ucla engineer fall 2012
DESCRIPTION
The Fall 2012 issue of UCLA Engineer debuts a new redesign. Features include a profile of Broadcom Co-Founder, Chairman and CTO Henry Samueli β75, MS β76, PhD β80, on how his work at UCLA propelled him to success; a profile of Dean Vijay K. Dhir, who has led the school to new heights over the past 10 years; and a profile of bioengineering associate professor Dino Di Carlo, who has been making big strides in microfluidic technologies. Research breakthroughs featured including using ultra-fast cameras to detect cancer cells; transparent solar cells that can be used as windows; nanoscale microwave oscillators for improvements in communications, and more. The magazine also includes stories on ACM Turing Award winner Judea Pearl, of computer science; and on TANMS, the schoolβs new NSF-funded research center on nanoelectronic devices. In addition to the news on students, alumni, faculty and recent UCLA Engineering events, you'll also find the school's 2010-11 Annual Report.TRANSCRIPT
UCLA FALL 2012, Issue No. 28
DEANVijay K. Dhir
ASSOCIATE DEANSRichard D. WeselAcademic and Student Affairs
Jane P. ChangResearch and Physical Resources
ASSISTANT DEANMary OkinoChief Financial Officer
DEPARTMENT CHAIRSBenjamin WuBioengineering
James C. LiaoChemical and Biomolecular Engineering
Jonathan P. StewartCivil and Environmental Engineering
Jens PalsbergComputer Science
M.C. Frank ChangElectrical Engineering
Jenn-Ming YangMaterials Science and Engineering
Tsu-Chin TsaoMechanical and Aerospace Engineering
EXTERNAL AFFAIRS COMMUNICATIONSSheila Bergman Executive Director
Matthew ChinCommunications Manager and Writer
HauChee ChungGraphic Designer
ContributorsKatharine GammonWileen Wong KromhoutJennifer Marcus
OFFICE OF EXTERNAL AFFAIRS(310) [email protected]
FROM THE DEAN
Welcome to the new UCLA Engineer magazine. It has a fresh and inviting design that I think you will enjoy. While the look may be new, our emphasis on highlighting UCLA engineers at the leading edge of innovation has not changed.
UCLA engineers are making a big impact. In fact, UCLA Engineering was fourth in the world in research impact over the past 10 years in recent rankings, based on citation index, by Microsoft Academic Search. Also, over the past few months, our faculty and students have received the most prestigious of recognitions, such as the ACM Turing Award; the EPAβs Presidential Green Chemistry Challenge Award; the Presidential Early Career Award for Scientists and Engineers (PECASE); and the Top Innovation of 2011 from The Scientist magazine, just to name a few.
This issue of UCLA Engineer features stories on faculty and alumni who themselves are leading revolutionary changes in technology.
Many of you may be familiar with the schoolβs namesake, Henry Samueli, Co-Founder, Chairman and CTO of
Broadcom, but you may not know much about how he got his start here at UCLA as a leader in the communications semi-conductor industry.
One of our young faculty members, Dino Di Carlo of Bioengineering, has been developing microfluidic technologies with great potential for applications in the medical and life sciences, such as diagnosing diseases earlier.
The National Science Foundation awarded a highly competitive Engineering Research Center (ERC) to the school. The multi-million dollar ERC will usher in a paradigm shift in nanoscale electro-magnetic devices.
This is wonderful time to be a part of the UCLA Henry Samueli School of Engineering and Applied Science.
Sincerely,
Vijay K. DhirDean
UCLA
02 | Demographics
03 | Year in Review
04 | Breakthroughs
20 | School news
24 | Alumni news
34 | 2011-2012 Report
FA L L 2 0 1 2 | Issue No. 28
From Professor to Leader of Industry, With A Little Help From His Friends β Henry Samueli β75, MS β76, PhD β80
Dean Dhir Boldly Leads the School β Vijay K. Dhir
High-Speed, High-Volume, High-Precision β Dino Di Carlo
8
12
16
On the cover:Clockwise from top right Bahram Jalali, Electrical Engineering, conducts photonics research for biomedical applications. http://www.photonics.ucla.edu/
James Liao, Chemical and Biomolecular Engineering, develops next-generation biofuels. http://www.seas.ucla.edu/~liaoj/
John Wallace, Civil and Environmental Engineering, evaluates structural performance in earthquakes. http://nees.ucla.edu/wallace/
Yang Yang, Materials Science and Engineering, develops new classes of photovoltaic cells. http://yylab.seas.ucla.edu/index.aspx
Mario Gerla, Computer Science, is developing vehicular networks. http://nrlweb.cs.ucla.edu/
Daniel Kamei, Bioengineering, explores new methods that deliver drugs to cells. http://kameilab.seas.ucla.edu/
Richard Wirz, Mechanical and Aerospace Engineering, investigates plasma processes in advanced space propulsion systems. http://www.wirz.seas.ucla.edu/
UC
LA E
NG
INE
ER
|
2ALUMNI
DemographicsTotal: 29,785
through Spring 2012
South and Central America 51
Europe 148
Canada 31
Asia 477
Middle East and Africa 57
Australia and New Zealand 4
Southern CA
18,032
Northern CA5,579
HI167
NV, AZ, UT, CO, NM
1,129
WA, OR, AK, ID, MT, WY
993ND, SD, MN,
IA, WI, IL273
MS, AL, TN, GA, FL, SC, NC, LA
608
MI, IN, OH, KY
268
VA, MD, DC, WV, DE
507
PA, NY, NJ, CT614
VT, NH, RI, MA, ME
264
TX,OK, KS, MO, NE, AR
583
157 FULL-TIME FACULTY
$30,454,342GIFTS TO UCLA ENGINEERING
24PATENTS AWARDED
UC
LA E
NG
INE
ER
|
3
UCLA Henry Samueli School of Engineering and Applied Science
Y E A R I N R E V I E W
PUBLICATIONS
UCLA Engineering faculty published
9 books, 33 chapters, 597 journal articles
and 434 conference proceedings.
EDITORIAL POSITIONS
UCLA Engineering faculty held
39 editorships, 62 associate editorships
and 6 guest editorships.
RESEARCH EXPENDITURES
$93,281,730
DEGREES AWARDED (2012 PROJECTIONS)
Undergraduate Master's Doctoral Total
ENROLLMENT 2011-2012
GIFTS BY PURPOSE
Student Support 14%
Faculty 4%
Program Research 22%
Capital Projects 23%
Discretionary 37%
740 529 156 1,425 B.S. M.S. Ph.D. Total
3,311 924 921 5,156
BREAKTHROUGHS
ULTRA-FAST CAMERA DETECTS
ROGUE CANCER CELLS BAHRAM JALALI, Northrop Grumman Endowed Opto-Electronic Chair in Electrical Engineering
DINO DI CARLO, Associate Professor of Bioengineering
KEISUKE GODA, Professor of Physical Chemistry, University of Tokyo
The ability to distinguish and isolate rare cells from among a large population
of assorted cells has become increasingly important for the early detection
of disease and for monitoring disease treatments.
An interdisciplinary research team with expertise in optics and
high-speed electronics, microfluidics, and biotechnology, has developed
a high-throughput flow-through optical microscope with the ability to
detect rare cells with sensitivity of one part per million in real time. The
new blood-screening technology boasts a throughput of 100,000 cells per
second, approximately 100 times higher than conventional imaging-based
blood analyzers. n
By M
atth
ew C
hin
and
Wile
en W
ong
Kro
mho
ut
www.engineer.ucla.edu/cancer-detecting-camera
FreeLayer
Pinned Layer
X
Hext
UC
LA E
NG
INE
ER
|
5
WORLDβS MOST POWERFUL
NANOSCALE MICROWAVE
OSCILLATORS
NEW GENETIC METHOD TO PINPOINT INDIVIDUALSβ GEOGRAPHIC ORIGIN
ELEAZAR ESKIN, Associate Professor of Computer Science
JOHN NOVEMBRE, Associate Professor of Ecology and Evolutionary Biology
Understanding the genetic diversity within and between populations
has important implications for studies of human disease and evolution.
A team of researchers at UCLA and Israelβs Tel Aviv University has
developed an innovative approach to the study of genetic diversity
called spatial ancestry analysis (SPA), which allows for the modeling of
genetic variation in two- or three-dimensional space.
With SPA, researchers can model the spatial distribution of each
genetic variant by assigning a genetic variantβs frequency as a continuous
function in geographic space. By doing this, they show that the explicit
modeling of the genetic variant frequency β the proportion of individuals
who carry a specific variant β allows individuals to be localized on a world
map on the basis of their genetic information alone. n
KANG L. WANG, Raytheon Professor of Electrical Engineering
PEDRAM KHALILI, Project Manager, UCLA-DARPA research programs in STT-RAM and non-volatile logic
A team of researchers has created the most powerful high-perfor-
mance nanoscale microwave oscillators in the world, a development that
could lead to cheaper, more energy-efficient mobile communication
devices that deliver much better signal quality.
Cell phones and WiFiβenabled tablets all use microwave oscillators,
tiny devices that generate the electrical signals used in communications.
In a cell phone, the transmitter and receiver circuits contain oscillators
that produce radio-frequency signals, which are then converted by the
phoneβs antenna into incoming and outgoing electromagnetic waves.
The UCLA-developed oscillators utilize the spin of an electron,
as in the case of magnetism, and carry several orders-of-magnitude
advantages over the oscillators in use today. nβ
By M
atth
ew C
hin
and
Wile
en W
ong
Kro
mho
ut
www.engineer.ucla.edu/geographic-origin
www.engineer.ucla.edu/nanoscale-oscillators
BREAKTHROUGHS
HIGHLY TRANSPARENT SOLAR CELLS CREATED FOR WINDOWS THAT GENERATE ELECTRICITY
YANG YANG, Carol and Lawrence E. Tannas, Jr., Endowed Chair in Engineering
PAUL S. WEISS, Fred Kavli Chair in NanoSystems Sciences, CNSI Director, and Department of Chemistry and Biochemistry
UCLA researchers have developed a new transparent solar cell that is an
advance toward giving windows in homes and other buildings the ability to generate
electricity while still allowing people to see outside.
The new kind of polymer solar cell (PSC) produces energy by absorbing mainly
infrared light, not visible light, making the cells nearly 70% transparent to the hu-
man eye. The device is made from a photoactive plastic that converts infrared light
into an electrical current. n
www.engineer.ucla.edu/solar-window
UC
LA E
NG
INE
ER
|
7
GAME ON! USING ONLINE CROWD-SOURCING TO DIAGNOSE MALARIA
ELECTRICITY CAN GENERATE ALTERNATIVE FUEL
AYDOGAN OZCAN, Associate Professor of Electrical Engineering and Bioengineering
DR. KARIN NIELSEN, Professor of Infectious Diseases, Department of Pediatrics, Geffen School of Medicine
Working on the assumption that large groups of public
non-experts can be trained to recognize infectious diseases
with the accuracy of trained pathologists, researchers
from the Henry Samueli School of Engineering and Applied
Science and the David Geffen School of Medicine at UCLA
have created a crowd-sourced online gaming system in
which players distinguish malaria-infected red blood cells
from healthy ones by viewing digital images obtained
from microscopes.
The team found that a small group of non-experts
playing the game was collectively able to diagnosis malaria-
infected red blood cells with an accuracy that was within
1.25 percent of the diagnostic decisions made by a trained
medical professional. n
JAMES C. LIAO, Ralph M. Parsons Foundation Chair in Chemical Engineering
Imagine being able to use electricity to power your car
β even if itβs not an electric vehicle. UCLA Engineering
researchers have for the first time demonstrated a method
for converting carbon dioxide into liquid fuel isobutanol
using electricity.
Today, electrical energy generated by various methods
is still difficult to store efficiently. Chemical batteries, hy-
draulic pumping and water splitting suffer from low energy-
density storage or incompatibility with current transporta-
tion infrastructure.
The team reports a method for storing electrical
energy as chemical energy in higher alcohols, which can be
used as liquid transportation fuels. n
www.engineer.ucla.edu/electricity-fuel
www.engineer.ucla.edu/malaria-gaming
010101010100001101001100010000010010000001000101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001001000011001010110111001110010011110010010000001010011011000010110110101110101011001010110110001101001001000000101001101100011011010000110111101101111011011000010000001101111011001100010000001100101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001100001011011100110010000100000011000010111000001110000011011000110100101100101011001000010000001110011011000110110100101100101011011100110001101100101
Pho
to: W
alte
r Uri
eU
CLA
EN
GIN
EE
R
| 8
010101010100001101001100010000010010000001000101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001001000011001010110111001110010011110010010000001010011011000010110110101110101011001010110110001101001001000000101001101100011011010000110111101101111011011000010000001101111011001100010000001100101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001100001011011100110010000100000011000010111000001110000011011000110100101100101011001000010000001110011011000110110100101100101011011100110001101100101
UC
LA E
NG
INE
ER
|
9
FROM PROFESSOR TO LEADER OF INDUSTRY, WITH A LITTLE HELP FROM HIS FRIENDS By Katharine Gammon
Today, Henry Samueli is a household name in Southern
California. But twenty years ago, he was a professor at UCLA
working to forge a new kind of research collaboration
with his colleagues. Together with three other professors,
Samueli embarked on exciting new research β which
eventually became part of Broadcom. This is the story
of how UCLA Engineering research helped forge a new
communications industry.
βOne of Henryβs strongest points is he could
identify and invest in talent without wanting
short-term returns.β PROFESSOR ASAD ABIDI
UC
LA E
NG
INE
ER
|
10Broadcom grew to be one of the leading semi-
conductor companies, and also supplies the
WiFi+Bluetooth combo chip for Apple iPhone
3GS and iPod touch second generation.
Henry Samueli had an epiphany in engineering class. He was a senior at
UCLA, studying electrical engineering and signed up for a course taught by
Alan Willson β the first course ever at UCLA in digital signal processing in
electrical engineering. βThat class set me on the path of that field, and it was a major
milestone in my educational career,β Samueli said with a smile. βI had to pick a focus,
and when I took that class from Professor Willson I decided. It was a brand new field,
and it just seemed to have so much potential.β
When he finished his Ph.D. in 1980, Samueli went to work for TRW, Inc. in
Redondo Beach. There, he worked to develop military satellite and radio communi-
cations systems, and in particular, a high-speed digital radio modem for the Army.
He says the experience at TRW prepared him to work closely with people across
different disciplines.
Along the way, he had been teaching classes at different colleges, and in 1985,
he was offered a full-time position back at UCLA. When he returned, he started
talking to other young faculty colleagues about proposals for the Defense Advanced
Research Projects Agency. βFaculty typically think of their narrow fields, itβs not until
you get to industry that people think of putting all those parts together,β he says β
but his colleagues were willing to collaborate on new technologies.
Together with electrical engineering professors Greg Pottie, Asad
Abidi, and Yahya Rahmat-Samii, Samueli created a proposal to the first
all-CMOS (complementary metal-oxide semi-conductor) radio with
both the analog and digital in CMOS on a single chip. The communica-
tions system research was revolutionary in a few different ways. The
team Samueli assembled had unique talents: Samueli was in charge of the digital
signal processing, Abidi focused on the analog portion, Rahmat-Samii took care of
the antennas, and Pottie was in charge of the systems analysis.
Outside of the unique talents of the team, the project was pushing boundaries.
βNo one thought it could be done in one chip,β says Pottie. βBut Henry realized that if
you made the analog portion low-power enough and structure it correctly, it could
stay on one chip, radically reducing the cost.β
Samueliβs colleagues say that he has great
skills as a manager as well as a thinker.
p(top) Samueli received the Marconi Prize, awarded in June 2012. And he was awarded the prestigious UCLA Medal in 2010.
UC
LA E
NG
INE
ER
|
11
FA
CT
S &
FIG
UR
ES
99.98%of Internet data traffic
crosses a Broadcom chip.
βWe were merging analog and digital, which had
traditionally hard lines between them,β recalls Abidi.
βWhen we first proposed that we would build radios on the
same chip as digital stuff, companies like Motorola laughed
in our faces.β
Despite the hurdles, the project proved to be a great
success, and some interesting research was produced.
βOne of the most interesting outcomes was that we invented
the concept of back-mounted antennas for handsets β not
like typical monopoles that sticks out,β says Rahmat-Samii.
Later on, those back-mounted antennas became internal,
which are now the norm in any cell phone.
As the project continued, research papers were
published, and the laughter turned to curiosity. βWe didnβt
even worry about patents at that time, we just published
our work and put it in the public domain. We were so far
ahead of everyone else in the field,β says Samueli, who
ended up publishing more than 100 research papers during
his time in the department.
βOut of those publications, we
started getting a lot of inquiries from
companies who loved our results
and wanted us to commercialize the
technology,β he says. Together with
his graduate student Henry Nicholas,
Samueli formed Broadcom in 1991. They
first worked out of a spare bedroom in
co-founder Henry Nicholasβs house, and
then from 1,200-square-foot offices on
Wilshire Boulevard.
In 1995, Samueli took a leave from UCLA, however
he still holds a faculty appointment in the Department of
Electrical Engineering. Broadcom's first project was to
design the worldβs first chips for digital interactive cable
television, followed by the worldβs first single-chip
cable modem.
Samueliβs colleagues say that he is a skilled manager
as well as a long-range thinker. βOne of Henryβs strongest
points is that he can identify and invest in talent without
wanting short-term returns,β says Abidi.
Broadcom grew to be one of the worldβs leading
semiconductor companies, and currently supplies the
WiFi+Bluetooth combo chip for Appleβs iPhone, iPad and iPod
Touch devices. Among the accolades Samueli has received
is the Marconi Society Prize and Fellowship, awarded in
June 2012. He was also elected a Fellow of the Institute of
Electrical and Electronics Engineers in 2000, a member of
the National Academy of Engineering in 2003, and a Fellow
of the American Academy of Arts and Sciences in 2004.
No matter how far the
company goes, Samueli, with
characteristic quiet coolness,
gives credit back to the team effort
at UCLA Engineering. βOur research
was one of the more successful,
early examples of broad collabor-
ative multi-disciplinary work in
the school, and it set a model for
the future.β n
11,000β number of Broadcom employees
in 15 countries
SOURCE: Broadcom
In his nearly ten years as Dean, Vijay K. Dhir has
tirelessly worked to improve the scale and scope of
the UCLA Henry Samueli School of Engineering and
Applied Science. He has raised funds, recruited superb
faculty, and grown the schoolβs profile domestically
and overseas β and he has done it all while continuing
his own high-level research on boiling in space.
A gentle smile covers the deanβs face when he
talks about the engineering school, and itβs clear that
Dean Dhir has as much love for his administrative job
as he does for his research.
In addition to building a bigger and better
engineering school, Dhir has looked beyond
the traditional walls of the university
to enhance learning and build a community.
Dean Dhir Boldly Leads By Katharine Gammon
Pho
to: W
alte
r Uri
eU
CLA
EN
GIN
EE
R
| 13
Vijay Dhir found his love for engineering
in school in India, where he did his
undergraduate and mastersβ degrees.
He first arrived at UCLA in 1974, after receiving
a doctorate in mechanical engineering at the
University of Kentucky. During the energy
crisis, he worked on ways to convert coal into
synthetic gas. Then, as a young UCLA assistant
professor, Dhir did an energy-source switch
and began researching nuclear safety. βIt
was brand-new, so I learned about nuclear
engineering while I was teaching courses in it,β
he says with a laugh. βInterestingly, I have
been involved in the energy business my
whole career.β
Dhir has made a profound impact since
taking the reins of UCLA Engineering in 2003.
His first effort was to give
the school a more multi-
disciplinary focus, and over
the past 10 years the school
has won 10 competitive
research centers from the federal government
and private industry to spur research and
development on emerging technologies. The
centers also bring in millions of dollars in
research funding each year. In addition to the
funds, the physical space has also expanded
under Dhirβs watch: the Engineering V building
has opened, allowing space for the new
Bioengineering Department and the Materials
Science and Engineering Department; and
Engineering VI is about to break ground.
With the new physical space comes
superb young faculty to fill it. Under Dhirβs
leadership, 60 new faculty have been added,
including some of the best junior faculty
anywhere. βUnder Dean Dhir's leadership, we
have recruited a group of distinguished young
faculty who have won wide and high recogni-
tions both domestically and internationally,β
said Frank Chang, chair of the Electrical
Engineering Department. βThe young faculty
members have already become global leaders
in each of their own research areas.β
Dhir has also worked hard to raise the
profile and resource base of the school. In
2003, when he became dean, US News and
World Report ranked the graduate school
22nd in the nation. Last year it garnered the
16th spot (9th among public universities). The
schoolβs extramural funding has swelled from
$54.9 million per year in 2001-2002 to
$105.8 million in 2010-2011. In Microsoftβs
Academic Search H-index, which measures
both the productivity and impact of published
work, UCLA Engineering is currently ranked
fourth in the world.
βMy most cherished dream for the school
is to be ranked at the very top.β says Dhir. βWe
have accomplished a lot in the last ten years, but
there is more we still need to do.β Dhir has taken
strides to improve all levels of education, making
curriculum changes that require students
to broaden their experience and technical
breadth by taking a three-course sequence in
another engineering field outside their major.
In addition to building a bigger and
better engineering school, Dhir has looked
beyond the traditional walls of the university
to enhance learning, and build a community.
Dean Dhir has inspired an entrepreneurial
spirit within UCLA Engineering that
is benefiting both the School and the
University. β DWIGHT STREIT, ITA DIRECTOR
βMy most cherished dream is for the school to be ranked
at the very top.β says Dhir.
UC
LA E
NG
INE
ER
|
15
Under Dean Dhir's leadership, we have recruited a group of distinguished young faculty who have won wide and high recognitions both domestically and internationally. β PROFESSOR FRANK CHANG
pTwo bubble merger under microgravity conditions. The experiment on boiling heat transfer was carried aboard the International Space Station in 2011.
In 2007, he established the Institute for
Technology Advancement β an off-campus
organization to incubate new technologies
that could be commercialized. According to
Dhir, four companies already have come out of
the ITA, and there are four more in the pipeline.
Dwight Streit, the ITAβs director, says that Dhir
was instrumental in creating the opportunities
there. "Dean Dhir has inspired an entrepre-
neurial spirit within UCLA Engineering that
is benefiting both the school and the
university,β he said.
The community-building effort goes
beyond industry and into the next generation
of engineers. βDean Dhir has initiated a number
of outreach efforts to attract a diverse range
of students into engineering,β said mechanical
and aerospace engineering professor
Adrienne Lavine. In three separate newly-
created programs, UCLA engineering students
tutor local high school students online, faculty
host high school students in their research labs
in the summer, and this summer a Tech Camp
was launched in the schoolβs new Creativity
Center. In addition, the school has created an
online engineering mastersβ program, with
more than 250 students enrolled. Students can
attend lectures, work with teaching assistants
and discuss assignments all online. Dhir plans
to take the program nationally and interna-
tionally in the future.
Even while fundraising for the school,
creating a vision for multi-disciplinary research
and education, and recruiting faculty,
Dhir continues to do research on the
fundamental process of boiling. βI
started as a researcher and teacher,
so thatβs my first love in some sense,β
he said, adding that itβs still exciting
to discover new information
and knowledge. During his near-40
years at UCLA, he has published
more than 300 papers and has
advised more than 40 doctoral
students and 50 masterβs students.
And, Dhir has continued his admin-
istrative and academic duties, he has
continued to serve on a number of
committees on behalf of the National
Research Council.
Dhirβs research has gone
far β his labβs experiment on heat
transfer and boiling traveled to the
International Space Station in 2011.
As it turns out, bubbles behave very differently
under microgravity conditions β something
that will be important as manned missions
venture further into space. A mission to Mars,
which would take six months one-way, would
need to use a nuclear reactor to power the
ship. That reactor would need to boil water
and condense it β and Dhir has researched the
dynamics of bubbles on Earth and in micro-
gravity. From space and back, Dean Vijay K.
Dhir creates excellence wherever he goes. n
TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCGATGCGTCCACAACGCTACAAATGTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC
TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCGATGCGTCCACAACGCTACAAATGTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC
Pho
to: W
alte
r Uri
e
UC
LA E
NG
INE
ER
|
17
High-Speed, High-Volume, High-Precision By Matthew Chin
Bioengineering professor Dino Di Carlo works
to make the tools of biology and medicine
faster, automated and more accurate.
Itβs a common theme in science fiction β a scientist peers into a microscope
at the fluid-filled slide, adjusts the focus, moves the slide, slowly fine-tunes
the focus until the targeted cell comes into view, and then⦠Eureka! They
found what they were looking for, whether it was good, bad, or unexpected.
Of course, while this makes for an excellent cinematic shot, itβs not the
way of the future. Or at least not how most biological analyses and health
care will be done. These analyses will be automated at speeds of tens of
thousands of cells per second, and with precision accurate enough to find
the earliest signs of disease in just a few of those cells.
Pho
to: W
alte
r Uri
e
UC
LA E
NG
INE
ER
|
18
uL to R: Henry Tse,
a post-doctoral fellow, Dino Di Carlo and
Mahdokht Masaeli, a Ph.D. student.
Most of what has created
the biggest impacts on
society can be considered
methods of automation.
Leading the way is Dino Di Carlo, a UCLA
associate professor of bioengineering, who
is exploiting the physical characteristics of
the micro-cellular environment to create and
develop miniaturized systems for biological
research and medical diagnostics.
βIn general, I think most of what has
created the biggest impacts on society can
be considered methods of
automation,β Di Carlo said.
βFor example, automating
information processing with
computers, automating
transportation with cars,
trains, and airplanes, and even automating
communication with phones and smart cell
phones. In our research group, we apply
unique microscale physical effects towards
the automation of diagnostics, life science
research, and cellular engineering.β
Think of a product assembly lineβs quality
control steps. Di Carloβs research themes follow
a similar principle in action, only operating
on cells in a fluid environment. Those bulky
table-top microscopes are now replaced
by silicon wafers, with precisely etched
channels that speed biological fluids through.
High-speed cameras and tracking software
monitor thousands of cells per second watching
for outliers β cells whose outward signs may
reveal deeper problems, such as cancer.
In one recent publication, Di Carlo and
his students in the Biomicrofluidics Laboratory
developed a new instrument that slams cells
against a wall of fluid. Knowing how those cells
respond following impact helps them identify
ones that could be cancerous or identify other
cell states. This platform could replace current
technologies that use expensive chemical tags.
But more than just engineering scientific
tools, Di Carlo has made several scientific
discoveries. In 2010, he and a colleague found
that particles will self-assemble in a fluid,
following similar patterns in nature from
phospholipids to spiral galaxies. And earlier
this year, Di Carlo looked at ways to construct
UC
LA E
NG
INE
ER
|
19
Looking forward, Di Carlo has several other areas
heβs exploring. One area is exploring how microfluidic
technologies may help guide cellular evolution.
F A C T S & F I G U R E S
10 millionThe number of cells
probed and analyzed mechanically to date
100,000The number of cells that
can be imaged and analyzed per second in
Di Carlo's platform
pFocused fluorescent particles are separated based on inertial fluid dynamic effects.
these micro-channels to help particles self-
assemble, and then use assembled particles
themselves to create constructive wakes in
the fluid. Both have applications for future
microfluidic diagnostic device design.
The great potential in his research has
led to several prestigious recognitions for
Di Carlo, who received tenure earlier this
summer with a promotion to associate
professor. These include a Packard Fellowship
for Science and Engineering, from the David
and Lucile Packard Foundation; a Young Faculty
Award from the Defense Advanced Research
Projects Agency; an Early Career Development
award from the National Science Foundation;
and a Young Investigator Award from the Office
of Naval Research.
As a young faculty member, Di Carlo
has also enjoyed much success as a teacher
and mentor to outstanding graduate and
undergraduate students. UCLA Engineeringβs
two most recent Outstanding Bachelorβs of
Science awardees both conducted research
in his lab. Earlier this year, a five-member
team of bioengineering seniors under his
advisement took their capstone project into a
national competition sponsored by the National
Institutes of Health, and won in the diagnostic
device category. The teamβs winning
platform screened patientsβ urine samples
for transitional cell carcinoma (TCC), a
common form of bladder cancer. And his first
Ph.D. graduate, Soojung Claire Hur, is currently
at Harvard University as a junior fellow at the
Rowland Institute.
Looking forward, Di Carlo has several other
areas heβs exploring. One area is exploring
how microfluidic technologies may help guide
cellular evolution. Beyond just controlling cells,
the idea would be to understand the molecular
and genetic basis for how cells behave. For
example, how do cells travel through the body,
or what is their durability against physical and
chemical changes. Research in this area could
eventually lead to insights on how evolved
cell populations may themselves have physical
characteristics that make them potential
candidates for therapeutic applications. n
ββ To find out more about Di Carloβs
research: www.biomicrofluidics.com/
Pho
tos:
Mat
thew
Chi
n
UC
LA E
NG
INE
ER
|
20SCHOOL
News
TECH CAMPS DEBUT AT NEW STUDENT CREATIVITY CENTERBuilding robots that navigate mazes, or fine-tuning
electronic musical devices that work in harmony β for a
group of high school students from the greater Los Angeles
area, those were just a few of the projects they completed at
UCLA Engineeringβs new Summer High School Tech Camp.
Two of the four-week camps were held during
the summer at the schoolβs new Creativity Center, a
5,000-square foot facility on the second floor of Boelter
Hall. The new technology sandbox is a space meant for
students to explore their imaginations.
βThe United States needs to increase the number of
students entering into science, technology, engineering
and mathematics (STEM) fields,β said Dean Vijay K. Dhir.
βAt UCLA Engineering, we are strongly committed to
doing our part to let young students, especially those
from underrepresented backgrounds, have an
excellent experience building and testing their
creations. We think our Tech Camps will enhance
the education they receive through their course
work in math and sciences.β
While summer is reserved for tech camps,
during the school year the Creativity Center will
be home to several of UCLA Engineeringβs student
groups, providing much-needed space and access to
tools and equipment. n
ββ To find out more about the camps, visit:
www.esc.seas.ucla.edu
uTech Camp students demonstrated their robot that navigates a maze and performs tasks. The camp was held at the new Creativity Center.
UC
LA E
NG
INE
ER
|
21
A new NSF-funded Engineering Research Center
and the debut of Tech Camps are a few of the
highlights for the past few months.
NEW ENGINEERING RESEARCH CENTER TO REVOLUTIONIZE NANOSCALE ELECTROMAGNETIC DEVICES
A multidisciplinary team of researchers from UCLA and
other universities is poised to help turn science fiction into
reality β in the form of some of the world's tiniest electro-
magnetic devices β thanks to a major grant from the
National Science Foundation's Engineering Research Center
(ERC) program.
The multi-million dollar grant will fund a new center
headquartered at UCLA's Henry Samueli School of
Engineering and Applied Science. It will focus on research
aimed at developing highly efficient and powerful electro-
magnetic systems roughly the size of a biological cell β systems that can power a range of devices, from
miniaturized consumer electronics and technologies important for national security to as-yet unimagined
machines, like nanoscale submarines that can navigate through the human blood stream.
Employing a fundamentally new approach to electromagnetic power at the nanoscale, researchers
at the NSF-funded TANMS center (Translational Applications of Nanoscale Multiferroic Systems) are working
to replace traditional wire-based electronics with a revolutionary technique that couples electricity and
magnetism by using multiferroic materials, which can be magnetically switched "on" and "off" by an
electric field.
UCLA's partners in the new center include UC Berkeley, Cornell University, Switzerland's ETH Zurich and
California State University, Northridge.
"We believe this is an opportunity for a truly revolutionary change in miniaturized electromagnetic
devices," said Greg Carman, director of the new center and a UCLA professor of mechanical and aerospace
engineering. "If you combine all three of our application areas β memory, antennas and motors β it really
opens the possibilities of what new platforms may become possible.β n
ββ The complete story is available online at: www.engineer.ucla.edu/TANMS-research-center
pTANMS researchers have used an electric field to turn a magnetic field on (left) and off (right). Credit: Ray C. J. Hsu, Mechanical and Aerospace Engineering
Pho
tos:
Gra
d Im
ages
UC
LA E
NG
INE
ER
|
22SCHOOL
News
1
4 6
5
2
3
1 Dr. Wanda Austin, president and CEO of The Aerospace Corporation, delivers the commencement address to the Class of 2012. She encouraged the graduates to change the world; advocate for STEM education; and be ethical role models.
2 Engineering graduates at the 2012 com-mencement.
3 Student speaker Melissa Erickson β12, reflected on the unique experiences of UCLA engineering students, and how they are now ready for lifeβs next steps.
4 New graduates enter Drake Stadium, which was filled with family and friends.
5 Graduates try to find family.
6 Graduate degree candidates.
β To view remarks from Austin and from Erickson: www.engineer.ucla.edu/commencement-2012
2012 COMMENCEMENT
Pho
tos:
To
dd C
hene
y (7
and
8),
Inci
te P
hoto
grap
hy (9
)
UC
LA E
NG
INE
ER
|
23
7
9
8
7 The 2012 Senior Class Campaign Committee presents Dean Dhir with their contribution at the annual Senior Class Dinner. Owen Lutje β10 was the emcee for the evening. All funds raised went to improve wireless capability within Boelter Hall.
8 The 2012 Engineering Graduate Student Association (EGSA) coordinated the first E-Grad Campaign, which raised money to support the building of Engineering VI. EGSA committee members celebrate here at the reception honoring their success.
9 Scholarship donors and recipients posed together at UCLA Engineeringβs annual Scholarship Brunch honoring those who have funded undergraduate scholarships at the School.
SENIOR DINNER,E-GRAD CAMPAIGN RECEPTION and SCHOLARSHIP BRUNCH
UC
LA E
NG
INE
ER
|
24ALUMNI
Notes
1960sHoward Kornstein β63 has retired this year after an active
career in the European information technology industry.
This included working for Computer Sciences Corporation;
Data Applications International, which he co-founded;
Intel; and Digital Research. In 1985, he co-founded QA
Training Ltd where he later became managing director. The
firm grew to be one of the UKβs most successful technical
training companies. After QA was acquired, Kornstein
took on a number of
non-executive director-
ships in British high-tech
startups. His retirement
now allows him the
luxury of returning to
his engineering roots
to potter about with
computer technology.
Tom Lazear MS β63, chairman of California-based Archway
Systems, received the inaugural Bentley Institute Lifetime
Achievement Award from Bentley Systems, Incorporated,
the leading company of comprehensive software solutions
for sustaining infrastructure. Lazear was recognized for
inspiring students, architects, and engineers to explore and
apply computer technology in the service of design and
engineering.
Herbert Hecht PhD β67, was recently honored with the
Society of Automotive Engineersβ Elmer A. Sperry Award.
The award recognizes the development and implemen-
tation of methods and tools that improve dependability
and safety in transportation. Hecht founded SoHaR
Incorporated in 1978, and served as its president until 1995,
when he assumed his current role of chief engineer.
His career has been focused on the design and verification
of reliability and safety critical systems. He has headed
the certification of flight control systems for helicopters
and light aircraft, and participated in the certification
of the electric power system for the mostly electric
Global Express.
1970sJim Breese MS β70 has finally retired after 50 years as an
engineer in the high-tech world. He has just released
an e-book that attempts to teach new graduates what
he learned about problem-solving during those years.
Available for your kids (or maybe your grand-kids, if they
are new grads) at Diesel e-books and other e-book outlets:
Famous By Friday is the title.
Van Schulz β74 MS β75 has been named the University of
California Alumni-Regent Designate, and Immediate Past
Chair, UCLA Alumni Association Board of Directors. The
appointment was effective July 1, 2012.
Armando Benavides MS β77, a systems engineer for Boeing
Satellite Systems in El Segundo, Calif. was recently awarded
his third patent applicable to GPS satellites. The title of this
patent is βSystem and method for accurate downlink power
control of composite QPSK modulated signalsβ.
UC
LA E
NG
INE
ER
|
25
Share news about your career, personal
life, honors, awards, and more!
Dan Stephenson β79 won four
gold medals at the Masters
World Swimming Champion-
ships, held in Riccione, Italy
in June 2012. Stephenson
also recently published The
Underwater Window, a novel
about friendship and rivalry
in the world of Olympic-level
swimming. Stephenson was
captain of the UCLA Menβs
Swimming Team in 1978-79.
1980sFarid Emrani β83 MS β85 was unanimously appointed by
the Logicube Board of Directors to become the President
and CEO of Logicube. Emrani is currently the Executive
Vice-President and COO. Logicube is the worldβs leader
in hard drive duplication and eForensics solutions. Emrani
began his career at Logicube in 2005. Prior to joining the
company he held various engineering, marketing and sales
positions with Xerox Corporation, Lucent Technologies
and Agere Systems.
Gary Lee Moore β85, City Engineer for the City of Los
Angeles, was appointed by Mayor Antonio Villaraigosa,
a UCLA alumnus in history, as interim general manager
of the cityβs Information Technology Agency. The ITA is
responsible for the cityβs computer networks, as well as
implements new technology. As City Engineer, Moore
oversees more than 800 engineers, architects, surveyors
and technical support staff and is responsible for the
planning, design and construction of all public facilities.
Moore has more than 27 years of public service and has
served as the city engineer since 2003.
Ljiljana Trajkovic PhD β86, a professor in the School of
Engineering Science at Simon Fraser University, has
been awarded the IEEE Circuits and Systems Society 2012
Meritorious Service Award.
George A. Lesieutre PhD β89, professor and head of
Aerospace Engineering at Pennsylvania State University,
presented a keynote address, βAdaptive Structures: The
Journey to Flight,β at the 53rd Structures, Structural
Dynamics, and Materials Conference of the American
Institute of Aeronautics and Astronautics (AIAA) in April.
1990sSteven Hast, ENG
β90 was recently
promoted to director
of the Astrodynamics
Department of The
Aerospace Corporation
in El Segundo, Calif.
Hast manages an
engineering team that
performs a wide variety of orbit-related
analyses, including orbit selection and satellite constellation
design, orbit perturbations and lifetime estimation, space
debris modeling and collision hazard assessment, optimal
on-orbit maneuvers and relative motion studies.
UC
LA E
NG
INE
ER
|
26Thomas Piechota MS β93 PhD β97 was recently named
interim vice president for research and dean of the
Graduate College at the University of Nevada, Las Vegas.
Piechota is a professor in the Department of Civil and
Environmental Engineering. Most recently, he served as
associate vice president for interdisciplinary research. In
2008, he became the UNLV principal investigator on a
$15 million NSF grant to study of climate change in Nevada.
Kinam Kim PhD β94 was one of 10 foreign associates elected
to the National Academy of Engineering , one of the most
prestigious recognitions bestowed to an engineer. Kim
is the CEO of Samsung Advanced Institute of Technology
(SAIT), Samsung Electronics Company. He was recognized
for his contributions to semiconductor technologies for
DRAM and nonvolatile memories. Kim is a former student of
electrical engineering professor Kang L. Wang.
2000sFather Trung H. Pham β00, was recently ordained as a
priest in the Roman Catholic Church in the Society of Jesus
(Jesuits). Pham was born in Vietnam and immigrated to
Orange County, CA. with his family when he was a teenager.
Pham, who taught drawing and painting at Santa Clara
University also holds a master of fine arts degree from the
the Pratt Institute in New York.
Elizabeth M. Hagerman MS β02 PhD β07 has become
Rose-Hulman Ventureβs new vice president. Rose-Hulman
Ventures offers a dynamic innovative space for students
at the Rose-Hulman Institute of Technology to apply their
studies to real-world issues. While at UCLA, Hagerman
focused her studies in biomedical engineering on
orthopedic biomaterials. Previously, Hagerman held
leadership roles at Baxter Healthcare.
Helen Jung β02, MS β05, PhD β09, P.E., a faculty member
in the Department of Civil Engineering at California Baptist
University has finished her term as interim chair in
2010-2011 and is now the department chair.
Paul Medvedev β02 recently became an assistant
professor at Pennsylvania State University in the
Department of Computer Science and Engineering, as
well as in the Department of Biochemistry and Molecular
Biology. His current focus is on DNA structural and
copy-number variations β which play an important role
in the development and progression of diseases. He was
also named one of 2011βs βTomorrowβs PIsβ by Genome
Technology magazine.
Chad Rosen β05 (B.A. Hebrew)
and Sarah (Tobin) Rosen β05
welcomed their second Bruin,
Adam Samual (Class of β34),
to the family in late August.
Adam, no doubt a future
engineer, joins big sister
Adena (UCLA class of β31).
Matt Olsson β07 has enrolled at the University of Chicago,
Booth School of Business.
Alex Kroll β08, MS β09 is currently serving as a 1st Lieutenant
in the Untied States Air Force as a pilot of the B-52 bomber.
Kroll was recently married.
Julie Nichols MS β09 represented the United States
at the 2012 Olympic Games. She competed in the
lightweight womenβs double sculls with rowing partner
Kristin Hedstrom.
2010sThomas Cowan β11 is
currently working as an
attitude control system
engineer at Boeingβs
Satellite Development
Center in El Segundo, Calif.
He has taken on various analysis and systems engineering
tasks supporting Boeingβs 702 line of satellites. Cowan
recently started an M.S. in Aerospace Engineering at UCLA.
Online MastersThe primary purpose of this program is to enable employed engineers and computer scientists to enhance their technical education beyond the Bachelor of Science level, and to enhance their value to the technical organizations in which they are employed.
DISTINCTIVE FEATURES OF THE PROGRAMβ’ Each course is fully equivalent to the corresponding on-campus course and taught by the faculty members who teach the on-campus course.
β’ The online lectures are carefully prepared for the online student.
AREAS(CS)Computer ScienceComputer Networking
(EE)Electrical EngineeringIntegrated CircuitsSignal Processing &
Communications
(MSE)Materials Science
Advanced Structural Materials
Electronic Materials
(MAE)Mechanical EngineeringAerospace EngineeringManufacturing and
Design
(EN)Systems Engineering
Additional information and online applications available at: msol.ucla.edu
TTGG
CGTA
ATCA
TGGT
CATA
GCTG
TTTC
CTGT
GTGA
AATT
GTTA
TCCG
CGAT
GCGT
CCAC
AACG
CTAC
AAAT
GTTG
GCGT
AATC
ATGG
TCAT
AGCT
GTTT
CCTG
TGTG
AAAT
TGTT
ATCC
GCGA
TGCG
TCCA
CAAC
GCTT
UC
LA E
NG
INE
ER
|
28FACULT Y
NewsU
CLA
Eng
inee
ring
New
Fac
ulty WENTAI LIU
Professor of Bioengineering
Ph.D. β University of Michigan
Wentai Liu studies the neural implants dealing with nerves and
muscles for retina, epilepsy, muscle, eyelids, spinal cord, and bladder.
Liu has been leading the engineering efforts of the retinal prosthesis to
restore vision, finally leading to successful implant trials in blind patients.
Liu has received several notable honors for his research including
a Popular Mechanics Breakthrough Award in 2010; an R&D 100 Award
in 2009; the Alcoa Foundation's Distinguished Engineering Research
Award, a NASA Group Achievement Award, and several outstanding paper
awards from IEEE. Liu has also received an Outstanding Alumni Award
from National Chiao-Tung University in Taiwan, where he received his
bachelorβs degree
Before joining UCLA Engineering in Winter 2012, Liu was a
professor at the Jack Baskin School of Engineering at the University of
California, Santa Cruz. Prior to that, Liu was a professor at North Carolina
State University. n
010101010100001101001100010000010010000001000101011011100110011101101001011011100110010101100101011100100110100101101110011001110010000001001000011001010110111001110010011110010010000001010011011000010110110101110101011001010110110001101001001000000101001101100011011010000110111101101111011011000010000001101111011001100010000001100101011011100110011101101001011011100110010101100101011100100110100101101110011
TTGG
CGTA
ATCA
TGGT
CATA
GCTG
TTTC
CTGT
GTGA
AATT
GTTA
TCCG
CGAT
GCGT
CCAC
AACG
CTAC
AAAT
GTTG
GCGT
AATC
ATGG
TCAT
AGCT
GTTT
CCTG
TGTG
AAAT
TGTT
ATCC
GCGA
TGCG
TCCA
CAAC
GCTT
UC
LA E
NG
INE
ER
|
29
WEI WANG
Professor of Computer Science
Ph.D. β UCLA Henry Samueli School of Engineering and Applied Science
Wei Wangβs research interests are in data mining, bioinformatics and
computational biology, and databases. She has filed seven patents, and
has published one monograph and more than 100 research papers in
international journals and major peer-reviewed conference proceedings.
Prior to joining UCLA Engineering, Wang spent 10 years as a faculty
member in the Computer Science Department at the University of North
Carolina, Chapel Hill. She was also a member of the Carolina Center for
Genomic Sciences and the Lineberger Comprehensive Cancer Center.
Wang was a research staff member at the IBM Thomas J. Watson Research
Center before joining UNC.
Wangβs honors include the NSF CAREER Award, IBM Invention
Achievement Award (twice), and she was a Microsoft Research Faculty
Fellow. She is currently an associate editor for ACM Transactions on
Knowledge Discovery in Data, International Journal of Knowledge
Discovery in Bioinformatics, and the International Journal of Data Mining
and Bioinformatics. n
UC
LA E
NG
INE
ER
|
30FACULT Y
Honors and Awards
Judea Pearl wins ACM TURING AWARD for contributions that transformed artificial intelligenceACM, the Association for Computing Machinery, presented Judea Pearl,
UCLA professor of computer science, with the 2011 ACM A.M. Turing
Award for innovations that enabled remarkable advances in the partnership
between humans and machines that is the foundation of Artificial
Intelligence (AI).
The ACM Turing Award, widely considered
the βNobel Prize in Computing,β carries a
$250,000 prize, with financial support provided
by Intel Corporation and Google Inc. It is named
for the British mathematician Alan M. Turing,
whose 100th anniversary was celebrated in June
at the ACM 2012 Turing Centenary Celebration.
Pearl pioneered developments in probabilistic and causal reasoning
and their application to a broad range of problems and challenges. He
created a computational foundation for processing information under
uncertainty, a core problem faced by intelligent systems. He also developed
UC
LA E
NG
INE
ER
|
31
UCLA Engineering's distinguished faculty have
won numerous accolades for their excellence in
research, teaching and service.
graphical methods and symbolic calculus that enable machines to reason
about actions and observations, and to assess cause-effect relationships
from empirical findings. His work serves as the standard method for
handling uncertainty in computer systems, with applications ranging from
medical diagnosis, homeland security and genetic counseling to natural
language understanding and mapping gene expression data. His influence
extends beyond artificial intelligence and even computer science, to human
reasoning and the philosophy of science.
βLike Alan Turing himself, Pearl turned his thinking
to constructing procedures that might be harnessed
to perform tasks traditionally associated with human
intelligence,β said Vint Cerf, chair of the ACM 2012 Turing
Centenary Celebration, and a former ACM Turing Award
recipient. βHis accomplishments over the last 30 years have provided the
theoretical basis for progress in artificial intelligence and led to extraor-
dinary achievements in machine learning, and they have redefined the term
βthinking machine.ββ Cerf pointed to Pearlβs innovation as a quantum leap
from Turingβs βtestβ dating to the 1950s, when Turing set out to discover if
machines could think. (from ACM) n
ββ www.engineer.ucla.edu/pearl-turing
ββ http://acm.org/pearl
His work serves as the
standard method for
handling uncertainty in
computer systems.
Pho
to: S
andy
Sch
aeff
er
UC
LA E
NG
INE
ER
|
32
Vaughan Receives UNITED STATESβ HIGHEST AWARD for Young Engineers and Scientists By Wileen Wong Kromhout
Jennifer Wortman Vaughan, an assistant professor
of computer science, received the Presidential
Early Career Award for Scientists and Engineers
(PECASE), the highest honor given by the United
States government to young engineers and scientists at
the outset of their professional careers.
Vaughan received the award in August at a special
ceremony for the PECASE honorees in Washington, D.C.
at the Smithsonian Institutionβs National Museum of
Natural History. John P. Holdren, Assistant to the President for Science and Technol-
ogy and Director of the White House Office of Science and Technology Policy led the
ceremony. The award winners then met with President Obama at the White House.
"Discoveries in science and technology not
only strengthen our economy, they inspire us as
a people,β President Obama said. βThe impressive
accomplishments of todayβs awardees so early in
their careers promise even greater advances in
the years ahead.β
Vaughanβs research interests are in machine learning, algorithmic aspects of
economics, and social computing.
βIt is a huge thrill and an honor to receive this award,β said Vaughan, who holds
the Symantec Term Chair in Computer Science. βItβs exciting to see such strong
government support for basic research in science and engineering.β
The growing popularity of the Internet including social networking sites like
Facebook has led to the availability of novel sources of data on preferences, behaviors,
and beliefs of massive populations of users. A major goal of Vaughanβs research is to
bridge the gap between theory and practice by designing a new generation of machine
learning models and algorithms to address and explain the issues commonly faced
when attempting to aggregate local information across large online communities. n
ββ www.engineer.ucla.edu/vaughan-pecase
A major goal of
Vaughanβs research is to
bridge the gap between
theory and practice.
Pho
to: K
endr
a G
reen
berg
UC
LA E
NG
INE
ER
|
33
Yi Tang receives PRESIDENTIAL GREEN CHEMISTRY CHALLENGE
AWARD from EPABy Wileen Wong Kromhout
Yi Tang, professor of chemical and
biomolecular engineering, has been
awarded the prestigious 2012 Presidential
Green Chemistry Challenge Award from
the U.S. Environmental Protection Agency.
The annual award recognizes pioneering chemical
technologies developed by leading researchers and
industrial innovators who are making significant contri-
butions to pollution prevention in the United States
β including the design of safer and more sustainable
chemicals, processes and products that will protect
citizens from exposure to harmful materials.
Tang's winning technology resulted in a new,
less-hazardous manufacturing process
for simvastatin, a leading cholesterol-
lowering statin drug. Though the
drug is manufactured from a natural
product, the traditional synthesis
was a wasteful, multi-step chemical
process that used large amounts of
hazardous reagents.
Tang conceived of a synthesis
that instead used an engineered
enzyme and a practical, low-cost
feedstock. He partnered with Codexis Inc. β a
developer of industrial enzymes that enable the
cost-advantaged production of biofuels, bio-based
chemicals and pharmaceutical intermediates β to
optimize both the enzyme and the chemical
process for commercial use. Codexis will also be
presented with
the EPA award
as part of this
collaboration.
"Receiving
this award shows
the impact that
can be made in a highly synergistic collaboration
between academic and industrial research teams,"
Tang said. "The development and optimization of the
process have been highly rewarding for my research
group. Receiving this recognition from the EPA two
years after my colleague James Liao received the
same award is a strong testament to the quality and
impact of the research that is being conducted in
the Department of Chemical and Biomolecular
Engineering at UCLA."
Tang is also a professor of chemistry and
biochemistry in the UCLA Division of Physical
Sciences. n
ββ www.engineer.ucla.edu/
tang-green-chemistry
Tang's winning technology
resulted in a new, less-
hazardous manufacturing
process for Simvastatin.
UC
LA E
NG
INE
ER
|
34
The Association for Computing
Machinery named Judea Pearl,
computer science, the winner of
the 2011 A.M. Turing Award, often
called the Nobel Prize for computing.
Pearl was recognized for innovations
that enabled remarkable advances
in artificial intelligence. Pearl also
received the Harvey Prize from the
Technion (Israel), for foundational
work that influenced spheres of
modern life. He was also named a
Fellow of the American Academy of
Arts & Sciences.
Henry Samueli, chairman, co-founder
and CTO of Broadcom Corporation
and an electrical engineering
professor, won the 2012 Marconi
Society Prize and Fellowship. Samueli
was selected for his pioneering
advances in the development and
commercialization of analog and
mixed-signal circuits for modern
communication systems, in particular
the cable modem. Samueli also
received the 2011 Dr. Morris Chang
Exemplary Leadership Award from the
Global Semiconductor Alliance.
Yi Tang, chemical and biomolecular
engineering, received the prestigious
2012 Presidential Green Chemistry
Challenge Award from the U.S.
Environmental Protection Agency.
The award recognizes pioneering
chemical technologies that will make
significant contributions to pollution
prevention. Tang was also named
a 2012 Arthur C. Cope Scholar by
the American Chemical Society, for
excellence in organic chemistry.
Aydogan Ozcan, electrical
engineering and bioengineering,
received the Presidential Early Career
Award for Scientists and Engineers
(PECASE), the highest honor given
by the United States government to
engineers and scientists at the outset
of their professional careers.
Ozcan received several other notable
honors in the previous year including:
the 2011 Army Research Office
Young Investigator Award, winning
the Health Allianceβs Innovators
Challenge; and seeing his cell-phone
based microscope selected as the top
innovation of 2011, from The Scientist
magazine. Also, he and a colleague
at Harvard received a Grainger
Foundation Frontiers of Engineering
Grant for Advancement of Interdis-
ciplinary Research from the National
Academy of Engineering.
Jennifer Wortman Vaughan,
computer science, received the
Presidential Early Career Award for
Scientists and Engineers (PECASE),
the highest honor given by the United
States government to engineers and
scientists at the outset of their profes-
sional careers. Vaughan holds the
Symantec Term Chair in
Computer Science.
Dino Di Carlo, bioengineering, was
awarded a Packard Fellowship for
Science and Engineering, from the
David and Lucile Packard Foundation.
Di Carlo received several other
notable honors in the previous year
including: a Young Faculty Award
from the Defense Advanced Research
Projects Agency; a Faculty Early Career
Development (CAREER) award from
the National Science Foundation; and
a 2012 Young Investigator Award from
the Office of Naval Research.
James C. Liao, chemical and
biomolecular engineering, was
honored by the White House as a
FACULT Y AWARDS
UCL A ENGINEERING 2011-2012
UC
LA E
NG
INE
ER
|
35
Champion of Change, for his new
ideas for a clean energy future.
Liao holds the Parsons Chair in
Chemical Engineering.
Leonard Kleinrock, computer science,
was honored by IEEE with its 2012
Alexander Graham Bell Medal, for
pioneering contributions to modeling,
analysis and design of packet-
switching networks. Kleinrock was
also named to the inaugural class for
the Internet Hall of Fame, coinciding
with the Internet Societyβs 20th
Anniversary.
William W-G. Yeh, civil and environ-
mental engineering, was named a
Fellow of the American Association
for the Advancement of Science, the
worldβs largest general scientific
society and the publisher of the
journal Science. Yeh holds the Richard
G. Newman AECOM Chair in Civil
Engineering. Yeh also received a
Lifetime Achievement Award from
the 2012 Environmental & Water
Resources Institute, ASCE.
Kuo-Nan Liou, atmospheric
and oceanic sciences , electrical
engineering, and mechanical and
aerospace engineering, received the
2012 Quadrennial Gold Medal Award
from the International Radiation
Commission. He was recognized for
βcontributions of lasting significance to
the field of radiation research.β
M.C. Frank Chang, electrical
engineering, was elected to the
Academic Sinica, the highest
academic honor in Taiwan. Election
recognizes scholars with exemplary
research achievements in the fields
of mathematics and physical sciences,
life sciences, or humanities and social
sciences. Chang holds the Wintek
Chair in Electrical Engineering.
Russell Caflisch, mathematics, and
materials science and engineering
was among 220 distinguished scholars,
scientists, authors, artists, and
business and philanthropic leaders
elected to the American Academy of
Arts & Sciences.
C. Kumar N. Patel, physics and
astronomy, and electrical engineering,
was inducted into the National
Inventors Hall of Fame for his
invention of the carbon dioxide laser
in the early 1960s.
Algirdas Avizienis, computer science,
received the Jean-Claude Laprie
Award, which recognizes outstanding
papers published at least ten years
ago that have significantly influenced
dependable computing. Avizienis also
received the 2012 ACM/IEEE Eckert-
Mauchly Award, considered the
most prestigious award for computer
architecture.
Danijela Cabric, electrical
engineering, received a Faculty Early
Career Development (CAREER) award
from the National Science Foundation.
It funds her research on an integrated
physical and network layer approach
for wireless spectrum sharing. Cabric
also received an award for the UCLA
Hellman Fellows program, which
supports promising junior faculty.
Robert Candler, electrical
engineering, received a Young Inves-
tigator Award from the Army Research
Office. The award funds research on
fundamental mechanisms in which
energy is dissipated in nanoscale
vibrating structures.
Jiun-Shyan Chen, civil and environ-
mental engineering, mechanical
and aerospace engineering, and
mathematics, received the Compu-
tational Mechanics Award, from
the International Association for
Computational Mechanics. The award
recognizes significant contribu-
tions to traditional and new areas of
computational mechanics.
Panagiotis D. Christofides,
chemical and biomolecular
engineering, was elected a Fellow
of the International Federation
of Automatic Control (IFAC),
recognizing outstanding and
extraordinary contributions in the
fields of interest to IFAC.
Jason Cong, computer science,
received the 2012 ACM Transactions
on Design Automation of Electronic
Systems Best Paper Award, for the
journal entitled βBehavior-Level
Observability Analysis for Operation
continued
UC
LA E
NG
INE
ER
|
36Gating in Low-Power Behavioral
Synthesis,β with co-authors from
UCLA Bin Liu and professor Rupak
Majumdar, and Zhiru Zhang from
AutoESL Design Technologies, Inc.
UCLA Engineering Dean Vijay K.
Dhir, mechanical and aerospace
engineering, was named an Honorary
Member of ASME, reserved for a
person who has made βdistinctive
contributionsβ to engineering,
science, industry, research, public
service, or other pursuits allied with
and beneficial to the engineering
profession. Dhir also received an
honorary degree from his Ph.D.
alma mater, the University of
Kentucky. He also received a Lifetime
Achievement Award from the
International Conference on
Computational & Experimental
Engineering and Sciences.
Lara Dolecek, electrical engineering,
received a Faculty Early Career
Development (CAREER) award from
the National Science Foundation.
The award funds her research on
improving the storage and processing
of massive amounts of data by
fundamentally rethinking the
underlying data reliability metrics.
Bruce Dunn, materials science and
engineering, was elected as a Fellow
of the Materials Research Society.
Dunn was cited for βextraordinary
contributions to development of new
materials based on sol-gel chemistry;
synthesis, characterization, and
development of electrochemical
materials; design, materials, and
fabrication processes for 3-D battery
technology.β Dunn holds the Nippon
Sheet Glass Chair in Materials Science.
Rajit Gadh, mechanical and aerospace
engineering, was elected a Fellow of
the American Society of Mechanical
Engineers (ASME) for his information-
based design and manufacturing.
Warren Grundfest, bioengineering,
has been appointed to the FDA
Science Advisory Board, to serve
on the Subcommittee for the
Center for Devices & Radiological
Health. This prestigious committee
provides scientific advice and
reviews regulatory science issues and
programs of the FDA.
Puneet Gupta, electrical engineering,
received an IBM Faculty Award.
Guptaβs lab focuses its research on
electronic design automation and
design for manufacturing, in particular,
application-architecture-implemen-
tation-fabrication interfaces.
Chih-Ming Ho, mechanical and
aerospace engineering, and bioen-
gineering, was appointed a visiting
member of the Hong Kong University
of Science and Technologyβs Institute
of Advanced Study, which champions
collaborative projects across
disciplines and institutions. Ho holds
the Ben Rich Lockheed Martin Chair
in Aeronautics. Ho also presented
the Yunchuan Aisinjioro-Soo
Distinguished Lecture at the University
of Illinois, Urbana-Champaign.
Tatsuo Itoh, electrical engineering,
received the College of Engineering
Alumni Award for Distinguished
Service from the University of Illinois,
Urbana-Champaign. He was cited for
βSeminal Contributions in Microwave
and Millimeter-Wave Technology and
Electrical Engineering Education.β
Also, Itoh and graduate student
Hanseung Lee received the Best
Paper Award at the Asia Pacific
Microwave Conference 2011. Itoh
holds the Northrop Grumman Chair in
Microwave Electronics.
Bahram Jalali, electrical engineering
has been elected a Fellow of the
American Physical Society (APS)
for his significant and innovative
contribution to the application of
physics in science and technology
and advances in knowledge through
research. Jalali holds the Northrop
Grumman Chair in Opto-Electronics.
Jiann-Wen βWoodyβ Ju, civil and
environmental engineering, was the
keynote speaker at the Symposium
on βFundamental Theory for the
Performance Evolution and Sensing
Control of Urban Metro Structures."
Ju was also the Plenary Lecturer and
Conference Co-Chairman of the
First International Conference on
Damage Mechanics.
continued
UC
LA E
NG
INE
ER
|
37
William Kaiser, electrical engineering,
and alumnus Henrik Borgstrom,
recently received a Best Paper award
from the ASEE for a publication
on their new hands-on instruction
technology developed for the UCLA
undergraduate curriculum.
Ann Karagozian, mechanical
and aerospace engineering, was
appointed as a Member-at-Large
of the U.S. National Committee on
Theoretical and Applied Mechanics.
On behalf of the National Academy of
Sciences and the National Research
Council, USNC/TAM is the official U.S.
representative to the International
Union of Theoretical and Applied
Mechanics.
Andrea M. Kasko, bioengineering,
received a 2011 NIH Directorβs New
Innovator Award from the National
Institutes for Health. The program
supports exceptionally creative
investigators at an early stage in
their career.
Chang-Jin (CJ) Kim, mechanical and
aerospace engineering professor, was
selected by the Korean newspaper
Dong-A as one of β100 People Who
Will Light Up Korea in Year 2020.β
The selection noted his outstanding
research in micro electro-mechanical
systems (MEMS).
Asad M. Madni, electrical
engineering, received the 2012 IEEE
Aerospace and Electronic Systems
Societyβs (AESS) Pioneer Award for
the development and commercial-
ization of aerospace and electronic
systems. Madni also recently received
an honorary doctorate from Technical
University of Crete.
Jens Palsberg, computer science,
was honored by the Association
for Computing Machinery (ACM)
for services to the programming
languages community.
Alexander Sherstov, computer
science, received a Faculty Early
Career Development (CAREER) award
from the National Science Foundation.
The award funds Sherstovβs research
on communication complexity.
The UCLA Academic Senate awarded
Jonathan P. Stewart, civil and
environmental engineering, a Distin-
guished Teaching Award. Stewart was
recognized for distinction in teaching
at the graduate level.
Paulo Tabuada, electrical engineering,
and former student Adolfo Anta
received the 2011 George S. Axelby
Award at the 50th IEEE Conference
on Decision and Control. The award
recognizes the best paper published
in the IEEE Transactions on Automatic
Control in the previous two years.
Benjamin Williams, electrical
engineering, received a Faculty Early
Career Development (CAREER) Award
from the National Science Foundation.
The award supports his research
on βwidely tunable monolithic THz
waveguides, lasers, and arrays.β
Alan Willson, electrical engineering,
received the 2012 Darlington Best
Paper Award, from the IEEE Circuits
and Systems Society. The award
recognizes the best paper bridging
the gap between theory and practice
published in the βIEEE Transactions
on Circuits and Systems.β Willson
holds the Charles P. Reames Chair in
Electrical Engineering.
Gerard Wong, bioengineering, was
elected a fellow of the American
Physical Society for his contributions
to the understanding of electrostatic
interactions in biological systems.
Ya-Hong Xie, materials science and
engineering, received an Alexander
von Humboldt Research Award from
the Germany-based foundation. The
award recognizes a researcherβs
fundamental discoveries, new
theories, or insights that have had a
significant impact on their
own discipline.
The paper, βSystolic Arrays for
Lattice Reduction Aided MIMO
Detection,β authored by PhD student
Ni-Chung Wang, Adjunct Professor
Ezio Biglieri and Professor Kung Yao,
published in October 2011 in
IEEE Journal of Communications
and Networks, received the Best
Paper Award.
UC
LA E
NG
INE
ER
|
38Ph.D. ALUMNI NEW ACADEMIC APPOINTMENTS
Chiao-En Chen, PhD β09
Electrical Engineering/Communi-
cation Engineering
National Chung Cheng University,
Taiwan
ADVISOR: Kung Yao
Kai Chen, PhD β09
Materials Science
Jiao Tung University, Xβian, China.
ADVISOR: King-Ning Tu
Ting-Hsuan Chen, PhD β12
Mechanical and Biomedical
Engineering
City University of Hong Kong
ADVISOR: Chih-Ming Ho
Pei-Ling Chi, PhD β11
Electrical Engineering
National Chaio Tung University,
Taiwan
ADVISOR: Tatsuo Itoh
Sheng-Wei Chi, PhD β10
Civil and Materials Engineering
University of Illinois at Chicago
ADVISOR: Jiun-Shyan (JS) Chen
Yi-Chia Chou, PhD β10
Materials Science and Engineering
National Chiao Tung University,
Hsinchu, Taiwan.
ADVISOR: King-Ning Tu
Wei-Ho Chung, PhD β09
Research Center for Information
Technology Innovation
Academia Sinica, Taiwan
ADVISOR: Kung Yao
Marisa Eisenberg, PhD β09
Epidemiology, Mathematics
University of Michigan
ADVISOR: Joseph DiStefano III
Zhen Gu, PhD β10
Biomedical Engineering
North Carolina State University
ADVISOR: Yi Tang
Shalabh Gupta, PhD β09
Electrical Engineering
Indian Institutes of Technology,
Bombay, India
ADVISOR: Bahram Jalali
Ping-Hsuan Hsieh, PhD β09
Electrical Engineering
National Tsing-Hua University, Taiwan
ADVISOR: Chih-Kong βKenβ Yang
Bryan Yu Hu, PhD β09
Electrical and Computer Engineering
University of Alberta, Alberta, Canada
ADVISOR: Lei He
Dohyun Kim, PhD β08
Mechanical Engineering
Myongji University, South Korea
ADVISOR: Jack Judy
Peter Bjorn Lillehoj, PhD β11
Mechanical Engineering
Michigan State University
ADVISOR: Chih-Ming Ho
Jenny Yi-Chun Liu, PhD β11
Electrical Engineering
National Tsing Hua University, Taiwan
ADVISOR: M.C. Frank Chang
Jinfeng Liu, Phd β11
Chemical Engineering and Materials
Science
University of Alberta, Canada
ADVISOR: Panagiotis D. Christofides
Nicholas Mastronarde, PhD β11
Electrical Engineering
The State University of New York at
Buffalo
ADVISOR: Mihaela van der Schaar
Manuel Mazo,Jr., PhD β12
Delft Center for Systems and Control
Delft University of Technology,
Netherlands
ADVISOR: Paulo Tabuada
Youngsuk Nam, PhD β10
Mechanical Engineering
Kyung Hee University, South Korea
ADVISOR: Y. Sungtaek Ju
Jaeok Park, PhD β09
Economics
Yonsei University, South Korea
ADVISOR: Mihaela van der Schaar
Bibhudatta Sahoo, PhD β09
Electronics & Electrical Communi-
cation Engineering
Indian Institute of Technology (IIT),
Kharagpur, India
ADVISOR: Behzad Razavi
Thomas Schmid, PhD β09
Electrical and Computer Engineering
The University of Utah
ADVISOR: Mani Srivastava
UC
LA E
NG
INE
ER
|
39
Wenjiang Shen, PhD β04
Mechanical Engineering
Suzhou Institute of Nano-Tech and
Nano-Bionics, China
ADVISOR: Chang-Jin (CJ) Kim
James R. Springstead, PhD β08
Paper Engineering, Chemical
Engineering and Imaging
Western Michigan University
ADVISOR: Harold G. Monbouquette
Vincent Tung, PhD β09
Materials Science and Engineering
UC Merced
ADVISOR: Yang Yang
Tak-Sing Wong, PhD β09
Mechanical and Nuclear Engineering
Pennsylvania State University
Ph.D. and POST-ADVISOR: Chih-Ming Ho
Judy P. Yang, PhD β12
National Chiao Tung University,
Taiwan
ADVISOR: Jiun-Shyan (JS) Chen
Lap Yeung, PhD β10
Electronic Engineering
Chinese University of Hong Kong
ADVISOR: Yuanxun Ethan Wang
Yan Yao, PhD β08
Electrical and Computing Engineering
University of Houston
ADVISOR: Yang Yang
Hao Yu, PhD β07
Electrical and Electronic Engineering
Nanyang Technological University,
Singapore
ADVISOR: Lei He
POST-DOCTORAL SCHOLARS ACADEMIC APPOINTMENTS
Keisuke Goda
Physical Chemistry
University of Tokyo
Post-doctoral advisor: Bahram Jalali
Xue Jin
Edinburgh University, Scotland,
United Kingdom
Post-doctoral advisor: Eric M.V. Hoek
Miuling Lam
Creative Media
City University of Hong Kong
Post-doctoral Advisor: Chih-Ming Ho
Arun Prakash
Civil Engineering
Purdue University
Post-doctoral advisor: Ertugrul
Taciroglu
Guy Ramon
Technion University, Israel
Post-doctoral advisor: Eric M.V. Hoek
FACULTY ENDOWED CHAIR HOLDERS
Ben Rich Lockheed Martin Chair in
Advanced Aerospace Technologies
Chih-Ming Ho
Carol and Lawrence E. Tannas, Jr.,
Endowed Chair in Engineering
Yang Yang
Charles P. Reames Endowed Chair in
Electrical Engineering
Alan Willson, Jr
Edward K. and Linda L. Rice Endowed
Term Chair in Civil Engineering
Materials
Gaurav Sant
Jonathan B. Postel Chair in Computer
Systems
Lixia Zhang
Jonathan B. Postel Chair in
Networking
Deborah Estrin
Nippon Sheet Glass Company Chair
Materials Science
Bruce S. Dunn
Norman E. Friedmann Chair in
Knowledge Sciences
Carlo Zaniolo
Northrop Grumman Chair in Electrical
Engineering/Electromagnetics
Yahya Rahmat-Samii
Northrop Grumman Chair in Electrical
Engineering
Tatsuo Itoh
UC
LA E
NG
INE
ER
|
40Northrop Grumman Opto-Electronic
Chair in Electrical Engineering
Bahram Jalali
Ralph M. Parsons Foundation Chair in
Chemical Engineering
James C. Liao
Raytheon Chair in Electrical
Engineering
Kang L. Wang
Richard G. Newman AECOM Endowed
Chair in Civil Engineering
William W-G. Yeh
Rockwell International Chair in
Engineering
J. John Kim
Symantec Term Chair in Computer
Science
Jennifer Wortman Vaughan
William Frederick Seyer Endowed
Chair in Materials Electrochemistry
Jane P. Chang
Wintek Endowed Chair in Electrical
Engineering
M.C. Frank Chang
Vacant Chairs
Evalyn Knight Chair in Engineering
Leonard Kleinrock Term Chair in
Computer Science
Levi James Knight Jr. Chair in
Engineering
L.M.K. Boelter Chair in Engineering
Ronald and Valerie Sugar Chair in
Engineering
Raytheon Chair in Manufacturing
Engineering
Traugott and Dorothea Frederking
Endowed Chair in Cryogenics
William D. Van Vorst Chair in Chemical
Engineering Education
Chancellorβs Professors
Asad Abidi
Jiun-Shyan (JS) Chen
Jason Cong
Yi Tang
Demetri Terzopoulos
Mihaela van der Schaar
Samueli Fellows
Danijela Cabric
Eric Hoek
Yu Huang
Benjamin Williams
DEANβS ADVISORY COUNCIL
William F. Ballhaus, Jr. PhD
CEO (Retired)
The Aerospace Corporation
Charles Bergan
Vice President
Engineering Research & Development
Qualcomm
Aaron S. Cohen β58
Vice Chairman and Founder
National Technical Systems
Vinton G. Cerf MS β70, PhD β72
Chief Internet Evangelist
Lou Cornell, P.E.
Vice President
Southern California District Manager
AECOM
Lucien βAlβ Couvillon, Jr. β62,
MS β66
Retired
Vice President for Corporate R&D
Boston Scientific Corporation
R. Paul Crawford
Director of Health Research
Intel Labs
Richard A. Croxall
Vice President and Chief Engineer
(Retired)
Northrop Grumman Corporation
Siddhartha Dalal
Chief Technology Officer
RAND Corporation
Vijay K. Dhir
Dean
UCLA Henry Samueli School of
Engineering and Applied Science
James L. Easton β59
Chairman and President
Jas D. Easton, Inc.
Gary W. Ervin β80
Corporate Vice President & President
Aerospace Systems
Northrop Grumman Corporation
B. John Garrick MS β62, PhD β68
President & CEO (Retired)
PLG, Inc.
Sam F. Iacobellis MS β63
Deputy Chairman (Retired)
Rockwell International Corporation
UC
LA E
NG
INE
ER
|
41
William A. Jeffrey
President and CEO
HRL Laboratories, LLC
Leslie M. Lackman
Deputy Director, ITA
UCLA Henry Samueli School of
Engineering and Applied Science
Jeff Lawrence β79
President and CEO
Clivia Systems
Steven D. Liedle
Project Manager
Bechtel Power Corporation
Rajeev Madhavan
Chairman and CEO
Magma Design Automation, Inc.
Joanne M. Maguire MS β78,
CERT β89
Executive Vice President
Lockheed Martin Space Systems
Pankaj Patel
Senior Vice President and General
Manager
Cisco Systems, Inc.
Rami R. Razouk β75, MS β75, PhD β80
Senior Vice President
Engineering and Technology
The Aerospace Corporation
Edward K. Rice
Chairman
CTS Cement Manufacturing Company
Kevin Riley
President
Teledyne Scientific & Imaging, LLC
Henry Samueli β75, MS β76, PhD β80
Chairman, co-founder and CTO
Broadcom Corporation
Gerald Solomon
Executive Director
Samueli Foundation
Dwight C. Streit MS β83, PhD β86
Professor
Director, Institute for Technology
Advancement
UCLA Henry Samueli School of
Engineering and Applied Science
Lawrence E. Tannas, Jr. β59, MS β61
Electronics Consultant
Tannas Electronics
Murli Tolaney
Chairman
MWH Global, Inc.
John J. Tracy, Ph.D
CTO & SVP of Engineering, Operations
& Technology
The Boeing Company
Stephen Trilling CERT β00
Vice President
Security Technology and Response
Symantec Corporation
Nicholas M. Uros ME β84, CERT β93
Vice President
Advanced Concepts and Technology
Raytheon Systems Company
David A. Whelan MS β78, PhD β83
Vice President, General Manager, and
Deputy to the President
The Boeing Company
FACULTY PATENTS AWARDED 2011-2012
M.C. Frank Chang, holder of the
Wintek Endowed Chair in Electrical
Engineering, Daquan Huang, and Tim
LaRocca: Origami cascaded topology
for analog and mixed-signal appli-
cations; Submillimeter-wave signal
generation by linear superimposition
of phase-shifted fundamental tone
signals (two patents).
Chang, Huang and Willian Hant:
Tunable artificial dielectrics.
Chang, Qun Gu, Jenwei Ko, and
Zhiwei Xu: Self-sychronized radio
frequency interconnect for three-
dimensional circuit.
Francis Chen, professor emeritus of
electrical engineering, and Humberto
Torreblanca: Helicon plasma source
with permanent magnets.
Wesley Chu, professor of electrical
engineering, Jianming He, and
Zhenyu Liu: System and methods for
evaluating interferences of unknown
attributes in a social network.
Eric M.V. Hoek, associate professor of
civil and environmental engineering,
Asim Ghosh, and Jodie Nygaard:
Micro and nanocomposite support
structures for reserve osmosis thin
film membranes.
UC
LA E
NG
INE
ER
|
42Mario Gerla, professor of computer
science, and M. Yahya Sanadidi: TCP
Westwood with priorities for quality
of service differentiation at the
transport layer.
Tatsuo Itoh, holder of the Northrop
Grumman Chair in Electrical
Engineering, and Pei-Ling Chi:
Compact dual-band metamaterial-
based hybrid ring coupler.
Itoh, Christophe Caloz, and Hsiang
Lin: Composite right/left-handed
(CRLH) couplers.
CJ Kim, professor of mechanical
and aerospace engineering, and
De-Sheng Meng: Method and
Apparatus for pumping liquids using
direction growth with elimination of
bubbles.
Kim and Jane Tsai: Printing pins
having selective wettability and
method of making same.
Kim, and Gaurav Jitendra Shah:
Methods for using magnetic particles
in droplet microfluidics.
Rafail Ostrovky, professor of
computer science: Method for low
distortion embedding of edit distance
to hamming distance.
Jacob Schmidt, associate professor
of bioengineering, Tae Joon Jeon,
Noah Malmstadt, and Jason Poulos:
Formation and encapsulation of
molecular bilayer and monolayer
membranes.
Kang L. Wang, holder of the
Raytheon Chair in Electrical
Engineering, Fei Liu, and Siguang Ma:
Carbon nanotube/nanowire thermo-
photovoltaic cell.
Wang, Mary Eshaghian-Wilner and
Alexander Khitun: Spin-wave
architectures.
Benjamin Wu, professor of
bioengineering: Composition for
promoting cartilage formation
or repair comprising a NELL Gene
produce and method of treating;
Expression of NELL Peptide; NELL
peptide expression systems and bone
formation activity of NELL peptide;
and NELL-1 enhanced bone mineral-
ization (four patents).
Yang Yang, holder of the Carol and
Lawrence E. Tannas, Jr., Endowed
Chair in Engineering, and Jinsong
Huang: Polymer electronic devices
by all-solution process.
Ya Hong Xie, professor of materials
science and engineering: Spin
injection device having semicon-
ductor-ferromagnetic-semiconductor
structgure; Spin injector. (two
patents).
THE 2012 BOELTER SOCIETY HONOR ROLL
DEANβS VISIONARIESThe Deanβs Visionaries are individuals who have committed one million dollars or more, over the course of their lifetime or through their estate, to support the students and faculty of the UCLA Henry Samueli School of Engineering and Applied Science.
Degrees listed include UCLA alumni and parents of engineering students.
Robert B. Allan Trust
Therese Kerze-Cheyovich Family Trust
Aaron S. Cohen β58 and Nancy D. Cohen
Ralph E. Crump β50 and Marjorie L. Crump β46
James L. Easton β59 and Phyllis F. Easton
Rhodine R. Gifford and Jack Gifford* β63
Kalosworks.org
W. N. Lin, Parent β11
Robert Nakich β65, MS β69 Trust
Mukund Padmanabhan MS β89, PhD β92
Charles P. Reames MS β80, ENG β82, PhD β85 and Deborah A. Reames
Edward K. Rice and Linda L. Rice
Henry Samueli β75, MS β76, PhD β80 and Susan F. Samueli
Patrick Soon-Shiong and Michele C. Soon-Shiong
Ronald D. Sugar β68, MS β69, PhD β71 and Valerie H. Sugar β71
Lawrence E. Tannas, Jr. β59, MS β61 and Carol A. Tannas, Parents β85
*Deceased
UC
LA E
NG
INE
ER
|
43
LIFETIME MEMBERSThis honor roll gratefully acknowl-edges those who have given $100,000 or more over the course of their lifetime or through their estate.
Sheldon G. Adelson and Miriam O. Adelson
Balu Balakrishnan MS β76 and Mohini Balakrishnan, Parents β11
Harold S. Becker ME β59 and Marilyn L. Becker
Benton Bejach and Wanlyn Bejach
Mark Berman MS β92, PhD β95 and Sharon B. Berman β91
Bernard L. Beskind β62, ME β66 and Lois R. Beskind
John Burnett
Vinton G. Cerf MS β70, PhD β72 and Sigrid L. Thorstenberg
Valerie Choudhury
Josephine Cheng β75, MS β77 and Michael Y. Pong
Brian L. Cochran β54 and Nancy A. Cochran
Aaron S. Cohen β58 and Nancy D. Cohen
Neal M. Cohen β87 and Adrienne D. Cohen β86
Robert N. Crane MS β65, PhD β70
Irina Cromwell
Ralph E. Crump β50 and Marjorie L. Crump β46
Alan P. Cutter β61, MBA β64
Stanley A. Dashew
Noel J. Deitrich β67
James L. Doane β68 and Jean M. Doane
James L. Easton β59 and Phyllis F. Easton
Thelma Estrin
Christopher P. Ferguson β86, PhD β99
Barry J. Forman β60
Dorothea H. Frederking
Norman E. Friedmann β50, MS β52, PhD β57 and Irene C. Kassorla β63, MA β65
B. John Garrick MS β62, PhD β68 and Amelia Garrick
Richard L. Gay β73, MS β73, PhD β76
Rhodine R. Gifford
H. P. Gillis
Bruce E. Gladstone β57, MS β62 and Beverly J. Gladstone β59
Ms. Victoria F. Goldberg β87
Hisayo Graham
Armond Hairapetian β87, MS β88, PhD β93, MFE β09 and Elena Hairapetian β96
Kevin G. Hall, Parent β06
James N. Harger β80
Ernest R. Harris β49
Robert Hawley MS β91, PhD β97
Franklin J. Henderson and Doris B. Henderson
P. Michael Henderson
Jerome Hollander β48 and Sonya Hollander
Hyley Huang, Parent β09
Jau-Hsiung Huang MS β85, PhD β88 and Hua J. Chang MBA β88
Pearl Illg β70
B. V. Jagadeesh
Kalosworks.org
James F. Kerswell β66 and Elizabeth Szeliga-Kerswell
Toshiko Kikuchi
Elizabeth Argue Knesel
Ryo Kokubu
Jeff Lawrence β79 and Diane E. Troth β80, MS β81
Terence Lim β92
Robert P. Lin and Lily W. Lin
W. N. Lin, Parent β11
Fang Lu MS β88, ENG β89, PhD β92 and Jui-Chuan Yeh MPH β96
Daniel C. Lynch MA β65
Asad M. Madni β69, MS β72 and Gowhartaj A. Madni, Parents β08
Dennis Maynard β69
Jonathan S. Min PhD β95, MBA β07
David Mong β84 and Emmy Mong
Richard Nesbit and Rose Marie Nesbit
Henry T. Nicholas, III β82, MS β85, PhD β98
Stacey E. Nicholas β85, MS β87
Tracy Nishikawa MS β85, PhD β88 and Gail K. Masutani
Sallie Boyd OβNeill
Marie A. Oberholtz
Mukund Padmanabhan MS β89, PhD β92
Michael W. Phelps β71, MS β71
Richard W. Phillips
Simon Ramo
Charles P. Reames MS β80, ENG β82, PhD β85 and Deborah A. Reames
Edward K. Rice and Linda L. Rice
Henry Samueli β75, MS β76, PhD β80 and Susan F. Samueli
Shioupyn Shen PhD β91 and Waishan Wu
Shiva Shivakumar β94
Bernard Shyffer β49, MS β63 and Barbara W. Shyffer
Richard G. Somers and Mary E. Bosak
Alfred W. Sommer and Joyce Sommer
Patrick Soon-Shiong and Michele C. Soon-Shiong
UC
LA E
NG
INE
ER
|
44Oscar M. Stafsudd, Jr. and
Jacqueline Stafsudd
Eugene P. Stein β68 and Marilyn L. Stein
Richard Stevenson and Kirsten L. Sommer β60
David E. Storrs β82, MS β83
Ronald D. Sugar β68, MS β69, PhD β71 and Valerie H. Sugar β71
Lawrence E. Tannas, Jr. β59, MS β61 and Carol A. Tannas, Parents β85
Raymond M. Taylor, Jr. β62, MS β66
Kathleen Tipton
Spyros I. Tseregounis MS β82, PhD β84 and Linda P. B. Katehi MS β81, PhD β84
King-Ning Tu
Sumermal Vardhan and Raj Kumari Vardhan, Parents β92, β98
V. M. Watanabe β72
Robert K. Williamson β62, MS β64, PhD β69 and Sandra Williamson
Marc A. Wood β69, ME β85
Tien-Tsai Yang PhD β68 and Jane J. Yang PhD β71
William W. Yeh and Jennie P. Yeh PhD β75
Norman L. Yeung β77
Anonymous (7)
DEANβS LOYALTY CIRCLE The new Deanβs Loyalty Circle honors donors who make a gift to UCLA Engineering for three or more consecutive years at $2,500 or more. Members of the Deanβs Loyalty Circle are among UCLA Engineeringβs most dedicated supporters, providing the school with a consistent source of vital funding.
Β’Deanβs Loyalty Circle donors
2011-2012 MEMBERSThis honor roll gratefully acknowl-edges gifts made to the UCLA Henry Samueli School of Engineering and Applied Science from July 1, 2011 through June 30, 2012.
Deanβs Ambassadors - $100,000 to $999,999Balu Balakrishnan MS β76 and
Mohini Balakrishnan, Parents β11
Josephine Cheng β75, MS β77 and Michael Y. Pong Β’
James N. Harger β80
Hyley Huang, Parent β09
Fang Lu MS β88, ENG β89, PhD β92 and Jui-Chuan Yeh MPH β96 Β’
David Mong β84 and Emmy Mong
Mukund Padmanabhan MS β89, PhD β92 Β’
Edward K. Rice and Linda L. Rice Β’
Lawrence E. Tannas, Jr. β59, MS β61 and Carol A. Tannas, Parents β85 Β’
Deanβs Scholars - $50,000 - $99,999Benton Bejach and Wanlyn Bejach
Robin B. Joshi β89, MS β91, PhD β95 and Celia Joshi β89 Β’
Kalosworks.org
Ryo Kokubu
W. N. Lin, Parent β11
John E. Rex β74
Shioupyn Shen PhD β91 and Waishan Wu
Allen M. Yourman, Jr. β76, MS β78 and Kimberley E. Yourman β73 Β’
Boelter Investors - $25,000 - $49,999Aaron S. Cohen β58 and
Nancy D. Cohen Β’
Ralph E. Crump β50 and Marjorie L. Crump β46 Β’
B. John Garrick MS β62, PhD β68 and Amelia Garrick
Vincent S. Ho β86, MS β86, PhD β90, MBA β94
Charles Seim β52 and Janet Y. Seim
Eugene P. Stein β68 and Marilyn L. Stein Β’
King-Ning Tu
Boelter Fellows - $10,000 - $24,999Beatrice D. Beggs β63, MA β67
Raymond S. Beggs Β’
Jiwen Cai MS β12
Yen-Ju Chen β88 and Fai-Long Kuo
Youngsoo Cha and Jin Hee Choi, Parents β15
Dorothea H. Frederking Β’
Marjorie R. Friedlander
Andrew A. Holden, Parent β13
Ronald E. Kent β57 and Myra Kent β55
Ajit K. Mal and Rosita N. Mal Β’
Waleed M. Namoos β94
Jonathan M. Orszag and Rica Orszag β93 Β’
Pankaj S. Patel, Parent β06 Β’
Christopher S. Proctor β82 and Julie A. Proctor β82, Parents β16
Andrew W. Pryor-Miller β08
Thierry Sanglerat and Rita Y. Sanglerat, Parents β13 Β’
Michael K. Stenstrom Β’
Vijayakumar Tella MS β88
Spyros I. Tseregounis MS β82, PhD β84 and Linda P. B. Katehi MS β81, PhD β84 Β’
Yang Yang and Danmei Lee Β’
Anonymous
Boelter Sponsors - $5,000 - $9,999Andrew D. Africk β88 and Jackie Africk Β’
David C. Banks β80, MS β81 and Judy Banks, Parents β12 Β’
UC
LA E
NG
INE
ER
|
45
James D. Barrie β83, MS β85, PhD β88 and Leslie A. Momoda β85, MS β87, PhD β90 Β’
Mark Berman MS β92, PhD β95 and Sharon B. Berman β91
Ming-Li Chai
Alan P. Cutter β61, MBA β64 Β’
Hernan Pongan De Guzman β85 and Suanne C. De Guzman, Parents β14
Dennis J. Drag MS β69, PhD β82 and Leslie A. Drag Β’
James L. Easton β59 and Phyllis F. Easton Β’
Bob English β82 and Anna M. Zara Β’
Hsiou-Ling C. Hsiang, Parent β13
Paul J. Jansen and Deborah K. Jansen, Parents β13
Russell W. Krieger, Jr. β70 and Linda M. Krieger
Leslie M. Lackman and Marjorie M. Lackman Β’
Elaine C. Lewis-Hovind β52
Kenneth H. Ma β83, MS β84 and Linda Ma β84 Β’
Carol L. Massey, Parent β13 Β’
Jerry Y. Ogawa β69 Β’
Dodd R. Portman and Lucia Portman, Parents β13
Simon Ramo
Marvin Rubinstein β53 Β’
George S. Stern β58, MA β59, PhD β64 and Adele R. Stern Β’
Dwight C. Streit MS β83, PhD β86 and Deborah Streit
Ghassan Toubia β81 and Nina Toubia
Ernst Volgenau PhD β66 and Sara L. Volgenau
Robert M. Webb β57, MS β63, PhD β67 and Dorothy Webb
Tien-Tsai Yang PhD β68 and Jane J. Yang PhD β71 Β’
Boelter Associates - $2,500 - $4,999Jacqueline N. Anderson β06
William Ballhaus, Jr. and Jane K. Ballhaus Β’
Fred J. Barker and Su Barker, Parents β14
Robert J. Barker β68, MBA β70 and Ildiko V. Barker Β’
Gary H. Burdorf β87, MS β89, PhD β93 and Sherry L. Burdorf β86, MBA β90 Β’
Jone Chen
Kaiwen Cheng
Douglas Corbett β73 and Lisa L. Corbett Β’
Michael Deutsch β78, MS β80 and Elena Deutsch
Vijay K. Dhir and Komal Dhir Β’
Navin H. Doshi and Pratima Doshi
Kenneth I. Friedman β61 Β’
Norman A. Futami and Jean K. Futami MBA β87, Parents β13
Hisayo Graham MS β60, PhD β69
Robert A. Green β72, JD β75 and Judy A. Green, Parents β03
Gene C. Gritton β63, MS β65, PhD β67 and Gwendolyn O. Gritton Β’
Ernest R. Harris β49 Β’
John M. Haworth
Jeffrey A. Houck and Monica C. Houck, Parents β13 Β’
Henry G. Jung β87
David B. Kennedy β83 and Ruth A. Holly, Parents β15
David W. Kim β98, MS β01
Francis H. Kishi β53, MS β58, PhD β63
Jeff Lawrence β79 and Diane E. Troth β80, MS β81
Sanboh Lee
Keith R. Leonard, Jr. β84, MBA β95 and Nanette L. Leonard β84 Β’
Ralph C. Levin β51
Craig R. Moles MS β89 and Nancy L. Moles Β’
James Murray β70, MS β71 and Carol L. Donald
Carey S. Nachenberg β95, MS β95 Β’
Daniel C. Pappone β77 and Syndie B. Meyer
Kenneth W. Privitt β77, MS β80 and Nancy G. Privitt β78
Alfonso Fred Ratcliffe β51, MS β63, PhD β70 and Dolores C. Ratcliffe
Joseph J. Rice β88 and Monica Rice
Glenn M. Sakamoto β82, MS β84
Peter B. Sender and Haya S. Sender, Parents β09 Β’
Durwin L. Sharp β70, MBA β74, PhD β79 and Christianne Melanson
Akira Shinoda β67 Β’
Steve J. Shire and Maria Yang, Parents β13
Chet M. Thaker β74 and Julie Dobson
Brian J. Thompson and Janet L. Thompson, Parents β15
David K. Triolo β80 Β’
Sarah M. Vasquez β08
Benjamin C. Wang β90 and Diana Tran Wang Β’
Feng C. Wang MA β65 and Yung H. Wang* MBA β70 Β’
Benjamin M. Wu and Betty Wu Β’
Russell G. Yee and Anne C. Wang Yee β89 Β’
Guo-Feng Yuan
Boelter Contributors - $1,000 - $2,499Arlene G. Adams
John S. Adams β62
UC
LA E
NG
INE
ER
|
46Darren Aghabeg β89 and
Angela Aghabeg
Song-Haur An MS β81, ENG β83, PhD β86 and Agnes An
James Edward Anhalt, III β92 and Lisa Anhalt
Richard E. Arnell and Cynthia A. Arnell, Parents β13
Ethan Aronoff PhD β71 and Barbara Aronoff
Lawrence K. Au β04, MS β07, PhD β11 and Gigi K. Lau β04
Rajive L. Bagrodia and Anju Bagrodia
Lisa L. Barker β84
John R. Barr MS β70, PhD β78 and Mary E. Barr
Richard S. Baty PhD β70 and Linda S. Baty
Paul T. Bent β73 and Barbara J. Bent
Erik C. Berg β89, ENG β95 and Phyllis Fang β90
Stevan A. Birnbaum β65
Brian K. Blockhus and Terese C. Blockhus, Parents β15
Heather B. Blockhus β15
Glen Boe β60 and Jean E. Boe
Michael Bruner β80 and Judy Bruner β80
Henry W. Burgess MS β75 and Cindy Burgess
Barak H. Bussel MS β93 MBA β95 and Helen Liu MS β04
Scott G. Campbell β04
Paul H. Chandler MS β74 and Kathleen R. Chandler
Benny C. Chang β70, MS β72 and Janet B. Chang β77
Chia-Ming Chang MS β07, PhD β07
Frank M. Chang and Shelly Chang, Parents β02
Leang-Kai Chang and Li-Chu Wu, Parents β13
Stanley E. Charles β56, MS β68 and Mary Louise Charles β60
Eddie C. Chau β89
Francis F. Chen and Edna L. Chen
Tong-Chen Cheng and Jennifer Jan, Parents β12
Ken C. Cheng MS β92, PhD β95 and Tiffany C. King
Louis T. Cheng MS β71 and Geraldine F. Cheng
Steve Chiou and Patricia Lee, Parents β15
Loren A. Chow PhD β99 and Jenny Ko JD β97
Wesley W. Chu and Julia Chu
Christopher A. Clark, Jr. β08
Neal M. Cohen β87 and Adrienne D. Cohen β86
Joseph L. Coleman and Kathleen Y. Coleman JD β84, Parents β14
John D. Cosgrove ME β67 and Shirley M. Cosgrove
Karal D. Cottrell β60 and Ann R. Cottrell
Lucien Alfred Couvillon, Jr. β62, MS β66 and Mary L. Couvillon
Benjamin F. Cowan β67, MD β75 and Lettie M. Burgett
Eric A. Cullenward and Laurie A. Cullenward, Parents β12
Curtis L. Dahlberg β73
Hans J. Dall and Carolyn R. Dall, Parents β14
Robert A. Dell-Imagine MS β60, PhD β65 and Helen R. Dell-Imagine β60, CRED β61
Patrick W. Dennis β76, MS β78, MBA β82, JD β82 and Nancy L. Dennis β79
Prithviraj Dharmaraja and Nirmala Dharmaraja, Parents β11
James L. Doane β68 and Jean M. Doane β70
Joe Donahoo and Luisa Tam
Wayne Dunlap β68 and Elise G. Dunlap
Mordecai N. Dunst β75 and Karen R. Dunst, Parents β13
Paul L. Dutra β96 and Holly H. Liu β99
Charles H. Eldredge and Melissa M. Eldredge, Parents β13
Thomas E. Ellis and Donna Mae Ellis, Parents β13
Augustine Moses O. Esogbue β64
Mark F. Flores β08
Gregory A. Fountain and Annette C. Fountain, Parents β14
R. E. Frederking
David G. Frostad β59 and Peggy J. Frostad β59
Terry N. Gardner PhD β75 and Shifra Gardner
Arnold J. Gaunt β86
Rodney C. Gibson MS β66, PhD β69 and Nancy P. Gibson, Parents β92
Vanessa Ozuna Ginzton β97 and Matthew D. Ginzton
Albert J. Glassman PhD β71
Thomas P. Goebel PhD β69
Anthony T. Gomez β69
William R. Goodin MS β71, PhD β75, ME β82 and Caroline Dockrell
Gagandeep S. Grewal β93 and Ramanjit K. Grewal
Arnold Hackett β87
William Hant PhD β70 and Myrna A. Hant β64, PhD β87, Parents β96
Frank J. Hanzel, Jr. β79, MS β81
Adam David Harmetz β05 and Helen Harmetz β04
Correta K. Harris β83
UC
LA E
NG
INE
ER
|
47
Jonathan K. Hart MS β84, ENG β85, PhD β88 and Kirsten E. Hart
Jan C. Harzan β76 and Annette Harzan
Barbara C. Heiller β69 and Larry Heiller
Jerre A. Hitz β58, MS β61 and Nancy K. Hitz β60
Wai K. Ho β78, MS β79 and Sou K. Ho
Frederick Hans Hoffman and Stella Ann Hoffman, Parents β11
Yasukazu Hoshino MS β94, PhD β02
Donald R. Howard β58 and Edwina Howard
Kenneth F. Hsiang β13
Kevin Hsiang
Linden Hsu β91
Terry Huang and Cindy Huang, Parents β13
Ryan Hundley
Reginald Jue MS β80 and Kathryn Cooperman Jue
Reynold S. Kagiwada β60, MS β63, PhD β66 and Harriet Kagiwada
Josephine Y. Kao β96
Ann Renee Karagozian β78 and Theodore Aram Sarafian
Andrew E. Katz β69, JD β72 and Denise L. Katz
Dr. Paul Kazimiroff and M. Renee McReynolds, Parents β13
James J. Killackey β57 and Cynthia M. Killackey
Seon Myung Kim PhD β90
Yong U. Kim MS β83, PhD β87 and Elizabeth Kim
Kerry H. Kokubun, Parent β12
Kevin Michael Kolnowski and Shirley M. Kolnowski, Parents β12, β12
Rosalie K. Kuhlmann β91
Rodney A. Kurihara and Peggy S. Kurihara, Parents β13
Robert C. Leamy β70 and Patricia Watts Leamy β70
Francis P. Lee and Christine S. Yip, Parents β14
John M. Lee MBA β86 and Lily T. Lee, Parents β13
Peter S. Lee β70
Sai Cheong Lee and Chung Ping Lee Lue, Parents β12
Shawmo E. Lin and Grace Lin, Parents β13
William H. Lingle, IV β80
Yuk C. Lo β84
Howard Khanh Luu β92 and My T. Luu
Gary E. MacDougal β58 and Charlene MacDougal
Asad M. Madni β69, MS β72 and Gowhartaj A. Madni, Parents β08
Brian W. Marbach β77 and Phyllis Rafferty Marbach MS β84
Donald R. Martin PhD β76 and Melissa C. Martin MS β75
Juan V. Martinez β81
Roxann M. Marumoto β85, MS β87 and David H. Julifs
Brian N. Mc Innis β95
Scott Mishima β87
Harold G. Monbouquette and Jeannette Monbouquette
Roger Murry β73, MS β76 and Catherine B. Murry
Don S. Myers β64 and Deborah K. Myers
Mas Nagami β53 and Dorothy Nagami
Kenneth W. Nam and Elena Nam, Parents β13
Fabiola Navarro
Andrew Kenneth Newman MS β95, PhD β05 and Amy Lam β94
William E. Nicolai, Jr. β50 and Mary L. Nicolai
Howard S. Nussbaum β71, MS β72, PhD β76 and Deborah M. Nussbaum
Lincoln D. Odell β56
Sallie B. OβNeill
Robert Oshiro β81
William Overman β73, PhD β81 and Rita Overman
Steven N. Pappas β87, MBA β91 and Christine M. Pappas β87, MBA β92
Sanjay K. Parikh and Asha S. Parikh, Parents β09
Chan K. Park β91 and Cindy S. Park
Christopher G. Peak and Jacquelyn J. Weber, Parents β12
John B. Peller MS β66, PhD β68 and Pat Peller
Daniel J. Peterson β80 and Lisa J. Peterson β81
Martin Posner β56 and Thao Posner, Parents β14
Steven D. Powell β00, MBA β10
Jacob J. Rael MS β95, PhD β07 and Elia L. Perez β93, MSN β00
Rami R. Razouk β75, MS β75, PhD β80 and Deborah D. Downs PhD β80
Paul B. Ricci MS β80 and Valeria W. Ricci
Christopher A. Rimer β91 and Christine Rimer β93
Peter B. Robertson and Diana L. Robertson, Parents β15
Rhonda M. Sakaida β81, MS β84
Roy R. Sakaida β53 and Dorothy W. Sakaida β55, Parents β83, β84, β86, β86
John P. Schauerman β79 and Claudia H. Schauerman
Christopher Peter Schlies and Christine C. Schlies, Parents β12
Van N. Schultz β74, MS β75 and Susan R. Schultz β75, Parents β04
UC
LA E
NG
INE
ER
|
48Hermann D. Schurr β82, MS β85 and
Juliet N. Schurr β82, MS β86, Parents β12
David E. Schwab MS β67 and Gretchen A. Burton β66
Stephen S. Schwartz, Parent β13
William M. Scott and Jill Baran Scott, Parents β13
Shara Nicole Senior β01
Michelle A. Sequerth β03
George M. Shannon, Jr. and Linda A. Shannon β76
Phillip M. Shigemura β69, MS β71 and Joyce M. Shigemura
Takashi Shiozaki β69 and Leslie E. Shiozaki
Michael W. Sievers β73, MS β75, PhD β80 and Charlene M. Sievers
Yet M. Siu β53 and Marion L. Siu, Parents β75, β77, β78
Ning C. Sizto and Minda S. Sizto, Parents β10
Bruce J. Smith β65 and Cynthia C. Smith
David P. Smith MS β68
William R. Snow and Judy S. Snow, Parents β12
Craig W. Somerton β76, MS β79, PhD β82
Alfred W. Sommer and Joyce Sommer
Alex Spataru β70, MBA β79 and Anne-Marie Spataru MBA β78
Ronald S. Squires and Sherri L. Squires, Parents β13
V. V. Srinivasan and Padmini Srinivasan, Parents β13
Frederik N. Staal MS β87 and Dara J. Staal
Oscar M. Stafsudd, Jr. β59, MS β61, PhD β67 and Jacqueline Stafsudd β69
David W. Stephens MS β89
Jeremy L. Switzer β98, MBA β07 and Midco K. Switzer
Norito R. Takamoto β56 and Takaye Takamoto
Helene Terris
Chantal Toporow β78, MS β81, PhD β86
Che M. Tsai β88 and Josan C. Chen
Frank C. Tung PhD β68 and Roberta T. Tung
Brad Vartan and Vestoria Vartan
Efren Vasquez β07
Jonathan A. Walcott β02
Kang Wang and Edith S. Wang
Raymond Wang and Shirley C. Wang, Parents β10
Sherman S. Wang β04
Jeffrey S. Way β76 and Linda K. Way, Parents β12
Gershon Weltman β58, MS β60, PhD β62 and Tova Weltman β61
Leland Z. Wiesner β87
Charles E. Wilcoxson β85, MBA β94 and Jeanine W. Wilcoxson
John Suihon Wong β74 and Ruth Manling Wong
Kim Fan Wong and Christine F. Ng, Parents β13
Kin Wah Wong PhD β77
Tao Wu MS β09, PhD β11
Shigeru Yoshida
Farouk Youssef and Laila Hanna, Parents β11
Stanley S. Yue β80, MS β84 and Alice Law β81, MS β83
Tongyi Zhang
Anonymous
Young Professional Boelter SocietyJacqueline N. Anderson β06
Lawrence K. Au β04, MS β07, PhD β11 and Gigi K. Lau β04
Laura C. Basualdo β08
Aidan S. Begg β08
Heather B. Blockhus β15
Barak H. Bussel MS β93 MBA β95 and Helen Liu MS β04
Jiwen Cai MS β12
Scott G. Campbell β04
Chia-Ming Chang MS β07, PhD β07
Calvin C. Chong β12
Victor K. Chu β05
Christopher A. Clark, Jr. β08
Harris C. Crozier β12
Gregory Z. Ferl MS β03, PhD β05
Mark F. Flores β08
Rajindra S. Handapangoda β05, MS β06
Adam David Harmetz β05 and Helen Harmetz β04
Terence Foster Heinrich β08, MS β11 and Julie Lanier Heinrich β07
Bradley S. Hirasuna β02, MS β04
Daniel P. Ithurburn β09
Joshua L. Laheru MS β11 and Joanna Chen
Owen A. Lutje β10
Jamal A. Madni MS β08
Ryan Martin β03, PhD β08
Olaleke O. Owolabi β10
Angela Renae Pinley β07
Andrew W. Pryor-Miller β08
Eric K. Sender β09, MS β12
Harpreet Singh β04
Julia S. Sizto β10
Efren Vasquez β07
Sarah M. Vasquez β08
Vishal Vaswani β10
Jonathan A. Walcott β02
Taikang Martin Wan β09
Sherman S. Wang β04
Andrew J. Winther β03
Tao Wu MS β09, PhD β11
Qiyue Zou, PhD β08
Prin
ted
on
recy
cled
pap
er
We have made every effort to ensure the completeness and accuracy of this Honor Roll. If you discover an error, please contact the Office of External Affairs at (310) 206-0678 or email [email protected].
THE UCLA ENGINEERING FUND | Enhancing Engineering Excellence
What does the future hold?
Thanks to the UCLA Henry Samueli School of Engineering and Applied Science, the future is bright.
UCLA Engineers are conducting research that
will create better sources of clean and renewable
energy, improve the ability to detect and cure
cancer, enhance cyber security, and make infra-
structure stronger and safer.
Bruin Engineers like you, who support the UCLA
Engineering Fund, are enabling UCLA Engineer-
ingβs faculty and students to make a real and
critical impact on our world.
You can Fund the Future.
MAKE A GIFT TO THE UCLA ENGINEERING
FUND TODAY.
Make your gift online at www.engineer.ucla.edu/
give or by calling 310-206-0678.
NON-PROFIT ORG.U.S. POSTAGE
PAIDUCLA
405 Hilgard AvenueBoelter Hall Suite 7256Box 951600Los Angeles, CA 90095-1600
Engineering VI Building Groundbreaking Ceremony and ReceptionOCTOBER 26, 2012
Parentsβ WeekendNOVEMBER 2-4, 2012
Engineering Awards DinnerNOVEMBER 2, 2012
Tech ForumMARCH 2013
UPCOMING EVENTS