieties, using different exotic germplasm including

LRA 5166, CP15/2 and Cedix in the late 1990s, were very promising against CLCuD

reinstating cotton production to the pre-epidemic levels [311]. However, the

resistance offered by these exotic germplasm was not long lasting and from 2001

onwards, CLCuD reverted on all the previously resistant varieties in a more

overwhelming form known as the “Burewala” strain [232].

Agroinoculation (using Agrobacterium tumefaciens), to deliver cloned viral

DNAs as partial or complete dimers into host plant, is predominantly used [331, 332]

producing the genome-sized viral DNAs. The first ever successful transformation of

rice following agroinoculation was achieved in 1993 producing several fertile plants

[333]. Since then it has been the method of choice for the transformation of cereals

especially wheat, maize and rice. Geminiviruses uses specific insect vectors for their

natural transmission to host plants, however agroinoculation has been used as a

preferred method, in case of cloned viral genomes, to carry out the infectivity analysis

to determine their host range. Nevertheless agroinoculation sometimes fail to induce

infections in some of the host plants using dimeric clones from some of the

geminiviruses mentioned below. Infectious clones of Tomato golden mosaic virus

(TGMV) DNA-A and DNA-B fails to induce infection in tomato, following

agroinoculation, in spite of being a natural host of TGMV [214], however, biolistic-

inoculation of these clones produced symptoms typical of TGMV in tomato [334].

85

5 Biolistic-Inoculation to Evaluate Cotton Germplasm

Same is the case with Tomato leaf curl New Delhi virus (ToLCNDV DNA-A) and

CLCuMuB where agroinoculation fails to induce symptoms in tomatoes [334]

compared to their biolistic- inoculation inducing the disease symptoms [103]. Adding

to these agroinoculation not only demands an extensive labour to clone tandem repeat

constructs of viral DNAs into binary vectors but also is a potential threat in itself

causing infections in some of the hosts [335] which has been shown to possibly

overcome the natural resistance of several wild species of tomato when

agroinoculated with tandem repeats of cloned TYLCV DNA [89]. The highly

recalcitrant nature of cotton to agroinoculation and concerns of host-range specificity

linked to agrobacterium-mediated transformation can be easily overcome by biolistic-

inoculation procedure [336].

One of the lately developed techniques for the inoculation of the cloned DNA

into plants is particle bombardment/particle acceleration [337]. Gilbertson et al. [338]

reported the first successful use of this technique with clones of Bean golden mosaic

virus (BGMV), inoculating radicles of the germinating seeds. This technique was also

used to inoculate rice seedlings with a very limited success rate, only one out of 200

plants being infected, following bombardment with Rice tungro bacilliform virus

(RTBV), a badnavirus [339]. The partial success in rice, whether due to its

monocotyledonous nature or the badnavirus itself, is not very clear. High inoculation

efficiency was achieved, for the bipartite begomoviruses, using biolistic inoculation of

either unit-length (monomer) or tandem repeats (dimer) of cloned begomoviruses,

thus eliminating the need for excessive DNA manipulations and assisting the genetic

analysis of begomoviruses [340]. The first ever biolistic inoculation of a monopartite

begomovirus was reported for Tomato leaf curl Karnataka virus (TLCKV)in 2002

[341]using cloned monomeric DNA. Morilla et al. [342] reported the first biolistic

inoculation of plants with dimeric forms of DNA cloned from Tomato yellow leaf curl

virus (TYLCV)-Alm (Almeria isolate), TYLCV-Mld (mild strain) and Tomato yellow

leaf curl Sardinia virus (TYLCSV). Lapidot et al. [343] most recently reported the

first biolistic inoculation of cloned monomeric linear or closed-circular form of

TYLCV double-stranded DNA in Tomato (Solanum lycopersicum) and Datura

(Datura stramonium) plants, with an inoculating efficiency of 40% and 85%,

respectively. Successful biolistic-inoculation of cotton (S-12 plants), using infectious

clone of CLCuD-associated monopartite begomovirus (CLCuMuV), was reported at

86


John Innes Centre with very low percentage of infectivity [344]. Mansoor et al. [109]

also reported successful biolistic- inoculation of cotton (S-12) and Nicotiana

benthamiana using infectious clones of CLCuMuV, CLCuKoV and Papaya leaf curl

virus (PaLCuV).

The present study was intended to investigate the potential of biolistic, as an

alternative approach, for direct inoculation of CLCuBuV, the resistance breaking

strain of CLCuD, and CLCuKoV, old strain of CLCuD, into the selected germplasm

of cotton to get an insight into the mechanism of their resistance against CLCuD

under controlled conditions.

87



5.2.1 Test Plants and the Monopartite Begomoviruses Used in this Study

Seeds from different germplasm of cotton, including G. arboreum cv. Ravi, G.

hirsutum cvs. Dominique, Haiti, Coker and S-12, were obtained from both NIBGE

(National Institute for Biotechnology and Genetic Engineering) and NIAB (Nuclear

Institute for Agriculture and Biology) and grown in small pots having a proper

combination of silt, clay and sand in an insect proof greenhouse.

Infectious clone of Cotton leaf curl Burewala virus (CLCuBuV; AM421522;

[156]) and its cognate betasatellite CLCuMuBBur (AM774307; [156], as tandem

repeats (dimers), in a binary vector, pGreen0029.

Infectious clone of Cotton leaf curl Kokhran virus (CLCuKoV; AJ 496286;

[109]) and its cognate betasatellite (CLCuMuBMul, AJ298903; [345]), as tandem

repeats (dimers), in a binary vector, pBin19.

CLCuBuV/CLCuMuB (HF569171 and HF912232, section 3.3.4, Chapter 3)

maintained in severely infected plants of cotton, G. hirsutum CIM 496, in the

greenhouse.

5.2.2 Extraction of DNA

DNA was extracted from leaf samples using the CTAB method [235]described in

detail earlier (Chapter 2, section 2.5).

5.2.3 Rolling Circle Amplification (RCA) of Total DNA Extracted from G. hirsutum CIM 496

Begomovirus from CIM 496 confirmed to be CLCuBuV/CLCuMuBBur (HF569171

and HF912232; chapter 3, section 3.3.4) with circular DNA molecules, serving as a

template for ɸ29 DNA polymerase from bacteriophage [346], was first amplified by

RCA (Chapter 2, section 2.7.1) using the above mentioned enzyme and random

hexamer primer (RHP; [239]). The resulting concatameric product was used for

biolistic-inoculation.

88


5.2.4 Biolistic-Inoculation and Maintenance of Plants

The gold particles (1μm, INBIO Gold, Victoria), used as microcarrier, for biolistic-

inoculation were prepared as described in detail earlier (Chapter 2, section 2.1). The

corresponding viral DNAs (CLCuBuV/CLCuMuBBur and CLCuKoV/CLCuMuBMul)

were precipitated onto it and the resulting gold/DNA mix was bombarded to cotton

seedlings at the first 2-3 true leaf stage detailed earlier (Chapter 2, section 2.2) using

helium pressure-based apparatus (Helios Biolistic PDS-1000; Bio-Rad, Hercules, CA)

with 28mm Hg of vacuum. The gold/DNA mix was bombarded to cotton seedlings at

pressure of 450 psi maintaining ~ 3-4cm of distance between the rupture disc and

plant target.

Seedlings of Ravi, Dominique, Haiti, Coker and S-12 at the first and second

true leaf stage were inoculated with infectious clones of CLCuBuV/CLCuMuBBur and

CLCuKoV/CLCuMuBMul as dimers in binary vectors; pGreen0029 and pBin19,

respectively, as well as RCA product of CLCuBuV/CLCuMuBBur. A total of 40 plants

each of Ravi, Coker and S-12 (along with 5 plants each as controls without

inoculation from each of the genotype) and 30 plants each of Dominique and Haiti

(along with 2 plants each as controls without inoculation from each of the genotype)

for each of the two viral constructs were used for inoculation. The same numbers of

plants from the mentioned genotypes were used for inoculation with RCA product of

CLCuBuV/CLCuMuBBur except for Dominique and Haiti where the number of plants

were reduced to 20 each. Following biolistic inoculation the plants were transferred to

insect-proof greenhouse and kept under thorough observation for the appearance of

symptoms of cotton leaf curl disease (CLCuD) if there is any. The observations were

taken daily following inoculation for the first month and then every 2-3 days till the

end of the experiment (~ 10 weeks post-inoculation [pi]).

5.2.5 Whitefly Transmission Assay of CLCuKoV in S-12 and CIM 496 Plants

The whitefly transmission assay was performed as described in detail earlier (Chapter

4, section 4.2.2) using acquisition access period (AAP) and inoculation access period

(IAP) for ~ 72 hours. The S-12 plants infected with CLCuKoV/CLCuMuBMul

(following biolistic-inoculation) were used as the source of inoculum to transmit the

disease to healthy S-12 and CIM 496 plants using viruliferous adult whiteflies. Five

89


each of S-12 and CIM 496 plants, with 50 whiteflies per plant, were used for whitefly

infestation.

5.2.6 Phenotypic Scoring of Disease and Molecular Diagnostics

The plants were shifted to greenhouse following biolistic- inoculation and whitefly

infestation and scored for the appearance of visible symptoms of the disease regularly.

Molecular diagnostics of the begomovirus-complex, using primers pairs

CLCV1/CLCV2 [240] and Beta01/Beta02 [241] for virus and betasatellite,

respectively, were carried out at different intervals. To be absolutely sure of the

presence or absence of begomovirus-complex in inoculated plants RCA/PCR

described in detail earlier (section 3.2.3, chapter 3) was also used.

90


5.3 Results

5.3.1 Biolistic-Inoculation Using Dimers of Begomovirus-Complex

No symptomatic evidence of the initiation of CLCuD was observed in any single

plant of G. arboreum cv. Ravi, G. hirsutum cvs. Dominique and Haiti inoculated with

Cotton leaf curl Burewala virus (CLCuBuV) and Cotton leaf curl Kokhran virus

(CLCuKoV) along with their cognate betasatellites, cotton leaf curl Multan

betasatellites (CLCuMuBBur and CLCuMuBMul), from the time of inoculation to the

end of the experiment (~ 10 weeks post-inoculation [pi]; Table 5.1).

The situation was very much the same in all of the G. hirsutum cvs. Coker and

S-12 plants inoculated with CLCuBuV/CLCuMuBBur. However the situation was

different when Coker and S-12 plants were inoculated using

CLCuKoV/CLCuMuBMul. The initiations of symptoms of CLCuD were evident

almost 21 and 19 days pi in 4 of Coker and 7 of S-12 plants in the newly emerging

leaves (Table 5.1).

The symptoms were mild in the form of small enations on the underside of

leaves in case of both Coker and S-12 plants encircled in red (Figure 5.1, on the left,

panel a and b). Almost 1 month pi all the biolistic- inoculated plants (Ravi,

Dominique, Haiti, Coker and S-12) were transferred to larger earthen pots and kept

under observation till the end of the experiment (~ 10 weeks pi). Recovery of disease

phenotype was observed in all 4 of the Coker (Figure 5.1, in the middle, panel a) and

3 of the S-12 plants with no systemic spread of the disease to the newly emerging

leaves (following the leaves with initial mild symptoms of the disease) almost 45 days

pi. However the rest of the 4 S-12 plants (with mild symptoms) were observed to have

a systemic spread of the disease to the newly emerging leaves 45 days pi encircled in

red (Figure 5.1, in the middle, panel b) and almost 70 days pi full blown symptoms of

the disease, characterized by leaf rolling and cupping, enhanced vein thickening and

darkening, and plant stunting (Figure 5.1, on the right, panel b), were observed in S-

12 plants compared to Coker plant (Figure 5.1, on the right, panel a).Molecular

diagnostics, using PCR and the most sensitive RCA/PCR [240], was carried out with

inoculated plants of Ravi, Dominique, Haiti, Coker and S-12 sampled at 25, 50 days

pi and at the end of the experiment (10 weeks pi). Neither of the

CLCuBuV/CLCuMuBBur or CLCuKoV/CLCuMuBMul inoculated plants of Ravi,

91


Dominique and Haiti produced the expected products (~1100nt for virus and ~1350nt

for betasatellite) with primer pairs CLCV1/CLCV2 [240] and Beta01/Beta02 [241]

following both direct PCR and RCA/PCR. All of the Coker and S-12 plants (Table

5.1) inoculated with CLCuBuV/CLCuMuBBur was also found negative for the

presence of begomovirus/betasatellite following PCR and RCA/PCR. However only

the 4 and 7 mildly symptomatic plants of Coker and S-12, inoculated with

CLCuKoV/CLCuMuBMul, produced the expected products (~ 1100nt for virus and

~1350nt for betasatellite) following both direct PCR and RCA/PCR25 days pi. The

remaining CLCuKoV/CLCuMuBMul inoculated plants of Coker and S-12 with no

symptoms (36 and 33 plants, respectively) were unable to yield the expected products

using PCR and RCA/PCR 25 days pi. However after the recovery of disease

Table 5.1 Biolistic inoculations of cotton plants using cloned dimers of CLCuBuV and CLCuKoV in binary vectors as well as rolling circle amplified (RCA) DNA from

CLCuBuV-infected CIM 496 plants under vacuum.

phenotype in all 4 and 3 of the mildly symptomatic Coker and S-12 plants,

respectively, direct PCR and even RCA/PCR was not able to produce expected

products in those recovered plants 50 days pi and at the end of the experiment (10

weeks pi). The remaining 4 of the CLCuKoV/CLCuMuBMul inoculated S-12 plants

where the systemic spread of the disease was observed 45 days pi were able to yield

the expected products (~ 1100nt for virus and ~ 1350nt for betasatellite) with both

direct and indirect RCA/PCR 50 days pi and at the end of experiment (10 weeks pi).

92


The remaining CLCuKoV/CLCuMuBMul inoculated Coker and S-12 plants (36 and 33

plants, respectively) were unable to yield the expected products using PCR and

RCA/PCR 50 days pi and at the end of experiment (10 weeks pi).

Figure 5-1 Photographs showing symptoms of disease in the form of small enations on the undersides of leaves in both Coker and S-12 plants (panels a and b, on the left)

21 and 19 days pi, respectively, systemic spread of disease to the newly emerging leaves in S-12 plant as vein thickening and upward cupping of leaves 45 days pi (panel b, in the middle) compared to Coker plant (panel a, in the middle) and full

blown symptoms of disease almost 70 days pi in S-12 plant (panel b, on the left) as enhanced vein thickening and darkening, leaf rolling and cupping, and plant stunting

compared to Coker plant (panel a, on the left). The red circles denote features described in the text.

5.3.2 Biolistic-Inoculation Using RCA of the Total DNA from Infected Plants of CIM 496

Purified RCA products amplified from the total DNA of symptomatic leaves of

CLCuBuV/CLCuMuBBur infected CIM 496 was also used for biolistic- inoculation of

the above mentioned plants. The numbers of Ravi, Coker and S-12 plants (along with

5 plants from each of the genotypes as control with no biolistic- inoculation)

inoculated were the same except Dominique and Haiti where the number of plants

inoculated were reduced due to limited availability of the seeds (Table 5.1). No

93


Visible symptoms of CLCuD were seen, following thorough observations in the

greenhouse, in any single plant of Ravi, Dominique, Haiti, Coker and S-12 from

inoculation till the end of the experiment (10 weeks pi). The aseptic nature of these

plants was also ensured by molecular diagnostics, PCR and RCA/PCR, using specific

primer pairs mentioned earlier 25, 50 days pi and at the end of the experiment (10

weeks pi).

5.3.3 Bombarded Plants as a Source of Inoculum for Acquisition and Transmission by Whiteflies

All 5 plants of S-12 were infected following whitefly transmission of

CLCuKoV/CLCuMuBMul; however, all of the 5 CIM 496 plants remained

asymptomatic (healthy) throughout the experiment (~ 2 months post inoculation).

Molecular diagnostics, PCR and RCA/PCR using primer pairs CLCV1/CLCV2 [240]

and Beta01/Beta02 [241], produced the expected products (~ 1100nt for virus and ~

1350nt for betasatellite) but only from all 5 of infected S-12 plants and none from any

single of the 5 asymptomatic plants of CIM 496 ~ 30 and 60 days post inoculation.

The purpose of this study was to show how long it takes for the whitefly to get the

initial as well as full blown symptoms of the disease in comparison to biolistic-

inoculation. The initiation of symptoms of CLCuD in all 5 of the S-12 plants were

evident ~ 13-14 days post inoculation as mild vein thickening which became severe

within the next ~ 40-45 days post inoculation; characterized by intense vein

thickening, leaf rolling and cupping (Result not shown).

94


5.4 Discussion The study tested the ability of CLCuBuV/CLCuMuBBur and

CLCuKoV/CLCuMuBMul, monopartite begomoviruses cloned as dimers in binary

vectors, to infect different germplasm of cotton, the highly resistant Ravi, Dominique

and Haiti, and highly susceptible Coker and S-12 genotypes, using the commercially

available Gene Gun (Helios Biolistic PDS-1000; Bio-Rad, Hercules, CA), as an

attempt to get an insight into the underlying mechanism of their resistance against

CLCuD. Similarly using ɸ 29 DNA polymerase from bacteriophage the total nucleic

acid from CLCuBuV/CLCuMuBBur-infected plants of CIM 496 was also amplified by

rolling circle amplification (RCA) and inoculated to the above mentioned germplasm

of cotton under same conditions.

The highly resistant nature of Ravi also determined through field trials [240],

Dominique and Haiti also determined through whitefly transmission assay (section

4.3.1, Chapter 4), following biolistic- inoculation, scored by the absence of visual

phenotypic symptoms of CLCuD and molecular diagnostics (PCR and sensitive

RCA/PCR), shows the likely involvement of resistance, possibly contributed by

resistance (R)-genes [305, 306], or lectin proteins; certain ecotypes of Arabidopsis

thaliana produces lectin proteins (JAX1) to resist various potexviruses [308]. There is

a phenomenal difference between biolistic- and whitefly- inoculation procedures;

whiteflies inoculate/inject the begomovirus-complex directly into the phloem cells

from where it is translocated to different parts of the plant contrasting biolistic-

inoculation delivering begomovirus-complex to the non-phloem cells where it needs

to be replicated to reach phloem cells for translocation to the remote parts of the plant.

The resistance response from Ravi, Dominique and Haiti against

CLCuBuV/CLCuMuBBur and CLCuKoV/CLCuMuBMul is very much understandable

due to the fact that very mild symptoms of CLCuD were evident in Ravi [240] and

French lines, Dominique and Haiti (chapter 4), following grafting that consistently

delivers a much higher amount of the begomovirus-complex directly into the phloem

contrasting both whitefly and biolistic-inoculation procedures delivering a much more

smaller amount of the begomovirus-complex.

On the other hand a very small number of Coker and S-12 (10% and 17.5%,

respectively) plants showed very mild symptoms of CLCuD in which none of Coker

95


and only 4 of the S-12 plants were able to develop full blown systemic infection with

a slight delay for few days during the onset as well as development of full blown

symptoms of the disease compared to whitefly transmission of the virus, following

biolistic-inoculation with cloned dimers of CLCuKoV/CLCuMuB. The slight delay

during the initiation as well as fully established systemic infection compared to

whitefly transmission of the same begomovirus-complex might be a contribution of

several factors. One of the key factors might be the lack of capsid protein which has

been reported to be an important nuclear shuttle protein shuttling the viral DNAs into

and out of the nucleus; the capsid protein of Tomato yellow leaf curl virus (TYLCV)

was shown to be an important nuclear shuttle protein [194, 347]. The second

important factor causing the delay might be the lower amount of viral DNAs reaching

to the nuclei of the host plant following biolistic- inoculation compared to whitefly

transmission of the virus; TYLCV infecting tomato and datura plants produced

delayed symptoms of disease following biolistic- inoculation compared to its whitefly

transmission [343].

Bipartite begomoviruses have been found, in most cases, to have a higher rate

of infectivity compared to monopartite begomoviruses following biolistic- inoculation;

Tomato mottle virus (ToMV), a bipartite virus, infected approximately 58% (8/14) of

tomato plants compared to Tomato yellow leaf curl virus (TYLCV), a monopartite

virus, infecting only 5% (2/40) of tomato plants following biolistic- inoculation using

RCA-enriched total DNA from infected tomato leaves [348]. Cotton plants inoculated

with Cotton leaf crumple virus (CLCrV), a bipartite virus of Western Hemisphere,

have shown 100% (16/16) infectivity rate following biolistic- inoculation [349]. It can

be speculated, might not be the case, that the lower rate of infectivity in these cotton

plants might be due to the monopartite nature of the begomovirus used in this study.

However, cloned dimers of CLCuBuV in pGreen29, found infectious when

agroinoculated into Nicotiana benthamiana, N. glutinosa and N. tabacum [156], and

RCA-enriched total nucleic acid from CLCuBuV-infected CIM 496 plants failed to

induce CLCuD in Coker and S-12 following biolistic- inoculation with reasons very

much unknown. Some previous studies, following biolistic- inoculation with infectious

clones of monopartite begomoviruses (CLCuMuV, CLCuKoV and PaLCuV), have

also reported lower infectivity in cotton (S-12; [109, 344]). Previous studies have used

pre-resistance breaking species of the CLCuD-causing begomoviruses, and as

96


infectious clones only but no RCA product. However, in the present study both pre-

and post-resistance breaking species, both as infectious clones as well as RCA

product (in case of CLCuBuV), were used. Similarly in the previous study only highly

susceptible germplasm of cotton were inoculated but in the present study both

susceptible and highly resistant germplasm of cotton were inoculated.

Recovery of disease phenotype was observed in all of mildly symptomatic

Coker (4 plants) and 3 of the S-12 plants with no evidence of CLCuD in the newly

emerging leaves, following the initial few leaves with mild symptoms, suggests the

low titre of the begomovirus-complex and possible involvement of posttranscriptional

gene silencing (PTGS), RNA-interference. The absence of begomovirus-complex in

those non-symptomatic leaves by molecular diagnostics, PCR and RCA/PCR,

somehow confirms the involvement of these forces overcoming the low titre of

begomovirus-complex. The remission of symptoms had also been witnessed in plants

infected by Pepper golden mosaic virus (PepGMV) in several cases [350, 351], where

the recovered plants have shown either a complete disappearance or decline of

symptoms in the newly emerging leaves after the first two or three symptomatic

leaves. Recovery of hosts from viral infections have also been reported in numerous

systems of host-virus interactions [161, 352], counting geminiviruses [301, 351], and

also in transgenic plants injected by viral replicons comprising the transgene [353,

354]. The recovery phenomenon in most of these cases have been explained as

posttranscriptional gene silencing (PTGS; [355-357]), a specific RNA-degradation

procedure directed by double stranded RNA (dsRNA), generating 21- to 25-

nucleotide long RNA fragments known as small interfering RNAs (siRNAs; [161,

358]). The remaining 4 of the S-12 plants developing full blown symptoms of the

disease, with reasons very much unknown, suggest a possible escape from RNA-

interference.

Whitefly transmission of disease to S-12 plants by back-indexing shows that

biolistic-inoculated (4 of the S-12 plants with full blown symptoms of the disease)

plants can also be used as a source of virus for whitefly transmission of the disease.

The failure in whitefly transmission of disease to CIM 496 plants further confirms the

virus to be transmitted (from biolistic-inoculated S-12 to healthy S-12 plants) is

CLCuKoV/CLCuMuBMul as CIM 496 is resistant to the virus complex causing the

97


disease pre-resistance breaking [359] but highly susceptible to the new, Burewala

strain [284].

The results indicated a successful biolistic- inoculation, though with a limited

rate of success in the susceptible germplasm of cotton, needs improvements to

increase the efficiency of the procedure. Once improved, this procedure can ease the

screening of resistant germplasm of cotton against CLCuD under controlled

conditions.

98

CHAPTER 6 General Discussion

6 General Discussion

Cotton, contributing significantly to the local textile industries with significant

influence on the labor employment sector, is the principal component of foreign

exchange via exports as lint and textile products. Pakistan’s economy, listed as the

fifth leading cotton grower worldwide according to the Economic Survey of Pakistan

[360], is heavily based on the production of cotton. Unfortunately the production of

cotton is under severe stress of CLCuD since its first epidemic in the mid-1980s till

now. The introductions of resistant cotton varieties in the late 1990s, produced by

conventional breeding programs, have shown promise refurbishing cotton production

to the pre-epidemic levels. The resistance however proved to be a slight pause and the

disease soon reappeared in an even more deadly shape, as CLCuBuV, in 2001. Since

then CLCuBuV is playing havoc with cotton crops throughout Pakistan and north-

western parts in India. It is very much possible that the begomovirus-complex might

find its way to areas where it is not present at present; as evident from its recent

introduction into China [326], a far more distantly located region from CLCuD

affected areas in India and Pakistan. The fear was even further promulgated when the

begomovirus-complex was reported in plants species other than cotton like China rose

(Hibiscus rosa-sinensis; [361]) and Brinjal (Solanum melongena; [362]), serving as

potent reservoirs where the virus can overwinter thus providing the primary source to

infect subsequent cotton crops.

Natural resistance and use of carriers (vectors) targeted insecticides to

alleviate begomoviruses induced losses to crops, cotton of course being a major

concern, have remained the main weapons. Concerns to the environment regarding

the excessive use of insecticides, in particular, and lack of suitable genes for

resistance in most of the crop species can possibly limit the use of these approaches in

future [363]. Most of the high yielding, but at the same time highly susceptible,

commercial cotton varieties introduced from the New World (NW) initiated the first

epidemic of CLCuD. The resistant cotton varieties on the other hand, released for

cultivation under conventional breeding programs and main players involved in the

99


second epidemic of CLCuD, also did not offer durable resistance due to several

factors; including the lack of knowledge underlying the molecular mechanism of

resistance and even most importantly due to higher propensity of begomoviruses for

recombination/mutation [364]. The dominance of CLCuBuV-induced infection in

cotton fields and lack of resistant germplasm, considering the case in hugely

cultivated tetraploids in particular, is an alarming concern for cotton growers in

Pakistan, in particular, as well as in north-western parts of India. Understanding the

molecular basis of resistance in these germplasm, before being utilized in breeding

programs to produce resistant varieties with durable resistance, is needed to properly

address the problem, CLCuD. Unfortunately the absence of infectivity system to

introduce cloned viruses in different germplasm of cotton has precluded us to

investigate mechanism of their resistance, the question yet to be answered. The

described work was instigated with that aim in mind, hoping from the outset that it

will be useful to combat the disease.

At present no single CLCuD-resistant G. hirsutum (upland cotton) lines have

become available to farmers following interspecific crosses with G. arboreum, scored

naturally immune with no single report of infectivity as yet by begomoviruses, to be

specific, and even geminiviruses, in general [284, 286-288]. Grafting is an efficient

mean of inoculation delivering a much larger amount of virus and is consistent in

comparison to much lower and highly dispersed delivery by its whitefly vector. A

genotype from G. thurberi and AS0349 (an Exotic accession of G. hirsutum) were

found highly resistant with no symptoms or any detectible level of virus when

exposed to whiteflies in fields compared to their graft- inoculation where they were

scored highly susceptible indicating a possible resistance against the whitefly vector

[284]. The study conducted here is in support of the work done by Akhtar et al. [284].

Resistance to the vector can either be complete, where resistance cannot be breached

by changing the number of viruliferous insect vectors, or partial, where resistance can

be breached by changing the number of viruliferous insect vectors, depending on the

host-plants. Melon plants exhibited complete resistance against the insect vector

Aphis gossypii transmitting non-circulative viruses [365] controlled by a single

dominant gene [366]. Maize and Solanum pimpinellifolium (accession LA1478) plants

on the other hand were reported to be partially resistant against plant hopper

(Peregrinus maidis), transmitting Maize mosaic virus (MMV) and Maize stripevirus

100


(MSV; [367]), and whitefly, transmitting Potato yellow mosaic virus (PYMV; [368]),

respectively. From the response of French lines (Dominique and Haiti) in the work

presented here it can be speculated, might not be the case, to be offering complete

resistance against the virus vector. However, exhibition of extremely mild symptoms

with ultimate recovery from disease symptoms in the work presented here (chapter 3,

section 3.3.3) shows possible involvement of additional forces of resistance in

operation.

RNA silencing/Post transcriptional gene silencing (PTGS), an adaptive

defence mechanism in plants against foreign genomes, is induced against viruses or

transgenes to protect host plants [264]. Small interfering (si) RNA, an intermediate of

the silencing pathway [264, 369], is the key feature of RNA silencing mechanism.

The work presented here, both in G. arboreum cv. Ravi and French lines (cvs.

Dominique and Haiti), have shown recovery of disease phenotype but still with

detectable levels of the begomovirus-complex consistent with most reports on RNAi

based resistance studies against geminiviruses where the plants were found

symptomless but still infected [370-373].

Following successful inoculation most plant viruses, moving locally from cell-

to-cell, stretch to vascular tissues, phloem in particular and also to xylem in very rare

cases, for distribution to other parts of the plants triggering systemic infection [374].

The resistance to movement displayed by host plants can either be local, preventing

cell-to-cell movement, or systemic, preventing long distance movement, depending

both on the invading pathogens and host plants. The 30kDa movement protein (MP)

of Tobacco mosaic virus (TMV) was found to mediate its cell-to-cell movement [375,

376] capable of modifying the size exclusion limit of plasmodesmata [377]. Tobacco

etch virus (TEV) was found to show a restricted long distance/systemic spread in the

Col-3 ecotype of Arabidopsis thaliana, with normal cell- to-cell movement, due to the

presence of a specific locus designated as RTM1 (restricted TEV movement 1; [378]).

The impaired systemic movement of Tomato leaf curl virus (TLCV) in FLA653, a

tomato breeding line supporting replication and local cell- to-cell movement of the

virus in inoculated leaves, was attributed to the presence of a recessive allele tgr-1

[379]. The presence of low titre of begomovirus-complex in grafted G. arboreum cv.

Ravi and both of the French lines in comparison to their respective controls, evident

from RCA/PCR diagnostics and Southern hybridization (Figure 3.7 and 4.5, chapter 3

101


and 4 respectively), and at the same time symptomatic infections in the second

healthy grafts (section 3.3.2, chapter 3), ruling out the possible involvement of

resistance to the systemic spread of begomovirus-complex, can be speculated to be

due to their resistance to the local spread of the begomovirus-complex.

Mutation and recombination, together with multiple infections in the fields,

are the main players of evolution producing a large number of variants of which the

fittest one, with selection based on vector population and host plants [380], are

recruited. The introduction and widespread cultivation of resistant host varieties, a

possible selection pressure, can introduce resistance breaking strains; as is evident

from the emergence of CLCuBuV in those resistant cultivars of cotton at Vehari

district [156]. Keeping these things in mind the completely sequenced clones of the

begomovirus-complex from G. arboreum cv. Ravi and both of the French lines

(section 3.3.4 and 4.3.3, chapter 3 and 4 respectively) when analysed, suspecting the

possible appearance of resistance breaking strain other than CLCuBuV or some other

major recombination events, were found to be isolates of the existing strain.

Owing to the highly recalcitrant nature of cotton to agroinoculation other

approaches of inoculation needs to be established to investigate the mechanism of

their resistance under controlled conditions. Following successful biolistic inoculation

of TGMV (Both DNA-A and B; [334]) and ToLCNDV (ToLCNDV DNA-A and

CLCuMuB; [103]) in tomatoes, where agroinoculation failed to do so using the same

viral clones [214, 334], this technique, less labor oriented with no host-specificities

attached, can be employed to explore the mechanism of resistance in different

germplasm of cotton. Higher rates of infectivity in plants have been reported with

bipartite begomoviruses than monopartite viruses in most cases; 58 % of tomato

plants were infected following biolistic inoculation with ToMV, a bipartite virus,

compared to 5% of its infectivity using TYLCV, a monopartite virus [348]. An

infectivity rate of even 100% was reported in cotton plants following biolistic

inoculation with a bipartite CLCrV from USA [349]. The lower rate of infectivity,

combined with infectivity in susceptible germplasm of cotton only (S-12 and Coker),

reported here can be the possible outcome of monopartite nature of the begomovirus-

complex as well as highly resistant nature of the resistant germplasm (G. arboreum

cv. Ravi and both of the French lines) of cotton.

102


The findings provide clues to breeders about the presence and level of

resistance in the tested germplasm evident from their responses to CLCuBuV (the

prevailing strain of CLCuD). Both of the French lines, tetraploids with no

incompatibility issues when triggered into interspecific crosses with cultivated

germplasm (productive but at the same time highly susceptible) and highly resistant

diploid genome of G. arboreum cv. Ravi, naturally immune to CLCuD in field, need

to be employed in conventional breeding programs to develop new resilient varieties,

hoping to be the ones, restraining the prevailing strain of CLCuD.

Improving the rate of infectivity of momopartite begomoviruses in cotton via

biolistics, ensuring interspecific crosses of the investigated germplasm of cotton and

analysing the behaviour of different possible siRNAs when triggered with infection in

G. arboreum cv. Ravi and both of the French lines (G. hirsutum cvs. Dominique and

Haiti), in comparison to their respective controls, should be the focus of future

studies.

103

understanding the molecular basis of cotton leaf curl...

Documents