ucla engineer fall 2012

52
UCLA FALL 2012, Issue No. 28

Upload: wileen-kromhout

Post on 16-Mar-2016

235 views

Category:

Documents


3 download

DESCRIPTION

The Fall 2012 issue of UCLA Engineer debuts a new redesign. Features include a profile of Broadcom Co-Founder, Chairman and CTO Henry Samueli ’75, MS ’76, PhD ’80, on how his work at UCLA propelled him to success; a profile of Dean Vijay K. Dhir, who has led the school to new heights over the past 10 years; and a profile of bioengineering associate professor Dino Di Carlo, who has been making big strides in microfluidic technologies. Research breakthroughs featured including using ultra-fast cameras to detect cancer cells; transparent solar cells that can be used as windows; nanoscale microwave oscillators for improvements in communications, and more. The magazine also includes stories on ACM Turing Award winner Judea Pearl, of computer science; and on TANMS, the school’s new NSF-funded research center on nanoelectronic devices. In addition to the news on students, alumni, faculty and recent UCLA Engineering events, you'll also find the school's 2010-11 Annual Report.

TRANSCRIPT

Page 1: UCLA Engineer Fall 2012

UCLA FALL 2012, Issue No. 28

Page 2: UCLA Engineer Fall 2012

DEANVijay K. Dhir

ASSOCIATE DEANSRichard D. WeselAcademic and Student Affairs

Jane P. ChangResearch and Physical Resources

ASSISTANT DEANMary OkinoChief Financial Officer

DEPARTMENT CHAIRSBenjamin WuBioengineering

James C. LiaoChemical and Biomolecular Engineering

Jonathan P. StewartCivil and Environmental Engineering

Jens PalsbergComputer Science

M.C. Frank ChangElectrical Engineering

Jenn-Ming YangMaterials Science and Engineering

Tsu-Chin TsaoMechanical and Aerospace Engineering

EXTERNAL AFFAIRS COMMUNICATIONSSheila Bergman Executive Director

Matthew ChinCommunications Manager and Writer

HauChee ChungGraphic Designer

ContributorsKatharine GammonWileen Wong KromhoutJennifer Marcus

OFFICE OF EXTERNAL AFFAIRS(310) [email protected]

FROM THE DEAN

Welcome to the new UCLA Engineer magazine. It has a fresh and inviting design that I think you will enjoy. While the look may be new, our emphasis on highlighting UCLA engineers at the leading edge of innovation has not changed.

UCLA engineers are making a big impact. In fact, UCLA Engineering was fourth in the world in research impact over the past 10 years in recent rankings, based on citation index, by Microsoft Academic Search. Also, over the past few months, our faculty and students have received the most prestigious of recognitions, such as the ACM Turing Award; the EPA’s Presidential Green Chemistry Challenge Award; the Presidential Early Career Award for Scientists and Engineers (PECASE); and the Top Innovation of 2011 from The Scientist magazine, just to name a few.

This issue of UCLA Engineer features stories on faculty and alumni who themselves are leading revolutionary changes in technology.

Many of you may be familiar with the school’s namesake, Henry Samueli, Co-Founder, Chairman and CTO of

Broadcom, but you may not know much about how he got his start here at UCLA as a leader in the communications semi-conductor industry.

One of our young faculty members, Dino Di Carlo of Bioengineering, has been developing microfluidic technologies with great potential for applications in the medical and life sciences, such as diagnosing diseases earlier.

The National Science Foundation awarded a highly competitive Engineering Research Center (ERC) to the school. The multi-million dollar ERC will usher in a paradigm shift in nanoscale electro-magnetic devices.

This is wonderful time to be a part of the UCLA Henry Samueli School of Engineering and Applied Science.

Sincerely,

Vijay K. DhirDean

Page 3: UCLA Engineer Fall 2012

UCLA

02 | Demographics

03 | Year in Review

04 | Breakthroughs

20 | School news

24 | Alumni news

34 | 2011-2012 Report

FA L L 2 0 1 2 | Issue No. 28

From Professor to Leader of Industry, With A Little Help From His Friends β€” Henry Samueli ’75, MS ’76, PhD ’80

Dean Dhir Boldly Leads the School β€” Vijay K. Dhir

High-Speed, High-Volume, High-Precision β€” Dino Di Carlo

8

12

16

On the cover:Clockwise from top right Bahram Jalali, Electrical Engineering, conducts photonics research for biomedical applications. http://www.photonics.ucla.edu/

James Liao, Chemical and Biomolecular Engineering, develops next-generation biofuels. http://www.seas.ucla.edu/~liaoj/

John Wallace, Civil and Environmental Engineering, evaluates structural performance in earthquakes. http://nees.ucla.edu/wallace/

Yang Yang, Materials Science and Engineering, develops new classes of photovoltaic cells. http://yylab.seas.ucla.edu/index.aspx

Mario Gerla, Computer Science, is developing vehicular networks. http://nrlweb.cs.ucla.edu/

Daniel Kamei, Bioengineering, explores new methods that deliver drugs to cells. http://kameilab.seas.ucla.edu/

Richard Wirz, Mechanical and Aerospace Engineering, investigates plasma processes in advanced space propulsion systems. http://www.wirz.seas.ucla.edu/

Page 4: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

2ALUMNI

DemographicsTotal: 29,785

through Spring 2012

South and Central America 51

Europe 148

Canada 31

Asia 477

Middle East and Africa 57

Australia and New Zealand 4

Southern CA

18,032

Northern CA5,579

HI167

NV, AZ, UT, CO, NM

1,129

WA, OR, AK, ID, MT, WY

993ND, SD, MN,

IA, WI, IL273

MS, AL, TN, GA, FL, SC, NC, LA

608

MI, IN, OH, KY

268

VA, MD, DC, WV, DE

507

PA, NY, NJ, CT614

VT, NH, RI, MA, ME

264

TX,OK, KS, MO, NE, AR

583

Page 5: UCLA Engineer Fall 2012

157 FULL-TIME FACULTY

$30,454,342GIFTS TO UCLA ENGINEERING

24PATENTS AWARDED

UC

LA E

NG

INE

ER

|

3

UCLA Henry Samueli School of Engineering and Applied Science

Y E A R I N R E V I E W

PUBLICATIONS

UCLA Engineering faculty published

9 books, 33 chapters, 597 journal articles

and 434 conference proceedings.

EDITORIAL POSITIONS

UCLA Engineering faculty held

39 editorships, 62 associate editorships

and 6 guest editorships.

RESEARCH EXPENDITURES

$93,281,730

DEGREES AWARDED (2012 PROJECTIONS)

Undergraduate Master's Doctoral Total

ENROLLMENT 2011-2012

GIFTS BY PURPOSE

Student Support 14%

Faculty 4%

Program Research 22%

Capital Projects 23%

Discretionary 37%

740 529 156 1,425 B.S. M.S. Ph.D. Total

3,311 924 921 5,156

Page 6: UCLA Engineer Fall 2012

BREAKTHROUGHS

ULTRA-FAST CAMERA DETECTS

ROGUE CANCER CELLS BAHRAM JALALI, Northrop Grumman Endowed Opto-Electronic Chair in Electrical Engineering

DINO DI CARLO, Associate Professor of Bioengineering

KEISUKE GODA, Professor of Physical Chemistry, University of Tokyo

The ability to distinguish and isolate rare cells from among a large population

of assorted cells has become increasingly important for the early detection

of disease and for monitoring disease treatments.

An interdisciplinary research team with expertise in optics and

high-speed electronics, microfluidics, and biotechnology, has developed

a high-throughput flow-through optical microscope with the ability to

detect rare cells with sensitivity of one part per million in real time. The

new blood-screening technology boasts a throughput of 100,000 cells per

second, approximately 100 times higher than conventional imaging-based

blood analyzers. n

By M

atth

ew C

hin

and

Wile

en W

ong

Kro

mho

ut

www.engineer.ucla.edu/cancer-detecting-camera

Page 7: UCLA Engineer Fall 2012

FreeLayer

Pinned Layer

X

Hext

UC

LA E

NG

INE

ER

|

5

WORLD’S MOST POWERFUL

NANOSCALE MICROWAVE

OSCILLATORS

NEW GENETIC METHOD TO PINPOINT INDIVIDUALS’ GEOGRAPHIC ORIGIN

ELEAZAR ESKIN, Associate Professor of Computer Science

JOHN NOVEMBRE, Associate Professor of Ecology and Evolutionary Biology

Understanding the genetic diversity within and between populations

has important implications for studies of human disease and evolution.

A team of researchers at UCLA and Israel’s Tel Aviv University has

developed an innovative approach to the study of genetic diversity

called spatial ancestry analysis (SPA), which allows for the modeling of

genetic variation in two- or three-dimensional space.

With SPA, researchers can model the spatial distribution of each

genetic variant by assigning a genetic variant’s frequency as a continuous

function in geographic space. By doing this, they show that the explicit

modeling of the genetic variant frequency β€” the proportion of individuals

who carry a specific variant β€” allows individuals to be localized on a world

map on the basis of their genetic information alone. n

KANG L. WANG, Raytheon Professor of Electrical Engineering

PEDRAM KHALILI, Project Manager, UCLA-DARPA research programs in STT-RAM and non-volatile logic

A team of researchers has created the most powerful high-perfor-

mance nanoscale microwave oscillators in the world, a development that

could lead to cheaper, more energy-efficient mobile communication

devices that deliver much better signal quality.

Cell phones and WiFi–enabled tablets all use microwave oscillators,

tiny devices that generate the electrical signals used in communications.

In a cell phone, the transmitter and receiver circuits contain oscillators

that produce radio-frequency signals, which are then converted by the

phone’s antenna into incoming and outgoing electromagnetic waves.

The UCLA-developed oscillators utilize the spin of an electron,

as in the case of magnetism, and carry several orders-of-magnitude

advantages over the oscillators in use today. n 

By M

atth

ew C

hin

and

Wile

en W

ong

Kro

mho

ut

www.engineer.ucla.edu/geographic-origin

www.engineer.ucla.edu/nanoscale-oscillators

Page 8: UCLA Engineer Fall 2012

BREAKTHROUGHS

HIGHLY TRANSPARENT SOLAR CELLS CREATED FOR WINDOWS THAT GENERATE ELECTRICITY

YANG YANG, Carol and Lawrence E. Tannas, Jr., Endowed Chair in Engineering

PAUL S. WEISS, Fred Kavli Chair in NanoSystems Sciences, CNSI Director, and Department of Chemistry and Biochemistry

UCLA researchers have developed a new transparent solar cell that is an

advance toward giving windows in homes and other buildings the ability to generate

electricity while still allowing people to see outside.

The new kind of polymer solar cell (PSC) produces energy by absorbing mainly

infrared light, not visible light, making the cells nearly 70% transparent to the hu-

man eye. The device is made from a photoactive plastic that converts infrared light

into an electrical current. n

www.engineer.ucla.edu/solar-window

Page 9: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

7

GAME ON! USING ONLINE CROWD-SOURCING TO DIAGNOSE MALARIA

ELECTRICITY CAN GENERATE ALTERNATIVE FUEL

AYDOGAN OZCAN, Associate Professor of Electrical Engineering and Bioengineering

DR. KARIN NIELSEN, Professor of Infectious Diseases, Department of Pediatrics, Geffen School of Medicine

Working on the assumption that large groups of public

non-experts can be trained to recognize infectious diseases

with the accuracy of trained pathologists, researchers

from the Henry Samueli School of Engineering and Applied

Science and the David Geffen School of Medicine at UCLA

have created a crowd-sourced online gaming system in

which players distinguish malaria-infected red blood cells

from healthy ones by viewing digital images obtained

from microscopes.

The team found that a small group of non-experts

playing the game was collectively able to diagnosis malaria-

infected red blood cells with an accuracy that was within

1.25 percent of the diagnostic decisions made by a trained

medical professional. n

JAMES C. LIAO, Ralph M. Parsons Foundation Chair in Chemical Engineering

Imagine being able to use electricity to power your car

β€” even if it’s not an electric vehicle. UCLA Engineering

researchers have for the first time demonstrated a method

for converting carbon dioxide into liquid fuel isobutanol

using electricity.

Today, electrical energy generated by various methods

is still difficult to store efficiently. Chemical batteries, hy-

draulic pumping and water splitting suffer from low energy-

density storage or incompatibility with current transporta-

tion infrastructure.

The team reports a method for storing electrical

energy as chemical energy in higher alcohols, which can be

used as liquid transportation fuels. n

www.engineer.ucla.edu/electricity-fuel

www.engineer.ucla.edu/malaria-gaming

Page 10: UCLA Engineer Fall 2012

010101010100001101001100010000010010000001000101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001001000011001010110111001110010011110010010000001010011011000010110110101110101011001010110110001101001001000000101001101100011011010000110111101101111011011000010000001101111011001100010000001100101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001100001011011100110010000100000011000010111000001110000011011000110100101100101011001000010000001110011011000110110100101100101011011100110001101100101

Pho

to: W

alte

r Uri

eU

CLA

EN

GIN

EE

R

| 8

Page 11: UCLA Engineer Fall 2012

010101010100001101001100010000010010000001000101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001001000011001010110111001110010011110010010000001010011011000010110110101110101011001010110110001101001001000000101001101100011011010000110111101101111011011000010000001101111011001100010000001100101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001100001011011100110010000100000011000010111000001110000011011000110100101100101011001000010000001110011011000110110100101100101011011100110001101100101

UC

LA E

NG

INE

ER

|

9

FROM PROFESSOR TO LEADER OF INDUSTRY, WITH A LITTLE HELP FROM HIS FRIENDS By Katharine Gammon

Today, Henry Samueli is a household name in Southern

California. But twenty years ago, he was a professor at UCLA

working to forge a new kind of research collaboration

with his colleagues. Together with three other professors,

Samueli embarked on exciting new research – which

eventually became part of Broadcom. This is the story

of how UCLA Engineering research helped forge a new

communications industry.

β€œOne of Henry’s strongest points is he could

identify and invest in talent without wanting

short-term returns.” PROFESSOR ASAD ABIDI

Page 12: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

10Broadcom grew to be one of the leading semi-

conductor companies, and also supplies the

WiFi+Bluetooth combo chip for Apple iPhone

3GS and iPod touch second generation.

Henry Samueli had an epiphany in engineering class. He was a senior at

UCLA, studying electrical engineering and signed up for a course taught by

Alan Willson – the first course ever at UCLA in digital signal processing in

electrical engineering. β€œThat class set me on the path of that field, and it was a major

milestone in my educational career,” Samueli said with a smile. β€œI had to pick a focus,

and when I took that class from Professor Willson I decided. It was a brand new field,

and it just seemed to have so much potential.”

When he finished his Ph.D. in 1980, Samueli went to work for TRW, Inc. in

Redondo Beach. There, he worked to develop military satellite and radio communi-

cations systems, and in particular, a high-speed digital radio modem for the Army.

He says the experience at TRW prepared him to work closely with people across

different disciplines.

Along the way, he had been teaching classes at different colleges, and in 1985,

he was offered a full-time position back at UCLA. When he returned, he started

talking to other young faculty colleagues about proposals for the Defense Advanced

Research Projects Agency. β€œFaculty typically think of their narrow fields, it’s not until

you get to industry that people think of putting all those parts together,” he says –

but his colleagues were willing to collaborate on new technologies.

Together with electrical engineering professors Greg Pottie, Asad

Abidi, and Yahya Rahmat-Samii, Samueli created a proposal to the first

all-CMOS (complementary metal-oxide semi-conductor) radio with

both the analog and digital in CMOS on a single chip. The communica-

tions system research was revolutionary in a few different ways. The

team Samueli assembled had unique talents: Samueli was in charge of the digital

signal processing, Abidi focused on the analog portion, Rahmat-Samii took care of

the antennas, and Pottie was in charge of the systems analysis.

Outside of the unique talents of the team, the project was pushing boundaries.

β€œNo one thought it could be done in one chip,” says Pottie. β€œBut Henry realized that if

you made the analog portion low-power enough and structure it correctly, it could

stay on one chip, radically reducing the cost.”

Samueli’s colleagues say that he has great

skills as a manager as well as a thinker.

p(top) Samueli received the Marconi Prize, awarded in June 2012. And he was awarded the prestigious UCLA Medal in 2010.

Page 13: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

11

FA

CT

S &

FIG

UR

ES

99.98%of Internet data traffic

crosses a Broadcom chip.

β€œWe were merging analog and digital, which had

traditionally hard lines between them,” recalls Abidi.

β€œWhen we first proposed that we would build radios on the

same chip as digital stuff, companies like Motorola laughed

in our faces.”

Despite the hurdles, the project proved to be a great

success, and some interesting research was produced.

β€œOne of the most interesting outcomes was that we invented

the concept of back-mounted antennas for handsets β€” not

like typical monopoles that sticks out,” says Rahmat-Samii.

Later on, those back-mounted antennas became internal,

which are now the norm in any cell phone.

As the project continued, research papers were

published, and the laughter turned to curiosity. β€œWe didn’t

even worry about patents at that time, we just published

our work and put it in the public domain. We were so far

ahead of everyone else in the field,” says Samueli, who

ended up publishing more than 100 research papers during

his time in the department.

β€œOut of those publications, we

started getting a lot of inquiries from

companies who loved our results

and wanted us to commercialize the

technology,” he says. Together with

his graduate student Henry Nicholas,

Samueli formed Broadcom in 1991. They

first worked out of a spare bedroom in

co-founder Henry Nicholas’s house, and

then from 1,200-square-foot offices on

Wilshire Boulevard.

In 1995, Samueli took a leave from UCLA, however

he still holds a faculty appointment in the Department of

Electrical Engineering. Broadcom's first project was to

design the world’s first chips for digital interactive cable

television, followed by the world’s first single-chip

cable modem.

Samueli’s colleagues say that he is a skilled manager

as well as a long-range thinker. β€œOne of Henry’s strongest

points is that he can identify and invest in talent without

wanting short-term returns,” says Abidi.

Broadcom grew to be one of the world’s leading

semiconductor companies, and currently supplies the

WiFi+Bluetooth combo chip for Apple’s iPhone, iPad and iPod

Touch devices. Among the accolades Samueli has received

is the Marconi Society Prize and Fellowship, awarded in

June 2012. He was also elected a Fellow of the Institute of

Electrical and Electronics Engineers in 2000, a member of

the National Academy of Engineering in 2003, and a Fellow

of the American Academy of Arts and Sciences in 2004.

No matter how far the

company goes, Samueli, with

characteristic quiet coolness,

gives credit back to the team effort

at UCLA Engineering. β€œOur research

was one of the more successful,

early examples of broad collabor-

ative multi-disciplinary work in

the school, and it set a model for

the future.” n

11,000β€” number of Broadcom employees

in 15 countries

SOURCE: Broadcom

Page 14: UCLA Engineer Fall 2012

In his nearly ten years as Dean, Vijay K. Dhir has

tirelessly worked to improve the scale and scope of

the UCLA Henry Samueli School of Engineering and

Applied Science. He has raised funds, recruited superb

faculty, and grown the school’s profile domestically

and overseas – and he has done it all while continuing

his own high-level research on boiling in space.

A gentle smile covers the dean’s face when he

talks about the engineering school, and it’s clear that

Dean Dhir has as much love for his administrative job

as he does for his research.

In addition to building a bigger and better

engineering school, Dhir has looked beyond

the traditional walls of the university

to enhance learning and build a community.

Dean Dhir Boldly Leads By Katharine Gammon

Page 15: UCLA Engineer Fall 2012

Pho

to: W

alte

r Uri

eU

CLA

EN

GIN

EE

R

| 13

Page 16: UCLA Engineer Fall 2012

Vijay Dhir found his love for engineering

in school in India, where he did his

undergraduate and masters’ degrees.

He first arrived at UCLA in 1974, after receiving

a doctorate in mechanical engineering at the

University of Kentucky. During the energy

crisis, he worked on ways to convert coal into

synthetic gas. Then, as a young UCLA assistant

professor, Dhir did an energy-source switch

and began researching nuclear safety. β€œIt

was brand-new, so I learned about nuclear

engineering while I was teaching courses in it,”

he says with a laugh. β€œInterestingly, I have

been involved in the energy business my

whole career.”

Dhir has made a profound impact since

taking the reins of UCLA Engineering in 2003.

His first effort was to give

the school a more multi-

disciplinary focus, and over

the past 10 years the school

has won 10 competitive

research centers from the federal government

and private industry to spur research and

development on emerging technologies. The

centers also bring in millions of dollars in

research funding each year. In addition to the

funds, the physical space has also expanded

under Dhir’s watch: the Engineering V building

has opened, allowing space for the new

Bioengineering Department and the Materials

Science and Engineering Department; and

Engineering VI is about to break ground.

With the new physical space comes

superb young faculty to fill it. Under Dhir’s

leadership, 60 new faculty have been added,

including some of the best junior faculty

anywhere. β€œUnder Dean Dhir's leadership, we

have recruited a group of distinguished young

faculty who have won wide and high recogni-

tions both domestically and internationally,”

said Frank Chang, chair of the Electrical

Engineering Department. β€œThe young faculty

members have already become global leaders

in each of their own research areas.”

Dhir has also worked hard to raise the

profile and resource base of the school. In

2003, when he became dean, US News and

World Report ranked the graduate school

22nd in the nation. Last year it garnered the

16th spot (9th among public universities). The

school’s extramural funding has swelled from

$54.9 million per year in 2001-2002 to

$105.8 million in 2010-2011. In Microsoft’s

Academic Search H-index, which measures

both the productivity and impact of published

work, UCLA Engineering is currently ranked

fourth in the world.

β€œMy most cherished dream for the school

is to be ranked at the very top.” says Dhir. β€œWe

have accomplished a lot in the last ten years, but

there is more we still need to do.” Dhir has taken

strides to improve all levels of education, making

curriculum changes that require students

to broaden their experience and technical

breadth by taking a three-course sequence in

another engineering field outside their major.

In addition to building a bigger and

better engineering school, Dhir has looked

beyond the traditional walls of the university

to enhance learning, and build a community.

Dean Dhir has inspired an entrepreneurial

spirit within UCLA Engineering that

is benefiting both the School and the

University. β€” DWIGHT STREIT, ITA DIRECTOR

β€œMy most cherished dream is for the school to be ranked

at the very top.” says Dhir.

Page 17: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

15

Under Dean Dhir's leadership, we have recruited a group of distinguished young faculty who have won wide and high recognitions both domestically and internationally. β€” PROFESSOR FRANK CHANG

pTwo bubble merger under microgravity conditions. The experiment on boiling heat transfer was carried aboard the International Space Station in 2011.

In 2007, he established the Institute for

Technology Advancement – an off-campus

organization to incubate new technologies

that could be commercialized. According to

Dhir, four companies already have come out of

the ITA, and there are four more in the pipeline.

Dwight Streit, the ITA’s director, says that Dhir

was instrumental in creating the opportunities

there. "Dean Dhir has inspired an entrepre-

neurial spirit within UCLA Engineering that

is benefiting both the school and the

university,” he said.

The community-building effort goes

beyond industry and into the next generation

of engineers. β€œDean Dhir has initiated a number

of outreach efforts to attract a diverse range

of students into engineering,” said mechanical

and aerospace engineering professor

Adrienne Lavine. In three separate newly-

created programs, UCLA engineering students

tutor local high school students online, faculty

host high school students in their research labs

in the summer, and this summer a Tech Camp

was launched in the school’s new Creativity

Center. In addition, the school has created an

online engineering masters’ program, with

more than 250 students enrolled. Students can

attend lectures, work with teaching assistants

and discuss assignments all online. Dhir plans

to take the program nationally and interna-

tionally in the future.

Even while fundraising for the school,

creating a vision for multi-disciplinary research

and education, and recruiting faculty,

Dhir continues to do research on the

fundamental process of boiling. β€œI

started as a researcher and teacher,

so that’s my first love in some sense,”

he said, adding that it’s still exciting

to discover new information

and knowledge. During his near-40

years at UCLA, he has published

more than 300 papers and has

advised more than 40 doctoral

students and 50 master’s students.

And, Dhir has continued his admin-

istrative and academic duties, he has

continued to serve on a number of

committees on behalf of the National

Research Council.

Dhir’s research has gone

far – his lab’s experiment on heat

transfer and boiling traveled to the

International Space Station in 2011.

As it turns out, bubbles behave very differently

under microgravity conditions – something

that will be important as manned missions

venture further into space. A mission to Mars,

which would take six months one-way, would

need to use a nuclear reactor to power the

ship. That reactor would need to boil water

and condense it – and Dhir has researched the

dynamics of bubbles on Earth and in micro-

gravity. From space and back, Dean Vijay K.

Dhir creates excellence wherever he goes. n

Page 18: UCLA Engineer Fall 2012

TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCGATGCGTCCACAACGCTACAAATGTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC

Page 19: UCLA Engineer Fall 2012

TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCGATGCGTCCACAACGCTACAAATGTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC

Pho

to: W

alte

r Uri

e

UC

LA E

NG

INE

ER

|

17

High-Speed, High-Volume, High-Precision By Matthew Chin

Bioengineering professor Dino Di Carlo works

to make the tools of biology and medicine

faster, automated and more accurate.

It’s a common theme in science fiction – a scientist peers into a microscope

at the fluid-filled slide, adjusts the focus, moves the slide, slowly fine-tunes

the focus until the targeted cell comes into view, and then… Eureka! They

found what they were looking for, whether it was good, bad, or unexpected.

Of course, while this makes for an excellent cinematic shot, it’s not the

way of the future. Or at least not how most biological analyses and health

care will be done. These analyses will be automated at speeds of tens of

thousands of cells per second, and with precision accurate enough to find

the earliest signs of disease in just a few of those cells.

Page 20: UCLA Engineer Fall 2012

Pho

to: W

alte

r Uri

e

UC

LA E

NG

INE

ER

|

18

uL to R: Henry Tse,

a post-doctoral fellow, Dino Di Carlo and

Mahdokht Masaeli, a Ph.D. student.

Most of what has created

the biggest impacts on

society can be considered

methods of automation.

Leading the way is Dino Di Carlo, a UCLA

associate professor of bioengineering, who

is exploiting the physical characteristics of

the micro-cellular environment to create and

develop miniaturized systems for biological

research and medical diagnostics.

β€œIn general, I think most of what has

created the biggest impacts on society can

be considered methods of

automation,” Di Carlo said.

β€œFor example, automating

information processing with

computers, automating

transportation with cars,

trains, and airplanes, and even automating

communication with phones and smart cell

phones. In our research group, we apply

unique microscale physical effects towards

the automation of diagnostics, life science

research, and cellular engineering.”

Think of a product assembly line’s quality

control steps. Di Carlo’s research themes follow

a similar principle in action, only operating

on cells in a fluid environment. Those bulky

table-top microscopes are now replaced

by silicon wafers, with precisely etched

channels that speed biological fluids through.

High-speed cameras and tracking software

monitor thousands of cells per second watching

for outliers – cells whose outward signs may

reveal deeper problems, such as cancer.

In one recent publication, Di Carlo and

his students in the Biomicrofluidics Laboratory

developed a new instrument that slams cells

against a wall of fluid. Knowing how those cells

respond following impact helps them identify

ones that could be cancerous or identify other

cell states. This platform could replace current

technologies that use expensive chemical tags.

But more than just engineering scientific

tools, Di Carlo has made several scientific

discoveries. In 2010, he and a colleague found

that particles will self-assemble in a fluid,

following similar patterns in nature from

phospholipids to spiral galaxies. And earlier

this year, Di Carlo looked at ways to construct

Page 21: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

19

Looking forward, Di Carlo has several other areas

he’s exploring. One area is exploring how microfluidic

technologies may help guide cellular evolution.

F A C T S & F I G U R E S

10 millionThe number of cells

probed and analyzed mechanically to date

100,000The number of cells that

can be imaged and analyzed per second in

Di Carlo's platform

pFocused fluorescent particles are separated based on inertial fluid dynamic effects.

these micro-channels to help particles self-

assemble, and then use assembled particles

themselves to create constructive wakes in

the fluid. Both have applications for future

microfluidic diagnostic device design.

The great potential in his research has

led to several prestigious recognitions for

Di Carlo, who received tenure earlier this

summer with a promotion to associate

professor. These include a Packard Fellowship

for Science and Engineering, from the David

and Lucile Packard Foundation; a Young Faculty

Award from the Defense Advanced Research

Projects Agency; an Early Career Development

award from the National Science Foundation;

and a Young Investigator Award from the Office

of Naval Research.

As a young faculty member, Di Carlo

has also enjoyed much success as a teacher

and mentor to outstanding graduate and

undergraduate students. UCLA Engineering’s

two most recent Outstanding Bachelor’s of

Science awardees both conducted research

in his lab. Earlier this year, a five-member

team of bioengineering seniors under his

advisement took their capstone project into a

national competition sponsored by the National

Institutes of Health, and won in the diagnostic

device category. The team’s winning

platform screened patients’ urine samples

for transitional cell carcinoma (TCC), a

common form of bladder cancer. And his first

Ph.D. graduate, Soojung Claire Hur, is currently

at Harvard University as a junior fellow at the

Rowland Institute.

Looking forward, Di Carlo has several other

areas he’s exploring. One area is exploring

how microfluidic technologies may help guide

cellular evolution. Beyond just controlling cells,

the idea would be to understand the molecular

and genetic basis for how cells behave. For

example, how do cells travel through the body,

or what is their durability against physical and

chemical changes. Research in this area could

eventually lead to insights on how evolved

cell populations may themselves have physical

characteristics that make them potential

candidates for therapeutic applications. n

βžβ€ƒ To find out more about Di Carlo’s

research: www.biomicrofluidics.com/

Page 22: UCLA Engineer Fall 2012

Pho

tos:

Mat

thew

Chi

n

UC

LA E

NG

INE

ER

|

20SCHOOL

News

TECH CAMPS DEBUT AT NEW STUDENT CREATIVITY CENTERBuilding robots that navigate mazes, or fine-tuning

electronic musical devices that work in harmony – for a

group of high school students from the greater Los Angeles

area, those were just a few of the projects they completed at

UCLA Engineering’s new Summer High School Tech Camp.

Two of the four-week camps were held during

the summer at the school’s new Creativity Center, a

5,000-square foot facility on the second floor of Boelter

Hall. The new technology sandbox is a space meant for

students to explore their imaginations.

β€œThe United States needs to increase the number of

students entering into science, technology, engineering

and mathematics (STEM) fields,” said Dean Vijay K. Dhir.

β€œAt UCLA Engineering, we are strongly committed to

doing our part to let young students, especially those

from underrepresented backgrounds, have an

excellent experience building and testing their

creations. We think our Tech Camps will enhance

the education they receive through their course

work in math and sciences.”

While summer is reserved for tech camps,

during the school year the Creativity Center will

be home to several of UCLA Engineering’s student

groups, providing much-needed space and access to

tools and equipment. n

βžβ€ƒ To find out more about the camps, visit:

www.esc.seas.ucla.edu

uTech Camp students demonstrated their robot that navigates a maze and performs tasks. The camp was held at the new Creativity Center.

Page 23: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

21

A new NSF-funded Engineering Research Center

and the debut of Tech Camps are a few of the

highlights for the past few months.

NEW ENGINEERING RESEARCH CENTER TO REVOLUTIONIZE NANOSCALE ELECTROMAGNETIC DEVICES

A multidisciplinary team of researchers from UCLA and

other universities is poised to help turn science fiction into

reality β€” in the form of some of the world's tiniest electro-

magnetic devices β€” thanks to a major grant from the

National Science Foundation's Engineering Research Center

(ERC) program.

The multi-million dollar grant will fund a new center

headquartered at UCLA's Henry Samueli School of

Engineering and Applied Science. It will focus on research

aimed at developing highly efficient and powerful electro-

magnetic systems roughly the size of a biological cell β€” systems that can power a range of devices, from

miniaturized consumer electronics and technologies important for national security to as-yet unimagined

machines, like nanoscale submarines that can navigate through the human blood stream.

Employing a fundamentally new approach to electromagnetic power at the nanoscale, researchers

at the NSF-funded TANMS center (Translational Applications of Nanoscale Multiferroic Systems) are working

to replace traditional wire-based electronics with a revolutionary technique that couples electricity and

magnetism by using multiferroic materials, which can be magnetically switched "on" and "off" by an

electric field.

UCLA's partners in the new center include UC Berkeley, Cornell University, Switzerland's ETH Zurich and

California State University, Northridge.

"We believe this is an opportunity for a truly revolutionary change in miniaturized electromagnetic

devices," said Greg Carman, director of the new center and a UCLA professor of mechanical and aerospace

engineering. "If you combine all three of our application areas β€” memory, antennas and motors β€” it really

opens the possibilities of what new platforms may become possible.” n

βžβ€ƒ The complete story is available online at: www.engineer.ucla.edu/TANMS-research-center

pTANMS researchers have used an electric field to turn a magnetic field on (left) and off (right). Credit: Ray C. J. Hsu, Mechanical and Aerospace Engineering

Page 24: UCLA Engineer Fall 2012

Pho

tos:

Gra

d Im

ages

UC

LA E

NG

INE

ER

|

22SCHOOL

News

1

4 6

5

2

3

1 Dr. Wanda Austin, president and CEO of The Aerospace Corporation, delivers the commencement address to the Class of 2012. She encouraged the graduates to change the world; advocate for STEM education; and be ethical role models.

2 Engineering graduates at the 2012 com-mencement.

3 Student speaker Melissa Erickson ’12, reflected on the unique experiences of UCLA engineering students, and how they are now ready for life’s next steps.

4 New graduates enter Drake Stadium, which was filled with family and friends.

5 Graduates try to find family.

6 Graduate degree candidates.

  To view remarks from Austin and from Erickson: www.engineer.ucla.edu/commencement-2012

2012 COMMENCEMENT

Page 25: UCLA Engineer Fall 2012

Pho

tos:

To

dd C

hene

y (7

and

8),

Inci

te P

hoto

grap

hy (9

)

UC

LA E

NG

INE

ER

|

23

7

9

8

7 The 2012 Senior Class Campaign Committee presents Dean Dhir with their contribution at the annual Senior Class Dinner. Owen Lutje ’10 was the emcee for the evening. All funds raised went to improve wireless capability within Boelter Hall.

8 The 2012 Engineering Graduate Student Association (EGSA) coordinated the first E-Grad Campaign, which raised money to support the building of Engineering VI. EGSA committee members celebrate here at the reception honoring their success.

9 Scholarship donors and recipients posed together at UCLA Engineering’s annual Scholarship Brunch honoring those who have funded undergraduate scholarships at the School.

SENIOR DINNER,E-GRAD CAMPAIGN RECEPTION and SCHOLARSHIP BRUNCH

Page 26: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

24ALUMNI

Notes

1960sHoward Kornstein ’63 has retired this year after an active

career in the European information technology industry.

This included working for Computer Sciences Corporation;

Data Applications International, which he co-founded;

Intel; and Digital Research. In 1985, he co-founded QA

Training Ltd where he later became managing director. The

firm grew to be one of the UK’s most successful technical

training companies. After QA was acquired, Kornstein

took on a number of

non-executive director-

ships in British high-tech

startups. His retirement

now allows him the

luxury of returning to

his engineering roots

to potter about with

computer technology.

Tom Lazear MS ’63, chairman of California-based Archway

Systems, received the inaugural Bentley Institute Lifetime

Achievement Award from Bentley Systems, Incorporated,

the leading company of comprehensive software solutions

for sustaining infrastructure. Lazear was recognized for

inspiring students, architects, and engineers to explore and

apply computer technology in the service of design and

engineering.

Herbert Hecht PhD ’67, was recently honored with the

Society of Automotive Engineers’ Elmer A. Sperry Award.

The award recognizes the development and implemen-

tation of methods and tools that improve dependability

and safety in transportation. Hecht founded SoHaR

Incorporated in 1978, and served as its president until 1995,

when he assumed his current role of chief engineer.

His career has been focused on the design and verification

of reliability and safety critical systems. He has headed

the certification of flight control systems for helicopters

and light aircraft, and participated in the certification

of the electric power system for the mostly electric

Global Express.

1970sJim Breese MS ’70 has finally retired after 50 years as an

engineer in the high-tech world. He has just released

an e-book that attempts to teach new graduates what

he learned about problem-solving during those years.

Available for your kids (or maybe your grand-kids, if they

are new grads) at Diesel e-books and other e-book outlets:

Famous By Friday is the title.

Van Schulz ’74 MS ’75 has been named the University of

California Alumni-Regent Designate, and Immediate Past

Chair, UCLA Alumni Association Board of Directors. The

appointment was effective July 1, 2012.

Armando Benavides MS ’77, a systems engineer for Boeing

Satellite Systems in El Segundo, Calif. was recently awarded

his third patent applicable to GPS satellites. The title of this

patent is β€œSystem and method for accurate downlink power

control of composite QPSK modulated signals”.

Page 27: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

25

Share news about your career, personal

life, honors, awards, and more!

Dan Stephenson ’79 won four

gold medals at the Masters

World Swimming Champion-

ships, held in Riccione, Italy

in June 2012. Stephenson

also recently published The

Underwater Window, a novel

about friendship and rivalry

in the world of Olympic-level

swimming. Stephenson was

captain of the UCLA Men’s

Swimming Team in 1978-79.

1980sFarid Emrani ’83 MS ’85 was unanimously appointed by

the Logicube Board of Directors to become the President

and CEO of Logicube. Emrani is currently the Executive

Vice-President and COO. Logicube is the world’s leader

in hard drive duplication and eForensics solutions. Emrani

began his career at Logicube in 2005. Prior to joining the

company he held various engineering, marketing and sales

positions with Xerox Corporation, Lucent Technologies

and Agere Systems.

Gary Lee Moore ’85, City Engineer for the City of Los

Angeles, was appointed by Mayor Antonio Villaraigosa,

a UCLA alumnus in history, as interim general manager

of the city’s Information Technology Agency. The ITA is

responsible for the city’s computer networks, as well as

implements new technology. As City Engineer, Moore

oversees more than 800 engineers, architects, surveyors

and technical support staff and is responsible for the

planning, design and construction of all public facilities.

Moore has more than 27 years of public service and has

served as the city engineer since 2003.

Ljiljana Trajkovic PhD ’86, a professor in the School of

Engineering Science at Simon Fraser University, has

been awarded the IEEE Circuits and Systems Society 2012

Meritorious Service Award.

George A. Lesieutre PhD ’89, professor and head of

Aerospace Engineering at Pennsylvania State University,

presented a keynote address, β€œAdaptive Structures: The

Journey to Flight,” at the 53rd Structures, Structural

Dynamics, and Materials Conference of the American

Institute of Aeronautics and Astronautics (AIAA) in April.

1990sSteven Hast, ENG

’90 was recently

promoted to director

of the Astrodynamics

Department of The

Aerospace Corporation

in El Segundo, Calif.

Hast manages an

engineering team that

performs a wide variety of orbit-related

analyses, including orbit selection and satellite constellation

design, orbit perturbations and lifetime estimation, space

debris modeling and collision hazard assessment, optimal

on-orbit maneuvers and relative motion studies.

Page 28: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

26Thomas Piechota MS ’93 PhD ’97 was recently named

interim vice president for research and dean of the

Graduate College at the University of Nevada, Las Vegas.

Piechota is a professor in the Department of Civil and

Environmental Engineering. Most recently, he served as

associate vice president for interdisciplinary research. In

2008, he became the UNLV principal investigator on a

$15 million NSF grant to study of climate change in Nevada.

Kinam Kim PhD ’94 was one of 10 foreign associates elected

to the National Academy of Engineering , one of the most

prestigious recognitions bestowed to an engineer. Kim

is the CEO of Samsung Advanced Institute of Technology

(SAIT), Samsung Electronics Company. He was recognized

for his contributions to semiconductor technologies for

DRAM and nonvolatile memories. Kim is a former student of

electrical engineering professor Kang L. Wang.

2000sFather Trung H. Pham ’00, was recently ordained as a

priest in the Roman Catholic Church in the Society of Jesus

(Jesuits). Pham was born in Vietnam and immigrated to

Orange County, CA. with his family when he was a teenager.

Pham, who taught drawing and painting at Santa Clara

University also holds a master of fine arts degree from the

the Pratt Institute in New York.

Elizabeth M. Hagerman MS ’02 PhD ’07 has become

Rose-Hulman Venture’s new vice president. Rose-Hulman

Ventures offers a dynamic innovative space for students

at the Rose-Hulman Institute of Technology to apply their

studies to real-world issues. While at UCLA, Hagerman

focused her studies in biomedical engineering on

orthopedic biomaterials. Previously, Hagerman held

leadership roles at Baxter Healthcare.

Helen Jung ’02, MS ’05, PhD ’09, P.E., a faculty member

in the Department of Civil Engineering at California Baptist

University has finished her term as interim chair in

2010-2011 and is now the department chair.

Paul Medvedev ’02 recently became an assistant

professor at Pennsylvania State University in the

Department of Computer Science and Engineering, as

well as in the Department of Biochemistry and Molecular

Biology. His current focus is on DNA structural and

copy-number variations – which play an important role

in the development and progression of diseases. He was

also named one of 2011’s β€œTomorrow’s PIs” by Genome

Technology magazine.

Chad Rosen ’05 (B.A. Hebrew)

and Sarah (Tobin) Rosen ’05

welcomed their second Bruin,

Adam Samual (Class of ’34),

to the family in late August.

Adam, no doubt a future

engineer, joins big sister

Adena (UCLA class of β€˜31).

Matt Olsson ’07 has enrolled at the University of Chicago,

Booth School of Business.

Alex Kroll ’08, MS ’09 is currently serving as a 1st Lieutenant

in the Untied States Air Force as a pilot of the B-52 bomber.

Kroll was recently married.

Julie Nichols MS ’09 represented the United States

at the 2012 Olympic Games. She competed in the

lightweight women’s double sculls with rowing partner

Kristin Hedstrom.

2010sThomas Cowan ’11 is

currently working as an

attitude control system

engineer at Boeing’s

Satellite Development

Center in El Segundo, Calif.

He has taken on various analysis and systems engineering

tasks supporting Boeing’s 702 line of satellites. Cowan

recently started an M.S. in Aerospace Engineering at UCLA.

Page 29: UCLA Engineer Fall 2012

Online MastersThe primary purpose of this program is to enable employed engineers and computer scientists to enhance their technical education beyond the Bachelor of Science level, and to enhance their value to the technical organizations in which they are employed.

DISTINCTIVE FEATURES OF THE PROGRAMβ€’ Each course is fully equivalent to the corresponding on-campus course and taught by the faculty members who teach the on-campus course.

β€’ The online lectures are carefully prepared for the online student.

AREAS(CS)Computer ScienceComputer Networking

(EE)Electrical EngineeringIntegrated CircuitsSignal Processing &

Communications

(MSE)Materials Science

Advanced Structural Materials

Electronic Materials

(MAE)Mechanical EngineeringAerospace EngineeringManufacturing and

Design

(EN)Systems Engineering

Additional information and online applications available at: msol.ucla.edu

Page 30: UCLA Engineer Fall 2012

TTGG

CGTA

ATCA

TGGT

CATA

GCTG

TTTC

CTGT

GTGA

AATT

GTTA

TCCG

CGAT

GCGT

CCAC

AACG

CTAC

AAAT

GTTG

GCGT

AATC

ATGG

TCAT

AGCT

GTTT

CCTG

TGTG

AAAT

TGTT

ATCC

GCGA

TGCG

TCCA

CAAC

GCTT

UC

LA E

NG

INE

ER

|

28FACULT Y

NewsU

CLA

Eng

inee

ring

New

Fac

ulty WENTAI LIU

Professor of Bioengineering

Ph.D. – University of Michigan

Wentai Liu studies the neural implants dealing with nerves and

muscles for retina, epilepsy, muscle, eyelids, spinal cord, and bladder.

Liu has been leading the engineering efforts of the retinal prosthesis to

restore vision, finally leading to successful implant trials in blind patients.

Liu has received several notable honors for his research including

a Popular Mechanics Breakthrough Award in 2010; an R&D 100 Award

in 2009; the Alcoa Foundation's Distinguished Engineering Research

Award, a NASA Group Achievement Award, and several outstanding paper

awards from IEEE. Liu has also received an Outstanding Alumni Award

from National Chiao-Tung University in Taiwan, where he received his

bachelor’s degree

Before joining UCLA Engineering in Winter 2012, Liu was a

professor at the Jack Baskin School of Engineering at the University of

California, Santa Cruz. Prior to that, Liu was a professor at North Carolina

State University. n

Page 31: UCLA Engineer Fall 2012

010101010100001101001100010000010010000001000101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001001000011001010110111001110010011110010010000001010011011000010110110101110101011001010110110001101001001000000101001101100011011010000110111101101111011011000010000001101111011001100010000001100101011011100110011101101001011011100110010101100101011100100110100101101110011

TTGG

CGTA

ATCA

TGGT

CATA

GCTG

TTTC

CTGT

GTGA

AATT

GTTA

TCCG

CGAT

GCGT

CCAC

AACG

CTAC

AAAT

GTTG

GCGT

AATC

ATGG

TCAT

AGCT

GTTT

CCTG

TGTG

AAAT

TGTT

ATCC

GCGA

TGCG

TCCA

CAAC

GCTT

UC

LA E

NG

INE

ER

|

29

WEI WANG

Professor of Computer Science

Ph.D. – UCLA Henry Samueli School of Engineering and Applied Science

Wei Wang’s research interests are in data mining, bioinformatics and

computational biology, and databases. She has filed seven patents, and

has published one monograph and more than 100 research papers in

international journals and major peer-reviewed conference proceedings.

Prior to joining UCLA Engineering, Wang spent 10 years as a faculty

member in the Computer Science Department at the University of North

Carolina, Chapel Hill. She was also a member of the Carolina Center for

Genomic Sciences and the Lineberger Comprehensive Cancer Center.

Wang was a research staff member at the IBM Thomas J. Watson Research

Center before joining UNC.

Wang’s honors include the NSF CAREER Award, IBM Invention

Achievement Award (twice), and she was a Microsoft Research Faculty

Fellow. She is currently an associate editor for ACM Transactions on

Knowledge Discovery in Data, International Journal of Knowledge

Discovery in Bioinformatics, and the International Journal of Data Mining

and Bioinformatics. n

Page 32: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

30FACULT Y

Honors and Awards

Judea Pearl wins ACM TURING AWARD for contributions that transformed artificial intelligenceACM, the Association for Computing Machinery, presented Judea Pearl,

UCLA professor of computer science, with the 2011 ACM A.M. Turing

Award for innovations that enabled remarkable advances in the partnership

between humans and machines that is the foundation of Artificial

Intelligence (AI).

The ACM Turing Award, widely considered

the β€œNobel Prize in Computing,” carries a

$250,000 prize, with financial support provided

by Intel Corporation and Google Inc. It is named

for the British mathematician Alan M. Turing,

whose 100th anniversary was celebrated in June

at the ACM 2012 Turing Centenary Celebration.

Pearl pioneered developments in probabilistic and causal reasoning

and their application to a broad range of problems and challenges. He

created a computational foundation for processing information under

uncertainty, a core problem faced by intelligent systems. He also developed

Page 33: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

31

UCLA Engineering's distinguished faculty have

won numerous accolades for their excellence in

research, teaching and service.

graphical methods and symbolic calculus that enable machines to reason

about actions and observations, and to assess cause-effect relationships

from empirical findings. His work serves as the standard method for

handling uncertainty in computer systems, with applications ranging from

medical diagnosis, homeland security and genetic counseling to natural

language understanding and mapping gene expression data. His influence

extends beyond artificial intelligence and even computer science, to human

reasoning and the philosophy of science.

β€œLike Alan Turing himself, Pearl turned his thinking

to constructing procedures that might be harnessed

to perform tasks traditionally associated with human

intelligence,” said Vint Cerf, chair of the ACM 2012 Turing

Centenary Celebration, and a former ACM Turing Award

recipient. β€œHis accomplishments over the last 30 years have provided the

theoretical basis for progress in artificial intelligence and led to extraor-

dinary achievements in machine learning, and they have redefined the term

β€˜thinking machine.’” Cerf pointed to Pearl’s innovation as a quantum leap

from Turing’s β€œtest” dating to the 1950s, when Turing set out to discover if

machines could think. (from ACM) n

βžβ€ƒ www.engineer.ucla.edu/pearl-turing

βžβ€ƒ http://acm.org/pearl

His work serves as the

standard method for

handling uncertainty in

computer systems.

Page 34: UCLA Engineer Fall 2012

Pho

to: S

andy

Sch

aeff

er

UC

LA E

NG

INE

ER

|

32

Vaughan Receives UNITED STATES’ HIGHEST AWARD for Young Engineers and Scientists By Wileen Wong Kromhout

Jennifer Wortman Vaughan, an assistant professor

of computer science, received the Presidential

Early Career Award for Scientists and Engineers

(PECASE), the highest honor given by the United

States government to young engineers and scientists at

the outset of their professional careers.

Vaughan received the award in August at a special

ceremony for the PECASE honorees in Washington, D.C.

at the Smithsonian Institution’s National Museum of

Natural History. John P. Holdren, Assistant to the President for Science and Technol-

ogy and Director of the White House Office of Science and Technology Policy led the

ceremony. The award winners then met with President Obama at the White House.

"Discoveries in science and technology not

only strengthen our economy, they inspire us as

a people,” President Obama said. β€œThe impressive

accomplishments of today’s awardees so early in

their careers promise even greater advances in

the years ahead.”

Vaughan’s research interests are in machine learning, algorithmic aspects of

economics, and social computing.

”It is a huge thrill and an honor to receive this award,” said Vaughan, who holds

the Symantec Term Chair in Computer Science. β€œIt’s exciting to see such strong

government support for basic research in science and engineering.”

The growing popularity of the Internet including social networking sites like

Facebook has led to the availability of novel sources of data on preferences, behaviors,

and beliefs of massive populations of users. A major goal of Vaughan’s research is to

bridge the gap between theory and practice by designing a new generation of machine

learning models and algorithms to address and explain the issues commonly faced

when attempting to aggregate local information across large online communities. n

βžβ€ƒ www.engineer.ucla.edu/vaughan-pecase

A major goal of

Vaughan’s research is to

bridge the gap between

theory and practice.

Page 35: UCLA Engineer Fall 2012

Pho

to: K

endr

a G

reen

berg

UC

LA E

NG

INE

ER

|

33

Yi Tang receives PRESIDENTIAL GREEN CHEMISTRY CHALLENGE

AWARD from EPABy Wileen Wong Kromhout

Yi Tang, professor of chemical and

biomolecular engineering, has been

awarded the prestigious 2012 Presidential

Green Chemistry Challenge Award from

the U.S. Environmental Protection Agency.

The annual award recognizes pioneering chemical

technologies developed by leading researchers and

industrial innovators who are making significant contri-

butions to pollution prevention in the United States

β€” including the design of safer and more sustainable

chemicals, processes and products that will protect

citizens from exposure to harmful materials.

Tang's winning technology resulted in a new,

less-hazardous manufacturing process

for simvastatin, a leading cholesterol-

lowering statin drug. Though the

drug is manufactured from a natural

product, the traditional synthesis

was a wasteful, multi-step chemical

process that used large amounts of

hazardous reagents.

Tang conceived of a synthesis

that instead used an engineered

enzyme and a practical, low-cost

feedstock. He partnered with Codexis Inc. β€” a

developer of industrial enzymes that enable the

cost-advantaged production of biofuels, bio-based

chemicals and pharmaceutical intermediates β€” to

optimize both the enzyme and the chemical

process for commercial use. Codexis will also be

presented with

the EPA award

as part of this

collaboration.

"Receiving

this award shows

the impact that

can be made in a highly synergistic collaboration

between academic and industrial research teams,"

Tang said. "The development and optimization of the

process have been highly rewarding for my research

group. Receiving this recognition from the EPA two

years after my colleague James Liao received the

same award is a strong testament to the quality and

impact of the research that is being conducted in

the Department of Chemical and Biomolecular

Engineering at UCLA."

Tang is also a professor of chemistry and

biochemistry in the UCLA Division of Physical

Sciences. n

βžβ€ƒ www.engineer.ucla.edu/

tang-green-chemistry

Tang's winning technology

resulted in a new, less-

hazardous manufacturing

process for Simvastatin.

Page 36: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

34

The Association for Computing

Machinery named Judea Pearl,

computer science, the winner of

the 2011 A.M. Turing Award, often

called the Nobel Prize for computing.

Pearl was recognized for innovations

that enabled remarkable advances

in artificial intelligence. Pearl also

received the Harvey Prize from the

Technion (Israel), for foundational

work that influenced spheres of

modern life. He was also named a

Fellow of the American Academy of

Arts & Sciences.

Henry Samueli, chairman, co-founder

and CTO of Broadcom Corporation

and an electrical engineering

professor, won the 2012 Marconi

Society Prize and Fellowship. Samueli

was selected for his pioneering

advances in the development and

commercialization of analog and

mixed-signal circuits for modern

communication systems, in particular

the cable modem. Samueli also

received the 2011 Dr. Morris Chang

Exemplary Leadership Award from the

Global Semiconductor Alliance.

Yi Tang, chemical and biomolecular

engineering, received the prestigious

2012 Presidential Green Chemistry

Challenge Award from the U.S.

Environmental Protection Agency.

The award recognizes pioneering

chemical technologies that will make

significant contributions to pollution

prevention. Tang was also named

a 2012 Arthur C. Cope Scholar by

the American Chemical Society, for

excellence in organic chemistry.

Aydogan Ozcan, electrical

engineering and bioengineering,

received the Presidential Early Career

Award for Scientists and Engineers

(PECASE), the highest honor given

by the United States government to

engineers and scientists at the outset

of their professional careers.

Ozcan received several other notable

honors in the previous year including:

the 2011 Army Research Office

Young Investigator Award, winning

the Health Alliance’s Innovators

Challenge; and seeing his cell-phone

based microscope selected as the top

innovation of 2011, from The Scientist

magazine. Also, he and a colleague

at Harvard received a Grainger

Foundation Frontiers of Engineering

Grant for Advancement of Interdis-

ciplinary Research from the National

Academy of Engineering.

Jennifer Wortman Vaughan,

computer science, received the

Presidential Early Career Award for

Scientists and Engineers (PECASE),

the highest honor given by the United

States government to engineers and

scientists at the outset of their profes-

sional careers. Vaughan holds the

Symantec Term Chair in

Computer Science.

Dino Di Carlo, bioengineering, was

awarded a Packard Fellowship for

Science and Engineering, from the

David and Lucile Packard Foundation.

Di Carlo received several other

notable honors in the previous year

including: a Young Faculty Award

from the Defense Advanced Research

Projects Agency; a Faculty Early Career

Development (CAREER) award from

the National Science Foundation; and

a 2012 Young Investigator Award from

the Office of Naval Research.

James C. Liao, chemical and

biomolecular engineering, was

honored by the White House as a

FACULT Y AWARDS

UCL A ENGINEERING 2011-2012

Page 37: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

35

Champion of Change, for his new

ideas for a clean energy future.

Liao holds the Parsons Chair in

Chemical Engineering.

Leonard Kleinrock, computer science,

was honored by IEEE with its 2012

Alexander Graham Bell Medal, for

pioneering contributions to modeling,

analysis and design of packet-

switching networks. Kleinrock was

also named to the inaugural class for

the Internet Hall of Fame, coinciding

with the Internet Society’s 20th

Anniversary.

William W-G. Yeh, civil and environ-

mental engineering, was named a

Fellow of the American Association

for the Advancement of Science, the

world’s largest general scientific

society and the publisher of the

journal Science. Yeh holds the Richard

G. Newman AECOM Chair in Civil

Engineering. Yeh also received a

Lifetime Achievement Award from

the 2012 Environmental & Water

Resources Institute, ASCE.

Kuo-Nan Liou, atmospheric

and oceanic sciences , electrical

engineering, and mechanical and

aerospace engineering, received the

2012 Quadrennial Gold Medal Award

from the International Radiation

Commission. He was recognized for

β€œcontributions of lasting significance to

the field of radiation research.”

M.C. Frank Chang, electrical

engineering, was elected to the

Academic Sinica, the highest

academic honor in Taiwan. Election

recognizes scholars with exemplary

research achievements in the fields

of mathematics and physical sciences,

life sciences, or humanities and social

sciences. Chang holds the Wintek

Chair in Electrical Engineering.

Russell Caflisch, mathematics, and

materials science and engineering

was among 220 distinguished scholars,

scientists, authors, artists, and

business and philanthropic leaders

elected to the American Academy of

Arts & Sciences.

C. Kumar N. Patel, physics and

astronomy, and electrical engineering,

was inducted into the National

Inventors Hall of Fame for his

invention of the carbon dioxide laser

in the early 1960s.

Algirdas Avizienis, computer science,

received the Jean-Claude Laprie

Award, which recognizes outstanding

papers published at least ten years

ago that have significantly influenced

dependable computing. Avizienis also

received the 2012 ACM/IEEE Eckert-

Mauchly Award, considered the

most prestigious award for computer

architecture.

Danijela Cabric, electrical

engineering, received a Faculty Early

Career Development (CAREER) award

from the National Science Foundation.

It funds her research on an integrated

physical and network layer approach

for wireless spectrum sharing. Cabric

also received an award for the UCLA

Hellman Fellows program, which

supports promising junior faculty.

Robert Candler, electrical

engineering, received a Young Inves-

tigator Award from the Army Research

Office. The award funds research on

fundamental mechanisms in which

energy is dissipated in nanoscale

vibrating structures.

Jiun-Shyan Chen, civil and environ-

mental engineering, mechanical

and aerospace engineering, and

mathematics, received the Compu-

tational Mechanics Award, from

the International Association for

Computational Mechanics. The award

recognizes significant contribu-

tions to traditional and new areas of

computational mechanics.

Panagiotis D. Christofides,

chemical and biomolecular

engineering, was elected a Fellow

of the International Federation

of Automatic Control (IFAC),

recognizing outstanding and

extraordinary contributions in the

fields of interest to IFAC.

Jason Cong, computer science,

received the 2012 ACM Transactions

on Design Automation of Electronic

Systems Best Paper Award, for the

journal entitled β€œBehavior-Level

Observability Analysis for Operation

continued

Page 38: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

36Gating in Low-Power Behavioral

Synthesis,” with co-authors from

UCLA Bin Liu and professor Rupak

Majumdar, and Zhiru Zhang from

AutoESL Design Technologies, Inc.

UCLA Engineering Dean Vijay K.

Dhir, mechanical and aerospace

engineering, was named an Honorary

Member of ASME, reserved for a

person who has made β€œdistinctive

contributions” to engineering,

science, industry, research, public

service, or other pursuits allied with

and beneficial to the engineering

profession. Dhir also received an

honorary degree from his Ph.D.

alma mater, the University of

Kentucky. He also received a Lifetime

Achievement Award from the

International Conference on

Computational & Experimental

Engineering and Sciences.

Lara Dolecek, electrical engineering,

received a Faculty Early Career

Development (CAREER) award from

the National Science Foundation.

The award funds her research on

improving the storage and processing

of massive amounts of data by

fundamentally rethinking the

underlying data reliability metrics.

Bruce Dunn, materials science and

engineering, was elected as a Fellow

of the Materials Research Society.

Dunn was cited for β€œextraordinary

contributions to development of new

materials based on sol-gel chemistry;

synthesis, characterization, and

development of electrochemical

materials; design, materials, and

fabrication processes for 3-D battery

technology.” Dunn holds the Nippon

Sheet Glass Chair in Materials Science.

Rajit Gadh, mechanical and aerospace

engineering, was elected a Fellow of

the American Society of Mechanical

Engineers (ASME) for his information-

based design and manufacturing.

Warren Grundfest, bioengineering,

has been appointed to the FDA

Science Advisory Board, to serve

on the Subcommittee for the

Center for Devices & Radiological

Health. This prestigious committee

provides scientific advice and

reviews regulatory science issues and

programs of the FDA.

Puneet Gupta, electrical engineering,

received an IBM Faculty Award.

Gupta’s lab focuses its research on

electronic design automation and

design for manufacturing, in particular,

application-architecture-implemen-

tation-fabrication interfaces.

Chih-Ming Ho, mechanical and

aerospace engineering, and bioen-

gineering, was appointed a visiting

member of the Hong Kong University

of Science and Technology’s Institute

of Advanced Study, which champions

collaborative projects across

disciplines and institutions. Ho holds

the Ben Rich Lockheed Martin Chair

in Aeronautics. Ho also presented

the Yunchuan Aisinjioro-Soo

Distinguished Lecture at the University

of Illinois, Urbana-Champaign.

Tatsuo Itoh, electrical engineering,

received the College of Engineering

Alumni Award for Distinguished

Service from the University of Illinois,

Urbana-Champaign. He was cited for

β€œSeminal Contributions in Microwave

and Millimeter-Wave Technology and

Electrical Engineering Education.”

Also, Itoh and graduate student

Hanseung Lee received the Best

Paper Award at the Asia Pacific

Microwave Conference 2011. Itoh

holds the Northrop Grumman Chair in

Microwave Electronics.

Bahram Jalali, electrical engineering

has been elected a Fellow of the

American Physical Society (APS)

for his significant and innovative

contribution to the application of

physics in science and technology

and advances in knowledge through

research. Jalali holds the Northrop

Grumman Chair in Opto-Electronics.

Jiann-Wen β€œWoody” Ju, civil and

environmental engineering, was the

keynote speaker at the Symposium

on β€œFundamental Theory for the

Performance Evolution and Sensing

Control of Urban Metro Structures."

Ju was also the Plenary Lecturer and

Conference Co-Chairman of the

First International Conference on

Damage Mechanics.

continued

Page 39: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

37

William Kaiser, electrical engineering,

and alumnus Henrik Borgstrom,

recently received a Best Paper award

from the ASEE for a publication

on their new hands-on instruction

technology developed for the UCLA

undergraduate curriculum.

Ann Karagozian, mechanical

and aerospace engineering, was

appointed as a Member-at-Large

of the U.S. National Committee on

Theoretical and Applied Mechanics.

On behalf of the National Academy of

Sciences and the National Research

Council, USNC/TAM is the official U.S.

representative to the International

Union of Theoretical and Applied

Mechanics.

Andrea M. Kasko, bioengineering,

received a 2011 NIH Director’s New

Innovator Award from the National

Institutes for Health. The program

supports exceptionally creative

investigators at an early stage in

their career.

Chang-Jin (CJ) Kim, mechanical and

aerospace engineering professor, was

selected by the Korean newspaper

Dong-A as one of β€œ100 People Who

Will Light Up Korea in Year 2020.”

The selection noted his outstanding

research in micro electro-mechanical

systems (MEMS).

Asad M. Madni, electrical

engineering, received the 2012 IEEE

Aerospace and Electronic Systems

Society’s (AESS) Pioneer Award for

the development and commercial-

ization of aerospace and electronic

systems. Madni also recently received

an honorary doctorate from Technical

University of Crete.

Jens Palsberg, computer science,

was honored by the Association

for Computing Machinery (ACM)

for services to the programming

languages community.

Alexander Sherstov, computer

science, received a Faculty Early

Career Development (CAREER) award

from the National Science Foundation.

The award funds Sherstov’s research

on communication complexity.

The UCLA Academic Senate awarded

Jonathan P. Stewart, civil and

environmental engineering, a Distin-

guished Teaching Award. Stewart was

recognized for distinction in teaching

at the graduate level.

Paulo Tabuada, electrical engineering,

and former student Adolfo Anta

received the 2011 George S. Axelby

Award at the 50th IEEE Conference

on Decision and Control. The award

recognizes the best paper published

in the IEEE Transactions on Automatic

Control in the previous two years.

Benjamin Williams, electrical

engineering, received a Faculty Early

Career Development (CAREER) Award

from the National Science Foundation.

The award supports his research

on β€œwidely tunable monolithic THz

waveguides, lasers, and arrays.”

Alan Willson, electrical engineering,

received the 2012 Darlington Best

Paper Award, from the IEEE Circuits

and Systems Society. The award

recognizes the best paper bridging

the gap between theory and practice

published in the β€œIEEE Transactions

on Circuits and Systems.” Willson

holds the Charles P. Reames Chair in

Electrical Engineering.

Gerard Wong, bioengineering, was

elected a fellow of the American

Physical Society for his contributions

to the understanding of electrostatic

interactions in biological systems.

Ya-Hong Xie, materials science and

engineering, received an Alexander

von Humboldt Research Award from

the Germany-based foundation. The

award recognizes a researcher’s

fundamental discoveries, new

theories, or insights that have had a

significant impact on their

own discipline.

The paper, β€œSystolic Arrays for

Lattice Reduction Aided MIMO

Detection,” authored by PhD student

Ni-Chung Wang, Adjunct Professor

Ezio Biglieri and Professor Kung Yao,

published in October 2011 in

IEEE Journal of Communications

and Networks, received the Best

Paper Award.

Page 40: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

38Ph.D. ALUMNI NEW ACADEMIC APPOINTMENTS

Chiao-En Chen, PhD ’09

Electrical Engineering/Communi-

cation Engineering

National Chung Cheng University,

Taiwan

ADVISOR: Kung Yao

Kai Chen, PhD ’09

Materials Science

Jiao Tung University, X’ian, China.

ADVISOR: King-Ning Tu

Ting-Hsuan Chen, PhD ’12

Mechanical and Biomedical

Engineering

City University of Hong Kong

ADVISOR: Chih-Ming Ho

Pei-Ling Chi, PhD ’11

Electrical Engineering

National Chaio Tung University,

Taiwan

ADVISOR: Tatsuo Itoh

Sheng-Wei Chi, PhD ’10

Civil and Materials Engineering

University of Illinois at Chicago

ADVISOR: Jiun-Shyan (JS) Chen

Yi-Chia Chou, PhD ’10

Materials Science and Engineering

National Chiao Tung University,

Hsinchu, Taiwan.

ADVISOR: King-Ning Tu

Wei-Ho Chung, PhD ’09

Research Center for Information

Technology Innovation

Academia Sinica, Taiwan

ADVISOR: Kung Yao

Marisa Eisenberg, PhD ’09

Epidemiology, Mathematics

University of Michigan

ADVISOR: Joseph DiStefano III

Zhen Gu, PhD ’10

Biomedical Engineering

North Carolina State University

ADVISOR: Yi Tang

Shalabh Gupta, PhD ’09

Electrical Engineering

Indian Institutes of Technology,

Bombay, India

ADVISOR: Bahram Jalali

Ping-Hsuan Hsieh, PhD ’09

Electrical Engineering

National Tsing-Hua University, Taiwan

ADVISOR: Chih-Kong β€œKen” Yang

Bryan Yu Hu, PhD ’09

Electrical and Computer Engineering

University of Alberta, Alberta, Canada

ADVISOR: Lei He

Dohyun Kim, PhD ’08

Mechanical Engineering

Myongji University, South Korea

ADVISOR: Jack Judy

Peter Bjorn Lillehoj, PhD ’11

Mechanical Engineering

Michigan State University

ADVISOR: Chih-Ming Ho

Jenny Yi-Chun Liu, PhD ’11

Electrical Engineering

National Tsing Hua University, Taiwan

ADVISOR: M.C. Frank Chang

Jinfeng Liu, Phd ’11

Chemical Engineering and Materials

Science

University of Alberta, Canada

ADVISOR: Panagiotis D. Christofides

Nicholas Mastronarde, PhD ’11

Electrical Engineering

The State University of New York at

Buffalo

ADVISOR: Mihaela van der Schaar

Manuel Mazo,Jr., PhD ’12

Delft Center for Systems and Control

Delft University of Technology,

Netherlands

ADVISOR: Paulo Tabuada

Youngsuk Nam, PhD ’10

Mechanical Engineering

Kyung Hee University, South Korea

ADVISOR: Y. Sungtaek Ju

Jaeok Park, PhD ’09

Economics

Yonsei University, South Korea

ADVISOR: Mihaela van der Schaar

Bibhudatta Sahoo, PhD ’09

Electronics & Electrical Communi-

cation Engineering

Indian Institute of Technology (IIT),

Kharagpur, India

ADVISOR: Behzad Razavi

Thomas Schmid, PhD ’09

Electrical and Computer Engineering

The University of Utah

ADVISOR: Mani Srivastava

Page 41: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

39

Wenjiang Shen, PhD ’04

Mechanical Engineering

Suzhou Institute of Nano-Tech and

Nano-Bionics, China

ADVISOR: Chang-Jin (CJ) Kim

James R. Springstead, PhD ’08

Paper Engineering, Chemical

Engineering and Imaging

Western Michigan University

ADVISOR: Harold G. Monbouquette

Vincent Tung, PhD ’09

Materials Science and Engineering

UC Merced

ADVISOR: Yang Yang

Tak-Sing Wong, PhD ’09

Mechanical and Nuclear Engineering

Pennsylvania State University

Ph.D. and POST-ADVISOR: Chih-Ming Ho

Judy P. Yang, PhD ’12

National Chiao Tung University,

Taiwan

ADVISOR: Jiun-Shyan (JS) Chen

Lap Yeung, PhD ’10

Electronic Engineering

Chinese University of Hong Kong

ADVISOR: Yuanxun Ethan Wang

Yan Yao, PhD ’08

Electrical and Computing Engineering

University of Houston

ADVISOR: Yang Yang

Hao Yu, PhD ’07

Electrical and Electronic Engineering

Nanyang Technological University,

Singapore

ADVISOR: Lei He

POST-DOCTORAL SCHOLARS ACADEMIC APPOINTMENTS

Keisuke Goda

Physical Chemistry

University of Tokyo

Post-doctoral advisor: Bahram Jalali

Xue Jin

Edinburgh University, Scotland,

United Kingdom

Post-doctoral advisor: Eric M.V. Hoek

Miuling Lam

Creative Media

City University of Hong Kong

Post-doctoral Advisor: Chih-Ming Ho

Arun Prakash

Civil Engineering

Purdue University

Post-doctoral advisor: Ertugrul

Taciroglu

Guy Ramon

Technion University, Israel

Post-doctoral advisor: Eric M.V. Hoek

FACULTY ENDOWED CHAIR HOLDERS

Ben Rich Lockheed Martin Chair in

Advanced Aerospace Technologies

Chih-Ming Ho

Carol and Lawrence E. Tannas, Jr.,

Endowed Chair in Engineering

Yang Yang

Charles P. Reames Endowed Chair in

Electrical Engineering

Alan Willson, Jr

Edward K. and Linda L. Rice Endowed

Term Chair in Civil Engineering

Materials

Gaurav Sant

Jonathan B. Postel Chair in Computer

Systems

Lixia Zhang

Jonathan B. Postel Chair in

Networking

Deborah Estrin

Nippon Sheet Glass Company Chair

Materials Science

Bruce S. Dunn

Norman E. Friedmann Chair in

Knowledge Sciences

Carlo Zaniolo

Northrop Grumman Chair in Electrical

Engineering/Electromagnetics

Yahya Rahmat-Samii

Northrop Grumman Chair in Electrical

Engineering

Tatsuo Itoh

Page 42: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

40Northrop Grumman Opto-Electronic

Chair in Electrical Engineering

Bahram Jalali

Ralph M. Parsons Foundation Chair in

Chemical Engineering

James C. Liao

Raytheon Chair in Electrical

Engineering

Kang L. Wang

Richard G. Newman AECOM Endowed

Chair in Civil Engineering

William W-G. Yeh

Rockwell International Chair in

Engineering

J. John Kim

Symantec Term Chair in Computer

Science

Jennifer Wortman Vaughan

William Frederick Seyer Endowed

Chair in Materials Electrochemistry

Jane P. Chang

Wintek Endowed Chair in Electrical

Engineering

M.C. Frank Chang

Vacant Chairs

Evalyn Knight Chair in Engineering

Leonard Kleinrock Term Chair in

Computer Science

Levi James Knight Jr. Chair in

Engineering

L.M.K. Boelter Chair in Engineering

Ronald and Valerie Sugar Chair in

Engineering

Raytheon Chair in Manufacturing

Engineering

Traugott and Dorothea Frederking

Endowed Chair in Cryogenics

William D. Van Vorst Chair in Chemical

Engineering Education

Chancellor’s Professors

Asad Abidi

Jiun-Shyan (JS) Chen

Jason Cong

Yi Tang

Demetri Terzopoulos

Mihaela van der Schaar

Samueli Fellows

Danijela Cabric

Eric Hoek

Yu Huang

Benjamin Williams

DEAN’S ADVISORY COUNCIL

William F. Ballhaus, Jr. PhD

CEO (Retired)

The Aerospace Corporation

Charles Bergan

Vice President

Engineering Research & Development

Qualcomm

Aaron S. Cohen ’58

Vice Chairman and Founder

National Technical Systems

Vinton G. Cerf MS ’70, PhD ’72

Chief Internet Evangelist

Google

Lou Cornell, P.E.

Vice President

Southern California District Manager

AECOM

Lucien β€œAl” Couvillon, Jr. ’62,

MS ’66

Retired

Vice President for Corporate R&D

Boston Scientific Corporation

R. Paul Crawford

Director of Health Research

Intel Labs

Richard A. Croxall

Vice President and Chief Engineer

(Retired)

Northrop Grumman Corporation

Siddhartha Dalal

Chief Technology Officer

RAND Corporation

Vijay K. Dhir

Dean

UCLA Henry Samueli School of

Engineering and Applied Science

James L. Easton ’59

Chairman and President

Jas D. Easton, Inc.

Gary W. Ervin ’80

Corporate Vice President & President

Aerospace Systems

Northrop Grumman Corporation

B. John Garrick MS ’62, PhD ’68

President & CEO (Retired)

PLG, Inc.

Sam F. Iacobellis MS ’63

Deputy Chairman (Retired)

Rockwell International Corporation

Page 43: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

41

William A. Jeffrey

President and CEO

HRL Laboratories, LLC

Leslie M. Lackman

Deputy Director, ITA

UCLA Henry Samueli School of

Engineering and Applied Science

Jeff Lawrence ’79

President and CEO

Clivia Systems

Steven D. Liedle

Project Manager

Bechtel Power Corporation

Rajeev Madhavan

Chairman and CEO

Magma Design Automation, Inc.

Joanne M. Maguire MS ’78,

CERT ’89

Executive Vice President

Lockheed Martin Space Systems

Pankaj Patel

Senior Vice President and General

Manager

Cisco Systems, Inc.

Rami R. Razouk ’75, MS ’75, PhD ’80

Senior Vice President

Engineering and Technology

The Aerospace Corporation

Edward K. Rice

Chairman

CTS Cement Manufacturing Company

Kevin Riley

President

Teledyne Scientific & Imaging, LLC

Henry Samueli ’75, MS ’76, PhD ’80

Chairman, co-founder and CTO

Broadcom Corporation

Gerald Solomon

Executive Director

Samueli Foundation

Dwight C. Streit MS ’83, PhD ’86

Professor

Director, Institute for Technology

Advancement

UCLA Henry Samueli School of

Engineering and Applied Science

Lawrence E. Tannas, Jr. ’59, MS ’61

Electronics Consultant

Tannas Electronics

Murli Tolaney

Chairman

MWH Global, Inc.

John J. Tracy, Ph.D

CTO & SVP of Engineering, Operations

& Technology

The Boeing Company

Stephen Trilling CERT ’00

Vice President

Security Technology and Response

Symantec Corporation

Nicholas M. Uros ME ’84, CERT ’93

Vice President

Advanced Concepts and Technology

Raytheon Systems Company

David A. Whelan MS ’78, PhD ’83

Vice President, General Manager, and

Deputy to the President

The Boeing Company

FACULTY PATENTS AWARDED 2011-2012

M.C. Frank Chang, holder of the

Wintek Endowed Chair in Electrical

Engineering, Daquan Huang, and Tim

LaRocca: Origami cascaded topology

for analog and mixed-signal appli-

cations; Submillimeter-wave signal

generation by linear superimposition

of phase-shifted fundamental tone

signals (two patents).

Chang, Huang and Willian Hant:

Tunable artificial dielectrics.

Chang, Qun Gu, Jenwei Ko, and

Zhiwei Xu: Self-sychronized radio

frequency interconnect for three-

dimensional circuit.

Francis Chen, professor emeritus of

electrical engineering, and Humberto

Torreblanca: Helicon plasma source

with permanent magnets.

Wesley Chu, professor of electrical

engineering, Jianming He, and

Zhenyu Liu: System and methods for

evaluating interferences of unknown

attributes in a social network.

Eric M.V. Hoek, associate professor of

civil and environmental engineering,

Asim Ghosh, and Jodie Nygaard:

Micro and nanocomposite support

structures for reserve osmosis thin

film membranes.

Page 44: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

42Mario Gerla, professor of computer

science, and M. Yahya Sanadidi: TCP

Westwood with priorities for quality

of service differentiation at the

transport layer.

Tatsuo Itoh, holder of the Northrop

Grumman Chair in Electrical

Engineering, and Pei-Ling Chi:

Compact dual-band metamaterial-

based hybrid ring coupler.

Itoh, Christophe Caloz, and Hsiang

Lin: Composite right/left-handed

(CRLH) couplers.

CJ Kim, professor of mechanical

and aerospace engineering, and

De-Sheng Meng: Method and

Apparatus for pumping liquids using

direction growth with elimination of

bubbles.

Kim and Jane Tsai: Printing pins

having selective wettability and

method of making same.

Kim, and Gaurav Jitendra Shah:

Methods for using magnetic particles

in droplet microfluidics.

Rafail Ostrovky, professor of

computer science: Method for low

distortion embedding of edit distance

to hamming distance.

Jacob Schmidt, associate professor

of bioengineering, Tae Joon Jeon,

Noah Malmstadt, and Jason Poulos:

Formation and encapsulation of

molecular bilayer and monolayer

membranes.

Kang L. Wang, holder of the

Raytheon Chair in Electrical

Engineering, Fei Liu, and Siguang Ma:

Carbon nanotube/nanowire thermo-

photovoltaic cell.

Wang, Mary Eshaghian-Wilner and

Alexander Khitun: Spin-wave

architectures.

Benjamin Wu, professor of

bioengineering: Composition for

promoting cartilage formation

or repair comprising a NELL Gene

produce and method of treating;

Expression of NELL Peptide; NELL

peptide expression systems and bone

formation activity of NELL peptide;

and NELL-1 enhanced bone mineral-

ization (four patents).

Yang Yang, holder of the Carol and

Lawrence E. Tannas, Jr., Endowed

Chair in Engineering, and Jinsong

Huang: Polymer electronic devices

by all-solution process.

Ya Hong Xie, professor of materials

science and engineering: Spin

injection device having semicon-

ductor-ferromagnetic-semiconductor

structgure; Spin injector. (two

patents).

THE 2012 BOELTER SOCIETY HONOR ROLL

DEAN’S VISIONARIESThe Dean’s Visionaries are individuals who have committed one million dollars or more, over the course of their lifetime or through their estate, to support the students and faculty of the UCLA Henry Samueli School of Engineering and Applied Science.

Degrees listed include UCLA alumni and parents of engineering students.

Robert B. Allan Trust

Therese Kerze-Cheyovich Family Trust

Aaron S. Cohen ’58 and Nancy D. Cohen

Ralph E. Crump ’50 and Marjorie L. Crump ’46

James L. Easton ’59 and Phyllis F. Easton

Rhodine R. Gifford and Jack Gifford* ’63

Kalosworks.org

W. N. Lin, Parent ’11

Robert Nakich ’65, MS ’69 Trust

Mukund Padmanabhan MS ’89, PhD ’92

Charles P. Reames MS ’80, ENG ’82, PhD ’85 and Deborah A. Reames

Edward K. Rice and Linda L. Rice

Henry Samueli ’75, MS ’76, PhD ’80 and Susan F. Samueli

Patrick Soon-Shiong and Michele C. Soon-Shiong

Ronald D. Sugar ’68, MS ’69, PhD ’71 and Valerie H. Sugar ’71

Lawrence E. Tannas, Jr. ’59, MS ’61 and Carol A. Tannas, Parents ’85

*Deceased

Page 45: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

43

LIFETIME MEMBERSThis honor roll gratefully acknowl-edges those who have given $100,000 or more over the course of their lifetime or through their estate.

Sheldon G. Adelson and Miriam O. Adelson

Balu Balakrishnan MS ’76 and Mohini Balakrishnan, Parents ’11

Harold S. Becker ME ’59 and Marilyn L. Becker

Benton Bejach and Wanlyn Bejach

Mark Berman MS ’92, PhD ’95 and Sharon B. Berman ’91

Bernard L. Beskind ’62, ME ’66 and Lois R. Beskind

John Burnett

Vinton G. Cerf MS ’70, PhD ’72 and Sigrid L. Thorstenberg

Valerie Choudhury

Josephine Cheng ’75, MS ’77 and Michael Y. Pong

Brian L. Cochran ’54 and Nancy A. Cochran

Aaron S. Cohen ’58 and Nancy D. Cohen

Neal M. Cohen ’87 and Adrienne D. Cohen ’86

Robert N. Crane MS ’65, PhD ’70

Irina Cromwell

Ralph E. Crump ’50 and Marjorie L. Crump ’46

Alan P. Cutter ’61, MBA ’64

Stanley A. Dashew

Noel J. Deitrich ’67

James L. Doane ’68 and Jean M. Doane

James L. Easton ’59 and Phyllis F. Easton

Thelma Estrin

Christopher P. Ferguson ’86, PhD ’99

Barry J. Forman ’60

Dorothea H. Frederking

Norman E. Friedmann ’50, MS ’52, PhD ’57 and Irene C. Kassorla ’63, MA ’65

B. John Garrick MS ’62, PhD ’68 and Amelia Garrick

Richard L. Gay ’73, MS ’73, PhD ’76

Rhodine R. Gifford

H. P. Gillis

Bruce E. Gladstone ’57, MS ’62 and Beverly J. Gladstone ’59

Ms. Victoria F. Goldberg ’87

Hisayo Graham

Armond Hairapetian ’87, MS ’88, PhD ’93, MFE ’09 and Elena Hairapetian ’96

Kevin G. Hall, Parent ’06

James N. Harger ’80

Ernest R. Harris ’49

Robert Hawley MS ’91, PhD ’97

Franklin J. Henderson and Doris B. Henderson

P. Michael Henderson

Jerome Hollander ’48 and Sonya Hollander

Hyley Huang, Parent ’09

Jau-Hsiung Huang MS ’85, PhD ’88 and Hua J. Chang MBA ’88

Pearl Illg ’70

B. V. Jagadeesh

Kalosworks.org

James F. Kerswell ’66 and Elizabeth Szeliga-Kerswell

Toshiko Kikuchi

Elizabeth Argue Knesel

Ryo Kokubu

Jeff Lawrence ’79 and Diane E. Troth ’80, MS ’81

Terence Lim ’92

Robert P. Lin and Lily W. Lin

W. N. Lin, Parent ’11

Fang Lu MS ’88, ENG ’89, PhD ’92 and Jui-Chuan Yeh MPH ’96

Daniel C. Lynch MA ’65

Asad M. Madni ’69, MS ’72 and Gowhartaj A. Madni, Parents ’08

Dennis Maynard ’69

Jonathan S. Min PhD ’95, MBA ’07

David Mong ’84 and Emmy Mong

Richard Nesbit and Rose Marie Nesbit

Henry T. Nicholas, III ’82, MS ’85, PhD ’98

Stacey E. Nicholas ’85, MS ’87

Tracy Nishikawa MS ’85, PhD ’88 and Gail K. Masutani

Sallie Boyd O’Neill

Marie A. Oberholtz

Mukund Padmanabhan MS ’89, PhD ’92

Michael W. Phelps ’71, MS ’71

Richard W. Phillips

Simon Ramo

Charles P. Reames MS ’80, ENG ’82, PhD ’85 and Deborah A. Reames

Edward K. Rice and Linda L. Rice

Henry Samueli ’75, MS ’76, PhD ’80 and Susan F. Samueli

Shioupyn Shen PhD ’91 and Waishan Wu

Shiva Shivakumar ’94

Bernard Shyffer ’49, MS ’63 and Barbara W. Shyffer

Richard G. Somers and Mary E. Bosak

Alfred W. Sommer and Joyce Sommer

Patrick Soon-Shiong and Michele C. Soon-Shiong

Page 46: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

44Oscar M. Stafsudd, Jr. and

Jacqueline Stafsudd

Eugene P. Stein ’68 and Marilyn L. Stein

Richard Stevenson and Kirsten L. Sommer ’60

David E. Storrs ’82, MS ’83

Ronald D. Sugar ’68, MS ’69, PhD ’71 and Valerie H. Sugar ’71

Lawrence E. Tannas, Jr. ’59, MS ’61 and Carol A. Tannas, Parents ’85

Raymond M. Taylor, Jr. ’62, MS ’66

Kathleen Tipton

Spyros I. Tseregounis MS ’82, PhD ’84 and Linda P. B. Katehi MS ’81, PhD ’84

King-Ning Tu

Sumermal Vardhan and Raj Kumari Vardhan, Parents ’92, ’98

V. M. Watanabe ’72

Robert K. Williamson ’62, MS ’64, PhD ’69 and Sandra Williamson

Marc A. Wood ’69, ME ’85

Tien-Tsai Yang PhD ’68 and Jane J. Yang PhD ’71

William W. Yeh and Jennie P. Yeh PhD ’75

Norman L. Yeung ’77

Anonymous (7)

DEAN’S LOYALTY CIRCLE The new Dean’s Loyalty Circle honors donors who make a gift to UCLA Engineering for three or more consecutive years at $2,500 or more. Members of the Dean’s Loyalty Circle are among UCLA Engineering’s most dedicated supporters, providing the school with a consistent source of vital funding.

Β’Dean’s Loyalty Circle donors

2011-2012 MEMBERSThis honor roll gratefully acknowl-edges gifts made to the UCLA Henry Samueli School of Engineering and Applied Science from July 1, 2011 through June 30, 2012.

Dean’s Ambassadors - $100,000 to $999,999Balu Balakrishnan MS ’76 and

Mohini Balakrishnan, Parents ’11

Josephine Cheng ’75, MS ’77 and Michael Y. Pong Β’

James N. Harger ’80

Hyley Huang, Parent ’09

Fang Lu MS ’88, ENG ’89, PhD ’92 and Jui-Chuan Yeh MPH ’96 Β’

David Mong ’84 and Emmy Mong

Mukund Padmanabhan MS ’89, PhD ’92 Β’

Edward K. Rice and Linda L. Rice Β’

Lawrence E. Tannas, Jr. ’59, MS ’61 and Carol A. Tannas, Parents ’85 Β’

Dean’s Scholars - $50,000 - $99,999Benton Bejach and Wanlyn Bejach

Robin B. Joshi ’89, MS ’91, PhD ’95 and Celia Joshi ’89 Β’

Kalosworks.org

Ryo Kokubu

W. N. Lin, Parent ’11

John E. Rex ’74

Shioupyn Shen PhD ’91 and Waishan Wu

Allen M. Yourman, Jr. ’76, MS ’78 and Kimberley E. Yourman ’73 Β’

Boelter Investors - $25,000 - $49,999Aaron S. Cohen ’58 and

Nancy D. Cohen Β’

Ralph E. Crump ’50 and Marjorie L. Crump ’46 Β’

B. John Garrick MS ’62, PhD ’68 and Amelia Garrick

Vincent S. Ho ’86, MS ’86, PhD ’90, MBA ’94

Charles Seim ’52 and Janet Y. Seim

Eugene P. Stein ’68 and Marilyn L. Stein Β’

King-Ning Tu

Boelter Fellows - $10,000 - $24,999Beatrice D. Beggs ’63, MA ’67

Raymond S. Beggs Β’

Jiwen Cai MS ’12

Yen-Ju Chen ’88 and Fai-Long Kuo

Youngsoo Cha and Jin Hee Choi, Parents ’15

Dorothea H. Frederking Β’

Marjorie R. Friedlander

Andrew A. Holden, Parent ’13

Ronald E. Kent ’57 and Myra Kent ’55

Ajit K. Mal and Rosita N. Mal Β’

Waleed M. Namoos ’94

Jonathan M. Orszag and Rica Orszag ’93 Β’

Pankaj S. Patel, Parent ’06 Β’

Christopher S. Proctor ’82 and Julie A. Proctor ’82, Parents ’16

Andrew W. Pryor-Miller ’08

Thierry Sanglerat and Rita Y. Sanglerat, Parents ’13 Β’

Michael K. Stenstrom Β’

Vijayakumar Tella MS ’88

Spyros I. Tseregounis MS ’82, PhD ’84 and Linda P. B. Katehi MS ’81, PhD ’84 Β’

Yang Yang and Danmei Lee Β’

Anonymous

Boelter Sponsors - $5,000 - $9,999Andrew D. Africk ’88 and Jackie Africk Β’

David C. Banks ’80, MS ’81 and Judy Banks, Parents ’12 Β’

Page 47: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

45

James D. Barrie ’83, MS ’85, PhD ’88 and Leslie A. Momoda ’85, MS ’87, PhD ’90 Β’

Mark Berman MS ’92, PhD ’95 and Sharon B. Berman ’91

Ming-Li Chai

Alan P. Cutter ’61, MBA ’64 Β’

Hernan Pongan De Guzman ’85 and Suanne C. De Guzman, Parents ’14

Dennis J. Drag MS ’69, PhD ’82 and Leslie A. Drag Β’

James L. Easton ’59 and Phyllis F. Easton Β’

Bob English ’82 and Anna M. Zara Β’

Hsiou-Ling C. Hsiang, Parent ’13

Paul J. Jansen and Deborah K. Jansen, Parents ’13

Russell W. Krieger, Jr. ’70 and Linda M. Krieger

Leslie M. Lackman and Marjorie M. Lackman Β’

Elaine C. Lewis-Hovind ’52

Kenneth H. Ma ’83, MS ’84 and Linda Ma ’84 Β’

Carol L. Massey, Parent ’13 Β’

Jerry Y. Ogawa ’69 Β’

Dodd R. Portman and Lucia Portman, Parents ’13

Simon Ramo

Marvin Rubinstein ’53 Β’

George S. Stern ’58, MA ’59, PhD ’64 and Adele R. Stern Β’

Dwight C. Streit MS ’83, PhD ’86 and Deborah Streit

Ghassan Toubia ’81 and Nina Toubia

Ernst Volgenau PhD ’66 and Sara L. Volgenau

Robert M. Webb ’57, MS ’63, PhD ’67 and Dorothy Webb

Tien-Tsai Yang PhD ’68 and Jane J. Yang PhD ’71 Β’

Boelter Associates - $2,500 - $4,999Jacqueline N. Anderson ’06

William Ballhaus, Jr. and Jane K. Ballhaus Β’

Fred J. Barker and Su Barker, Parents ’14

Robert J. Barker ’68, MBA ’70 and Ildiko V. Barker Β’

Gary H. Burdorf ’87, MS ’89, PhD ’93 and Sherry L. Burdorf ’86, MBA ’90 Β’

Jone Chen

Kaiwen Cheng

Douglas Corbett ’73 and Lisa L. Corbett Β’

Michael Deutsch ’78, MS ’80 and Elena Deutsch

Vijay K. Dhir and Komal Dhir Β’

Navin H. Doshi and Pratima Doshi

Kenneth I. Friedman ’61 Β’

Norman A. Futami and Jean K. Futami MBA ’87, Parents ’13

Hisayo Graham MS ’60, PhD ’69

Robert A. Green ’72, JD ’75 and Judy A. Green, Parents ’03

Gene C. Gritton ’63, MS ’65, PhD ’67 and Gwendolyn O. Gritton Β’

Ernest R. Harris ’49 Β’

John M. Haworth

Jeffrey A. Houck and Monica C. Houck, Parents ’13 Β’

Henry G. Jung ’87

David B. Kennedy ’83 and Ruth A. Holly, Parents ’15

David W. Kim ’98, MS ’01

Francis H. Kishi ’53, MS ’58, PhD ’63

Jeff Lawrence ’79 and Diane E. Troth ’80, MS ’81

Sanboh Lee

Keith R. Leonard, Jr. ’84, MBA ’95 and Nanette L. Leonard ’84 Β’

Ralph C. Levin ’51

Craig R. Moles MS ’89 and Nancy L. Moles Β’

James Murray ’70, MS ’71 and Carol L. Donald

Carey S. Nachenberg ’95, MS ’95 Β’

Daniel C. Pappone ’77 and Syndie B. Meyer

Kenneth W. Privitt ’77, MS ’80 and Nancy G. Privitt ’78

Alfonso Fred Ratcliffe ’51, MS ’63, PhD ’70 and Dolores C. Ratcliffe

Joseph J. Rice ’88 and Monica Rice

Glenn M. Sakamoto ’82, MS ’84

Peter B. Sender and Haya S. Sender, Parents ’09 Β’

Durwin L. Sharp ’70, MBA ’74, PhD ’79 and Christianne Melanson

Akira Shinoda ’67 Β’

Steve J. Shire and Maria Yang, Parents ’13

Chet M. Thaker ’74 and Julie Dobson

Brian J. Thompson and Janet L. Thompson, Parents ’15

David K. Triolo ’80 Β’

Sarah M. Vasquez ’08

Benjamin C. Wang ’90 and Diana Tran Wang Β’

Feng C. Wang MA ’65 and Yung H. Wang* MBA ’70 Β’

Benjamin M. Wu and Betty Wu Β’

Russell G. Yee and Anne C. Wang Yee ’89 Β’

Guo-Feng Yuan

Boelter Contributors - $1,000 - $2,499Arlene G. Adams

John S. Adams ’62

Page 48: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

46Darren Aghabeg ’89 and

Angela Aghabeg

Song-Haur An MS ’81, ENG ’83, PhD ’86 and Agnes An

James Edward Anhalt, III ’92 and Lisa Anhalt

Richard E. Arnell and Cynthia A. Arnell, Parents ’13

Ethan Aronoff PhD ’71 and Barbara Aronoff

Lawrence K. Au ’04, MS ’07, PhD ’11 and Gigi K. Lau ’04

Rajive L. Bagrodia and Anju Bagrodia

Lisa L. Barker ’84

John R. Barr MS ’70, PhD ’78 and Mary E. Barr

Richard S. Baty PhD ’70 and Linda S. Baty

Paul T. Bent ’73 and Barbara J. Bent

Erik C. Berg ’89, ENG ’95 and Phyllis Fang ’90

Stevan A. Birnbaum ’65

Brian K. Blockhus and Terese C. Blockhus, Parents ’15

Heather B. Blockhus ’15

Glen Boe ’60 and Jean E. Boe

Michael Bruner ’80 and Judy Bruner ’80

Henry W. Burgess MS ’75 and Cindy Burgess

Barak H. Bussel MS ’93 MBA ’95 and Helen Liu MS ’04

Scott G. Campbell ’04

Paul H. Chandler MS ’74 and Kathleen R. Chandler

Benny C. Chang ’70, MS ’72 and Janet B. Chang ’77

Chia-Ming Chang MS ’07, PhD ’07

Frank M. Chang and Shelly Chang, Parents ’02

Leang-Kai Chang and Li-Chu Wu, Parents ’13

Stanley E. Charles ’56, MS ’68 and Mary Louise Charles ’60

Eddie C. Chau ’89

Francis F. Chen and Edna L. Chen

Tong-Chen Cheng and Jennifer Jan, Parents ’12

Ken C. Cheng MS ’92, PhD ’95 and Tiffany C. King

Louis T. Cheng MS ’71 and Geraldine F. Cheng

Steve Chiou and Patricia Lee, Parents ’15

Loren A. Chow PhD ’99 and Jenny Ko JD ’97

Wesley W. Chu and Julia Chu

Christopher A. Clark, Jr. ’08

Neal M. Cohen ’87 and Adrienne D. Cohen ’86

Joseph L. Coleman and Kathleen Y. Coleman JD ’84, Parents ’14

John D. Cosgrove ME ’67 and Shirley M. Cosgrove

Karal D. Cottrell ’60 and Ann R. Cottrell

Lucien Alfred Couvillon, Jr. ’62, MS ’66 and Mary L. Couvillon

Benjamin F. Cowan ’67, MD ’75 and Lettie M. Burgett

Eric A. Cullenward and Laurie A. Cullenward, Parents ’12

Curtis L. Dahlberg ’73

Hans J. Dall and Carolyn R. Dall, Parents ’14

Robert A. Dell-Imagine MS ’60, PhD ’65 and Helen R. Dell-Imagine ’60, CRED ’61

Patrick W. Dennis ’76, MS ’78, MBA ’82, JD ’82 and Nancy L. Dennis ’79

Prithviraj Dharmaraja and Nirmala Dharmaraja, Parents ’11

James L. Doane ’68 and Jean M. Doane ’70

Joe Donahoo and Luisa Tam

Wayne Dunlap ’68 and Elise G. Dunlap

Mordecai N. Dunst ’75 and Karen R. Dunst, Parents ’13

Paul L. Dutra ’96 and Holly H. Liu ’99

Charles H. Eldredge and Melissa M. Eldredge, Parents ’13

Thomas E. Ellis and Donna Mae Ellis, Parents ’13

Augustine Moses O. Esogbue ’64

Mark F. Flores ’08

Gregory A. Fountain and Annette C. Fountain, Parents ’14

R. E. Frederking

David G. Frostad ’59 and Peggy J. Frostad ’59

Terry N. Gardner PhD ’75 and Shifra Gardner

Arnold J. Gaunt ’86

Rodney C. Gibson MS ’66, PhD ’69 and Nancy P. Gibson, Parents ’92

Vanessa Ozuna Ginzton ’97 and Matthew D. Ginzton

Albert J. Glassman PhD ’71

Thomas P. Goebel PhD ’69

Anthony T. Gomez ’69

William R. Goodin MS ’71, PhD ’75, ME ’82 and Caroline Dockrell

Gagandeep S. Grewal ’93 and Ramanjit K. Grewal

Arnold Hackett ’87

William Hant PhD ’70 and Myrna A. Hant ’64, PhD ’87, Parents ’96

Frank J. Hanzel, Jr. ’79, MS ’81

Adam David Harmetz ’05 and Helen Harmetz ’04

Correta K. Harris ’83

Page 49: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

47

Jonathan K. Hart MS ’84, ENG ’85, PhD ’88 and Kirsten E. Hart

Jan C. Harzan ’76 and Annette Harzan

Barbara C. Heiller ’69 and Larry Heiller

Jerre A. Hitz ’58, MS ’61 and Nancy K. Hitz ’60

Wai K. Ho ’78, MS ’79 and Sou K. Ho

Frederick Hans Hoffman and Stella Ann Hoffman, Parents ’11

Yasukazu Hoshino MS ’94, PhD ’02

Donald R. Howard ’58 and Edwina Howard

Kenneth F. Hsiang ’13

Kevin Hsiang

Linden Hsu ’91

Terry Huang and Cindy Huang, Parents ’13

Ryan Hundley

Reginald Jue MS ’80 and Kathryn Cooperman Jue

Reynold S. Kagiwada ’60, MS ’63, PhD ’66 and Harriet Kagiwada

Josephine Y. Kao ’96

Ann Renee Karagozian ’78 and Theodore Aram Sarafian

Andrew E. Katz ’69, JD ’72 and Denise L. Katz

Dr. Paul Kazimiroff and M. Renee McReynolds, Parents ’13

James J. Killackey ’57 and Cynthia M. Killackey

Seon Myung Kim PhD ’90

Yong U. Kim MS ’83, PhD ’87 and Elizabeth Kim

Kerry H. Kokubun, Parent ’12

Kevin Michael Kolnowski and Shirley M. Kolnowski, Parents ’12, ’12

Rosalie K. Kuhlmann ’91

Rodney A. Kurihara and Peggy S. Kurihara, Parents ’13

Robert C. Leamy ’70 and Patricia Watts Leamy ’70

Francis P. Lee and Christine S. Yip, Parents ’14

John M. Lee MBA ’86 and Lily T. Lee, Parents ’13

Peter S. Lee ’70

Sai Cheong Lee and Chung Ping Lee Lue, Parents ’12

Shawmo E. Lin and Grace Lin, Parents ’13

William H. Lingle, IV ’80

Yuk C. Lo ’84

Howard Khanh Luu ’92 and My T. Luu

Gary E. MacDougal ’58 and Charlene MacDougal

Asad M. Madni ’69, MS ’72 and Gowhartaj A. Madni, Parents ’08

Brian W. Marbach ’77 and Phyllis Rafferty Marbach MS ’84

Donald R. Martin PhD ’76 and Melissa C. Martin MS ’75

Juan V. Martinez ’81

Roxann M. Marumoto ’85, MS ’87 and David H. Julifs

Brian N. Mc Innis ’95

Scott Mishima ’87

Harold G. Monbouquette and Jeannette Monbouquette

Roger Murry ’73, MS ’76 and Catherine B. Murry

Don S. Myers ’64 and Deborah K. Myers

Mas Nagami ’53 and Dorothy Nagami

Kenneth W. Nam and Elena Nam, Parents ’13

Fabiola Navarro

Andrew Kenneth Newman MS ’95, PhD ’05 and Amy Lam ’94

William E. Nicolai, Jr. ’50 and Mary L. Nicolai

Howard S. Nussbaum ’71, MS ’72, PhD ’76 and Deborah M. Nussbaum

Lincoln D. Odell ’56

Sallie B. O’Neill

Robert Oshiro ’81

William Overman ’73, PhD ’81 and Rita Overman

Steven N. Pappas ’87, MBA ’91 and Christine M. Pappas ’87, MBA ’92

Sanjay K. Parikh and Asha S. Parikh, Parents ’09

Chan K. Park ’91 and Cindy S. Park

Christopher G. Peak and Jacquelyn J. Weber, Parents ’12

John B. Peller MS ’66, PhD ’68 and Pat Peller

Daniel J. Peterson ’80 and Lisa J. Peterson ’81

Martin Posner ’56 and Thao Posner, Parents ’14

Steven D. Powell ’00, MBA ’10

Jacob J. Rael MS ’95, PhD ’07 and Elia L. Perez ’93, MSN ’00

Rami R. Razouk ’75, MS ’75, PhD ’80 and Deborah D. Downs PhD ’80

Paul B. Ricci MS ’80 and Valeria W. Ricci

Christopher A. Rimer ’91 and Christine Rimer ’93

Peter B. Robertson and Diana L. Robertson, Parents ’15

Rhonda M. Sakaida ’81, MS ’84

Roy R. Sakaida ’53 and Dorothy W. Sakaida ’55, Parents ’83, ’84, ’86, ’86

John P. Schauerman ’79 and Claudia H. Schauerman

Christopher Peter Schlies and Christine C. Schlies, Parents ’12

Van N. Schultz ’74, MS ’75 and Susan R. Schultz ’75, Parents ’04

Page 50: UCLA Engineer Fall 2012

UC

LA E

NG

INE

ER

|

48Hermann D. Schurr ’82, MS ’85 and

Juliet N. Schurr ’82, MS ’86, Parents ’12

David E. Schwab MS ’67 and Gretchen A. Burton ’66

Stephen S. Schwartz, Parent ’13

William M. Scott and Jill Baran Scott, Parents ’13

Shara Nicole Senior ’01

Michelle A. Sequerth ’03

George M. Shannon, Jr. and Linda A. Shannon ’76

Phillip M. Shigemura ’69, MS ’71 and Joyce M. Shigemura

Takashi Shiozaki ’69 and Leslie E. Shiozaki

Michael W. Sievers ’73, MS ’75, PhD ’80 and Charlene M. Sievers

Yet M. Siu ’53 and Marion L. Siu, Parents ’75, ’77, ’78

Ning C. Sizto and Minda S. Sizto, Parents ’10

Bruce J. Smith ’65 and Cynthia C. Smith

David P. Smith MS ’68

William R. Snow and Judy S. Snow, Parents ’12

Craig W. Somerton ’76, MS ’79, PhD ’82

Alfred W. Sommer and Joyce Sommer

Alex Spataru ’70, MBA ’79 and Anne-Marie Spataru MBA ’78

Ronald S. Squires and Sherri L. Squires, Parents ’13

V. V. Srinivasan and Padmini Srinivasan, Parents ’13

Frederik N. Staal MS ’87 and Dara J. Staal

Oscar M. Stafsudd, Jr. ’59, MS ’61, PhD ’67 and Jacqueline Stafsudd ’69

David W. Stephens MS ’89

Jeremy L. Switzer ’98, MBA ’07 and Midco K. Switzer

Norito R. Takamoto ’56 and Takaye Takamoto

Helene Terris

Chantal Toporow ’78, MS ’81, PhD ’86

Che M. Tsai ’88 and Josan C. Chen

Frank C. Tung PhD ’68 and Roberta T. Tung

Brad Vartan and Vestoria Vartan

Efren Vasquez ’07

Jonathan A. Walcott ’02

Kang Wang and Edith S. Wang

Raymond Wang and Shirley C. Wang, Parents ’10

Sherman S. Wang ’04

Jeffrey S. Way ’76 and Linda K. Way, Parents ’12

Gershon Weltman ’58, MS ’60, PhD ’62 and Tova Weltman ’61

Leland Z. Wiesner ’87

Charles E. Wilcoxson ’85, MBA ’94 and Jeanine W. Wilcoxson

John Suihon Wong ’74 and Ruth Manling Wong

Kim Fan Wong and Christine F. Ng, Parents ’13

Kin Wah Wong PhD ’77

Tao Wu MS ’09, PhD ’11

Shigeru Yoshida

Farouk Youssef and Laila Hanna, Parents ’11

Stanley S. Yue ’80, MS ’84 and Alice Law ’81, MS ’83

Tongyi Zhang

Anonymous

Young Professional Boelter SocietyJacqueline N. Anderson ’06

Lawrence K. Au ’04, MS ’07, PhD ’11 and Gigi K. Lau ’04

Laura C. Basualdo ’08

Aidan S. Begg ’08

Heather B. Blockhus ’15

Barak H. Bussel MS ’93 MBA ’95 and Helen Liu MS ’04

Jiwen Cai MS ’12

Scott G. Campbell ’04

Chia-Ming Chang MS ’07, PhD ’07

Calvin C. Chong ’12

Victor K. Chu ’05

Christopher A. Clark, Jr. ’08

Harris C. Crozier ’12

Gregory Z. Ferl MS ’03, PhD ’05

Mark F. Flores ’08

Rajindra S. Handapangoda ’05, MS ’06

Adam David Harmetz ’05 and Helen Harmetz ’04

Terence Foster Heinrich ’08, MS ’11 and Julie Lanier Heinrich ’07

Bradley S. Hirasuna ’02, MS ’04

Daniel P. Ithurburn ’09

Joshua L. Laheru MS ’11 and Joanna Chen

Owen A. Lutje ’10

Jamal A. Madni MS ’08

Ryan Martin ’03, PhD ’08

Olaleke O. Owolabi ’10

Angela Renae Pinley ’07

Andrew W. Pryor-Miller ’08

Eric K. Sender ’09, MS ’12

Harpreet Singh ’04

Julia S. Sizto ’10

Efren Vasquez ’07

Sarah M. Vasquez ’08

Vishal Vaswani ’10

Jonathan A. Walcott ’02

Taikang Martin Wan ’09

Sherman S. Wang ’04

Andrew J. Winther ’03

Tao Wu MS ’09, PhD ’11

Qiyue Zou, PhD ’08

Prin

ted

on

recy

cled

pap

er

We have made every effort to ensure the completeness and accuracy of this Honor Roll. If you discover an error, please contact the Office of External Affairs at (310) 206-0678 or email [email protected].

Page 51: UCLA Engineer Fall 2012

THE UCLA ENGINEERING FUND | Enhancing Engineering Excellence

What does the future hold?

Thanks to the UCLA Henry Samueli School of Engineering and Applied Science, the future is bright.

UCLA Engineers are conducting research that

will create better sources of clean and renewable

energy, improve the ability to detect and cure

cancer, enhance cyber security, and make infra-

structure stronger and safer.

Bruin Engineers like you, who support the UCLA

Engineering Fund, are enabling UCLA Engineer-

ing’s faculty and students to make a real and

critical impact on our world.

You can Fund the Future.

MAKE A GIFT TO THE UCLA ENGINEERING

FUND TODAY.

Make your gift online at www.engineer.ucla.edu/

give or by calling 310-206-0678.

Page 52: UCLA Engineer Fall 2012

NON-PROFIT ORG.U.S. POSTAGE

PAIDUCLA

405 Hilgard AvenueBoelter Hall Suite 7256Box 951600Los Angeles, CA 90095-1600

Engineering VI Building Groundbreaking Ceremony and ReceptionOCTOBER 26, 2012

Parents’ WeekendNOVEMBER 2-4, 2012

Engineering Awards DinnerNOVEMBER 2, 2012

Tech ForumMARCH 2013

UPCOMING EVENTS