Transient posterior localization of a kinesin fusion proteinreflects anteroposterior polarity of the Drosophila oocyte

Ira Clark, Edward Giniger*, Hannele Ruohola-Bakert,Lily Yeh Jan and Yuh Nung Jan

Howard Hughes Medical Institute and Departments of Biochemistry and Biophysics and of Physiology,University of California at San Francisco, San Francisco, California 94143-0724, USA.

Background. During oogenesis in Drosophila, deter-minants that will dictate abdomen and germlineformation are localized to the 'polar plasm' in theposterior of the oocyte. Assembly of the polar plasminvolves the sequential localization of severalmessenger RNAs and proteins to the posterior of theoocyte, beginning with the localization of oskarmRNA and Staufen protein during stages 8 and 9 ofoogenesis. The mechanism by which these two earlycomponents accumulate at the posterior is notknown. We have investigated whether directedtransport along microtubules could be used toaccomplish this localization.Results: We have made a fusion protein composed ofthe bacterial {3-galactosidase enzyme as a reporter,joined to part of the plus-end-directed microtubulemotor, kinesin, and have found that the fusion protein

transiently localizes to the posterior of the oocyteduring stages 8 and 9 of oogenesis. Treatment withthe microtubule-depolymerizing agent colchicineprevents both the localization of the fusion proteinand the posterior transport of oskar mRNA andStaufen protein. Furthermore, the fusion proteinlocalizes normally in oocytes mutant for either oskarand staufen, but not in other mutants in which oskarmRNA and Staufen protein are mislocalized.Conclusions: Association with a plus-end-directedmicrotubule motor can promote posterior localizationof a reporter protein during oogenesis. The geneticrequirements for this localization and its sensitivity tocolchicine, both of which are shared with theposterior transport of oskar mRNA and Staufenprotein, suggest that similar mechanisms may functionin both processes.

Current Biology 1994, 4:289-300

Background

The early syncytial embryo of Drosophila melanogasteris a highly polarized cell. At the anterior, the cytoplasmcontains high levels of a morphogen that determineshead and thorax formation, whereas the 'polar plasm' atthe posterior contains determinants for abdominal andgermline development [1-7]. The anterior andabdominal determinants are, respectively, the transcriptsof the genes bicoid (bcd) and nanos (nos); nos functionalso requires the activity of the pumilio (pum) gene[7-13]. The nature of the germline determinant is lesswell understood, but its activity appears to require theproduct of the germ cell-less (gcl) gene, the transcript ofwhich is localized to the posterior pole of the earlyembryo [14].

The problem of localizing determinants to the posteriorof the developing oocyte is exacerbated by the fact thatthe nurse cells, which provide the majority of thecontents of the oocyte, are located at the anterior (For areview of oogenesis, see [15]). Posterior localizationthus presents two problems: transporting determinantsto the posterior and maintaining localization afterarrival. Although no clear mechanism for either processhas been reported, a genetic description of polar plasm

assembly has emerged in recent years [16]. At the top ofthis genetic hierarchy are the functions of the genescappuccino (capu) and spire (spir), required in thegermline, and Notch (N) and Delta (DI), required in thesomatic follicle cell layer, all four of which seem to benecessary for proper oocyte polarity and are essentialfor the posterior localization of all known polar plasmcomponents [17-20].

The first components to localize to the posterior pole,Staufen (Stau) protein and oskar (osk) mRNA, do soduring stages 8 and 9 of oogenesis. Their posteriorlocalization initially requires staufen (stau) genefunction; maintenance of their position at the posteriorpole subsequently requires osk gene function [6,21-24].Both osk and stau gene functions are required for thesubsequent posterior localization of Vasa protein, whichoccurs during stages 9 and 10 of oogenesis [25-29]. Thevasa (vas) gene function is, in turn, required for properlocalization of nos and gcl RNAs and Tudor protein(R. Lehmann, personal communication; [14,30]). Thegenes tudor (tud) and valois (vis) seem to be requiredin the embryo for maintaining the localization of polarplasm throughout the cleavage stages of developmentuntil germ cells are formed from the polar plasm[14,21,27,31]. Mutations in other genes, such as

© Current Biology 1994, Vol 4 No 4

*Present address: Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue, North Seattle, Washington 98104, USA.tPresent address: Department of Biochemistry SJ-70, University of Washington, Seattle, Washington 98195, USA.Correspondence to: Yuh Nung Jan.

289

290 Current Biology 1994, Vol 4 No 4

Fig. 1. Kin:3gal protein localizes transiently to the oocyte posterior. In this and all subsequent figures, posterior is to the right andanterior to the left. (a)-(c) Egg chambers from transgenic line KZ503, which produces kin:3gal in the female germline. -galactosidaseactivity is concentrated in the posterior (arrow) of stage 8 (a) and stage 9 (b) oocytes. Enzyme activity in stage 10 oocytes is foundeither distributed uniformly, or reduced along the oocyte periphery as shown in (c); reduced peripheral staining at this stage may bedue to cytoplasmic streaming, which begins at stage 10 and which may involve subcortical oocyte microtubules 148]. Activity is alsoconcentrated along the cortex at the interface with the nurse cells at all three stages. Occasionally, stage 14 oocytes show someenrichment of kin:p3gal near the posterior, but no localization has been detected in early embryos. (d) Anti-13-galactosidase staining ofan early stage 9 egg chamber from line KZ503. Kin:3gal protein is present in nurse cells and at the posterior of the oocyte. Posteriorstaining in many egg chambers appears fibrous (data not shown). (e) Stage 9 egg chamber from line AZE16g#4, which contains atransgene of Adh:lacZ expressed from the armadillopromoter; [3-galactosidase activity from this transgene is not localized to theoocyte posterior. (f) Stage 9 egg chamber from SHKZ E 7 line 11.1, which expresses khc97:lacZ in both the germline and follicle cells.No posterior localization of 1-galactosidase is observed in SHKZ E97 egg chambers. Most of the -galactosidase activity is found inclusters in the nurse cells; activity is also concentrated at the anterior corners of the oocyte (arrows). (g) Whole-mount in situhybridization of egg chambers from line KZ503, using an antisense RNA probe specific for lacZ. Alkaline phosphatase reactions wereallowed to develop until background staining was detected in control (Oregon-R) egg chambers. Most khc:lacZ mRNA is in the nursecells of stage 9 egg chambers, although a small amount is distributed uniformly throughout the oocyte. Egg chambers in (a), (b), (c), (e),and ( are stained with X-Gal.

Posterior localization of a kinesin fusion protein Clark et al.

mago nasbi (mago) and Bicaudal D (BicD) can affectthe assembly of polar plasm, although the specific rolesof these genes within the pathway are less clear [32,33].

Thus polar plasm, which contains large ribonucleo-protein 'polar granules' [34], seems to be assembled bythe sequential localization of components. Localizationof osk mRNA to the posterior pole seems to be a criticalstep in assembly, as the levels of abdominal andgermline determinants are sensitive to gene dosage ofosk, and mislocalization of osk to the anterior of theoocyte causes mislocalization of abdominal andgermline determinants to the anterior pole of the egg[35,36]. Although the cis-acting elements that arerequired for localization have been well characterized[35,37], the precise mechanism for localizing osk to theposterior pole has remained elusive.

The potential mechanisms by which a substance couldbe restricted to one region of a cell fall into three generalclasses. First, the substance could be actively transportedthere. Second, it could distribute randomly throughoutthe cell, but become trapped by a locally active receptor.Third, the molecule could be locally synthesized ordegraded, resulting in an asymmetric distribution. Thislast mechanism is unlikely to contribute to the posteriorlocalization of osk mRNA or Stau protein, as mutationsthat disrupt localization do not appreciably alter thelevels of these gene products [22,241.

Microtubules are one candidate for a component of astructural cellular axis, an essential feature of any activetransport mechanism. Microtubules are inherently asym-metrical, with a rapidly growing 'plus' end and a slowergrowing 'minus' end; and they can achieve cellulardimensions [38,39]. Moreover, the polarity of a micro-tubule can be interpreted by one of the mechano-chemical enzymes known colloquially as 'motors': theseinclude kinesin and dynein, which bind to microtubulesand move unidirectionally towards their plus or minusends, respectively [40-42]. Indeed, microtubules havebeen implicated in the localization of Vgl RNA in theXenopus laevis oocyte [431 and of bcd RNA in theDrosophila oocyte [44] and are thought to direct vesicletransport in both neurons and epithelial cells [40,45-47].Moreover, Theurkauf et al. [48] have shown that micro-tubules form an anterior-to-posterior gradient inDrosophila oocytes at the time that osk mRNA and Stauprotein become localized to the posterior. This has ledus to ask whether the polarity of oocyte microtubulesmight follow the anteroposterior axis of the oocyte;such polarity could, in principle, provide the structuralaxis for an active transport mechanism.

Because it will move unidirectionally along micro-tubules towards their plus ends [49,50], the motorprotein kinesin could theoretically act as a reporter formicrotubule polarity. Kinesin is found in cell extracts asa multimer of two heavy chains and two light chains[51,52]. The heavy chain contains three structuraldomains: a globular amino-terminal head, an a-helicalstalk region capable of forming coiled coils, and a

globular tail region which is thought to associate withthe light chain [53,54]. The head region of the heavychain is sufficient to provide plus-end-directed motilityin vitro [55].

In this paper, we use a fusion protein containing thehead region of the Drosophila kinesin heavy chainlinked to the bacterial enzyme -galactosidase [56] as aprobe for microtubule polarity in the Drosophila oocyte.We find that the fusion protein, when expressed in thefemale germline, localizes to the posterior of the oocyteat stages 8 to 9 of oogenesis, suggesting that the micro-tubule cytoskeleton is polarized at these stages alongthe anteroposterior axis. Localization of the fusionprotein is prevented by the microtubule-depolymerizingagent colchicine, as is localization of osk RNA and Stauprotein. Finally, we demonstrate that mutations in capu,spir, N and Dl perturb the localization of the fusionprotein, whereas mutations in genes encoding polarplasm components do not. Our results suggest that suf-ficient polarity exists within the microtubulecytoskeleton of oocytes at stages 8 and 9 to providea potential axis for active transport of osk mRNA andStau protein.

Results

Kinesin:p-galactosidase as a reporter of microtubule polarityTo examine the overall polarity of microtubules in theoocyte, we used a fusion protein made up of thefirst 604 amino acids of the Drosophila kinesin heavychain joined to the amino terminus of the bacterialenzyme 3-galactosidase; we call the protein kin:pgaland it is produced by the gene fusion khc:lacZ [56].The portion of kinesin contained in kin:Pgal has previ-ously been shown to be sufficient to produceplus-end-directed motor activity, even when fused toanother protein [55].

Expression of a khc:lacZ transgene was accomplishedby the 'enhancer trap' technique, which drives tissue-specific transcription on the basis of the site of insertionof the transgene in the genome [56-591. When producedin cells for which polarity of the microtubule cytoskele-ton is known, kin:3gal is distributed asymmetrically in amanner consistent with plus-end-directed motility.Hence, in neurons, the protein is concentrated in axonterminals, whereas in two types of columnar epithelialcells, namely cells of the early gastrula and ovarianfollicle, it accumulates in the basal cytoplasm ([56] andE.G., H.R-B. and I.C., unpublished observations). Thus,in a variety of cell types, kin:Pigal appears to act as areporter of microtubule polarity.

Stage-specific localization of the kin:3gal fusion protein tothe oocyte posteriorIn 14 different transgenic lines of flies that producedkin:p3gal in the female germline, P3-galactosidase activitywas found concentrated in the posterior of oocytes atstages 8 and 9 (Fig. la, b); these stages correspond tothe time at which osk mRNA and Stau protein

RESEARCH PAPER 291

292 Current Biology 1994, Vol 4 No 4

Fig. 2. Colchicine disrupts localization of kin:3gal fusion protein, Stau protein and osk RNA. All the egg chambers shown in this figureare at stage 9; those in (a),(c) and (e) are from untreated flies;, those in (b), (d), (f) and (g) are from flies fed 100 g ml- 1 colchicine forthe times indicated. (a) Microtubules (arrows) are detectable by anti-tubulin staining in oocyte and nurse cells. (6) After 3.5 hours ofcolchicine treatment, germline microtubules are undetectable by anti-tubulin staining; somatic follicle cell and border cell micro-tubules seem normal. Reduction in follicle cell tubulin staining is apparent in approximately 50 % of egg chambers after 6 hours offeeding, and in > 90 % of egg chambers after 10 hours of feeding. Both of the pictures shown here (a,b) are projections of five 1 vimoptical sections each, taken with the same optical settings, using the COMOS program supplied with the BioRad MRC600 confocalmicroscope. (c) Anti-Stau staining reveals that posterior localization of Stau is prominent (arrow) prior to colchicine treatment. (d) After10 hours of colchicine treatment, posterior localization of Stau is severely reduced (arrowhead); delocalized Stau staining often seemsto be particulate (arrow). (e) In situ hybridization shows that osk RNA is localized to the posterior of the oocyte (thin arrow); transientanterior accumulation can also be seen (thick arrow). (f) After 10 hours of colchicine treatment, no posterior localization of osk RNA isdetectable by in situ hybridization. (g) X-Gal staining of a stage 9 egg chamber after 3.5 hours of colchicine treatment. No localizedstaining is observed in 72 % of oocytes at this time point.

Posterio localiation o a kinein fusin protei Clark t al. RSEARCH APER 29

are localized to the oocyte posterior [22-241.Posterior localization of the fusion protein within theoocyte, as determined by -galactosidase activity, wasconfirmed by staining with anti-1-galactosidase antibod-ies (Fig. d). In contrast, [3-galactosidase expressed froma transgene lacking any kinesin sequences wasuniformly distributed within the oocyte cytoplasm(Fig. le). Posterior localization of kin:3gal was lost atstage 10 (Fig. c), a time at which cytoplasmicstreaming begins in the oocyte [60]. No obvious femalesterility or oogenetic defects seemed to result from pro-duction of kin:p3gal during oogenesis, and localizationof osk mRNA appeared to be normal, suggesting thattransport of endogenous material during oogenesis wasnot perturbed by expression of the fusion protein.

Posterior localization of kin:ogal is disrupted by colchicineTo test whether kin:pgal localization is dependent onthe integrity of the microtubule cytoskeleton, we fed themicrotubule-depolymerizing agent colchicine to adultfemale flies expressing khc:lacZ in their ovaries. After3.5 hours of treatment with colchicine at a concentration

A mutation in the conserved ATP-binding motif of its kinesindomain prevents posterior localization of kin:p3galBoth binding and hydrolysis of Mg2+-ATP are essentialfor motility of kinesin along microtubules: in theabsence of ATP or in the presence of non-hydrolyzableanalogs of ATP, kinesin binds to microtubules with highaffinity and fails to be translocated or released [61].Binding of ATP is believed to require the highlyconserved nucleotide-binding amino-acid sequenceGXXXXGKT (where X is any amino acid), which liesbetween residues 92 and 99 of the Drosophila kinesinheavy chain [54,62].

To assess whether ATP binding or hydrolysis by thekinesin portion of the fusion protein is necessary forposterior localization of kin:pgal, we created atransgene, khcE97:lacZ, in which the second conservedglycine within the nucleotide-binding motif of thekinesin heavy chain is mutated to glutamate, changingthe consensus sequence from GXXXXGKT toGXXXEKT. Corresponding GXXXXEKT mutations havebeen isolated for both the myosin heavy chain of thenematode Caenorhabditis elegans and the kinesin-likegene KAR3 of the budding yeast Saccharomycescerevisiae, and in each case the mutation produces phe-notypes consistent with defects in nucleotide binding orhydrolysis [63,64]. As shown in Figure If, kinE97:galmutant fusion protein failed to localize to the oocyteposterior, suggesting that localization requires theactivity of the kinesin nucleotide-binding sequence. Asmall amount of the mutant protein was detected at theanterior corners of the oocyte (Fig. If), which may be aresult of the protein being produced in the nurse cellsand then being trapped by microtubules immediatelyupon entering the oocyte.

Kin:pgal transcript is not localizedTo examine the possibility that localization of thekin:pgal protein might be a result of localization ofkhc:lacZ mRNA, we used a lacZ-specific RNA probeand performed whole-mount in situ hybridization ofovaries from khc:lacZ-bearing flies. As shown in Figure1g, khc:lacZ mRNA was not localized to the oocyteposterior. We could therefore eliminate RNA localizationas a mechanism leading to the posterior localization ofkin:igal protein.

Fig. 3. Graphic representation of the incidence of localizedkin:3gal protein in stage 9 oocytes (a), and of Stau protein (b)and osk RNA (c) in stage 8 and stage 9 oocytes. Data are fromthe experiment shown in Fig. 2; see Table 1 for actual numbersused in constructing these graphs. Note that, after 10 hours offeeding colchicine, approximately 50 % of stage 9 oocytesshowed very weak localization of Stau protein. The lightlyshaded region in (b) denotes oocytes with localization moreclosely resembling that of control, untreated oocytes.

Posterior localization of a kinesin fusion protein Clark et al. RESEARCH PAPER 293

294 Current Biology 1994, Vol 4 No 4

of 100 Ixg ml- ', no microtubules were detectable in theoocyte or nurse cells by immunofluorescence, althoughfollicle cell microtubules appeared normal until 6-10hours of treatment (Fig. 2a, b, and data not shown). 3-galactosidase activity seemed to be uniformly distributedin 72 % and 98 % of stage 9 oocytes after 3.5 and 6hours of colchicine treatment, respectively (Fig. 2g, Fig.3a and Table 1). Western immunoblot analysis showedthat total levels of kin:[3gal protein in ovaries were notaltered by colchicine treatment (data not shown). Thisresult suggests that localization of the fusion proteinrequires an intact microtubule cytoskeleton.

Localization of two components of polar plasm is preventedby colchicine treatment.Because kin:P3gal localization seemed to coincide withlocalization of osk RNA and Stau protein, we assayedthe effects of colchicine on osk and Stau distribution, inthe same experiment as described above for kin:{3gallocalization. The osk RNA and Stau protein are normallytransported to the oocyte posterior during stages 8 to 9of oogenesis; osk and Stau also transiently accumulatein the anterior during this period, possibly as an inter-mediate step in the transport process [22-24]. Both theanterior and posterior localizations of osk RNA and Stauprotein in stage 8-9 oocytes were disrupted bycolchicine feeding (Fig. 2c-f, Fig. 3b, c, and Table 1). Inoocytes from flies fed colchicine for 6-10 hours, oskRNA and Stau protein were distributed randomlythroughout the oocyte, and often appeared to concen-trate in large particles (Fig. 2d). It is unclear whether ornot such particles are related to polar granules.

Longer colchicine treatments were necessary to observedisruption of the posterior localization of osk RNA andStau protein than were required to delocalize kin:,3gal(Fig. 3 and Table 1). Although this difference couldreflect an indirect effect of microtubule disruption uponosk RNA and Stau protein localization, we believe that it

results from an inability of colchicine to perturb themaintenance of previously localized osk RNA or Stauprotein. Stages 8, 9 and 10 of oogenesis last approxi-mately 5 hours each at 25 C [151; although Stau waslocalized in only 36 % of stage 8 oocytes after 6 hoursof colchicine treatment, it was properly localized in95 % of stage 9 oocytes after the same length oftreatment. Similarly, after 10 hours of colchicinetreatment (approximately one stage-length later), 95 %of stage 10 oocytes examined had normal levels of pos-teriorly localized Stau, as compared to 22 % of stage 9oocytes at this time point (Fig. 3b, Table 1, and data notshown). Thus oocytes that were likely to have been atstage 8 at the time of colchicine treatment appeared toretain the osk and Stau that had already been localized,whereas oocytes that had entered stage 8 after 3.5 hoursof colchicine treatment did not have any newlylocalized osk or Stau. Total levels of Stau protein in theovary were unaffected by colchicine, as assayed byWestern immunoblot analysis (data not shown). Theseresults suggest that the initial transport of osk and Staugene products to the posterior require the integrity ofthe microtubule cytoskeleton, whereas the maintenanceof localization does not.

Mutations in Notch or Delta cause mislocalization ofkin:3gal to the center of the oocyteTo explore further the relationship between kin:pgallocalization and polar plasm assembly, we examinedthe distribution of the fusion protein in oocytes fromfemales carrying mutations in either N or Dl. Whenfemales bearing a temperature-sensitive mutation ineither of these genes are kept at the restrictive tempera-ture, they produce egg chambers with alterations infollicle cell identity and oocyte polarity. Specifically, thenormally anteriorly localized bcd RNA is found at boththe anterior and posterior of the oocyte, whereas oskRNA and Stau protein are mislocalized to the center ofthe oocyte ([18] and H.R-B., unpublished observations).

Posterior localization of a kinesin fusion protein Clark eta!. RESEARCH PAPER 295

Fig. 4. Kin:pgal localization is independent of osk and stau gene functions, but requires the upstream genes capu, spir, N and DI. Allpanels show X-Gal staining of stage 9 egg chambers. (a) capuG7/capuG7; KZ503/KZ503. Kin:pgal is not localized to the posterior andoften appears to be excluded from the posterior (arrow). (b) stauD3/Df(stau); KZ503/KZ503. Kin:3gal is localized normally to the posterior(arrow). (c) N'P/NS; KZ503. No posterior localization of kin:pgal was detected in 52 % (50/97) of stage 8-9 oocytes from flies of thisgenotype that had been incubated for 22 hours at the restrictive temperature of 32 °C (thin arrow, compare with d). In egg chamberslacking posterior localization, an abnormal localization of kin:pgal to the middle of the oocyte was detected (thick arrow). The incidenceof mislocalization increased to 84 % after 29 hours at 32 °C. (d) Nl/htsl; Dp(N+)/+; KZ503. Normal localization of kin:3gal (arrow) wasobserved in N' flies kept at restrictive temperature if these flies also carried a duplication of the wild-type allele of N.

We found that in NtSl/lIs and DI6B37/Dv a l flies kept atthe restrictive temperature of 32 C for 22-29 hours,kin:3gal, like osk RNA and Stau protein, was mislocal-ized to the center of the oocyte (Fig. 4c and data notshown). Normal posterior localization of kin:3gal wasobserved in oocytes from IV' flies carrying a duplica-tion of the wild-type N allele (Fig. 4d). This resultsuggests that the N and DI gene products, which arerequired in the somatic follicle cells, affect a feature ofthe oocyte that is used in common for the localizationof kin: 3gal protein, osk RNA and Stau protein.

Posterior localization of kin:3gal depends on capu and spir,but is independent of osk and stau gene functionsTo examine the possibility that kin:[ gal was localized asa result of its mimicking a component of polar plasm,we examined its distribution in oocytes from flies mutantfor osk or stau. Posterior localization of osk requires staugene function [22-24]. In contrast, kin:3gal was localizednormally to the posterior of oocytes from stauD3 andosk34 6 flies, demonstrating that its localization was inde-pendent of osk and stau function (Fig. 4b and data notshown). Normal posterior localization of kin:pgal wasalso observed in oocytes from females mutant for thedownstream genes vas, vs, tud, nos and pum (data notshown). Kin:p3gal is also localized properly in pipsqueakmutants, which affect Vasa protein levels, but do notdisrupt osk RNA localization [65].

Although posterior localization of kin:3gal was indepen-dent of osk and stau function, we found that it didrequire the genes capu and spir, both of which arerequired in the germline for posterior localization of osk

RNA and Stau protein [17,22-24]. Kin:[3gal failed tolocalize to the posterior of oocytes from capuG7 andspirPJ56 flies (Fig. 4a and data not shown). Thus,kin:3gal localization is genetically independent of thegenes encoding known polar plasm components, but isdependent on the genes required for the properlocalization of these components.

Discussion

Posterior localization of kin:3gal in developing oocytesWe have shown that a kinesin: -galactosidase fusionprotein transiently localizes to the posterior of thedeveloping oocyte. Posterior localization is apparentduring stages 8 and 9 of oogenesis, when osk mRNAand Stau protein also accumulate in the oocyteposterior. Like osk and Stau, kin:[3gal localizationrequires the wild-type function of the genes capu, spir,N and DI. Also, like osk and Stau, kin:3gal localizationcan be prevented with the microtubule-assemblyinhibitor colchicine, suggesting that the localization mayrequire microtubules.

There are several possible explanations for the localiza-tion of kin:3gal. The simplest is that kin:{3gal localizesto the posterior of the oocyte on the basis of its activityas a plus-end-directed microtubule-based motor. Thefusion protein contains a region of kinesin sufficient toprovide plus-end-directed motility in vitro, [55], and itsbehavior in neurons and epithelial cells is consistentwith plus-end-directed motor activity in vivo ([56] andE.G., H.R-B., and I.C., unpublished observations). The

Posterior localization of a kinesin fusion protein Clark et a. RESEARCH PAPER 295

296 Current Biology 1994, Vol 4 No 4

localization of kin:3gal in oocytes is sensitive tocolchicine, as would be expected if it were due tomicrotubule-based motility. Finally, mutating a singleresidue in the consensus ATP-binding motifGXXXXGKT [62] eliminates the posterior localization ofkin:[3gal. As nucleotide binding and hydrolysis arenecessary for the motility of kinesin along microtubules,the phenotype of the khcE9 7:lacZ mutation, in whichthe consensus motif is altered, suggests that the normalmechanochemical activity of kinesin may be involved inthe localization of the kin:[ggal fusion protein.

It should be noted, however, that the kin:3gal fusionprotein does not precisely mimic endogenous kinesin.For instance, endogenous kinesin does not accumulatein the cytoplasm of axon terminals, and thus does notserve as a convenient marker for cytoskeletal polarity[661. This may be due to recycling or rapid turnover ofkinesin that has reached the plus ends of microtubules.Kin:3gal may accumulate at microtubule plus endsbecause it lacks the entire carboxy-terminal half ofkinesin heavy chain, and may therefore be immune toany regulation imposed through that domain.Alternatively, the fusion of the amino-terminal half ofkinesin to -galactosidase, which normally exists as atetramer [67], may increase the number of motordomains per molecule, thereby leading to increasedmotor activity of kin:3gal relative to endogenous kinesin.

An alternative explanation for the localization ofkin:P3gal is that it structurally mimics a polar plasmcomponent, and thereby acts as a 'stowaway' in polarplasm assembly. However, if kin:3gal localizationresults from the presence of a targeting epitope, theepitope must be destroyed or overridden by thekhcE97lacZ point mutation. Furthermore, we believe astowaway mechanism for localization is unlikely, asthree features of osk and Stau localization are notobserved with kin:pgal. First, although posterior local-ization of osk RNA clearly requires stau gene function[22,231, posterior localization of kin:3gal does not.Secondly, both osk RNA and Stau protein displaytransient anterior accumulation during stages 8 and 9;this may represent an intermediate in the posteriorlocalization process, as it is enhanced in stau mutants[22-24]. No such anterior localization has been observedwith wildtype kin:,3gal, even though anterior accumula-tion of osk RNA and Stau protein is observed in oocytescontaining kin:3gal (Fig. 2e and data not shown).Finally, unlike osk and Stau, kin:3gal is not maintainedat the posterior of oocytes at stage 10, at which timecytoplasmic streaming begins. The 'anchoring' of polarplasm components after transport to the posteriorappears to require the protein products of osk and stau[22-24]. Kin:[ggal is apparently not a substrate for thisanchoring process, as it appears to be swept away fromthe posterior by the vigorously moving cytoplasm in

Fig. 5. Speculative model for polar plasm assembly, derived in part from arguments presented in text. The genetic pathway shown in(a) has been established by a wide body of work summarized in the Introduction and in recent reviews (for example, see [16]). Wesuggest that the upstream genes cappuccino, spire, Notch and Delta, affect the organization of, or transport along, the microtubulecytoskeleton in oocytes at stages 8 to 9. (b) Schematic diagram of a stage 9 egg chamber, with most of the nurse cells removed forpurposes of illustration. We speculate that association with plus-end-directed microtubule motors could promote transport of Stauprotein (blue squares) and osk RNA (yellow triangles) along oocyte microtubules to the oocyte posterior, as also suggested in [48]; weemphasize, however, that an association of osk and Stau with microtubule motors has not been demonstrated. We hypothesize thatkin:3gal may mimic such a process by transporting itself along microtubules to the posterior.

Posterior localization of a kinesin fusion protein Clark et al.

stage 10 oocytes. Together these differences suggest thatkin:3gal is not simply incorporated into polar plasm. Incontrast, the posterior localization of a Fat-facets:13-galactosidase fusion protein described by Fischer-Vize etal. [68] is likely to involve incorporation into polarplasm, as it requires osk and stau gene functions and ismaintained through early embryogenesis.

Implications for the oocyte microtubule cytoskeletonIf posterior localization of kin:Iggal is indeed due tomotor activity of the fusion protein, then one can inferthat at least a subset of the microtubules in oocytes atstages 8 and 9 have their plus ends pointing towardsthe posterior. It is formally possible that kin:p3gal movesalong only a small subset of oocyte microtubules, orthat the kinesin domain in the fusion protein isregulated in the oocyte, such that it moves in a minus-end direction. However, such regulation of kinesin'sdirectionality has never been reported. Furthermore, anorganization of oocyte microtubules with plus endspointing towards the posterior is consistent with theresults of immunofluorescent studies by Theurkauf et al.[481, which show that, at these stages, microtubule con-centration is highest at the anterior of the oocyte andtapers off towards the posterior. This anteroposteriorgradient of microtubules suggests that oocyte micro-tubules nucleate predominantly at the anterior, which isconsistent with the idea that the minus ends of oocytemicrotubules are clustered at the anterior.

This arrangement of microtubules follows a dramaticreorganization of the entire microtubule cytoskeletonthat occurs in the oocyte at approximately stage 7. Priorto this stage, a microtubule-organizing center can befound in the posterior of the oocyte and microtubulesemanate from this center and pass through the ringcanal that connects the oocyte to the nurse cells [48,69].One might predict that kin:pgal would therefore con-centrate in the nurse cells during these early stages. Wehave been unable to address this question, as we havenot isolated any lines of flies that produce detectablelevels of kin:f3gal before stage 7.

Implications for mechanisms of mRNA transportGiven their similarities, we are tempted to speculate thatthe localization of kin:,Bgal may mimic a processinvolved in localization of osk RNA and Stau protein, asdepicted graphically in Figure 5. We suggest that, wereosk and Stau to associate with endogenous plus-end-directed motors, this interaction would be sufficient totransport them to the posterior of the oocyte. The struc-tural axis for such transport might be a functionallypolarized microtubule cytoskeleton, as described in theprevious section (see also [48]). One hypothesis forexplaining the phenotypes of capu, spir, N and DImutations is that the microtubule cytoskeleton is alteredin these mutants in a manner that perturbs posteriorlocalization of kin:igal and of osk and Stau, assuggested in Figure 5.

Although the data presented here do not demonstratethat motors localize polar plasm components to the

oocyte posterior, they do show that at least one kinesin-like protein, kin:gal, can localize to the oocyteposterior, and that the localization of osk RNA and Stauprotein is sensitive to colchicine. However, it remains tobe seen whether or not any of the endogenous kinesin-like proteins that are known to be expressed duringoogenesis [70-74], or any other motor proteins, such asthe recently identified family of dynein-like proteins[751, are involved in polar plasm assembly. It is unlikelythat the kinesin heavy chain gene itself (khc) is essentialfor polar plasm assembly, as temperature-sensitivemutant mothers kept at the restrictive temperatureproduce embryos that hatch into larvae, suggesting thatat least nos RNA is properly localized in the absence offunctional kinesin heavy chain [76].

Localization of mRNA has been observed for a varietyof genes, not only in Drosophila oogenesis, but also inmany other types of cells and organisms [77-801. Todate, no mRNA has been shown to be transported by amicrotubule-based motor. In many instances, inhibitorstudies have suggested that intact microtubules arerequired for message localization [43,44,691. In oligo-dendrocytes, mRNA encoding myelin basic protein hasbeen shown to be actively transported [81], but it is notknown whether microtubules are required. Determiningwhether microtubule motors are actually used tolocalize any of these mRNAs will await the genetic orbiochemical identification of the motors involved, or thereconstruction of mRNA transport in vitro.

Conclusions

We have found that a 3-galactosidase reporter moleculecan be localized to the posterior of oocytes at stages 8and 9 of oogenesis, if it is joined to the plus-end-directed microtubule motor, kinesin. This localizationsuggests that, at these stages of oogenesis, the oocytemicrotubule cytoskeleton is functionally polarized alongthe anteroposterior axis, so that transport of substancesto the posterior could be achieved by association withplus-end-directed microtubule motors. The commonrequirements for intact microtubules and wild-typefunctions of the genes capu, spir, N and DI in the local-ization of osk mRNA, Stau protein and the kin:fggalfusion protein leads to the hypothesis that osk and Staumay be localized to the posterior of stage 8 and 9oocytes by their association with one or more plus-end-directed motors, in a process that is mimicked by thekin:3gal fusion protein (Fig. 5b). Polarization of themicrotubule cytoskeleton may thus be a critical step inestablishing anteroposterior polarity in the developingDrosophila oocyte.

Materials and methods

Fly stocksStocks bearing the khc:lacZ fusion gene on an enhancer trapvector are given the prefix 'KZ [56]. SHKZE9 7 stocks carry akhcE97.lacZ mutant transgene, under the control of the hsp83

RESEARCH PAPER 297

298 Current Biology 1994, Vol 4 No 4

promoter (see below). Strains KZ503 and KZ21, which carryinsertions of khc:lacZ on the third chromosome, werecrossed to the following mutant strains: capuG7 Df(capu)(Df(2L)edzl), spi PJ56, stauD3 , Df(stau) (Df(2R)Pc4 ), vasPD,tudWCs, vlsPE, s l, Asl; Dp(N +) (SMi Cy Dp(1;2)w+51b7N).Strains KZ32, KZ129 and KZ210 carry insertions on thesecond chromosome, and were crossed to the followingmutant strains: osk346, n1osL7 pum 6 80 D 6B37 and DIi a l.Temperature shifts with N and DI were performed as previ-ously described [18]. Mutants are described by Lindsley andZimm [82].

Strain AZE16g#4 contains the transgene armadillo:lacZ, andwas a gift from J.P. Vincent. This transgene is a fusion of afragment of the armadillo upstream regulatory region joinedto the Adh:lacZ gene from the plasmid C4AUG[3gal [831. Thetransgene is normally expressed ubiquitously, but inAZE16g#4 it is not expressed in the follicle cells surroundingthe oocyte, thereby allowing us to examine the distributionof the product within the oocyte.

Screen for germline expression of khc:lacZConstruction of the khc:lacZ fusion gene has been describedpreviously [56]. To identify insertion lines that expressedkhc:lacZ in the female germline, ovaries from 3-5 females ofeach line were hand-dissected and stained with X-Gal asdescribed below. Of 133 lines screened in this manner, 14were identified that express khc:lacZ in the germline.

Construction of khcE97:lacZ transgeneTo mutate codon 97 of khc:lacZ from GGA (glycine) to GAA(glutamate), we utilized a synthetic oligonucleotide ofsequence CCATCGTATGCGTTTTTTCGGAGGACGTCT,which corresponds to the reverse complement of the khcsequence from nucleotides 598-627 [54], except for amismatch at nucleotide 610. The point mutation destroyed aHpaII restriction site, and the absence of this site served as auseful marker in subsequent manipulations. Oligonucleotide-directed mutagenesis was performed as prescribed in theAmersham kit, version 2.1. Template for the reaction wassingle-stranded DNA prepared from khc subclone pEG160[56]. After mutagenesis, a 181 base-pair AatII fragmentincluding the mutated nucleotide was exchanged for the cor-responding fragment in unmutagenized pEG160; DNAsequencing (Sequenase, USB) confirmed that A610 (sensestrand) was the only mutation in this fragment. The 1.9kilobase insert from the mutant pEG 160 E97 plasmid was thenisolated by cutting with XbaI and EcoRI, and exchanged forthe corresponding fragment in khc:lacZ to producekhcE97 :lacZ.

To promote expression in the female germline, we fusedkhcE97:acZ to a 900 base-pair fragment of the hsp83 gene,from residues - 879 to +18 [84]; an hsp83 genomic clone wasgenerously provided by John Lis. The hsp83-khcE97 1acZfusion was then cloned into the P element vector pEG117[56]. The transgene was introduced into a yw stock by P-element-mediated transformation [85,86].

X-Gal stainingOvaries were hand-dissected from flies in phosphate-buffered saline (PBS) and then fixed for 8 minutes in 2.5 %glutaraldehyde (Ted Pella Inc., EM grade) in PBS. After tworinses with PBS, the ovaries were incubated at 37 °Covernight in PBS + 5 mM K3Fe(CN) 6 + 5 mM K4Fe(CN) 6 +0.2 % X-Gal. Ovaries were then washed with two rinses ofPBS, fixed again for 20 minutes in PBS + 2.5 %glutaraldehyde and rinsed twice with PBS. Ovarioles were

teased apart with forceps and mounted in 80 % glycerol inPBS.

Colchicine TreatmentFlies starved for 2 hours were fed yeast paste prepared witha fresh solution of 100 jxg ml-' colchicine, or, as a control,yeast made without colchicine. Feedings were performed at25 C. The experiment presented in the text used KZ503flies; comparable results for osk and Stau were obtained inother experiments performed using Oregon-R flies (data notshown). At varying time points, ovaries were dissected for insitu hybridization or prepared for antibody staining asdescribed below. The zero time point was taken fromcontrol Oregon-R flies fed yeast without colchicine. An addi-tional 5-10 pairs of ovaries were also dissected for Westernimmunoblot analysis from each time point. All time pointsreported are times of fixation. Samples from different timepoints were stained in parallel with each other and with thezero time point.

Whole-mount in situ hybridizationWhole-mount 1n situ hybridization of digoxigenin-labeledprobes to ovaries was performed according to the method ofTautz and Pfeifle [87], with the following modifications.Ovaries were hand dissected in modified Robb's buffer andfixed for 10 minutes in a potassium cacodylate buffer [48].Ovaries were then rinsed twice with PBS, dehydrated withethanol, rehydrated with PBS and digested for 1 hour atroom temperature with 50 pzg ml-1 Proteinase K (Boehringer-Mannheim). After prehybridization, ovarioles were separatedfrom each other by pipetting up and down with a P1000Pipetman (Gilson). When an RNA probe was used,hybridization and washes were performed at 55 C.

Digoxigenin-labeled DNA and RNA probes were preparedand detected using Boehringer Mannheim Genius kits. ADNA probe was prepared from an osk cDNA, generouslyprovided by A. Ephrussi. Template for an antisense RNAprobe for lacZ was prepared by linearizing the BluescriptSK(+) clone pkhc:lacZ [56] with EcoRI, which cuts at thejunction between kinesin sequences and lacZ. The RNAprobe was hydrolyzed with sodium carbonate to producefragments of 100-200 nucleotides.

Whole-mount antibody stainingOvaries were prepared for antibody staining using the masspreparation blender technique described previously [48]. Eggchambers were extracted for 2 hours at room temperature inPBS + 1 % Triton X-100 (for anti-tubulin and anti-Staufenstaining). All antibody incubations and washes were in PBS+ 0.1% Tween-20. Primary antibodies used were anti-a-tubulin mouse monoclonal DM1A (Sigma), used at 1:500;rabbit anti--galactosidase (Cappel) at 1:5000; and a rabbitantibody directed against Staufen protein, preadsorbedagainst an overnight collection of embryos and used at1:3000. The anti-Stau antibody was a generous gift from D.St Johnston. Secondary antibodies were DTAF-conjugateddonkey anti-mouse IgG (Jackson laboratories) at 1:200 andgoat anti-rabbit IgG conjugated to horseradish peroxidase(BioRad) at 1:100. Fluorescent samples were mounted inPBS + 90 % glycerol + 1 mg ml-' p-phenylenediamine(Sigma), and were analyzed using a BioRad MRC600confocal imaging system. DAB stains were dehydrated inethanol and xylene and mounted in Permount (FisherScientific).

Acknowledgements: We are indebted to Bill Wells for generatingmany of the KZ lines used in this study and to Daniel St Johnston,

Posterior localization of a kinesin fusion protein Clark et al. RESEARCH PAPER 299

Anne Ephrussi, Jean-Paul Vincent and John Lis for their generousgifts of reagents, Kirsten Bremer for assistance with the N and Dlexperiments, Sharon Fried and Erica Wolff for preparation ofoligonucleotides, and Ruth Lehmann, William Saxton, BillTheurkauf and Tom Jongens for sharing unpublished information.We thank Tom Jongens, Tim Baldwin, Morgan Sheng and espe-cially Vivian Siegel for helpful suggestions with the manuscript;members of the Jan laboratory for valuable discussions throughoutthe course of this work; and Larry Ackerman, Sandra Barbel andWilliam Walantus for help in preparing figures. I.C. was supportedby a National Science Foundation Predoctoral Fellowship; E.G.was supported by a Damon Runyon-Walter Winchell Cancer FundFellowship, DRG-967; H.R-B. was supported by an EMBOPostdoctoral Fellowship, by HHMI, and subsequently by anAmerican Cancer Society Senior Fellowship; L.Y.J. and Y-NJ. areInvestigators of the Howard Hughes Medical Institute.

References

1. ILLMENSEE K, MAHOWALD AP: Transplantation of posterior poleplasm in Drosophila: induction of germ cells at the anteriorpole of the egg. Proc NatlAcadSci USA 1974, 71:1016-1020.

2. OKADA M, KLEINMAN IS, SCHNEIDERMAN HA: Restoration offertility in sterilized Drosophlla eggs by transplantation ofpolar cytoplasm. Dev Biol 1974, 37:43-54.

3. NIKI Y: Germline autonomous sterility of P-M dysgenic hybridsand their application to germline transfers in Drosophllamelanogaster. Dev Biol 1986, 113:255-258.

4. FROHNHOFER HG, LEHMANN R, NOSSLEIN-VOLHARD C: Manipulatingthe anteroposterior pattern of the Drosophila embryo. JEmbryol Exp Morphol 1986, 97:169-179.

5. FROHNHOFER HG, NSSLEIN-VOLHARD C: Organization of anteriorpattern in the Drosophila embryo by the maternal gene bicold.Nature 1986, 324:120-125.

6. LEIHMANN R, NSSLEIN-VOLHARD C: Abdominal segmentation,pole cell formation, and embryonic polarity require thelocalized activity of oskar, a maternal gene in Drosophila. Cell1986, 47:141-152.

7. LEIIMANN R, NSSLEIN-VOLHARD C: Involvement of the pumllogene in the transport of an abdominal signal in the Drosophilaembryo. Nature 1987, 329:167-170.

8. BERLETi T, BURRI M, TOMA G, BoPP D, RICHSTEIN S, FRIGERIO G,ETAL.: The role of localization of bicoid RNA in organizing theanterior pattern of the Drosophlla embryo. EMBOJ 1988,7:1749-1756.

9. DRIEVER W, NSSLEIN-VOLHARD C: A gradient of bicoid protein inDrosophla embryos. Cell 1988, 54:83-93.

10. DRIEVER W, NOSSLEIN-VOLHARD C: The bicoid protein determinesposition in the Drosophlla embryo in a concentration-dependent manner. Cell 1988, 54:95-104.

11. DRIEVER W, SIEGEL V, NCissLEIN-VOLtARD C: Autonomous deter-mination of anterior structures in the early Drosophllaembryo by the bicoid morphogen. Development 1990, 109:811-820.

12. LEHMANN R, NSSLEIN-VOLHARD C: The maternal gene nanos hasa central role in posterior pattern formation in the Drosophilaembryo. Development 1991, 112:679-691.

13. WANG C, LEHMANN R: Nanos is the localized posterior deter-minant in Drosophila. Cell 1991, 66:637-647.

14. JONGENS TA, HAY B, JAN LY, JAN YN: The germ cell-less geneproduct: a posteriorly localized component necessary for germcell development in Drosophila. Cell 1992, 70:569-584.

15. MAHOWALD AP, KAMBYSELLIS MP: Oogenesis. In The Geneticsand Biology of Drosophila, Vol. 2. Edited by Ashburner M,Wright TRF. London: Academic Press; 1980:141-224.

16. LEIMANN R: Germ-plasm formation and germ-cell determinationin Drosophila. Curr Opin Genet Dev 1992, 2:543-549.

17. MANSEAU LJ, SCHUPBACH T: capuccino and spire: two uniquematernal-effect loci required for both the anteroposterior anddorsoventral patterns of the Drosophlla embryo. Genes Dev1989, 3:1437-1452.

18. RUOIIOIA H, BREMER KA, BAKER D, SWEDLOW JR, JAN LY, JAN YN:Role of neurogenic genes in establishment of follicle cell fate

and oocyte polarity during oogenesis in Drosophila. Cell 1991,66:433-449.

19. Xu T, CARON LA, FEHON RG, ARTAVANIs-TSAKONAS S: Theinvolvement of the Notch locus in Drosophila oogenesis.Development 1992, 115:913-922.

20. BENDER LB, KOOH PJ, MUSKAVITCH MAT: Complex function andexpression of Delta during Drosophila oogenesis. Genetics1993, 133:967-978.

21. SCHCPBACH T, WIESCHAUS E: Germline autonomy of maternal-effect mutations altering the embryonic body pattern ofDrosophila. DevBiol 1986, 113:443-448.

22. EPHRUSSI A, DICKINSON LK, LEHMANN R: oskar organizes thegerm plasm and directs localization of the posterior determi-nant nanos. Cell 1991, 66:37-50.

23. KIM-HA J, SMITH-JL, MACDONALD PM: oskar mRNA is localized tothe posterior pole of the Drosophtla oocyte. Cell 1991,66:23-35.

24. ST. JOHNSTON D, BEUCIILE D, NSSLEIN-VOLHARD, C: staufen, agene required to localize maternal RNAs in the Drosophilaegg. Cell 1991, 66:51-63.

25. HAY B, ACKERMAN L, BARBEL S, JAN L, JAN YN: Identification of acomponent of Drosophla polar granules. Development 1988,103:625-640.

26. HAY B, JAN LY, JAN YN: A protein component of Drosophllapolar granules is encoded by vasa and has extensive sequencesimilarity to ATP-dependent helicases. Cell 1988, 55:577-587.

27. HAY B, JAN LY, JAN YN: Localization of vasa, a component ofDrosophila polar granules, in maternal-effect mutants that alterembryonic anteroposterior polarity. Development 1990,109:425-433.

28. LASKO PF, ASHBURNER M: The product of the Drosophila genevasa is very similar to eukaryotic initiation factor4A. Nature1988, 335:611-617.

29. LASKO PF, ASIHBURNER M: Posterior localization of vasa proteincorrelates with, but is not sufficient for, pole cell develop-ment. Genes Dev 1990, 4:905-921.

30. BARDSLEY A, McDoNALD K, BOSWELL RE: Distribution of tudorprotein in the Drosophila embryo suggests separation offunctions based on site of localization. Development 1993,119:207-219.

31. BOSWELL RE, MAHOWALD AP: tudor, a gene required forassembly of the germ plasm in Drosophila melanogaster. Cell1985, 43:97-104.

32. BOSWELL RE, PROUT ME, STEICHEN JC: Mutations in a newly iden-tified Drosophila melanogaster gene, mago nashi, disruptgerm cell formation and result in the formation of mirror-imagesymmetrical double abdomen embryos. Development 1991,113:373-384.

33. MOHLER J, WIESCHAUS EF: Dominant maternal-effect mutationsof Drosophla melanogaster causing the production of double-abdomen embryos. Genetics 1986, 112:803-822.

34. MAHiOWALD AP: Polar granules of Drosophila. IV. Cytochemicalstudies showing loss of RNA from polar granules during earlystages of embryogenesis. JExp Zool 1971, 176:345-352.

35. EPHRUSSI A, LEIIMANN, R: Induction of germ cell formation byoskar. Nature 1992, 358:387-392.

36. SMITH JL, WILSON JE, MACDONALD PM: Overexpression of oskardirects ectopic activation of nanos and presumptive pole cellformation in Drosophila embryos. Cell 1992, 70:849-859.

37. KIM-HA J, WEBSTER PJ, SMITH JL, MACDONALD PM: Multiple RNAregulatory elements mediate distinct steps in localization ofoskar mRNA. Development 1993, 119:169-178.

38. KIRSCHNER M, MITCHIISON T: Beyond self-assembly: from micro-tubules to morphogenesis. Cell 1986, 45:329-342.

39. GELFAND VI, BERSHADSKY AD: Microtubule dynamics:mechanism, regulation and function. Annu Rev Cell Biol 1991,7:93-116.

40. VALE RD: Intracellular transport using microtubule-basedmotors. Annu Rev Cell Biol 1987, 3:347-378.

41. VALE RD, GOLDSTEIN LSB: One motor, many tails: An expandingrepertoire of force-generating enzymes. Cell 1990, 60:883-885.

42. WALKER RA, SHEETZ P: Cytoplasmic microtubule-associatedmotors. Annu Rev Biochem 1993, 62:429-451.

43. YISRAELI JK, SOKOL S, MELTON DA: A two-step model forthe localization of maternal mRNA in Xenopus oocytes:

300 Current Biology 1994, Vol 4 No 4

involvement of microtubules and microfilaments in the translo-cation and anchoring of Vgl mRNA. Development 1990,108:289-298.

44. POKRYWKA NJ, STEPHENSON EC: Microtubules mediate the local-ization of blcold RNA during Drosophila oogenesis.Development 1991, 113:55-66.

45. ACHLER C, FILMER, D, MERTE C, DRENCKHAHN D: Role of micro-tubules in polarized delivery of apical membrane proteins tothe brush border of the intestinal epithelium. J Cell Biol 1989,109:179-189.

46. BREITFELD PP, McKINNON WC, MOSTOV KE: Effect of nocodazoleon vesicular traffic to the apical and basolateral surfaces ofpolarized MDCK cells. J Cell Biol 1990, 111:2365-2373.

47. HALL DH, HEDGECOCK EM: Kinesin-related gene unc-104 isrequired for axonal transport of synaptic vesicles in C elegans.Cell 1991, 65:837-847.

48. THEURKAUF WE, SMILEY S, WONG ML, ALBERTS BM:Reorganization of the cytoskeleton during Drosophllaoogenesis: implications for axis specification and intercellulartransport. Development 1992, 115:923-936.

49. VALE RD, REESE TS, SHEETZ MP: Identification of a novel force-generating protein, kinesin, involved in microtubule-basedmotility. Cell 1985, 42:39-50.

50. VALE RD, SCHNAPP BJ, MITCHISON T, STEUER E, REESE TS, SHEETZMP: Different axoplasmic proteins generate movement inopposite directions along microtubules in vitro. Cell 1985,43:623-632.

51. BLOOM GS, WAGNER MC, PFISTER KK, BRADY ST: Nativestructure and physical properties of bovine brain kinesin andidentification of the ATP-binding subunit polypeptide.Biochemistry 1988, 27:3409-3416.

52. KUZNETSOV SA, VAISBERG EA, SHANINA NA, MAGRETOVA NN,CHERNYAK VY, GELFAND VI: The quaternary structure of bovinebrain kinesin. EMBOJ 1988, 7:353-356.

53. HIROKAWA N, PFISTER KK, YORIFUJI H, WAGNER MC, BRADY ST,BLOOM GS: Submolecular domains of bovine brain kinesin iden-tified by electron microscopy and monoclonal antibodydecoration. Cell 1989, 56:867-878.

54. YANG JT, LAYMON RA, GOLDSTEIN LSB: A three-domain structureof kinesin heavy chain revealed by DNA sequence and micro-tubule binding analyses. Cell 1989, 56:879-889.

55. YANG JT, SAXTON WM, STEWART RJ, RAFF EC, GOLDSTEIN LSB:Evidence that the head of kinesin is sufficient for force genera-tion and motility in vitro. Science 1990, 249:42-47.

56. GINIGER E, WELLS W, JAN LY, JAN YN: Tracing neurons with akinesin-3-galactosidase fusion protein. Roux's Arch Dev Btol1993, 202:112-122.

57. O'KANE C, GEHRING W: Detection in sltu of genomic regulatoryelements in Drosophlla. Proc Natl Acad Sci USA 1987,84:9123-9127.

58. BIER E, VASSIN H, SHEPHERD S, LEE K, MCCALL K, BARBEL S, ETAL.:Searching for pattern and mutation in the Drosophlla genomewith a P-lacZvector. Genes Dev 1989, 3:1273-1287.

59. GROSSNIKLAUS U, BELLEN HJ, WILSON C, GEHRING WJ: P-element-mediated enhancer detection applied to the study of oogenesisin Drosophlla. Development 1989, 107:189-200.

60. GUTZEIT HO, KOPPA R: Time-lapse film analysis of cytoplasmicstreaming during late oogenesis of Drosophlla. J Embryol ExpMorphol 1982, 67:101-111.

61. ROMBERG L, VALE RD: Chemomechanical cycle of kinesin differsfrom that of myosin. Nature 1993, 361:168-170.

62. WALKER JE, SARASTE M, RUNSWICK MJ, GAY NJ: Distantly relatedsequences in the a and Il-subunits of ATP synthase, myosin,kinases and other ATP-requiring enzymes and a commonnucleotide binding fold. EMBOJ 1982, 1:945-951.

63. BEJSOVEC A, ANDERSON P: Functions of the myosin ATP andactin binding sites are required for C elegans thick filamentassembly. Cell 1990, 60:133-140.

64. MELUII PM, ROSE MD: KAR3, a kinesin-related gene required foryeast nuclear fusion. Cell 1990, 60:1029-1041.

65. SIEGEL. V, JONGENS TA, JAN LY, JAN YN: pipsqueak, an early-acting member of the posterior group of genes, affects vasa

level and germ cell-somatic cell interaction in the developingegg chamber. Development 1993, 119:1187-1202.

66. PFISTER KK, WAGNER MC, STENOIEN DL, BRADY ST, BLOOM GS:Monoclonal antibodies to kinesin heavy and light chains stainvesicle-like structures, but not microtubules, in cultured cells.JCellBiol 1989, 108:1453-1463.

67. ZIPSER D: A study of the urea-produced subunits of 13-galacto-sidase. JMol Btol 1963, 7:113-121.

68. FISCHER-VIZE JA, RUBIN GM, LEHMANN R: The fat facets gene isrequired for Drosophlla eye and embryo development.Development 1992, 116:985-1000.

69. THEURKAUF WE, ALBERTS BM, JAN YN, JONGENS TA: A centralrole for microtubules in the differentiation of Drosophllaoocytes. Development 1993, 118:1169-1180.

70. MCDONALD HB, STEWART RJ, GOLDSTEIN LSB: The kinesin-likencd protein of Drosophla is a minus end-directed microtubulemotor. Cell 1990, 63:1159-1165.

71. WALKER RA, SALMON ED, ENDOW SA: The Drosophlla claret seg-regation protein is a minus-end directed motor molecule.Nature 1990, 347:780-782.

72. ZHANG P, KNOWLES BA, GOLDSTEIN LSB, HAWLEY RS: A kinesin-like protein required for distributive chromosome segregationin Drosophila. Cell 1990, 62:1053-1062.

73. ENDOW SA, HATSUMI M: A multimember kinesin gene family inDrosophila. Proc Nail Acad Sct USA 1991, 88:4424-4427.

74. STEWART RJ, PESAVENTO PA, WOERPEL DN, GOLDSTEIN LSB:Identification and partial characterization of six members ofthe kinesin superfamily in Drosophlta. Proc Natl Acad SciUSA 1991, 88:8470-8474.

75. RASMUSSON K, SERR M, GEPNER J, GIBBONS , HAYS TS: A family ofdynein genes in Drosophila melanogaster. Mol Btol Cell 1994,5:45-55.

76. SAXTON WM, HICKS J, GOLDSTEIN LSB, RAFF EC: Kinesin heavychain is essential for viability and neuromuscular functions inDrosophila, but mutants show no defects in mitosis. Cell 1991,64:1093-1102.

77. CHEUNG H-K, SERANO TL, COHEN RS: Evidence for a highlyselective RNA transport system and its role in establishing thedorsoventral axis of the Drosophila egg. Development 1992,114:653-661.

78. MACDONALD PM: The means to the ends: localization ofmaternal messenger RNAs. Semin Dev Biol 1992, 3:413-424.

79. NEUMAN-SILBERBERG FS, SCH0PBACH T: The Drosophila dorsoven-tral patterning gene gurken produces a dorsally localized RNAand encodes a TGFct-like protein. Cell 1993, 75:165-174.

80. WILHELM RJ, VALE RD: RNA on the move: the mRNA localiza-tion pathway. J Cell Btol 1993, 123: 269-274.

81. AINGER K, AVOSSA D, MORGAN F, HILL SJ, BARRY C, BARBARESE EET AL.: Transport and localization of exogenous myelin basicprotein mRNA microinjected into oligodendrocytes. J Cell Btol1993, 123:431-441.

82. LINDSLEY DL, ZIMM GG: The Genome of Drosophtlamelanogaster. San Diego: Academic Press; 1992.

83. THUMMEL CS, BOULET AM, LIPSHITZ HD: Vectors for DrosophIlaP element-mediated transformation and tissue culture transfec-tion. Gene 1988, 74:445-456.

84. XIAo H, L JT: Heat shock and developmental regulation of theDrosophlla melanogaster sp83 gene. Mol Cell Btol 1989,9:1746-1753.

85. RUBIN GM, SPRADLING AC: Genetic transformation ofDrosophila with transposable element vectors. Science 1982,218:348-353.

86. SPRADLING AC, RUBIN GM: Transposition of cloned P elementsinto Drosophila germ line chromosomes. Science 1982,218:341-347.

87. TAUTZ D, PFEIFLE C: A non-radioactive n stu hybridizationmethod for the localization of specific RNAs in Drosophtlaembryos reveals a translational control of the segmentationgene hunchback. Chromosoma 1989, 98:81-85.

Received: 14 February 1994; accepted: March 1994.