Transcriptome Analysis Provides Novel Insights into theCapacity of the Ectomycorrhizal Fungus Amanita pantherinaTo Weather K-Containing Feldspar and Apatite

Qibiao Sun,a Ziyu Fu,a Roger Finlay,b Bin Liana

aJiangsu Key Laboratory for Microbes and Functional Genomics, College of Life Sciences, Nanjing Normal University, Nanjing, ChinabDepartment of Forest Mycology and Plant Pathology, Uppsala BioCenter, Swedish University of Agricultural Sciences, Uppsala, Sweden

ABSTRACT Ectomycorrhizal (ECM) fungi, symbiotically associated with woody plants,markedly improve the uptake of mineral nutrients such as potassium (K) and phos-phorus (P) by their host trees. Although it is well known that ECM fungi can obtainK and P from soil minerals through biological weathering, the mechanisms regulat-ing this process are still poorly understood at the molecular level. Here, we investi-gated the transcriptional regulation of the ECM fungus Amanita pantherina in weath-ering K-containing feldspar and apatite using transcriptome sequencing (RNA-seq)and validated these results for differentially expressed genes using real-time quanti-tative PCR. The results showed that A. pantherina was able to improve relevant met-abolic processes, such as promoting the biosynthesis of unsaturated fatty acids andsteroids in the weathering of K-containing feldspar and apatite. The expression ofgenes encoding ion transporters was markedly enhanced during exposure to solidK-containing feldspar and apatite, and transcripts of the high-affinity K transporterApHAK1, belonging to the HAK family, were significantly upregulated. The resultsalso demonstrated that there was no upregulation of organic acid biosynthesis, re-flecting the weak weathering capacity of the A. pantherina isolate used in this study,especially its inability to utilize P in apatite. Our findings suggest that under naturalconditions in forests, some ECM fungi with low weathering potential of their ownmay instead enhance the uptake of mineral nutrients using their high-affinity iontransporter systems.

IMPORTANCE In this study, we revealed the molecular mechanism and possiblestrategies of A. pantherina with weak weathering potential in the uptake of insolublemineral nutrients by using transcriptome sequencing (RNA-seq) technology andfound that ApHAK1, a K transporter gene of this fungus, plays a very important rolein the acquisition of K and P. Ectomycorrhizal (ECM) fungi play critical roles in theuptake of woody plant nutrients in forests that are usually characterized by nutrientlimitation and in maintaining the stability of forest ecosystems. However, the regula-tory mechanisms of ECM fungi in acquiring nutrients from minerals/rocks are poorlyunderstood. This study investigated the transcriptional regulation of A. pantherinaweathering K-containing feldspar and apatite and improves the understanding offungal-plant interactions in promoting plant nutrition enabling increased productiv-ity in sustainable forestry.

KEYWORDS ectomycorrhizal fungi, high-affinity ion transporter, mineral weathering,molecular mechanism, RNA-seq, real-time quantitative PCR

Potassium (K) and phosphorus (P), two of the most important macronutrients forplant growth (1, 2), are abundant components of soil, but their low availability

(often in the form of minerals) can limit terrestrial plant growth and ecosystem

Citation Sun Q, Fu Z, Finlay R, Lian B. 2019.Transcriptome analysis provides novel insightsinto the capacity of the ectomycorrhizal fungusAmanita pantherina to weather K-containingfeldspar and apatite. Appl Environ Microbiol85:e00719-19. https://doi.org/10.1128/AEM.00719-19.

Editor Emma R. Master, University of Toronto

Copyright © 2019 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Bin Lian,bin2368@vip.163.com.

Received 29 March 2019Accepted 18 May 2019

Accepted manuscript posted online 24 May2019Published

GEOMICROBIOLOGY

crossm

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 1Applied and Environmental Microbiology

18 July 2019

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

productivity. In temperate and boreal forest ecosystems, woody plants develop effi-cient strategies to improve the uptake of K and P from soil. The symbiotic associationof trees with ectomycorrhizal (ECM) fungi is one of the most important strategies forimproving the bioavailability of mineral nutrients from soil. Forest trees are largelydependent on their fungal symbionts for the uptake of mineral nutrients; in return, thefungi can obtain photosynthetically fixed carbon from their tree hosts (3, 4).

ECM fungi form symbiotic associations with forest trees, such as the Pinaceae,Betulaceae, Salicaceae, Fagaceae, and Dipterocarpaceae (4). They play a critical role inimproving the uptake of plant nutrients in natural ecosystems that are usually charac-terized by nutrient limitation, especially with regard to N, K, and P (4–8). Plant nutrients,with the exception of nitrogen, are ultimately derived from weathering of terrestrialprimary minerals (9). Lindahl et al. (10) revealed that ECM fungi dominate the totalfungal community in the B horizon soil, suggesting that these fungi have the potentialto obtain nutrients from soil minerals. K and P in forest soil often occur in mineral forms,but ECM fungi can effectively obtain these elements in the minerals by bioweathering(11–16). This can involve hyphal tunneling (9, 17, 18), although this alone has beenestimated not to make a significant contribution to total mineral weathering (19).However, the effective impact of fungi on mineral weathering is probably increased bythe production of extracellular polymeric substances (EPS) that increase the effectivesurface area of contact with minerals (20). Biochemical weathering plays an importantrole in obtaining nutrients from soil minerals, and ECM fungi can weather soil mineralsthrough local acidification around the hyphae and by exuding metal-complexingweathering agents such as organic acids and siderophores (14, 21) and enhancing theabsorption of weathered products (22, 23). Griffiths et al. (24) found that the coloni-zation of the ECM fungus Gautieria monticola can markedly increase the content ofoxalic acid in the soil and thus can accelerate the weathering of minerals. In vitro studiesalso show that ECM fungi can secrete large amounts of oxalic acid to acquire K and Pfrom phlogopite and apatite (15, 25, 26). Bonneville et al. (27) investigated the disso-lution effect of individual hyphae of Paxillus involutus on biotite at the nanometer scaleand found that acidification at the hypha-mineral interface accelerates the weatheringof biotite. Smits et al. (26) investigated ectomycorrhizal weathering of apatite andfound that the fungus P. involutus could increase the weathering rate of apatite by afactor of three. Although the promotion of mineral weathering through secretion ofweathering agents by ECM fungi is well known, the molecular mechanisms regulatingECM fungal weathering are still poorly understood.

Some studies have reported on gene regulation and molecular mechanisms ofmineral weathering by saprophytic fungi. Xiao et al. (28) found the upregulatedexpression of weathering-related genes (carbonic anhydrase, acetaldehyde dehydro-genase, and metal transporters) during Aspergillus fumigatus weathering of K-bearingmineral, indicating these genes play an important role in mineral weathering. Forexample, microbial carbonic anhydrase can catalyze CO2 hydration and significantlypromote the weathering of minerals (29, 30). Wang et al. (31) found that Aspergillusniger can upregulate the biosynthesis of organic acids in the process of K-bearingfeldspar weathering and simultaneously improve the expression of a large number ofmembrane ion transporters, such as Na�/K�-ATPase. The weathering of minerals bysaprophytic fungi is driven by their demand for mineral nutrients, and the weatheringeffect on minerals will attenuate once the fungal demand for mineral nutrients issatisfied (31). However, in addition to meeting their own mineral nutrient requirement,ECM fungi in soil supply large amounts of mineral nutrients to tree hosts in exchangefor plant-derived carbohydrates. The continued supply of hexoses to the fungi iscontingent upon continued flow of nutrients such as P in the reverse direction to theplant (32), and the regulatory mechanisms of ECM fungal-driven mineral weatheringmay therefore differ greatly from those of free-living fungi.

Many studies have shown that ECM fungi can promote the uptake of mineralelements from soil by expressing high-affinity membrane ion transporters. Corratgé etal. (33) found that the K transporter (KT) HcTrk1 from the Trk family in the ECM fungus

Sun et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 2

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Hebeloma cylindrosporum expressed in Xenopus oocytes mediates the cotransport of K�

and Na�, and Garcia et al. (16) found that this transporter plays a major role in both Kand P nutrition of the fungus (and of the host plant) grown in potassium-poor solutions.Increasing numbers of high-affinity phosphorus transporters (PTs) have also beendiscovered during recent years (34). At present, at least 47 PTs of 14 ECM fungi can beretrieved in the database (35). Tatry et al. (36) found that among the two PTs of H.cylindrosporum, one (HcPT1) is induced by P starvation, whereas the other one (HcPT2)is less dependent on P availability. ECM fungi need not only to promote the release ofinsoluble mineral elements in the soil through weathering but also to rapidly transportthe released elements into hyphae and to host plants to exchange for C supply (37).

The process of mineral weathering by ECM fungi obviously involves complicatedpatterns of gene expression regulation, but the molecular mechanisms associated withthis process are still unknown. To decipher the molecular regulation mechanism of ECMfungi in mineral weathering, we used Amanita pantherina, one of the most frequentlyencountered ECM fungi, forming symbiotic associations with Quercus in Nanjing, China,as a model fungus. The transcriptome of A. pantherina during weathering interactionswith K-containing feldspar and apatite was investigated using transcriptome sequenc-ing (RNA-seq) technology, and the patterns of differential expression of weathering-related genes that were identified were validated using real-time quantitative PCR(RT-qPCR), to gain insight into the molecular mechanisms involved in mineral weath-ering and nutrient uptake.

RESULTSChanges in mineral composition. Mineral weathering by fungi is directly reflected

by changes in mineral structure and composition after fungal action. We determinedthe changes of the mineral structure and the relative content of the phases before andafter fungal weathering by X-ray powder diffraction (XRD) (Fig. 1). When A. pantherinawas incubated on K-deficient Pachlewski’s medium but containing an equivalentamount of K in the form of feldspar (KD treatment), the weathering of A. pantherinacaused a significant change in the relative content of the mineral phases, in which theK content of high K-bearing albite was reduced from 65.8% � 1.6% to 56.4% � 0.2%(t � 8.244, P � 0.002), and the �-quartz increased from 17.7% � 1.0% to 30.2% � 0.8%(t � �13.804, P � 0.001). When A. pantherina was incubated in Pachlewski’s mediumwith a low level of soluble P but containing an equivalent amount of P in the form ofapatite (PD treatment), the XRD data showed that A. pantherina had a very weakweathering effect on apatite. The relative contents of fluoroapatite and hydroxyapatitein the mineral hardly changed, and only the proportion of the amorphous phaseincreased slightly (Fig. 1B). When A. pantherina was incubated in K-deficient Pachlews-ki’s medium with a low level of soluble P but containing equivalent amounts of K andP in the form of the feldspar and apatite (KPD treatment), the XRD data showed that themean content of albite changed from 28.4% to 24.8% after incubation with A. pan-therina, but this difference was not statistically significant, while the mean relativecontents of fluoroapatite and hydroxyapatite showed no significant change. The meancontent of amorphous material increased from 16.9% to 20.5% in the mixed minerals,but this difference was not significantly different with the degree of replication used inthis experiment.

Differentially expressed genes during weathering of K-containing feldspar andapatite. To identify differentially expressed genes (DEGs) of A. pantherina related tomineral weathering, we used Illumina paired-end sequencing technology to character-ize fungal transcripts under different culture conditions. In total, the transcriptomesequencing yielded 347,835,310 reads with a GC content of each sample of 49.0% to50.0% and a quality score threshold of 30 (Q30) value between 91.56% and 92.73%. Atotal of 35,346 unigenes was successfully assembled, with the shortest unigene being201 bp and the longest unigene being 17,958 bp (Table 1). Examination of the lengthdistribution of assembled unigenes showed that 12,667 unigenes (35.84%) were lessthan or equal to 300 bp, 4,823 unigenes (13.64%) ranged from 301 to 400 bp, 13,465

Response of Amanita pantherina to Nutrient Deficiency Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 3

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

FIG 1 (A, B, and C) Changes of structure and relative content of minerals after the weathering of A. pantherina. Values are means � SDs.

Sun et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 4

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

unigenes (38.09%) ranged from 401 to 2,000 bp, and 4,391 unigenes (14.42%) exceeded2,000 bp (see Fig. S1 in the supplemental material).

When comparing gene expression in the KD treatment to that when A. pantherinawas incubated on solid full-strength Pachlewski’s medium (ND control), a set of 281DEGs was identified, and among these, 174 DEGs were upregulated, while 107 DEGswere downregulated (Fig. 2A). Compared to gene expression in ND, 119 DEGs wereupregulated and 96 DEGs downregulated in the PD treatment (Fig. 2B). More DEGswere found in KPD compared with expression in KD and PD. The results showed that199 DEGs were significantly upregulated and 371 DEGs were significantly downregu-lated in the KPD treatment compared with expression in the ND control (Fig. 2C).

GO enrichment analysis. To understand the involvement of DEGs in differenttreatments, Gene Ontology (GO) classification was performed, classifying functionsaccording to three nonoverlapping terms: biological process, cellular component, andmolecular function. Figure 3 shows the top ten upregulated GO terms significantlyenriched during weathering of K-containing feldspar and apatite. In KD, the signifi-cantly enriched GO categories of biological processes were protein synthesis anddegradation, such as ribosome synthesis and mitochondrial respiratory chain complexIII synthesis, and the significantly enriched categories of GO cell components andmolecular functions mostly belonging to transcription and translation (Fig. 3A). In PD,the enriched GO categories of biological processes included protein synthesis, trans-port, and degradation, endocytosis, and proton transport (Fig. 3B). The enriched GOcategories of cell components were mainly cell and organelle membranes such asmitochondria and Golgi membrane. The enriched GO categories of molecular functionswere mainly binding, transcriptional activator activity, oxidoreductase activity, endo-nuclease activity, and endopeptidase activity. In KPD, the enriched GO categories ofbiological processes included protein synthesis and degradation, endocytosis, andtranscription (Fig. 3C). The enriched GO categories of cell components were mainly

TABLE 1 Summary of the A. pantherina transcriptome

Description Value

Raw reads (bp) 366,517,238High-quality reads (bp) 347,835,310Q30 (%) 92.11GC content (%) of high-quality reads 49.67No. of unigenes 35,346Range of unigene length (bp) 201–17,958N50 length of unigenes (bp) 1,863

FIG 2 (A, B, and C) Volcano plots of differentially expressed genes (DEGs) between treatments. The x axis represents log2 (fold change) of DEGs,and the y axis represents the �log10 P value indicating the significance of the difference. The dots represent the unigenes; the blue dots indicatedownregulated DEGs; the red dots represent upregulated DEGs; the gray dots represent genes that are not differentially expressed betweentreatments.

Response of Amanita pantherina to Nutrient Deficiency Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 5

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

FIG 3 Enrichment of GO classification for different treatments: (A) KD versus ND; (B) PD versus ND; (C)KPD versus ND.

Sun et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 6

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

related to ribosome, mitochondrial membrane, and nucleus, while the upregulatedmolecular functions were primarily connected with oxidation activity (such as cyto-chrome c oxidation activity), endopeptidase activity, transcription factor activity, etc.These significantly enriched GO classifications may be a response to the weathering ofK-containing feldspar and apatite by the fungus.

KEGG pathway enrichment analysis. KEGG (the Kyoto Encyclopedia of Genes andGenomes) is a database resource for revealing high-level functions of genes, and theKEGG pathway enrichment analysis can map DEGs under nutrient-deficient conditionsto certain metabolic pathways. Figure 4 shows the top ten upregulated pathwaysduring weathering of K-containing feldspar and/or apatite. The predominant categoriesof enriched pathways were amino acid synthesis (ko00300, ko00400, ko00270, andko01230), ribosome (ko03010), and aminoacyl-tRNA biosynthesis (ko00970) in KD (Fig.4A). In PD, the results of KEGG pathway analysis suggested that cell signaling (ko04310,ko03320, and ko04150), amino acid degradation (ko00280), and oxidative phosphory-lation (ko00190) were particularly active (Fig. 4B). In KPD, the main upregulatedpathways were related to ribosome (ko03010), gene expression (ko03010 and ko03022),metabolism of sterols and sphingolipid (ko00100 and ko00600), and transmembranetransport of substances such as ABC transporters (ko02010) (Fig. 4C).

RT-qPCR validation. Validation, using RT-qPCR, of selected genes in each treatmentthat were significantly upregulated according to RNA-seq (Table 2), confirmed thepatterns of up- and downregulation at different culture times (20 days, 30 days, and 40days). At 20 days, the expression levels of all selected genes were markedly upregulatedduring weathering of K-containing feldspar and/or apatite (Fig. 5). As the culture timeincreased, genes detected in the control group were also upregulated to differentdegrees. The expression level of ApHAK1 was significantly upregulated whether in KD,PD, or KPD. In KD, the expression level of ApHAK1 increased with the culture time, withincreases of approximately 6-fold at 20 days, 612-fold at 30 days, and 115-fold at 40

FIG 4 KEGG pathways significantly enriched related to upregulated DEGs in KD (A), PD (B), and KPD (C).

Response of Amanita pantherina to Nutrient Deficiency Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 7

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

days. In PD, the expression of ApHAK1 reached the peak at 30 days, upregulatedapproximately 2,218-fold. However, in KPD, the expression of ApHAK1 was upregulatedapproximately 27,000-fold at 40 days, which was the highest in all treatments. Surpris-ingly, the levels of expression of all the PT genes did not vary under PD or KPDconditions. This could be due to the supply of soluble P (0.7 mM) in the mediumcontaining apatite to get fungal growth. To assess which PT genes responded tosoluble P starvation, we grew the fungus with low levels of available K (50 �M) and/orP (20 �M) for different lengths of time and measured the expression of KT and PTgenes. The results showed that the expression levels of seven cytoplasmic PTs found byhigh-throughput sequencing were all upregulated, but ApPT2 and ApPT3 were moreclosely related to soluble P starvation, which increased approximately 46- and 94-foldat 20 days, 60- and 59-fold at 30 days, and 18- and 16-fold at 40 days, respectively,under low soluble P conditions (Fig. 6). Under both low soluble K and P conditions, theexpression levels of ApPT2 and ApPT3 were the most upregulated as well.

DISCUSSION

ECM fungi have evolved repeatedly from saprotrophic ancestors (38, 39), formingsymbiotic associations with the Pinaceae in the Cretaceous period (ca. 100 million yearsago) according to fossil and molecular clock evidence (39, 40). To date, many ECM fungistill retain some of the characteristics of saprophytic fungi but contain limited numbersof genes for plant cell wall-degrading enzymes (39). Therefore, we can isolate the purecultures of ECM fungi from the wild, making it possible to study the biological functionof ECM fungi in vitro. In forest ecosystems, ECM fungi improve the mineral nutrition oftrees, especially for N, K, and P (3–6, 34). However, the molecular regulation mecha-nisms of ECM fungi in weathering minerals to obtain nutrients from soil minerals arestill a black box. Our results showed that A. pantherina can weather albite and reducethe relative content of K in the mineral (Fig. 1). However, the results also showed thatA. pantherina could not acquire P from apatite, even when small amounts of soluble Pwere supplied. The feldspar used in this study was a mixture of high-K-bearing albite

TABLE 2 Selected upregulated transcripts for validation using RT-qPCR

Transcript IDa Treatment Log2 fold change P value Definition Abbreviation

Comp11267_c0_seq1 PD 3.33 2.60E�26 Vacuolar iron transporter ApVITrComp14851_c0_seq1 KPD 2.85 1.79E�25 Cytochrome ApCytComp15580_c0_seq1 KD 2.40 1.00E�04 Putative steryl acetyl hydrolase ApSAHComp16274_c0_seq4 KD 2.14 2.37E�05 Probable mitochondrial chaperone ApMtCComp17778_c0_seq1 PD/KPD 4.13/6.01 2.18E�03 Zinc-dependent alcohol dehydrogenase ApADeHComp18566_c0_seq1 KD 1.86 6.00E�10 Polyphenol oxidase ApPPOComp19342_c0_seq1 KD/PD/KPD 2.02/1.92/3.99 8.66E�17 High-affinity potassium transporter ApHAK1Comp23084_c0_seq105 PD 2.07 2.68E�04 Probable polyol transporter ApPyTrComp23599_c3_seq1 PD/KPD 3.24/3.67 1.62E�02 Serine/threonine protein kinase with WD40 repeats ApSeThKComp24274_c0_seq1 KD 2.78 1.28E�06 WD40 repeat-containing protein ApWD40Comp24340_c0_seq1 KPD 3.72 9.86E�07 Zinc finger protein ApZnFaID, identifier.

FIG 5 Expression levels of selected genes at different incubation times validated by RT-qPCR in KD (A), PD (B), and KPD (C). The expressionof each gene of A. pantherina incubated on full-strength medium at 20 days was set as 1.

Sun et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 8

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

quartz: obviously, the fungus can acquire K from the albite, whereas the compositionof apatite is mainly fluoroapatite and hydroxyapatite, which are more resistant toweathering by A. pantherina. Using high-throughput sequencing, a large amount oftranscriptome data was obtained under different conditions (see Data Set S1 in thesupplemental matieral), allowing us to more clearly understand the molecular regula-tion mechanism of A. pantherina in response to nutritional deficiencies. The assembledtranscripts were assigned to KOG, GO, and KEGG databases, enabling a wide range ofcomparisons.

Molecular regulation mechanism of A. pantherina during weathering ofK-containing feldspar. Under conditions of soluble K deficiency, but in the presenceof added albite, the dominant biological process GO category was protein synthesis,indicating that A. pantherina needed to synthesize various proteins or enzymes tocatalyze multiple biological reactions during weathering of albite (Fig. 3A). The upregu-lated biological process of mitochondrial respiratory chain complex III assembly sug-gests that the fungus needed to supply more energy for activated metabolism byenhancing mitochondrial respiration. Cytosol and structural constituents of ribosomeswere the largest GO categories of cellular components and molecular functions,respectively. The KEGG pathway enrichment analysis showed that 4 of the top 10metabolic pathways were related to amino acid synthesis (Fig. 4A). The lack of K greatlypromoted the synthesis of various amino acids, which not only were synthetic com-ponents of proteins but might also be secreted to extracellular substrates involved inmineral weathering.

The expression levels of the five selected DEGs validated by RT-qPCR were substan-tially higher than those indicated by RNA-seq, except for ApMtC, further suggesting that

FIG 6 (A, B, and C) Expression levels of A. pantherina K transporter and phosphorus transporter genes inlow soluble K and/or P with different incubation phases. The expression of each gene was set as 1 at the20th day of full-strength medium. LK, Pachlewski’s medium with low soluble K (KH2PO4 replaced by1.15 g NaH2PO4·2H2O and 25 �M K2SO4); LP, Pachlewski’s medium with low soluble P (KH2PO4 replacedby 20 �M NaH2PO4·2H2O and 1.28 g K2SO4); LKP, Pachlewski’s medium with low soluble K and P (KH2PO4

replaced by 20 �M NaH2PO4·2H2O and 25 �M K2SO4).

Response of Amanita pantherina to Nutrient Deficiency Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 9

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

these genes were involved in K acquisition. The upregulated A. pantherina ApWD40gene product belongs to the WD40 repeat-containing protein family, found in alleukaryotes and implicated in a variety of functions such as signal transduction andtranscription regulation (41). ApWD40 may play a key role in the initial signal trans-mission of extracellular K stress. The RT-qPCR results confirmed the upregulatedtranscripts of steryl acetyl hydrolase ApSAH, associated with sterol metabolism. Sterolis involved in the synthesis of fungal ergosterol, which is thought to be related to fungalmembrane structure, signaling, and an adverse environment (42). Wang et al. (43)investigated the gene expression of A. niger under soluble K deficiency using RNA-seqand found that the biosynthesis of organic acids and KT (Na�/K�-ATPase) weresignificantly upregulated. It is well known that organic acids play a critical role in theprocess of mineral weathering (14, 15, 25, 44). In our results, no DEGs associated withthe synthesis of organic acids were found. This might indicate that A. pantherina cannotweather minerals by excreting organic acids. However, the massive network of ecto-mycorrhizal fungal hyphae can greatly improve nutrient uptake (45), which implies thation transporters of ECM fungi play an important role in nutrient absorption. Asexpected, the transcripts of high-affinity KT ApHAK1 were found among the DEGs. ECMfungi can constantly absorb K from the environment and store it in fungal vacuoles (46,47). In particular, large amounts of K sequestered in rhizomorphs facilitate the long-term exchange of photosynthetic products of host plants (20, 48). ApHAK1 was the onlyupregulated transcript in the four KT genes identified by RNA-seq, suggesting that notall A. pantherina KTs respond to the low availability of K. The expression levels of thefour KT genes at low K� (50 �M) were different during incubation, and ApHAK1 wasindeed closely related to K availability, while ApHAK2 and ApHAK3 were less closelyrelated (Fig. 6). Tatry et al. (36) found a similar phenomenon for H. cylindrosporum PTs,in which increased expression levels of HcPT1 transcripts are induced by P starvation inpure culture, but the transcript levels of HcPT2 are less dependent on P availability. A.pantherina may evolve different types of KTs to effectively cope with different extra-cellular K� levels and ensure the uptake of K�.

Molecular regulation mechanism of A. pantherina in apatite weathering.Under conditions of low levels of soluble P but in the presence of apatite, the biologicalprocess GO categories intracellular protein transport, signal transduction, and protontransport were particularly enriched (Fig. 3B). Signaling is a key process in which fungirespond to apatite weathering stress and make metabolic adjustments. The serine/threonine kinase containing WD40 repeating unit ApSeThK was upregulated duringapatite weathering, verified by RT-qPCR, which may involve an inward transfer low-Psignal. ECM fungi often depend on P:H� symporters to take up extracellular P (36, 49,50). The efficiency of P uptake through H�-dependent PTs (P:H� symporters) reliesstrongly on low external pH values (35) to a certain extent, which explains the fact thatthe optimal pH of A. pantherina is acidic (see Fig. S2). The enrichment of the protontransport category might involve the retention of extracellular proton gradients. Mem-brane was the largest cellular component GO category. In the process of mineralweathering, A. pantherina needs to secrete weathering agents continuously and trans-fer weathered products into its hyphae, leading to the frequent turnover of cell andorganelle membranes.

The KEGG pathway enrichment analysis also showed that unsaturated fatty acidsynthesis and oxidative phosphorylation occurred in the top 10 significantly enrichedcategories (Fig. 4B). Fungus-driven mineral weathering is a comprehensive process, andimproving the structure of the cell membrane contributes significantly to the physio-logical function of the membrane proteins. The enhancement of oxidative phosphor-ylation can provide more ATP for all physiological processes, which is beneficial for Pacquisition by the fungus. We found a significant upregulation of ApHAK1 (Table 2, Fig.4B), indicating that ApHAK1 was also closely related to P acquisition. Unexpectedly, thetranscripts of seven PTs were not upregulated. However, the role of A. pantherina PTsin apatite weathering cannot be dismissed, since the expression of some PTs in ECMfungi is not affected by P availability (37). Another possible explanation of the results

Sun et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 10

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

is that, in the PD treatment, the fungus is not really under a P starvation condition dueto the addition of a low level of soluble P to the medium. We further tested theexpression levels of these PTs in A pantherina at low P (20 �M PO4

3�), and the resultsshowed that ApPT2 and ApPT3 were more closely related to P availability while ApPT4was less closely related (Fig. 6).

In this study, we found that A. pantherina was unable to utilize structural P in apatite,suggesting the ability to use insoluble phosphates varies between different taxa of ECMfungi (51). Wallander et al. (52) also showed that P uptake from apatite by ECM fungiis not a common phenomenon. The results of the present study suggest that A.pantherina may acquire P from apatite through other means under field conditions,such as by enriching bacteria with high mineral-weathering potential. Frey-Klett et al.(53) found that the ectomycorrhiza of Laccaria bicolor Douglas fir can enrich Pseudomo-nas fluorescens populations that have the ability to solubilize inorganic phosphates, incontrast to the majority of P. fluorescens from the bulk soil, indicating some phosphate-solubilizing bacteria can interact synergistically with ECM fungi and promote sustain-able P supply to plants. The recent study by Liu et al. (54) also shows that ECM fungican enrich bacterial communities with respect to different ecological functions in thehyphosphere, such as mineral weathering by bacteria in the genera Sphingomonas (55)and Burkholderia (56, 57). Obviously, the selection of bacteria with weathering potentialcan compensate for the limited ability of particular ECM fungi to take up nutrients fromsoil minerals.

Molecular regulation mechanism of A. pantherina in the weathering ofK-containing feldspar and apatite. The dual stress of soluble K deficiency and low

level of soluble P caused A. pantherina to upregulate more genes (Fig. 2). However,most of the enriched GO categories of biological processes, cellular components, andmolecular functions were the same as under conditions of low-level soluble P or solubleK deficiency (Fig. 3). KEGG pathway enrichment analysis showed that metabolic pro-cesses such as ribosome, steroid biosynthesis, basal transcription factors, sphingolipidmetabolism, and ABC transporters were the major categories (Fig. 4C). In the limitationof K and P, A. pantherina also demonstrated the same metabolic responses to nutrientdeficiencies. First, the expression of weathering-related genes was initiated, and mem-brane structure was adjusted to promote the transport of metabolic substances, suchas accelerating proton transport; then, the upregulated ion transporters improved thetransport of weathering products into fungal hyphae. Among the selected DEGs forRT-qPCR validation, the expression of the cytochrome-encoding gene ApCyt graduallyincreased during incubation (Fig. 5). Cytochromes are primarily involved in cellularrespiration and energy production, indicating that A. pantherina needs more energyunder condition of limitation of K and P. The expression level of ApHAK1 was upregu-lated in KPD as well, further confirming that ApHAK1 was also closely related to Pacquisition. In fungi, at least three K transport systems have been reported, TrK(transporter of K), HAK (high-affinity K uptake) transporters, and K channel proteins (2).Based on phylogenetic analysis of predicted and functionally characterized KTs, A.pantherina ApHAK1 belongs to the HAK family (Fig. 7A). ApHAK1 has 12 predictedtransmembrane domains (Fig. 7B and C), located in the cytoplasmic membrane fromsubcellular prediction using WoLF PSORT (https://wolfpsort.hgc.jp/), more than those inthe first identified HAK transporter of Schwanniomyces occidentalis SoHAK1, but has thesame predicted number of transmembrane domains as the Neurospora crassa NcHAK1(see Fig. S3). The only two functionally described KTs in the HAK family of fungi, SoHAK1(58) and NcHAK1 (59), are H�-dependent transporters, suggesting that A. pantherinaApHAK1 may be an H�-dependent KT as well. It is assumed that most HAK KTs may beK�-H� symporters (2). Interestingly, the metabolic pathways of unsaturated fatty acid,terpenoid backbone, sphingolipid, and steroid were enriched in both PD and KPDtreatments. Lipids, steroids, and terpenoids are usually the precursors of signal mole-cules, such as hydroxy fatty acids (60) and lipochitooligosaccharides (61, 62). Thisfurther indicated that although A. pantherina could not utilize apatite, it might enrich

Response of Amanita pantherina to Nutrient Deficiency Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 11

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

P-solubilizing bacteria by synthesizing and secreting signal molecules in the field toassist P absorption.

In summary, this study characterizes the molecular regulation of A. pantherina inresponse to mineral nutrient deficiencies in the external environment. First, nutritionaldeficiencies stimulated the activation of cell surface signaling receptors. Subsequently,signals were transmitted intracellularly to activate relevant gene expression, showing asimilar molecular regulation mechanism to that hypothesized by Xiao et al. (63) inAspergillus nidulans during weathering of K-containing minerals. In forests, ECM fungican recruit mineral-weathering bacterial communities from the bulk soil (53–55) thatplay an important role in mineral dissolution. Our results suggested that ECM fungimight adopt different strategies for acquiring nutrients based on their character-istics. For example, some ECM fungi with weak weathering potential, such as A.pantherina, might compensate for functional deficiencies by enriching bacteria withhigh weathering potential, which can be recruited through secreting special sig-naling molecules (Fig. 4B and C), and upregulating the expression of special iontransporters.

MATERIALS AND METHODSPreparation of ECM fungi and minerals. The ECM fungus used in this study was A. pantherina LS08

(GenBank accession number KR456156), isolated from a fruiting body of A. pantherina associated withQuercus acutissima on the Nanjing Normal University campus. The fruiting bodies of A. pantherina mainlyform from June to October each year on the campus (Fig. 8). The optimum growth temperature ofisolated cultured strains was 25°C (see Fig. S4 in the supplemental material), and the optimal pH isapproximately 5 (Fig. S2). The isolate can utilize various types of carbohydrates, such as monosaccharides,disaccharides, and polysaccharides such as starch (see Fig. S5).

The fungus was isolated on Pachlewski’s medium with the following composition (per liter): maltose,5.0 g; glucose, 20 g; ammonium tartrate, 0.5 g; KH2PO4, 1 g; MgSO4·7H2O, 0.5 g; thiamine, 100 �g;microelements, including ZnSO4·7H2O, 0.63 mg; MnSO4·H2O, 1.54 mg; CuSO4·5H2O, 0.25 mg; (NH4)6

Mo7O24·4H2O, 0.05 mg; Fe(III)-EDTA, 3.44 mg; Bacto agar, 20 g. The pH was adjusted to 5.5 with NaOH.

FIG 7 Phylogenetic tree of KTs constructed using Mega 7.0 software by neighbor-joining method (A), thepredicted transmembrane domains (B), and schematic structural model based on SWISS-MODEL server(C) of ApHAK1. Values of the phylogenetic tree represent the bootstrap confidence tested using 1,000replicates of the data set. Am, Amanita muscaria; Hc, H. cylindrosporum; Nc, N. crassa; Sc, Saccharomycescerevisiae; So, S. occidentalis; Sp, Schizosaccharomyces pombe. Accession numbers: AmHAK1, KIL65804;AmHAK2, KIL55965; AmHAK3, KIL55966; ApHAK1, MH281948; HcTrK1, CAL36606; HcTrK2, CAL36607;NcTrK1, CAA08813; NcHAK1, CAA08814; ScTrK1, CAA89424; ScTrK2, CAA82128; SoTrK1, CAB91046;SoHAK1, AAB17122; SpTrk1, CAA93300.

Sun et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 12

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

K-containing feldspar was used as an insoluble K source in this study, and the chemical compositionof the mineral tested by X-ray fluorescence was as follows: Si, 38.40%; O, 37.70%; K, 9.61%; Al, 8.62%; Na,2.31%; C, 1.88%; Ca, 0.65%; and Fe, 0.65%. The feldspar was mainly composed of high K-bearing albite(65.8%) and quartz (17.7%). Apatite was used as an insoluble P source and the chemical composition ofthe mineral tested by X-ray fluorescence was as follows: O, 77.35%; Ca, 11.10%; P, 6.09%; F, 1.58%; Mg,1.36%; Si, 1.33%; Al, 0.35%; Fe, 0.29%; Sr, 0.23%; K, 0.19%; S, 0.06%; I, 0.06%; and Y, 0.01%. Apatite ismainly composed of fluoroapatite (45.6%) and hydroxyapatite (41.2%). The mineral samples (75 to150 �m) were cleaned ultrasonically using alcohol for 30 min, subsequently washed three times withdeionized water, and then oven dried overnight at 60°C.

Cultivation and collection of A. pantherina. To reveal weathering-related genes and metabolicpathways of A. pantherina, we set up four different treatments: treatment ND, A. pantherina wasincubated on solid full-strength Pachlewski’s medium; treatment KD, A. pantherina was incubated onK-deficient Pachlewski’s medium that contained an equivalent amount of K in the form of feldspar;treatment PD, A. pantherina was incubated in Pachlewski’s medium with a low level of soluble P butcontaining an equivalent amount of P in the form of apatite; treatment KPD, A. pantherina was incubatedin K-deficient Pachlewski’s medium with a low level of soluble P but containing equivalent amounts ofK and P in the form of the feldspar and apatite. The detailed addition methods of K and P sources in eachtreatment of this experiment are shown in Table 3. Briefly, the mineral particles (1 g) were spread evenlyon agar plates (20 ml medium). Then, the agar plates were directly inoculated with round agar plugs(diameter, 0.5 cm) taken from the peripheral growth zone of actively growing fungal colonies grownon Pachlewski’s medium for 30 days inoculated in different treatments. The petri dishes (diameter9.0 cm) were sealed with Parafilm (Bemis, USA), and the fungus was allowed to grow in the dark at25°C for 30 days; then, fungal mycelia were scraped off the plate using a sterile scalpel, quicklyfrozen in liquid nitrogen, and stored in a refrigerator at �80°C. Each treatment in this study wasperformed in triplicate.

Construction of cDNA library, Illumina sequencing, and data analysis. Total RNA was extractedusing a Fungal Total RNA Isolation kit (Sangon Biotech, China), and the integrity and concentrationwere evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, USA). Total fungal RNA waspurified to obtain mRNA using oligo(dT) magnetic beads. The cDNA libraries were constructed usingan Illumina TruSeq RNA Sample Prep kit (Illumina, USA) according to the manufacturer’s protocol.The quality of the constructed cDNA libraries was examined on an Agilent Technologies 2100

FIG 8 The morphological characteristics of an aboveground fruiting body of A. pantherina 1 to 4 daysfollowing emergence.

TABLE 3 The details of K and P added in each treatmenta

Treatment K source (g/liter) P source (g/liter)

ND KH2PO4 (1.00) NAb

KD Feldspar (5.00) NaH2PO4·2H2O (1.15)PD K2SO4 (1.28) Apatite (5.00) � KH2PO4 (0.10)c

KPD Feldspar (5.00) Apatite (5.00) � NaH2PO4·2H2O (0.11)c

aThe particle size of mineral ranges from 75 to 150 �m.bNA, no addition of soluble P.cSince in our pre-experiments, A. pantherina was found to be unable to grow in the initial culture mediumwhere soluble P was completely absent but with apatite (data not shown), a low level of soluble P (one-tenth of the original, nondeficient level) was added to the PD treatment to ensure fungal growth.

Response of Amanita pantherina to Nutrient Deficiency Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 13

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Bioanalyzer prior to sequencing with Illumina HiSeq 2500 at Shanghai OE Biotechnology Co., Ltd.(Shanghai, China).

To ensure sequencing data quality, the original sequencing data were evaluated using FastQCversion 0.11.5 software (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). NGS QC TOOLKITv2.3.3 software (64) was then used to remove low-quality reads and adaptor reads. Reads with sequencescontaining the adaptor sequence, paired reads with the amount of N contained in single-end sequencingreads exceeding 35 bp, and paired reads with low-quality (Phred score, �20) base number of thesingle-end sequencing reads greater than 70% of the read length were thus excluded. The frequency ofremaining valid clean reads was 96.33%. Clean reads were assembled de novo using Trinity software (65).The assembled reads were clustered using the TGICL software (66) to yield unigenes that cannot beextended on either end, and redundancies were removed to acquire nonredundant unigenes. Fragmentsper kilobase of transcript per million mapped reads (FPKM) was used to calculate the gene expression.Therefore, FPKM values were directly used to compare gene expression differences between differentsamples. The DESeq package was used to obtain the “base mean” value to identify differentiallyexpressed genes (DEGs). In this study, a P value of �0.05, a fold change (FC) of �2 (|log2FC| � 1), anda base mean of �50 in at least one treatment were set as thresholds to define the significance of geneexpression differences between two treatments (Data Set S1). Unigenes were searched against theNational Center for Biotechnology Information (NCBI) nonredundant protein (Nr) database, the Swiss-Prot protein database (67), and the Eukaryotic Orthologous Groups (KOG) (68) using BLASTx algorithmwith an E value cutoff of 1E�5. The Blast2GO software was applied to get the annotation results ofunigenes in the Gene Ontology (GO) database (69). The pathways were also annotated according to theKEGG database (70).

Validation of weathering-related transcripts by RT-qPCR. In combination with GO and KEGGpathway enrichment analysis, genes supposed to be related to mineral weathering with the highestexpression level in the top five with annotated information in each treatment were determined byRT-qPCR in order to validate the reliability of DEG data generated by the Illumina RNA-seq (Table 2). TotalRNA was extracted from each sample, and the concentration was measured using a NanoDrop 2000spectrophotometer (Thermo Scientific, USA). The reverse transcription of RNA into cDNA was performedusing HiScript II Q RT SuperMix for qPCR (�gDNA wiper) kit (Vazyme Biotech, China). An AceQ qPCR SYBRGreen PCR master mix kit (Vazyme Biotech, China) was used for RT-qPCR reactions according to themanufacturer’s instructions. Parameters for the quantitative amplification using an ABI StepOne Real-Time PCR system (Applied Biosystems, USA) were as follows: 5 min at 95°C for enzyme activation and 40cycles of 95°C for 10 s and 60°C for 30 s. The housekeeping gene encoding glyceraldehyde 3-phosphatedehydrogenase (GAPDH) was used as an internal control for normalization. The gene expression levelwas determined using the threshold cycle (2�ΔΔCT) method proposed by Pfaffl (71). Primers used inRT-qPCR are listed in Table 4, designed by IDT (Coralville, IA, USA). Three commonly used internalreference genes in fungi were selected, encoding �-actin, �-tubulin, and GAPDH. After the analyses ofexpression stability and amplification efficiency, the expression level of the �-actin gene was found to berelatively stable under different conditions, and its amplification efficiency was the highest (103.18%);thus, it was selected as the internal reference gene in this study (see Fig. S6).

TABLE 4 Primers of genes used in this study

Gene

Primer sequence (5=¡3=)

Forward Reverse

ApADeH GGAGATAAGTAGCGTGGATGATAAG AGACTGCGTTGCTGGTATTTApCyt CCATGGATCTAACCTCCCTTTC CCGAGTCGTCTCCTTGATTATGApMtC TCACACTTGTTGTCCCTCTTATC GGTAGTGCCTCCAACATTTCTApPyTr GAGCACACTGAGGATACAGAAG GCCTTGATTGGATGTTGGTTGApPPO TGCAGTGGCGCATAGTAATAA GAGCGGCTTGTGAGGAATAAApSAH CAACGTTTCCAATCCCACTAAAG GCGAGAGGAGCTGAAGAATAAGApSeThK GACGATATGTGTCTGAACCTCTG CCGTGAACAGTCTCGTGATAAAApVITr TCAAACCCTCGGGCTATTTC AGAGCAACTACTCAGCCAATCApWD40 TTCGTTCCATCGCATTCTCTC TGTAATTCGGCACCAGTCTTTApZnF GCTAGGCATGTGAAGGAGATAC CTTTCGCTTAAGATGGGCATTGApHAK1 CGCCAGTCCATCGTTATTCA CGGGACAAGTCAAGGCATTAApHAK2 CGAGTTCCCCGAAATTGTCAG GTCCCCTTACCTTTCTCAGCApHAK3 CCATCAATGCATCACCAACG ATGAGACGTTTTCAGGACCCApHAK4 GCATTATCCCCGTCTACGATG ATCTCATTCGCCCTGTTCGApPT1 AATCAAGACCCCACGAACC GGCAAAGATAAGAGACACCCCApPT2 GCATTGTCAACTTCCGCTAAAG GTTCCTGTCCTTCCCTCTTTACApPT3 GTTGCTTTGGTAGTCGTTGC GGGATTGTGAGACGGAAATAGAGApPT4 TTTCCACACGAGACAACGAG TAGCTGCCCGAATAAAGTACCApPT5 TGGTACTTTCGGTCAAGCG TCTAACGGGCGAAAACTCAGApPT6 TTTACAACCACGCACCTAGAG GTTATCGTAGCAATCCTCGTCTCApPT7 AATCGTAGCCCCAAGTTTCC TGTCTACTTTCGTGATTCCAGG�-actin GCAAACCGTGAAAAGATGACC CCATCACCAGAGTCCAATACG�-tubulin CGACATTTGCTTCAGGACAC TTAAGTTGACCAGGGAAGCGGAPDH CACATTTGGGAAAGTCGTTCG TGGCTGGTGTTTTGCTTTTAC

Sun et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 14

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Mineralogical analysis. The structure and composition of minerals were determined using an X-raydiffractometer BTX-526 (Olympus, Japan) using Co-K� radiation with a voltage of 30 kV and current of300 �A (� � 1.79 Å).

Statistical analyses. The data are expressed as means � standard deviations (SDs) from threereplicates. The significances of data of RT-PCR and relative content of mineral were determined with ttests, using IBM SPSS Statistics 20.0 software.

Accession number(s). The raw sequencing reads were submitted to the NCBI Sequence ReadArchive (SRA) under the study number SRP134686, available at https://www.ncbi.nlm.nih.gov/sra/SRP134686.

SUPPLEMENTAL MATERIALSupplemental material for this article may be found at https://doi.org/10.1128/AEM

.00719-19.SUPPLEMENTAL FILE 1, PDF file, 0.7 MB.SUPPLEMENTAL FILE 2, XLSX file, 0.1 MB.

ACKNOWLEDGMENTSThis work was supported by the National Natural Science Foundation of China (grant

numbers 41772360 and 41373078).We declare no conflict of interest.

REFERENCES1. Raghothama KG, Karthikeyan AS. 2005. Phosphate acquisition. Plant Soil

274:37– 49. https://doi.org/10.1007/s11104-004-2005-6.2. Rodrı́guez-Navarro A. 2000. Potassium transport in fungi and plants.

Biochim Biophys Acta 1469:1–30. https://doi.org/10.1016/S0304-4157(99)00013-1.

3. Landeweert R, Hoffland E, Finlay RD, Kuyper TW, van Breemen N. 2001.Linking plants to rocks: ectomycorrhizal fungi mobilize nutrients fromminerals. Trends Ecol Evol 16:248 –254. https://doi.org/10.1016/S0169-5347(01)02122-X.

4. Smith SE, Read D. 2008. Mycorrhizal symbiosis, 3rd ed. Elsevier AcademicPress Inc., Amsterdam, Netherlands.

5. Cairney J. 2011. Ectomycorrhizal fungi: the symbiotic route to the rootfor phosphorus in forest soils. Plant Soil 344:51–71. https://doi.org/10.1007/s11104-011-0731-0.

6. Garcia K, Zimmermann SD. 2014. The role of mycorrhizal associations inplant potassium nutrition. Front Plant Sci 5:337. https://doi.org/10.3389/fpls.2014.00337.

7. Jentschke G, Brandes B, Kuhn AJ, Schröder WH, Godbold DL. 2001.Interdependence of phosphorus, nitrogen, potassium and magnesiumtranslocation by the ectomycorrhizal fungus Paxillus involutus. NewPhytol 149:327–337. https://doi.org/10.1046/j.1469-8137.2001.00014.x.

8. Plassard C, Dell B. 2010. Phosphorus nutrition of mycorrhizal trees. TreePhysiol 30:1129. https://doi.org/10.1093/treephys/tpq063.

9. Finlay R, Wallander H, Smits M, Holmstrom S, van Hees P, Lian B, RoslingA. 2009. The role of fungi in biogenic weathering in boreal forest soils.Fungal Biol Rev 23:101–106. https://doi.org/10.1016/j.fbr.2010.03.002.

10. Lindahl BD, Ihrmark K, Boberg J, Trumbore SE, Högberg P, Stenlid J,Finlay RD. 2007. Spatial separation of litter decomposition and mycor-rhizal nitrogen uptake in a boreal forest. New Phytol 173:611– 620.https://doi.org/10.1111/j.1469-8137.2006.01936.x.

11. Balogh-Brunstad Z, Keller CK, Dickinson JT, Stevens F, Li CY, Bormann BT.2008. Biotite weathering and nutrient uptake by ectomycorrhizal fungus,Suillus tomentosus, in liquid-culture experiments. Geochim CosmochimActa 72:2601–2618. https://doi.org/10.1016/j.gca.2008.04.003.

12. Glowa KR, Arocena JM, Massicotte HB. 2003. Extraction of potassiumand/or magnesium from selected soil minerals by Piloderma. Geomicro-biol J 20:99 –111. https://doi.org/10.1080/01490450303881.

13. Jansa J, Finlay R, Wallander H, Smith FA, Smith SE. 2011. Role of mycor-rhizal symbioses in phosphorus cycling, p 137–168. In Bünemann EK,Oberson A, Frossard E (ed), Soil biology, vol 26. Phosphorus in action:biological processes in soil phosphorus cycling. Springer-Verlag, Berlin,Germany.

14. Rosling A, Roose T, Herrmann AM, Davidson FA, Finlay RD, Gadd GM.2009. Approaches to modelling mineral weathering by fungi. Fungal BiolRev 23:138 –144. https://doi.org/10.1016/j.fbr.2009.09.003.

15. Wallander H. 2000. Uptake of P from apatite by Pinus sylvestris seedlings

colonised by different ectomycorrhizal fungi. Plant Soil 218:249 –256.https://doi.org/10.1023/a:1014936217105.

16. Garcia K, Delteil A, Conéjéro G, Becquer A, Plassard C, Sentenac H,Zimmermann S. 2014. Potassium nutrition of ectomycorrhizal Pinuspinaster: overexpression of the Hebeloma cylindrosporum HcTrk1 trans-porter affects the translocation of both K� and phosphorus in the hostplant. New Phytol 201:951–960. https://doi.org/10.1111/nph.12603.

17. Hoffland E, Giesler R, Jongmans AG, Breemen NV. 2003. Feldspar tun-neling by fungi along natural productivity gradients. Ecosystems6:739 –746. https://doi.org/10.1007/s10021-003-0191-3.

18. Jongmans AG, van Breemen N, Lundström U, van Hees PAW, Finlay RD,Srinivasan M, Unestam T, Giesler R, Melkerud PA, Olsson M. 1997.Rock-eating fungi. Nature 389:682– 683. https://doi.org/10.1038/39493.

19. Smits MM, Hoffland E, Jongmans AG, van Breemen N. 2005. Contributionof mineral tunneling to total feldspar weathering. Geoderma 125:59 – 69.https://doi.org/10.1016/j.geoderma.2004.06.005.

20. Gazzè SA, Saccone L, Smits MM, Duran AL, Leake JR, Banwart SA,Ragnarsdottir KV, McMaster TJ. 2013. Nanoscale observations of extra-cellular polymeric substances deposition on phyllosilicates by an ecto-mycorrhizal fungus. Geomicrobiol J 30:721–730. https://doi.org/10.1080/01490451.2013.766285.

21. Winkelmann G. 2007. Ecology of siderophores with special reference tothe fungi. Biometals 20:379 –392. https://doi.org/10.1007/s10534-006-9076-1.

22. van Hees PAW, Jones DL, Jentschke G, Godbold DL. 2004. Mobilization ofaluminium, iron and silicon by Picea abies and ectomycorrhizas in aforest soil. Eur J Soil Sci 55:101–112. https://doi.org/10.1046/j.1365-2389.2003.00581.x.

23. van Schöll L, Smits MM, Hoffland E. 2006. Ectomycorrhizal weathering ofthe soil minerals muscovite and hornblende. New Phytol 171:805– 814.https://doi.org/10.1111/j.1469-8137.2006.01790.x.

24. Griffiths RP, Baham JE, Caldwell BA. 1994. Soil solution chemistry ofectomycorrhizal mats in forest soil. Soil Biol Biochem 26:331–337.https://doi.org/10.1016/0038-0717(94)90282-8.

25. Paris F, Botton B, Lapeyrie F. 1996. In vitro weathering of phlogopite byectomycorrhizal fungi. Plant Soil 179:141–150. https://doi.org/10.1007/BF00011651.

26. Smits MM, Bonneville S, Benning LG, Banwart SA, Leake JR. 2012. Plant-driven weathering of apatite–the role of an ectomycorrhizal fungus. Geo-biology 10:445–456. https://doi.org/10.1111/j.1472-4669.2012.00331.x.

27. Bonneville S, Morgan DJ, Schmalenberger A, Bray A, Brown A, BanwartSA, Benning LG. 2011. Tree-mycorrhiza symbiosis accelerate mineralweathering: evidences from nanometer-scale elemental fluxes at thehypha-mineral interface. Geochim Cosmochim Acta 75:6988 –7005.https://doi.org/10.1016/j.gca.2011.08.041.

28. Xiao B, Lian B, Sun L, Shao W. 2012. Gene transcription response to

Response of Amanita pantherina to Nutrient Deficiency Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 15

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

weathering of K-bearing minerals by Aspergillus fumigatus. Chem Geol306-307:1–9. https://doi.org/10.1016/j.chemgeo.2012.02.014.

29. Xiao L, Hao J, Wang W, Lian B, Shang G, Yang Y, Liu C, Wang S. 2014. Theup-regulation of carbonic anhydrase genes of Bacillus mucilaginosusunder soluble Ca2� deficiency and the heterologously expressed en-zyme promotes calcite dissolution. Geomicrobiol J 31:632– 641. https://doi.org/10.1080/01490451.2014.884195.

30. Xiao L, Lian B, Hao J, Liu C, Wang S. 2015. Effect of carbonic anhydraseon silicate weathering and carbonate formation at present day CO2

concentrations compared to primordial values. Sci Rep 5:7733. https://doi.org/10.1038/srep07733.

31. Wang W, Sun Q, Lian B. 2018. Redox of fungal multicopper oxidase: apotential driving factor for the silicate mineral weathering. GeomicrobiolJ 35:879 – 886. https://doi.org/10.1080/01490451.2018.1485065.

32. Nehls U, Grunze N, Willmann M, Reich M, Küster H. 2007. Sugar for myhoney: carbohydrate partitioning in ectomycorrhizal symbiosis. Phy-tochemistry 68:82–91. https://doi.org/10.1016/j.phytochem.2006.09.024.

33. Corratgé C, Zimmermann S, Lambilliotte R, Plassard C, Marmeisse R,Thibaud JB, Lacombe B, Sentenac H. 2007. Molecular and functionalcharacterization of a Na�-K� transporter from the Trk family in theectomycorrhizal fungus Hebeloma cylindrosporumk. J Biol Chem 282:26057–26066. https://doi.org/10.1074/jbc.M611613200.

34. Nehls U, Plassard C. 2018. Nitrogen and phosphate metabolism inectomycorrhizas. New Phytol 220:1047–1058. https://doi.org/10.1111/nph.15257.

35. Casieri L, Ait Lahmidi N, Doidy J, Veneault-Fourrey C, Migeon A,Bonneau L, Courty PE, Garcia K, Charbonnier M, Delteil A, Brun A,Zimmermann S, Plassard C, Wipf D. 2013. Biotrophic transportome inmutualistic plant-fungal interactions. Mycorrhiza 23:597– 625. https://doi.org/10.1007/s00572-013-0496-9.

36. Tatry MV, El Kassis E, Lambilliotte R, Corratgé C, Van Aarle I, Amenc LK,Alary R, Zimmermann S, Sentenac H, Plassard C. 2009. Two differentiallyregulated phosphate transporters from the symbiotic fungus Hebelomacylindrosporum and phosphorus acquisition by ectomycorrhizal Pinuspinaster. Plant J 57:1092–1102. https://doi.org/10.1111/j.1365-313X.2008.03749.x.

37. Nehls U, Göhringer F, Wittulsky S, Dietz S. 2010. Fungal carbohydratesupport in the ectomycorrhizal symbiosis: a review. Plant Biol 12:292–301. https://doi.org/10.1111/j.1438-8677.2009.00312.x.

38. Hibbett DS, Gilbert LB, Donoghue MJ. 2000. Evolutionary instability ofectomycorrhizal symbioses in basidiomycetes. Nature 407:506 –508.https://doi.org/10.1038/35035065.

39. Kohler A, Kuo A, Nagy LG, Morin E, Barry KW, Buscot F, Canback B, ChoiC, Cichocki N, Clum A, Colpaert J, Copeland A, Costa MD, Dore J, FloudasD, Gay G, Girlanda M, Henrissat B, Herrmann S, Hess J, Hogberg N,Johansson T, Khouja HR, LaButti K, Lahrmann U, Levasseur A, LindquistEA, Lipzen A, Marmeisse R, Martino E, Murat C, Ngan CY, Nehls U, PlettJM, Pringle A, Ohm RA, Perotto S, Peter M, Riley R, Rineau F, Ruytinx J,Salamov A, Shah F, Sun H, Tarkka M, Tritt A, Veneault-Fourrey C, ZuccaroA, Mycorrhizal Genomics Initiative Consortium, et al. 2015. Convergentlosses of decay mechanisms and rapid turnover of symbiosis genes inmycorrhizal mutualists. Nat Genet 47:410 – 415. https://doi.org/10.1038/ng.3223.

40. Tedersoo L, May TW, Smith ME. 2010. Ectomycorrhizal lifestyle in fungi:global diversity, distribution, and evolution of phylogenetic lineages.Mycorrhiza 20:217–263. https://doi.org/10.1007/s00572-009-0274-x.

41. Stirnimann CU, Petsalaki E, Russell RB, Russell RB, Müller CW. 2010. WD40proteins propel cellular networks. Trends Biochem Sci 35:565–574.https://doi.org/10.1016/j.tibs.2010.04.003.

42. Dupont S, Lemetais G, Ferreira T, Cayot P, Gervais P, Beney L. 2012.Ergosterol biosynthesis: a fungal pathway for life on land? Evolution66:2961–2968. https://doi.org/10.1111/j.1558-5646.2012.01667.x.

43. Wang W, Lian B, Pan L. 2015. An RNA-sequencing study of the genesand metabolic pathways involved in weathering of potassium feld-spar. Geomicrobiol J 32:689 –700. https://doi.org/10.1080/01490451.2014.991812.

44. Drever JI, Stillings LL. 1997. The role of organic acids in mineral weath-ering. Colloids Surf A Physicochem Eng Asp 120:167–181. https://doi.org/10.1016/S0927-7757(96)03720-X.

45. Ek H. 1997. The influence of nitrogen fertilization on the carbon econ-omy of Paxillus involutus in ectomycorrhizal association with Betulapendula. New Phytol 135:133–142. https://doi.org/10.1046/j.1469-8137.1997.00621.x.

46. Ashford AE, Vesk PA, Orlovich DA, Markovina AL, Allaway WG. 1999.Dispersed polyphosphate in fungal vacuoles in Eucalyptus pilularis/Pisolithus tinctorius ectomycorrhizas. Fungal Genet Biol 28:21–33. https://doi.org/10.1006/fgbi.1999.1140.

47. Orlovich DA, Ashford AE. 1993. Polyphosphate granules are an artefactof specimen preparation in the ectomycorrhizal fungus Pisolithus tinc-torius. Protoplasma 173:91–102. https://doi.org/10.1007/BF01378998.

48. Wallander H, Pallon J. 2005. Temporal changes in the elemental com-position of Rhizopogon rhizomorphs during colonization of patches withfresh organic matter or acid-washed sand. Mycologia 97:295–303.https://doi.org/10.1080/15572536.2006.11832804.

49. Garcia K, Doidy J, Zimmermann SD, Wipf D, Courty PE. 2016. Take a tripthrough the plant and fungal transportome of mycorrhiza. Trends PlantSci 21:937–950. https://doi.org/10.1016/j.tplants.2016.07.010.

50. Wang J, Li T, Wu X, Zhao Z. 2014. Molecular cloning and functionalanalysis of a H�-dependent phosphate transporter gene from the ecto-mycorrhizal fungus Boletus edulis in southwest China. Fungal Biol 118:453– 461. https://doi.org/10.1016/j.funbio.2014.03.003.

51. Lapeyrie F, Ranger J, Vairelles D. 1991. Phosphate-solubilizing activity ofectomycorrhizal fungi in vitro. Can J Bot 69:342–346. https://doi.org/10.1139/b91-046.

52. Wallander H, Fossum A, Rosengren U, Jones H. 2005. Ectomycorrhizalfungal biomass in roots and uptake of P from apatite by Pinus sylvestrisseedlings growing in forest soil with and without wood ash amendment.Mycorrhiza 15:143–148. https://doi.org/10.1007/s00572-004-0312-7.

53. Frey-Klett P, Chavatte M, Clausse ML, Courrier S, Le Roux C, Raaij-makers J, Martinotti MG, Pierrat JC, Garbaye J. 2004. Ectomycorrhizalsymbiosis affects functional diversity of rhizosphere fluorescent pseu-domonads. New Phytol 165:317–328. https://doi.org/10.1111/j.1469-8137.2004.01212.x.

54. Liu Y, Sun Q, Li J, Lian B. 2018. Bacterial diversity among the fruit bodiesof ectomycorrhizal and saprophytic fungi and their corresponding hy-phosphere soils. Sci Rep 8:11672. https://doi.org/10.1038/s41598-018-30120-6.

55. Uroz S, Calvaruso C, Turpault MP, Pierrat JC, Mustin C, Frey-Klett P. 2007.Effect of the mycorrhizosphere on the genotypic and metabolic diversityof the bacterial communities involved in mineral weathering in a forestsoil. Appl Environ Microbiol 73:3019 –3027. https://doi.org/10.1128/AEM.00121-07.

56. Calvaruso C, Turpault M-P, Leclerc E, Ranger J, Garbaye J, Uroz S,Frey-Klett P. 2010. Influence of forest trees on the distribution of mineralweathering-associated bacterial communities of the scleroderma citri-num mycorrhizosphere. Appl Environ Microbiol 76:4780 – 4787. https://doi.org/10.1128/AEM.03040-09.

57. Fontaine L, Thiffault N, Pare D, Fortin JA, Piche Y. 2016. Phosphate-solubilizing bacteria isolated from ectomycorrhizal mycelium of Piceaglauca are highly efficient at fluorapatite weathering. Botany 94:1183–1193. https://doi.org/10.1139/cjb-2016-0089.

58. Bañuelos MA, Madrid R, Rodríguez-Navarro A. 2002. Individual functionsof the HAK and TRK potassium transporters of Schwanniomyces occiden-talis. Mol Microbiol 37:671– 679. https://doi.org/10.1046/j.1365-2958.2000.02040.x.

59. Haro R, Sainz L, Rubio F, Rodríguez-Navarro A. 1999. Cloning of twogenes encoding potassium transporters in Neurospora crassa andexpression of the corresponding cDNAs in Saccharomyces cerevisiae.Mol Microbiol 31:511–520. https://doi.org/10.1046/j.1365-2958.1999.01192.x.

60. Nagahashi G, Douds DD, Jr. 2011. The effects of hydroxy fatty acids onthe hyphal branching of germinated spores of AM fungi. Fungal Biol115:351. https://doi.org/10.1016/j.funbio.2011.01.006.

61. Maillet F, Poinsot V, André O, Puech-Pagès V, Haouy A, Gueunier M,Cromer L, Giraudet D, Formey D, Niebel A, Martinez EA, Driguez H,Bécard G, Dénarié J. 2011. Fungal lipochitooligosaccharide symbioticsignals in arbuscular mycorrhiza. Nature 469:58 – 63. https://doi.org/10.1038/nature09622.

62. Rasmussen SR, Füchtbauer W, Novero M, Volpe V, Malkov N, Genre A,Bonfante P, Stougaard J, Radutoiu S. 2016. Intraradical colonizationby arbuscular mycorrhizal fungi triggers induction of a lipochitooli-gosaccharide receptor. Sci Rep 6:29733. https://doi.org/10.1038/srep29733.

63. Xiao L, Sun Q, Lian B. 2016. A global view of gene expression ofAspergillus nidulans on responding to the deficiency in soluble potas-sium. Curr Microbiol 72:410 – 419. https://doi.org/10.1007/s00284-015-0963-y.

Sun et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 16

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

64. Patel RK, Jain M. 2012. NGS QC toolkit: a toolkit for quality control of nextgeneration sequencing data. PLoS One 7:e30619. https://doi.org/10.1371/journal.pone.0030619.

65. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I,Adiconis X, Fan L, Raychowdhury R, Zeng Q, Chen Z, Mauceli E, HacohenN, Gnirke A, Rhind N, di Palma F, Birren BW, Nusbaum C, Lindblad-Toh K,Friedman N, Regev A. 2011. Trinity: reconstructing a full-length tran-scriptome without a genome from RNA-Seq data. Nat Biotechnol 29:644.https://doi.org/10.1038/nbt.1883.

66. Pertea G, Huang X, Liang F, Antonescu V, Sultana R, Karamycheva S, LeeY, White J, Cheung F, Parvizi B, Tsai J, Quackenbush J. 2003. TIGR GeneIndices clustering tools (TGICL): a software system for fast clustering oflarge EST datasets. Bioinformatics 19:651– 652. https://doi.org/10.1093/bioinformatics/btg034.

67. Boeckmann B, Bairoch A, Apweiler R, Blatter M-C, Estreicher A, GasteigerE, Martin MJ, Michoud K, O’Donovan C, Phan I, Pilbout S, Schneider M.2003. The SWISS-PROT protein knowledgebase and its supplement

TrEMBL in 2003. Nucleic Acids Res 31:365–370. https://doi.org/10.1093/nar/gkg095.

68. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV,Krylov DM, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS, SmirnovS, Sverdlov AV, Vasudevan S, Wolf YI, Yin JJ, Natale DA. 2003. The COGdatabase: an updated version includes eukaryotes. BMC Bioinformatics4:41. https://doi.org/10.1186/1471-2105-4-41.

69. Conesa A, Gotz S, Garcia-Gomez JM, Terol J, Talon M, Robles M. 2005.Blast2GO: a universal tool for annotation, visualization and analysis infunctional genomics research. Bioinformatics 21:3674 –3676. https://doi.org/10.1093/bioinformatics/bti610.

70. Ogata H, Goto S, Sato K, Fujibuchi W, Bono H, Kanehisa M. 1999. KEGG:Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res 27:29 –34.https://doi.org/10.1093/nar/27.1.29.

71. Pfaffl MW. 2001. A new mathematical model for relative quantification inreal-time RT–PCR. Nucleic Acids Res 29:e45. https://doi.org/10.1093/nar/29.9.e45.

Response of Amanita pantherina to Nutrient Deficiency Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00719-19 aem.asm.org 17

on October 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from