transcriptome analysis of escherichia coli o157:h7 exposed ... · transcriptome analysis of...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 2010, p. 1375–1387 Vol. 76, No. 50099-2240/10/$12.00 doi:10.1128/AEM.02461-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Transcriptome Analysis of Escherichia coli O157:H7Exposed to Lysates of Lettuce Leaves�

Jennifer L. Kyle, Craig T. Parker, Danielle Goudeau, and Maria T. Brandl*Produce Safety and Microbiology Research Unit, Western Regional Research Center, Agricultural Research Service,

U.S. Department of Agriculture, Albany, California 94710

Received 9 October 2009/Accepted 28 December 2009

Harvesting and processing of leafy greens inherently cause plant tissue damage, creating niches on leavesthat human pathogens can exploit. We previously demonstrated that Escherichia coli O157:H7 (EcO157)multiplies more rapidly on shredded leaves than on intact leaves (M. T. Brandl, Appl. Environ. Microbiol.74:5285–5289, 2008). To investigate how EcO157 cells adapt to physicochemical conditions in injured lettucetissue, we used microarray-based whole-genome transcriptional profiling to characterize gene expressionpatterns in EcO157 after 15- and 30-min exposures to romaine lettuce lysates. Multiple carbohydrate transportsystems that have a role in the utilization of substrates known to be prevalent in plant cells were activated inEcO157. This indicates the availability to the human pathogen of a variety of carbohydrates released frominjured plant cells that may promote its extensive growth in leaf lysates and, thus, in wounded leaf tissue. Inaddition, microarray analysis revealed the upregulation of numerous genes associated with EcO157 attach-ment and virulence, with oxidative stress and antimicrobial resistance (including the OxyR and Mar regulons),with detoxification of noxious compounds, and with DNA repair. Upregulation of oxidative stress and antimi-crobial resistance genes in EcO157 was confirmed on shredded lettuce by quantitative reverse transcription-PCR. We further demonstrate that this adaptation to stress conditions imparts the pathogen with increasedresistance to hydrogen peroxide and calcium hypochlorite. This enhanced resistance to chlorinated sanitizerscombined with increased expression of virulence determinants and multiplication at sites of injury on theleaves may help explain the association of processed leafy greens with outbreaks of EcO157.

Leafy vegetables are the second most common vehicleassociated with outbreak-related cases of food-borne illnessin the United States. Indeed, Escherichia coli O157:H7(EcO157) infections are increasingly linked to leafy pro-duce, with 27 outbreaks of EcO157-associated disease be-tween 1995 and 2008 (44; www.michigan.gov/documents/mda/ecoli_253034_7.pdf). Infection with EcO157 is ofparticular concern due to its potential to cause severe dis-ease; 6 of 11 deaths related to food-borne illness in 2006were linked to this bacterium, even though only 2% of allreported food-borne illnesses were attributed to EcO157that year (13). Of the documented outbreaks associated withEcO157 between 1991 and 2002, more than half (61%) wereassociated with either lettuce, salad, or coleslaw (57). Sincethen, several large outbreaks of EcO157 infection have oc-curred related to contaminated bagged spinach, and bag-ged Iceberg and romaine lettuce (12, 13; www.michigan.gov/documents/mda/ecoli_253034_7.pdf; www.doh.wa.gov/Publicat/2008_news/08-092.htm). The relative importance of preharvest topostharvest contamination, as well as the factors that allowEcO157 to persist in a nonhost environment such as leafyvegetables, remain unclear. Although increased processing ofproduce to meet rising consumer demand has potentiallycontributed to the emergence of EcO157 outbreaks (64), this

alone cannot account for the 38.6% increase in the proportionof outbreaks associated with leafy greens from 1996 to 2005,whereas the consumption of leafy greens increased only 9%(28).

We have previously reported that the growth rate of EcO157at 28°C on lettuce leaves over short periods of time increasedwith the severity of tissue damage inflicted by various mechan-ical means (8). Notably, in only 4 h, cell populations of EcO157increased 11-fold on shredded lettuce compared to 2-fold onintact lettuce leaves. This indicated that contamination with asingle cell of the pathogen theoretically could lead to an infec-tious dose on shredded lettuce in this short period of time, if asfew as 10 cells are required for this pathogen to cause illness inhumans (http://www.cfsan.fda.gov/�ebam). The survival andgrowth of EcO157 in the wounds of lettuce leaf tissue willgreatly depend on its ability to adapt to physicochemical con-ditions, such as changes in matric and osmotic water potentialand in substrate availability, as well as the presence of inhibi-tory compounds released passively or actively by the planttissue. Although the pathogen may benefit from the release ofnutrients from the lysed plant cells and may find physical pro-tection within the broken tissue, other factors brought about bythe plant response to mechanical injury and microbial coloni-zation of the wound site may dictate the outcome of a contam-ination event at the wound site. Mechanical plant injury in-duces several biochemical and signaling pathways involved inthe local and systemic wound response (31, 39). These includesecondary metabolism pathways leading to the synthesis ofantimicrobial compounds such as flavanoids, alkaloids, ali-phatic acids, and phenylpropanoids that accumulate at andaround the wound site and may retard the growth of microbial

* Corresponding author. Mailing address: Produce Safety and Mi-crobiology Research Unit, Western Regional Research Center, Agri-cultural Research Service, U.S. Department of Agriculture, Albany,CA 94710. Phone: (510) 559-5885. Fax: (510) 559-6162. E-mail: [email protected].

� Published ahead of print on 8 January 2010.

1375

on January 14, 2021 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

colonists (14, 21, 58). Upon wounding, plants produce an ox-idative burst that generates reactive oxygen and nitrogen spe-cies, including superoxide (O2

�) and hydrogen peroxide(H2O2) (42, 49) and nitric oxide (NO) (26, 32).

Despite increasing evidence of the enhanced attachment,survival, and growth of EcO157 on cut surfaces of processedlettuce, even after treatment with traditional sanitizers, there islittle understanding of the physiological response of the patho-gen to conditions encountered in damaged plant tissue. Knowl-edge of the molecular events that drive the adaptation ofEcO157 and its metabolism at these sites may provide insightnot only into the factors that enhance its survival but also intopotential biochemical pathways to target for inhibition of thepathogen with hurdle technologies. In the present study, weinvestigated the transcriptional profile of EcO157 in ro-maine lettuce leaf lysates with the aim of characterizing theresponse of the pathogen to the chemical conditions inwounded lettuce tissue and better understand its behavior inminimally processed lettuce. We demonstrate here that shortlyafter being exposed to lettuce lysate, EcO157 upregulates mul-tiple virulence and motility genes and shifts a great part of itsmetabolism to enable it to survive oxidative stress, osmoticstress, and the effect of antimicrobial or toxic plant com-pounds. In addition, we show that this adaptation to the presenceof reactive oxygen species resulting from damaged plant cellsimparts the pathogen with increased resistance to two sanitizers,namely, hydrogen peroxide and calcium hypochlorite.

MATERIALS AND METHODS

Preparation and inoculation of lettuce juice lysates and shredded lettuce.Romaine lettuce, Lactuca sativa Cos, obtained from commercial suppliers wasused for all experiments described herein. Leaves that were positioned in themiddle of the rosette and were external to the tightly closed head of the romainelettuce were used. These represented approximately the eleventh to the fifteenthleaf in age and are named hereafter “middle leaves.” Although young romainelettuce leaves support great population sizes of EcO157, as previously reportedby Brandl and Amundson (9), middle leaves are more similar physiologically andthus were likely to generate less variability between leaves as well as betweenlettuce heads in the chemical composition of the lysates. The middle leaves wererapidly crushed by hand using a mortar and pestle and immediately filteredthrough an 8-�m-pore-size filter (grade 40, Ashless; Whatman). The filtrate wascentrifuged at 12,000 � g for 5 min to pellet chloroplasts and plant debris. Formicroarray analysis, quantitative reverse transcription-PCR (QRT-PCR) andmeasurement of reactive oxygen species, the leaf lysate supernatant was usedimmediately after centrifugation. For growth curve experiments in lettuce leaflysate, the supernatant was sterilized by passage through a 0.45-�m-pore-sizesyringe filter (Fisherbrand). To quantify the growth and gene expression inEcO157 cells exposed to wounded lettuce tissue per se, lettuce leaves were finelyshredded into 2-mm wide strips with a serrated knife and then cut again cross-wise, resulting in lettuce pieces of �4 mm2. This fine shredding ensured that agreat part of the tissue that the pathogen was exposed to was indeed damagedtissue.

Bacterial strains and growth conditions. A spontaneous rifampin-resistantmutant of Escherichia coli O157:H7 strain EDL933 (ATCC 43895) was selectedfrom Luria-Bertani (LB) agar plates containing 100 �g of rifampin (MP Bio-medicals)/ml, incubated at 37°C, and designated MB211. Strain EDL933 grewand survived in shredded lettuce very similarly to EcO157 strain H1827, thecausal agent of a lettuce-linked outbreak (8; data not shown). Gene knockoutmutants of E. coli O157:H7 strain MB211 were generated by using the � redrecombinase system (20) by replacing the target gene in strain MB211 with akanamycin resistance cassette (Table 1). Bacterial strains expressing the greenfluorescent protein (GFP) were constructed by transformation with the plasmidpGT-KAN, as described previously (10). For growth curves and inoculation ontolettuce or into lettuce leaf lysates, all strains were grown overnight in M9 minimalmedium supplemented with 0.2% glucose (M9-glucose) and 100 �g of ri-fampin/ml on a rotary shaker at 28°C.

For growth curve experiments conducted in lettuce leaf lysates, overnightcultures were first washed twice with potassium phosphate buffer (10 mM, pH7.0; KP buffer) before transfer to the freshly prepared lysate. For experimentsmeasuring early gene expression in lettuce leaf lysate (by microarray and QRT-PCR) or on shredded lettuce (by QRT-PCR), overnight cultures were trans-ferred to fresh M9-glucose and grown for several hours into the mid-log phase ofgrowth at 28°C and 150 rpm and then washed twice with KP buffer beforeinoculation. The lysates were inoculated with EcO157 cells in the mid-log phaseof growth in minimal medium in order to isolate the bacterial responses toromaine lettuce lysates from changes in gene expression solely caused by thetransition out of stationary phase (6). Lysates were inoculated at 5 � 106 CFU/mlfor growth experiments and at 108 CFU/ml for microarray analysis and QRT-PCR and then incubated at 28°C with shaking at 150 rpm. In order to evaluategene expression in EcO157 in lettuce lysates, samples for RNA extraction andsubsequent microarray or QRT-PCR analysis were taken at 15 or 30 min afterexposure of mid-log-phase EcO157 cells to freshly prepared lysates. Short incu-bation periods in the lysates at 28°C were used in order to characterize the earlyresponse of the pathogen to fluids leaking out of leaf cells after injury occurred,at an ambient daytime temperature that would be present in the field duringgrowth and harvesting, or during processing under conditions that would fail tomaintain cool temperatures. Two and three replicate suspensions in lysates wereprepared for growth curves and for microarray analysis and QRT-PCR, respec-tively. All experiments were performed in duplicate with different lettuce headsand inocula on separate days.

For comparative growth studies of the parental and mutant strains on shred-ded lettuce and for collection of bacterial RNA to perform QRT-PCR, samplesconsisted of 10 and 100 g, respectively. All samples were inoculated at 5 � 106

CFU/g and incubated at 28°C for 30 min. The bacteria were then recovered fromthe shredded lettuce by stomaching as described below and either dilution platedto measure population sizes or handled for subsequent RNA extraction andQRT-PCR. Two replicate bags of shredded lettuce were prepared for the aboveexperiments and three replicate wells per RNA sample (i.e., per replicate bag)were used to perform QRT-PCR and compute mean gene expression ratios.

Recovery and measurement of bacterial populations. Samples of EcO157suspensions in lettuce lysates were diluted in 10 mM KP buffer, dilution-platedimmediately with an automated plater (Autoplate 4000; Spiral Biotech) onto LBagar containing 100 �g of rifampin/ml, and the plates were incubated overnightat 37°C. For shredded lettuce, 100 ml of KP buffer was added to each bag, whichthen was placed in a stomacher (Seward) on high for 2 min. The resulting leafwashings were dilution plated as described above to estimate population sizes ofthe pathogen and mutants or were immediately filtered with a 20-�m-pore-sizenylon filter (Millipore) to remove plant debris and collect bacterial cells for RNAextraction in the filtrate.

RNA extraction procedures and QRT-PCR. Ice-cold phenol-ethanol (5%:95%) solution was immediately added to suspensions in leaf lysates or to filteredleaf washings, and the mixture was incubated on ice for 30 to 60 min. The cellswere then centrifuged, and the pellet was stored at �80°C. RNA extraction wasperformed with the Promega SV Total RNA kit according to the manufacturer’sinstructions, except that bacterial pellets were first treated with 50 mg of ly-sozyme (Fisherbrand)/ml and 1 U of anti-RNase (Ambion)/�l. Total RNA wasquantified with a Nanodrop ND 1000 spectrophotometer (Thermo Scientific),examined for quality on an Agilent Bioanalyzer, and stored at �80°C until usedfor microarray analysis or QRT-PCR. Before QRT-PCR, total bacterial RNAwas treated with Turbo DNase I (Ambion), and the absence of DNA wasconfirmed by QRT-PCR in the absence of reverse transcriptase using primers forgyrB (Table 2). All QRT-PCR was performed with a Brilliant II SYBR green

TABLE 1. Bacterial strains examined in this study

Strain Genotypea Source

MB211 E. coli O157:H7 EDL933,spontaneous Rifr

This study

MB630 MB211 marA::kan, Rifr Kanr This studyMB634 MB211 marR::kan, Rifr Kanr This studyMB648 MB211 nemA::kan, Rifr Kanr This studyMB650 MB211 nemR::kan, Rifr Kanr This studyMB652 MB211 ycfR::kan, Rifr Kanr This studyMB654 MB211 yqhD::kan, Rifr Kanr This studyMB657 MB211 oxyR::kan, Rifr Kanr This study

a Rifr, rifampin resistance; Kanr, kanamycin resistance.

1376 KYLE ET AL. APPL. ENVIRON. MICROBIOL.


.asm.org/

Dow

nloaded from

http://aem.asm.org/

QRT-PCR 1-Step kit (Stratagene) on an MxPro 3000P Cycler (Stratagene). Foreach gene, the ratio of expression in EcO157 in the lysates or on shredded lettucecompared to that in M9 culture was normalized to the expression of gyrB basedon the equation by Pfaffl in 2001 (52a). Lysates were tested for the presence oflettuce RNA by using the forward primer 5�-ATCTGCGGACAACCAATGAG-3� and the reverse primer 5�-CACTAAAACGGGGAGGAATG -3� directedto the L. sativa chloroplast RNA polymerase beta subunit RNA (GenBankAccession YP_398317). Only insignificant amounts of lettuce RNA were de-tected; these were estimated to have minimal effect on calculated expressionratios of EcO157 genes.

Microarray procedures. Microarray procedures for gene expression profilingwere based on previously described methods (15, 25, 41, 72). Briefly, PCRproducts were spotted onto Ultra-GAPS glass slides (Corning) by using anOmniGrid Accent arrayer (GeneMachines), and DNA was cross-linked to theslides via UV radiation. Each array contained 4,262 open reading frames (ORFs)from E. coli K-12 strain MG1655 supplemented with the 1,125 ORFs from E. coliO157:H7 strain EDL933 (including 25 from plasmid pO157) that are not presenton the K-12 genome, similar to a previously published array design (41). Thecoding portion of the EcO157 chromosome, including the 25 protein-codinggenes found on the pO157 plasmid, was examined (4,745 ORFs). Microarrayanalysis was based on competitive hybridization between Cy5-DNA and Cy3-cDNA. Genomic DNA (2 �g) was labeled via dye incorporation of Cy5-dCTP(GE Healthcare) using Klenow fragment (New England Biolabs). Total RNA(20 �g) from each experimental condition and each biological replicate waslabeled via incorporation of Cy3-dCTP (GE Healthcare) into a cDNA productwith the Fairplay III microarray labeling kit (Stratagene), based on previouslydescribed methods (15, 25, 41). Hybridization of Cy5-DNA and Cy3-cDNA wascarried out overnight at 42°C as previously described (15, 25, 41). After hybrid-ization, the slides were scanned on a GenePix 4000B scanner (Axon Instruments;Molecular Devices), and individual spots were analyzed with GenePix Pro 6.0software (Axon Instruments). Normalization was conducted as previously de-scribed (72). Briefly, spots with a reference signal lower than background plustwo standard deviations or spots covered by an obvious blemish were excluded.Local background was subtracted from all spots, and a Cy3/Cy5 ratio was calcu-lated. Further normalization to account for differences in dye incorporationincluded data centering by setting the median natural logarithm to zero for eachgroup of spots in one sector (printed by one pin).

Three biological replicates were collected for each experimental condition ontwo separate days for a total of six replicates, and three separate arrays ondifferent slides of were hybridized for each biological replicate (technical repli-cates). Technical replicates were analyzed for outliers with the Dixon “Q” test(23) using a critical value of 0.1, and values lying outside of the cutoff werediscarded. All remaining technical replicate values were averaged to obtain thevalue for each biological replicate, and the data from all six biological replicateswere further tested by using an unpaired t test with unequal variance usingGenespring 10 (Agilent/Stratagene). Genes showing a �2-fold upregulation ordownregulation and a Benjamini-Hochberg false discovery rate-adjusted P valueof �0.05 were considered to be differentially regulated in leaf lysates compared

to M9 cultures. The expression of a subset of genes of interest was confirmed byQRT-PCR.

Measurement of reactive oxygen species and challenge with H2O2 or calciumhypochlorite. Lettuce leaf lysates were tested for the presence of reactive oxygenspecies. Amplex Red (N-acetyl-3,7-dihydroxyphenoxazine; Invitrogen) wasadded to the lysates at a final concentration of 50 �M in order to detect andquantify H2O2 by measuring the increase in fluorescence at 590 nm after exci-tation at 530 nm (45, 75), using a Synergy HT spectrofluorometer (BioTek) aftera 30-min incubation of the assay reaction. All assays were carried out in duplicateby using clear-bottom, black-sided, 96-well assay plates (Corning). A standardcurve was prepared with 3% certified H2O2 (Fisherbrand) in 50 mM KP bufferand 1 U of horseradish peroxidase (HRP; MP Biomedicals)/liter. Blank fluores-cence measurements were taken from wells containing only buffer, Amplex Red,and HRP; this fluorescence value was set to zero for the standard curve. Theconcentration of H2O2 in lettuce leaf lysates was then estimated based on abest-fit linear regression line generated with the Gen5 Software, version 1.01.9(BioTek). Catalase (Sigma) was added at 2 mg/ml to a subset of wells in order toconfirm the specificity of H2O2 detection; an 83 to 89% reduction in H2O2

concentration was noted, compared to the 62 to 63% reported previously (45).Studies of EcO157 survival to H2O2 were conducted in a solution of 8 mM

H2O2 (in 0.5 mM KP buffer) at 28°C and 150 rpm. Challenge studies with calciumhypochlorite (Spectrum) were conducted in distilled deionized water, and thelevel of total and free chlorine was assessed as 4 and 2ppm, respectively, basedon the Aquacheck test (Hach). After a 5-min exposure of the bacterial cells tochlorine, free chlorine was neutralized by the addition of a solution of sodiumthiosulfate at a final concentration of 0.1% (wt/vol) (59), and the suspension wasdilution plated onto LB agar containing 100 �g of rifampin/ml to measure thesurviving bacterial population sizes.

RESULTS

Growth of EcO157 in lysates of romaine lettuce juice. Wepreviously reported that EcO157 multiplied faster on damagedlettuce leaves than on intact leaves, with greater growth cor-responding to greater leaf damage (8). In order to create auniform experimental condition that would reflect the chemi-cal environment encountered in microsites at the cut surface ofthe leaves, the response of EcO157 to romaine lettuce lysateswas tested. Over a period of 24 h, the growth pattern ofEcO157 in the lysates was similar to that observed in M9-glucose (Fig. 1). After inoculation into the lettuce lysates,EcO157 cell concentrations remained stable for the first 4 to5 h of incubation, after which the pathogen multiplied with adoubling time of 1.2 h to achieve a concentration of ca. 2 � 109

TABLE 2. RT-PCR oligonucleotide primers

GenePrimer sequence (5�–3�)

Source or referenceForward Reverse

ahpF GCAGATTCGCCATATTGACG GCCCTGACCAAACTCTTTCC This studygloA ACTCACTGGCGTTTGTTGG GACCGGCGTCTTTCTCTTC This studygrxA CGGGTTGCCCTTACTGTG CGGGTTTACCTGCCTTTTG This studygyrB GCAAGCCACGCAGTTTCTC GGAAGCCGACCTCTCTGATG This studyhslO TGCAGGCGGTATGTTGTTG CGTTGTTGCGGATTTCAGC This studykatP CGGGAAACTTCAGAAACCTC GCCACAGTCTCCTCATCATC This studymarA CGAGGACAACCTGGAATCAC TGCGGCGGAACATCAAAG 18marR CGCGGCGTGTATTACTCC GGTTCGGCAACCTTTCTACC This studynemA GATTTCCGTCAGGCTATTGC CGCGTTTACCCAGTTGTTC This studynemR CCATTACGCCACATATCACC TATCACGGCCATTTTCCAG This studyoxyS GAGCGGCACCTCTTTTAACCCTTG CCTGGAGATCCGCAAAAGTTCACG 56soxS GTCGTCGCAAAAAAATCAGG TGGGAGTGCGATCAAACTG This studyycfR TAAGCTCCATGTCATTTGCC TTCCATGGAGGGTATTCGG This studyyfiA GACGCCACAATCAATACACC CGTCTTTCACCGATGTTGC This studyyqhC CGCGTGTTTCGTTATGATGC TTCGCGGATGATCTGTTTG This studyyqhD GGCAGCGTGAAAAAAACCG AACCCCCAGCAGGAAAGTC This study

VOL. 76, 2010 TRANSCRIPTOME OF O157:H7 EXPOSED TO LETTUCE LYSATE 1377


.asm.org/

Dow

nloaded from

http://aem.asm.org/

cells/ml in stationary phase (Fig. 1). The 4- to 5-h lag phase andperiod of adaptation in the lysates was observed whether theinoculum cells were prepared from mid-log-phase or station-ary-phase cultures in M9-glucose (Fig. 1). The final concentra-tion of EcO157 in lettuce lysates after 24 h of incubation at28°C was very similar to that in M9-glucose under the sameconditions.

Transcriptional response of EcO157 to lettuce lysates. Theglobal transcriptional response of EcO157 to romaine lettucelysates was assessed at 15 and 30 min postinoculation in com-parison to that of cells in the mid-log phase of growth inM9-glucose medium. At both sampling times, one-fifth of thegenome showed differential expression of at least twofold (P �0.05). At 15 min, 10.3% (487/4,745) and 11.3% (534/4,745) ofthe genes were upregulated and downregulated, respectively;similarly, 10.4% (494/4,745) and 9.4% (448/4,745) of the geneswere upregulated and downregulated, respectively, at 30 min(Fig. 2). Differentially regulated genes were categorized byClusters of Orthologous Groups (COG) designations, and thepercentage of genes differentially regulated in each categorywas compared to the overall percentage at each time point(Fig. 2). Categories that showed a notable over-representationof upregulated genes at both time points included those relatedto cell motility, intracellular trafficking and secretion, andnumerous genes lacking a COG designation (unclassified).Among the notable categories of genes that were downregu-lated in the lysates was a large number of genes associated withamino acid and nucleic acid transport and metabolism, as sug-gested by the disproportionate downregulation of their respec-tive COG categories (Fig. 2).

(i) Induction of flagellar machinery, TTS, and fimbrialgenes. Differentially expressed genes with a COG designationfor cell motility or secretion included both flagellar and fim-

brial genes, as well as structural genes for two separate type IIIsecretion systems (Table 3). The locus of enterocyte efface-ment (LEE) pathogenicity island associated with attaching-and-effacing lesions in both enteropathogenic and enterohem-orrhagic E. coli has been divided into five separate operonsdesignated LEE1, LEE2, LEE3, LEE5, and LEE4 (36). Alarge number of the structural genes that encode the type IIIsecretion (TTS) apparatus were upregulated in response tolettuce lysates (Table 3). The LEE effector proteins are locatedprimarily in the LEE4 operon, and the genes for these proteinshave been reported to be constitutively transcribed in EcO157(61). Nevertheless, one of these genes, espF, was differentiallyexpressed in our two test conditions (Table 3). A second TTSapparatus is encoded by EcO157 that has homology to theSalmonella pathogenicity island I (43); the structural genes inthis second TTS system were also upregulated in response tolettuce lysates (Table 3). Recently, a survey of the EcO157genome has identified 49 additional potential effector proteins(65). Of these putative effectors, nine were expressed at higherlevels in lettuce lysates than M9-glucose conditions, althoughthree of these nine may be pseudogenes (65). Finally, underthis category, a number of genes involved in cell motility (che,fhi, flg, flh, and fli) and/or adhesion (fim and others) had in-creased transcription compared to that in M9-glucose(Table 3).

(ii) Induction of stress-responsive genes. Analysis of theEcO157 transcriptional profile also revealed that several genesinvolved in oxidative stress, osmotic stress, and antimicrobialresistance were upregulated significantly (Table 3 and Fig. 3).E. coli, including EcO157, senses hydrogen peroxide primarily

FIG. 1. Growth of EcO157 in M9-glucose medium and romainelettuce lysates. All inoculum cells were grown in M9-glucose. Freshlyprepared lettuce lysates were inoculated with stationary-phase cellsgrown overnight (f) or with cells in the mid-log phase of growth (�).As a reference for growth rate, stationary-phase cells were inoculatedalso into M9-glucose (Œ). The data represent the mean cell concen-trations of two replicate cultures. Error bars represent one standarddeviation of the mean.

FIG. 2. Grouping into functional categories of differentially regu-lated genes in ECO157 in romaine lettuce lysates compared to M9-glucose medium, as determined by microarray analysis. The categoriesof orthologous genes (COG) were used for grouping. Bars representthe percentage of genes with decreased or increased expression in agiven category after a 15-min or a 30-min exposure to lettuce lysates.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

TABLE 3. EcO157 regulons and virulence factors upregulated in lettuce lysates as determined by microarray analysis

Categorya GeneTime point

Function15 min 30 min

Pathogenicity islandLEE1 operon Z5137 17.1 5.3 Putative TTS protein

Z5136 4.4 4.3 Putative TTS proteinescR 16.8 50.7 EscR; TTS apparatus proteinescU 10.0 10.0 EscU; TTS apparatus protein

LEE2 operon cesD 16.4 11.7 CesD; TTS system chaperoneescC 18.1 22.1 EscC; TTS apparatus proteinZ5125 4.2 3.9 SepD; TTS proteinescJ 6.2 EscJ; TTS apparatus proteinZ5123 3.7 4.1 Putative TTS protein

LEE3 operon escN 2.2 EscN; TTS apparatus proteinsepQ 3.4 7.4 SepQ; TTS apparatus protein

LEE5 operon Z5111 13.9 10.6 Putative cesT (tir chaperone)sepL 25.8 SepL; TTS apparatus protein

LEE4 operon espF 6.3 EspF; type III effector protein

Other TTS (SPI-1 homologs Z4180 20.8 Putative lipoprotein TTS apparatus; prgK homologSalmonella) Z4182 35.4 90.8 Hypothetical protein: prgH homolog

Z4187 16.5 TTS apparatus protein; spaR homologZ4189 6.4 Putative integral membrane protein TTS apparatus; spaP homologZ4190 7.6 5.7 TTS system apparatus protein; spaO homologZ4191 13.3 TTS apparatus protein; invJ homologZ4195 10.8 14.5 TTS apparatus protein; invA homologZ4196 4.7 Putative secreted protein; invE homologZ4197 11.0 TTS apparatus protein; invG homologZ4198 17.0 13.0 Putative regulatory protein for TTS apparatus; invF homolog

Putative effector proteins Z0025 5.1 Hypothetical proteinZ2240 8.6 22.5 Hypothetical proteinZ2241 3.6 Hypothetical proteinZ2242 8.7 8.9 Hypothetical proteinZ2075 2.3 Unknown protein encoded by prophage CP-933OZ4329 2.2 Hypothetical proteinZ5212 2.8 3.6 Hypothetical proteinZ6024 6.5 5.1 Unknown protein encoded by cryptic prophage CP-933PZ3023 4.1 Putative secreted protein (distant YopM homolog)

Flagellar regulon (by operon)Class 2 fliP 5.1 Flagellar biosynthesis protein (fliLMNOPQR)

fliQ 10.4 17.6 Flagellar biosynthesis proteinfliE 3.6 Flagellar basal body protein (fliE)fliJ 4.6 Flagellar protein (fliFGHIJK)flgB 3.1 Flagellar basal body rod protein (flgBCDEFGHIJKL)flgC 3.4 3.6 Flagellar basal body rod proteinflgD 8.5 Flagellar biosynthesis, initiation of hook assemblyflgE 2.9 Flagellar hook proteinflgG 38.4 Flagellar biosynthesis, cell-distal portion of basal body rodflgH 5.6 Flagellar L-ring protein precursorflgI 2.9 Flagellar P-ring protein precursorfhiA 6.8 11.3 Flagellar biosynthesis (FlhA homolog)flhE 4.6 14.2 Flagellar protein (flhBAE)fliZ 6.5 Flagellar biosynthesis protein (fliAZY)

Class 3 cheB 4.3 5.4 Chemotaxis-specific methylesterase (cheRBYZ)cheW 2.8 Positive regulator of CheA protein activity (cheAW)

Fimbrial genes (by operon)b yadM 3.4 5.7 loc2/putative fimbrial proteinybgP 12.8 7.4 loc4/putative chaperoneycbQ 5.2 loc5/putative fimbrialike proteinZ1288 m 3.9 2.7 loc5/PapC-like porin protein involved in fimbrial biogenesisZ1536 3.4 loc6/putative usher proteinZ3276 3.4 loc9/putative fimbrial proteinyehB 5.5 7.9 loc9/putative outer membrane proteinZ3596 4.4 3.3 loc10/putative minor fimbrial subunitZ3598 8.5 16.7 loc10/putative minor fimbrial subunitZ3600 3.9 loc10/putative fimbrial usher

Continued on following page



.asm.org/

Dow

nloaded from

http://aem.asm.org/

through the activated (oxidized) form of the transcription fac-tor OxyR (62) It is noteworthy that the large group of genesthat are involved in resistance to oxidative stress and that hadincreased expression in the lysates included key members ofthe OxyR regulon (ahpF, ahpC, grxA, trxC, and katG) (Table3). In addition, katP, a catalase/peroxidase gene that was re-cently identified as a member of the OxyR regulon (66),showed induction after the pathogen was incubated for 30 minin the lettuce lysates.

Oxidative stress damages enzymes with Fe-S clusters, re-leasing ferrous iron that reacts with H2O2 via the Fentonreaction, producing OH radicals that cause direct damage to

DNA (37). Repair systems for iron-sulfur cluster synthesisand repair (isc), iron regulation (fit and fep), sulfur acqui-sition (cys, ssu, and tau) (Fig. 3A) and DNA repair-relatedgenes (nrd and CRISPR-associated genes) (Fig. 3C) were allexpressed at higher levels in the lettuce lysates than inM9-glucose culture. Additional genes (along with their pu-tative corresponding transcriptional activators) that are as-sociated with oxidative stress and were highly upregulated inresponse to lysates included ycfR (bhsA), a gene inducedunder multiple stress conditions and involved in biofilmformation (73), and yqhD, which has been linked to repair oflipid peroxidation (52) (Fig. 3B). Genes in the bet and cai/fix

TABLE 3—Continued

Categorya GeneTime point

Function15 min 30 min

Z3601 6.0 9.0 loc10 /putative major fimbrial subunityraH 2.2 loc11/putative fimbria-like proteinZ4501 3.0 loc11/hypothetical proteinZ4965 10.8 15.8 loc12/putative fimbrial subunitZ4968 m 3.7 3.3 loc12/PapC-like porin protein involved in fimbrial biogenesisZ4969 3.8 loc12/putative fimbrial chaperoneZ5221 3.5 loc13/putative fimbrial proteinZ5225 9.9 12.3 loc13/putative major fimbrial subuitfimA 4.2 loc14/major type 1 subunit fimbrin (pilin)fimI 2.7 loc14/fimbrial proteinfimF 4.1 loc14/fimbrial morphologyfimZ 3.8 loc3/fimbrial Z protein; probable signal transducerppdD 2.2 ppdD/prelipin peptidase-dependent protein

OxyR regulon (oxidative ahpC 8.0 Alkyl hydroperoxide reductase, C22 subunitstress) ahpF 2.9 7.6 Alkyl hydroperoxide reductase, F52a subunit

grxA 8.7 29.5 Glutaredoxin 1 redox coenzymekatG 18.1 Catalase; hydroperoxidase HPI(I)trxC 3.2 9.4 Putative thioredoxin-like proteinkatP 31.3 EHEC-catalase/peroxidase

Other oxidative stress related cydC 87.2 Cysteine/glutathione ABC transporter membrane/ATP-bindingcomponent

fhuD 101.4 Hydroxamate-dependent iron uptake, cytoplasmic membranecomponent

yeeD 13.0 22.1 Predicted redox protein, regulator of disulfide bond formationyeeE 21.4 16.5 Putative transport permease proteinZ2347 35.4 Putative copper-zinc superoxide dismutase prophage CP-933RZ3312 5.6 Putative copper-zinc superoxide dismutase prophage CP-933VZ3974 6.5 9.2 Alkyl hydroperoxide reductase AhpD

Osmotic stress betA 7.8 9.0 Choline dehydrogenasebetB 5.4 6.0 Betaine aldehyde dehydrogenasecaiA 5.1 Crotonobetainyl-coenzyme A dehydrogenasecaiT 32.8 L-Carnitine/-butyrobetaine antiporterfixX 10.2 Putative ferredoxin

Mar regulon (antimicrobial gatA 10.1 11.8 Galactitol-specific enzyme IIA of phosphotransferase systemresistance) map 5.4 Methionine aminopeptidase, type I

marA 9.4 19.2 Multiple antibiotic resistance; transcriptional activatormarR 19.2 27.9 Multiple antibiotic resistance protein; repressor of mar operonribA 3.6 GTP cyclohydrolase IIsrlA_2 3.2 PTS system IIC componenttnaA 2.1 TryptophanaseyfaE 4.6 Putative 2Fe-2S ferrodoxin

Other antimicrobial emrD 3.3 4.8 Multidrug resistance proteinZ3494 5.8 9.0 Putative antibiotic efflux protein (norA homolog Salmonella)

a LEE, locus enterocyte effacement; SPI-1, Salmonella pathogenicity island 1; Nle, non-LEE effector.b Fimbrial loci designated as described previously (40).



.asm.org/

Dow

nloaded from

http://aem.asm.org/

operons, which are associated with osmotic stress, also showedincreased transcription (Table 3).

Increased expression of several genes involved in antibioticresistance and detoxification of damaging compounds was ob-served (Table 3 and Fig. 3B). These included genes belongingto the multiple antibiotic resistance (Mar) regulon (includingmarR, marA, gatA, map, ribA, and yfaE). marRA also plays arole in increased tolerance to oxidative stress and is a memberof the SoxR regulon (1, 5). Upregulated genes with a role indetoxification included the nemR (ydhM), nemA, and gloAoperon, as well as the frmRAB (yaiN, adhC, and yaiM) operon,which contributes to formaldehyde degradation (Fig. 3B) (29).

(iii) Carbon utilization genes derepressed in lettuce lysates.Carbohydrate transport in Gram-negative bacteria occursthrough one of four systems: sugar-specific porins, ATP-bind-ing cassette (ABC) superfamily proteins, phosphotransferasesystem (PTS) proteins, or one of several sugar-specific majorfacilitator superfamily (MFS) proteins (62). Among the sugar-specific ABC transporter systems upregulated in response tolettuce lysates are multiple operons in two further categories ofcarbohydrate uptake transporters (CUT); the CUT1 family,which transports oligosaccharides, glycerol-phosphates, andother sugars (ycjV, ycjP, and ycjO and malE), and the CUT2family, which transports monosaccharides exclusively (Z5689,Z5691, and Z0415) (Fig. 4A) (63).

The transcription of malE, encoding a maltooligosaccharide-binding protein, was 348-fold higher after 15 min of EcO157incubation in the lysates than in M9 culture (Fig. 4A). Thisgene was also expressed at very high levels later at 30 min of

incubation, but the mean expression in lysates compared tothat in the control treatment was not significantly different bythe t test (P � 0.05) due to high variability in transcriptionamong all replicates. malZ, which encodes a maltodextrin glu-cosidase that breaks down maltodextrins to glucose and mal-tose (7), was increased in expression 11.3- and 23.7-fold at 15and 30 min, respectively.

PTS genes upregulated in response to lettuce lysates in-cluded gatA, a gene encoding a component of a galactitol-specific transporter and a member of the Mar regulon (Table3), as well as the gatR repressor gene (48), which showed a7.8-fold downregulation at 30 min of incubation. PTS genesspecific for sorbose, N-acetylgalactosamine, sorbitol/glucitol,and another galactitol import system were also upregulated(Fig. 4B).

uhpC, an MFS member and regulator of the UhpT glucose6-phosphate antiporter, increased in expression 66.2- and 73.3-fold in lysates at 15 and 30 min, respectively. Also in the MFS,multiple genes in a sucrose transport operon, and galP, specificfor galactose transport, had increased transcription (Fig. 4C).The galactose utilization gene yafB, a putative aldose reductasethat may reduce galactose to galactitol, showed a 12.3-foldinduction at 15 min of incubation.

Measurement of reactive oxygen species in lettuce lysate.Because upregulation of multiple genes in the OxyR regulonwas observed, the concentration of H2O2 present in the lettucelysates was quantified. The Amplex Red assay revealed thatimmediately after preparation, the lysates contained �25 �M

FIG. 3. EcO157 operons related to oxidative stress (A), detoxification (B), and DNA repair (C). Genes are shown in order of location anddirection of transcription in the operons, and their size is not drawn to scale. Genes with increased expression in lettuce lysates compared toM9-glucose medium are presented as solid black arrows. The upper and lower numbers within each arrow show fold upregulation at 15 and 30min postexposure to lettuce lysates, respectively. Gene symbols above the arrows are the most recent gene names from E. coli genomes. Gene locustags or gene symbols below the arrows, when present, indicate currently used, EDL933-specific gene designations. CRISPR, clustered regularlyinterspaced short palindromic repeats.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

H2O2 and showed a steady decline in concentration to �5 �Mafter 30 min (data not shown).

QRT-PCR on select genes of EcO157 exposed to lettucelysates and shredded leaves. QRT-PCR on EcO157 cells re-covered from inoculated lysates and inoculated shreddedleaves, both incubated for 30 min at 28°C, confirmed the in-creased transcription observed by microarray analysis of a sub-set of genes of interest (ahpF, grxA, ycfR, marR, marA, nemR/Z2666, nemA, gloA, yqhC, and yqhD) in comparison withexpression in M9-grown cells (Fig. 5). QRT-PCR also allowedfor the detection of the increased expression of oxyS, a smallnoncoding RNA that is activated by the oxidized form ofOxyR and that was not spotted on the arrays. For all of thegenes above, the magnitude of upregulation was greater inEcO157 cells incubated in lettuce lysates than in shreddedlettuce.

QRT-PCR showed that genes belonging to the OxyR regu-lon (ahpF, grxA, oxyS, and katP) were not upregulated in cellsof the oxyR mutant, in contrast to the parental strain cells, afterexposure to lettuce lysates (Table 4). This loss of upregulationof ahpF, grxA, oxyS, and katP genes in the oxyR mutant con-firmed that OxyR was required for the activation of thesegenes in lettuce lysates. Several other oxidative stress-relatedgenes that are not known to be under OxyR control were notdifferentially transcribed in the oxyR mutant compared to theparental strain under the conditions described above. There-fore, identification of a redundant oxidative stress-responsive

pathway that enabled EcO157 to survive in the lysates despitea mutation in OxyR was not achieved.

Comparative behavior of EcO157 mutants in lettuce lysatesand shredded leaves. We investigated the role of EcO157genes that showed increased expression, in the survival of the

FIG. 4. EcO157 operons related to carbohydrate uptake and metabolism from three categories: ABC transporters (A), PTS proteins (B), andMFS proteins (C). Genes are shown in order of location and direction of transcription in the operons, and their sizes are not drawn to scale. Geneswith increased expression in lettuce lysates compared to M9-glucose medium are presented as solid black arrows. The upper and lower numberswithin each arrow show the fold upregulation at 15 and 30 min postexposure to lettuce lysates, respectively. Gene symbols above the arrows arethe most recent gene names from E. coli and Shigella genomes. Gene locus tags or gene symbols below the arrows, when present, indicate currentlyused, EDL933-specific gene designations. ABC, ATP-binding cassette; CUT, carbohydrate uptake transporter; PTS, phosphotransferase system;MFS, major facilitator superfamily. *, Substrate-specific binding protein.

FIG. 5. QRT-PCR quantification of change in expression ofEcO157 genes determined to be upregulated in lettuce lysates com-pared to M9-glucose medium by microarray analysis. Upregulation ofgenes was measured 30 min after inoculation of EcO157 in lettuce leaflysates or shredded lettuce. Each bar represents the mean upregulationin three replicate lysate samples and in two replicate shredded lettucesamples. The error bars represent one standard error of the mean.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

pathogen in lettuce lysates. Several EcO157 mutants were con-structed, and none of the mutants in oxyR, nemA, nemR/Z2666,marA, marR, yqhD, or ycfR exhibited reduced survival orgrowth over 5 h in lettuce lysates compared to the parentalstrain. In addition, neither the marA nor the marR mutantshowed a difference in behavior on shredded lettuce comparedto the parental strain (data not shown).

Survival of EcO157 challenged with H2O2 or Ca(OCl)2 afterexposure to lettuce lysates. In light of the numerous oxidativestress-related genes that were upregulated in EcO157 underconditions resulting from lettuce leaf damage, the effect ofexposure to lettuce lysates on the subsequent resistance ofthe EcO157 cells to oxidative compounds was investigated.When previously grown in M9-glucose, the EcO157 parentalstrain and oxyR mutant decreased in concentration 2.6- and3.7-fold, respectively, after exposure to 8 mM H2O2 for 70min (Fig. 6). The mutant survived at a slightly lower ratethan the parental strain in the first 40 min of incubation inH2O2 (Fig. 6). Most importantly, after exposure to romainelettuce lysates for 30 min, both strains exhibited enhancedsurvival in response to H2O2 challenge compared to M9-grown cells (Fig. 6).

In order to test whether this protective response gener-ated by exposure to lettuce lysates was also effective againsta chlorine challenge, EcO157 cells were treated with a cal-cium hypochlorite solution containing 2 ppm of free chlo-rine, both before and after exposure to romaine lettucelysates (Fig. 7). Cells that had been primed by a 30-minincubation in lettuce lysates survived at greater populationsizes after a 5-min exposure to chlorine than M9-growncells.

DISCUSSION

The global response of EcO157 to physicochemical condi-tions present at wound sites in processed lettuce was modeledusing leaf lysates obtained by rapidly crushing romaine lettuceleaves. Clearly, EcO157 experienced a period of adaptationafter inoculation into the lettuce lysates, as revealed by its lagphase within the first 4 to 5 h of incubation. The populationdynamics of the pathogen in the lysates were very similarwhether the cultures in minimal medium that were used asinoculum were in the stationary or the mid-log phase ofgrowth. Thus, the period of adaptation that we observed wasprobably not caused by a change in growth phase but rather bya physiological change in response to conditions prevailing in

TABLE 4. Change in gene expression in E. coli O157:H7 strainEDL933 and its oxyR deletion mutant in response to romaine

lettuce lysate as determined by QRT-PCR

GeneFold increase (SD)a

Wild type oxyR mutant

OxyR regulonahpF 2.3 (0.2) 1.0 (0.0)grxA 18.8 (5.8) 0.6 (0.2)oxyS 10.8 (5.6) 0.9 (0.2)katP 5.9 (0.1) 0.6 (0.0)

OxyR independent, H2O2 responsiveb

ibpA 0.6 (0.2) 0.5 (0.2)ibpB 0.4 (0.0) 0.3 (0.0)soxS 0.4 (0.0) 0.4 (0.1)yfiA 0.1 (0.0) �0.1 (0.0)

Other geneshslO 0.5 (0.0) 0.4 (0.1)marA 5.2 (2.6) 5.9 (1.3)marR 5.9 (0.5) 3.9 (0.9)nemA 52.3 (28.6) 20.5 (5.3)nemR 27.0 (1.7) 17.6 (0.9)norV 1.2 (0.9) 2.1 (0.8)ycfR 62.7 (18.2) 107.6 (2.1)yqhD 14.5 (0.1) 12.2 (1.4)

a Calculated in reference to expression in EcO157 cells cultured in M9 me-dium with 0.2% glucose to the mid-log phase of growth. n 2 biologicalreplicates.

b As described elsewhere (66, 74).

FIG. 6. Time course of survival of EcO157 parental (squares) andOxyR-minus mutant (triangles) in hydrogen peroxide after preincuba-tion in M9-glucose or in lettuce lysates. Cells were grown to exponen-tial phase in M9-glucose (open symbols) or were incubated in lettucelysates for 30 min (closed symbols) before exposure to 8 mM H2O2.The data represent the mean cell concentration of EcO157 in tworeplicate suspensions in H2O2, which were each prepared from differ-ent inoculum cultures in M9-glucose or lysates. The error bars repre-sent one standard deviation of the mean.

FIG. 7. Survival of EcO157 cells to calcium hypochlorite after pre-incubation in M9-glucose or in lettuce lysates. Cells were grown toexponential phase in M9-glucose or were incubated in lettuce lysatesfor 30 min, before transfer to a calcium hypochlorite solution contain-ing 2 ppm of free chlorine. Sodium thiosulfate was added to neutralizethe free chlorine after 5 min of incubation of the suspension. The datarepresent the mean cell concentration of EcO157 in four replicatesuspensions before (f) and after (�) exposure to calcium hypochlo-rite. The error bars represent one standard deviation of the mean.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

the lysates. Minimal medium was assessed as more relevantthan rich medium to grow the inoculum cells because, first, itslow complexity was likely closer to that of the lettuce lysates.Preliminary microarray analysis with LB-cultured cells as theinoculum indicated that a disproportionately high number ofhousekeeping genes were upregulated in EcO157 in the lettucelysates in response to the transition from a rich and complexenvironment to a low-nutrient milieu (data not shown). Sec-ond, the choice of minimal medium as a control environmentin the gene expression studies was based on the hypothesis thatEcO157 cells landing in lettuce lesions most likely originatefrom an environment of low nutritional complexity. As dis-cussed below, the upregulation in the lysates and shreddedlettuce of a large number of EcO157 genes involved in adap-tation to stresses caused by compounds that are prevalent inwounded plant tissue demonstrate that our control environ-ment allowed us to obtain transcriptional data relevant to theexposure of the pathogen to injured leaf tissue.

After a period of acclimation, EcO157 displayed a remark-able ability to multiply in the lettuce lysates and had a growthrate equivalent to that in minimal medium with glucose, sug-gesting that the nutritional content of lysed romaine lettucecells was sufficient to support growth of the pathogen underwarm temperature conditions. This growth represented 10 cellgenerations of the pathogen and therefore an infectious dosesufficient to cause disease (http://www.cfsan.fda.gov/�ebam).Microarray analysis of EcO157 gene expression during theadaptation phase in the lysates revealed that the cells wereadjusting to alternate nutrient sources, as well as to a variety ofstresses such as the presence of reactive oxygen species and ofantimicrobial or toxic compounds, and to osmotic stress. Asubset of upregulated genes that are involved in oxidativestress and antimicrobial resistance were tested by QRT-PCR inboth lettuce lysates and shredded lettuce. The similar patternof expression of these genes in both environments validatedthe use of lysates to approximate some of the early chemicalconditions in the lesions of processed lettuce leaves. Thegreater increase in expression of these genes in the lysatescompared to shredded lettuce may be due to the greater ho-mogeneity of conditions in the lysates, since EcO157 inoculumcells may have landed on the shredded lettuce not only on thecut tissue but also on undamaged surfaces where these chem-ical stresses may have been absent.

Carbohydrate utilization. Approximately 2% of the freshweight of romaine lettuce leaves are made up of carbohydrates,compared to 94% water (19). As photosynthetic organisms,lettuce plants are rich in a variety of sugars including, but notlimited to, sucrose, glucose, fructose, galactose, and mannose(63, 68). Glucose and maltose are present in leaves as productsof starch degradation (70), and sucrose is the primary sugartransported in the phloem (63). Multiple carbohydrate trans-port genes in EcO157 were upregulated in response to lysates,including those specific for the disaccharides maltose and su-crose, and at least two different monosaccharide transportersbelonging to the carbohydrate uptake transporters 1 (CUT1)family. The most impressive induction of a carbohydrate trans-port gene was that of malE, showing a 348-fold increase intranscription only 15 min after exposure of EcO157 to lysate.This rapid and large induction indicates that maltose may be acritical plant metabolite in the survival and/or growth of

EcO157 in damaged lettuce leaf tissue. Overall, it is clear thatinjured plant cells release a wide range of carbohydrates thatEcO157 can utilize as substrates for growth once its arsenal toa variety of stresses in the lysates has been deployed.

Oxidative stress and DNA repair. A large number ofEcO157 genes with increased expression in the lysates belongto operons that are responsive to oxidative stress. The twobest-characterized oxidative stress-responsive transcriptionfactors in E. coli are SoxR and OxyR (33, 55). SoxR has beenshown to detect superoxide radicals via oxidation of its iron-sulfur [2Fe-2S] cluster, whereas OxyR detects H2O2 via oxida-tion of specific cysteine residues (30, 62). The oxidation ofthese regulatory proteins per se initiates transcription of theirrespective regulons. This explains the lack of increased tran-scription of oxyR and soxR observed in the microarray analysis,while genes that are members of their regulons were upregu-lated. The oxidative stress apparently experienced by EcO157in the lysates and on shredded lettuce likely was caused by thepresence of reactive oxygen species such as O2

� and H2O2 thatare generated during the oxidative burst in plant cells as aresult of mechanical injury (14, 49).

The genes that were upregulated in the lysates and thatbelong to the Sox regulon also are members of the Mar regu-lon, namely, ribA, marR, and marA (Table 3). Although sodAand not sodC is part of the Sox regulon (54), two sodC-likeCu/Zn periplasmic superoxide dismutases encoded in EcO157(Z2347 and Z3312) had increased transcription in response tolettuce lysates. D’Orazio et al. (24) reported that singleEcO157 mutants in each of these genes displayed reducedsurvival to H2O2. Therefore, these genes were induced inEcO157 possibly due to the presence of H2O2 in lettuce ly-sates. Contrarily to the SoxR regulon, key genes of the OxyRregulon (ahpCF, grxA, trxC, katG, and katP) had increasedexpression in the lysates. Zheng et al. (74) demonstrated bymicroarray analysis that a core set of OxyR-regulated genes,namely, dps, katG, grxA, ahpCF, and trxC, are induced consid-erably in EcO157 cells exposed to 1 mM H2O2; all but one ofthese genes (dps) were upregulated more than eightfold inresponse to romaine lettuce lysates in the present study. Glu-tathione reductase (gor), a member of the OxyR regulon, wasnot differentially regulated; however, cydC, which is involved intransport of glutathione into the periplasm in order to regulateredox homeostasis (53), was highly upregulated after 15 min ofincubation of EcO157 in the lysates. In its oxidized form, theOxyR transcription factor also upregulates the small noncod-ing RNA, oxyS (3). The increased expression of oxyS in lettucelysate-exposed cells provided further support for the broadinduction of the OxyR regulon under our investigated condi-tions.

Both H2O2 and superoxide can damage enzymes with Fe-Sclusters via release of free iron, which can then lead to directDNA damage by reactive iron molecules, as well as by � OHradicals released when H2O2 reacts with ferrous iron (37). TheIscR-regulated gene cluster iscRSUA-hscBAfdx-iscX, which isassociated with Fe-S cluster assembly and repair (34), washighly upregulated at 30 min postexposure to lettuce lysates(including upregulation of iscR itself as soon as 15 min post-inoculation). Perhaps in order to recruit Fe and S required forFe-S cluster repair, genes with a role in sulfur acquisition in thecys, ssu, and tau operons (67), and others related to iron trans-



.asm.org/

Dow

nloaded from

http://aem.asm.org/

port in the fit (50) and fep (51) operons, were upregulated.Also upregulated in the lysates were genes involved in DNArepair, such as two clusters of ribonucleotide reductase genes(nrdAB and nrdHIEF) (46, 48).

Several other genes involved in oxidative stress were part ofthe transcriptional signature of EcO157 cells in lettuce lysates.These included the “biofilm through hydrophobicity and stressresponse” (bhsA) gene (formerly ycfR) and yqhD. bhsA wasobserved previously to be expressed in E. coli in response tothe presence of H2O2 (69, 74) and carbon monoxide (47). yqhDencodes an aldehyde reductase that recently was described asprotecting against lipid peroxidation stress resulting from var-ious reactive oxygen species-generating compounds (52).

The Amplex Red fluorescence assay revealed that H2O2

indeed was present in the lettuce lysates and that its concen-tration decreased over time. The failure of catalase to com-pletely suppress the Amplex Red signal in the lysates suggeststhat reactive oxygen species other than H2O2 may have beenpresent. The allocation of an extensive part of the transcrip-tional machinery to the increased expression of oxidative stressgenes, as shown by microarray analysis and confirmed by QRT-PCR also on shredded lettuce, indicates that EcO157 cells areexposed early to significant amounts of oxygen radicals result-ing from the plant response to injury. The large number ofgenes/operons recruited to adapt to these stressful conditionsmay explain why the oxyR mutant and other mutants in oxida-tive stress genes tested here were unaffected in survival andgrowth in the lysates. Likely, redundancy in this vast array ofresponses to oxidative stress may have ensured that sufficientcell protection is achieved, even in the event of some nonfunc-tional pathway. Besides the obvious adaptation of EcO157 tooxidative stress in the lysates, the degradation of reactive ox-ygen species over time, as assessed with the Amplex Red assay,may have contributed to a more favorable milieu and therebyenabled the subsequent growth of the pathogen in the lysates4 h after incubation.

Despite the obvious importance of oxidative stress, the in-creased activity of genes such as bet and cai-fix, which are partof two osmotic stress-responsive operons, suggests that addi-tional stresses are imposed on EcO157 under conditionsbrought about by plant cell damage and lysis. Most likely, lysedplant cells release numerous compounds that can act as os-molytes and may have induced an osmotic stress response inthe pathogen. It is possible that the downregulation of proVWXin EcO157 in the lysates (data not shown) is a consequence ofthe absence or insufficient amounts of glycine betaine andproline to import into the cells in order to remediate the effectsof osmotic stress on the bacterial cells.

Antimicrobial stress. A number of genes involved in anti-microbial resistance and detoxification of noxious compoundsshowed increased transcription in lysates, presumably in re-sponse to compounds freed from the ruptured plant cells;these included genes that overlap with the cellular response tooxidative stress. These genes consisted of multiple members ofthe Mar regulon, including the mar operon itself, the nemoperon, and the frm operon, which is involved in formaldehydedegradation (29). It is noteworthy that the mar operon is ac-tivated by salicylic acid (16), a derivative of the polypropanoidpathway (22) and a key signaling molecule in the plant globalresponse to stress, including injury (38). In addition, minimally

processed lettuce contains numerous phenolic compounds (11,35), as well as intermediate compounds of the phenylpro-panoid pathway that possess antimicrobial properties (4).Thus, the reactive oxygen species found at wound sites, and thevarious aromatic compounds present in leaf tissue, may explainthe broad transcriptional response in EcO157 that relates tooxidative and antimicrobial stress.

Flagellar machinery, TTS system, and fimbriae. Microarrayanalysis revealed that a large number of EcO157 genesencoding proteins in both TTS systems, in flagellar systems,and in fimbriae were upregulated in response to lettucelysates, compared to growth in M9 medium. The role ofthese bacterial virulence determinants and appendages inthe adaptation to conditions resulting from damaged leaftissue remains unclear. The increased expression of variousvirulence genes, including TTS genes, in EcO157 cellsshortly after nutrient replenishment in fresh culture brothhas been reported (2). It is also possible that signals in thelettuce lysates primed the pathogen for attachment to let-tuce tissue and that the TTS, the flagella, and the fimbriaeserve this function. Flagellum genes that had increased ex-pression in the lysates belonged primarily to the class 2 or“middle” genes, which are involved in formation of the basalflagellar structure. Flagellar and TTS systems have signifi-cant functional and structural homology (17, 27). EcO157mutants deficient in the flagellar subunit FliC or the TTSprotein EscN had reduced attachment to both spinach andlettuce leaves (71), whereas the LEE protein EspA medi-ated attachment of EcO157 to arugula, spinach, and lettuce,albeit after growth of the inoculum under culture and tem-perature conditions inducing TTS genes (60).

Our findings reveal that EcO157 has the ability to respondand adapt to stressful conditions in injured lettuce tissueand to use an array of substrates to multiply in that envi-ronment. The resulting change in transcriptional activityand metabolism leads to a particular physiology that maygreatly affect its ability to colonize wounded leaf tissue, itsresponse to decontamination treatment and perhaps also itsability to infect a host. The produce industry has reliedprimarily on oxidants, such as chlorinated compounds, tosanitize lettuce and wash water during processing. The sig-nificant upregulation of several oxidative stress-responsiveregulons in EcO157 cells in lettuce lysates and shreddedleaves observed in our study imply that the pathogen is welladapted to cope with oxidative assault after its initial expo-sure to injured leaf tissue. The enhanced survival to H2O2 ofEcO157 cells primed in lettuce lysates compared to that ofcultured cells, as well as the similar trend observed with Cahypochlorite challenge, supports this hypothesis. This in-creased resistance to chlorine sanitizers, combined with thegrowth of the pathogen in wounds on the leaves due theavailability of a variety of carbohydrates, may help explainthe association of processed leafy greens with outbreaks ofEcO157 in the recent years. On the other hand, knowledgeof the numerous stresses that EcO157 faces at the woundsites of cut lettuce may provide clues for new targets to usein hurdle technologies for the reduction of microbial con-tamination of processed produce.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

ACKNOWLEDGMENTS

We thank Steven Huynh and Yaguang Zhou for technical assistanceand B. Wanner for the gift of strains to perform �-Red Recombinase-based mutagenesis in EcO157.

This study was supported by a USDA/ARS award to M.T.B. and byfunds from USDA CRIS projects 5325-42000-044-00D and 5325-42000-045-00D.

REFERENCES

1. Alekshun, M. N., and S. B. Levy. 1997. Regulation of chromosomally medi-ated multiple antibiotic resistance: the Mar regulon. Antimicrob. AgentsChemother. 41:2067–2075.

2. Allen, K. J., D. Lepp, R. C. McKellar, and M. W. Griffiths. 2008. Examina-tion of stress and virulence gene expression in Escherichia coli O157:H7using targeted microarray analysis. Foodborne Pathog. Dis. 5:437–447.

3. Altuvia, S., D. Weinstein-Fischer, A. Zhang, L. Postow, and G. Storz. 1997.A small, stable RNA induced by oxidative stress: role as a pleiotropic reg-ulator and antimutator. Cell 90:43–53.

4. Barber, M. S., V. S. McConnell, and B. S. DeCaux. 2000. Antimicrobialintermediates of the general phenylpropanoid and lignin specific pathways.Phytochemistry 54:53–56.

5. Barbosa, T. M., and S. B. Levy. 2000. Differential expression of over 60chromosomal genes in Escherichia coli by constitutive expression of marA. J.Bacteriol. 182:3467–3474.

6. Bergholz, T. M., L. M. Wick, W. Qi, J. T. Riordan, L. M. Ouellette, and T. S.Whittam. 2007. Global transcriptional response of Escherichia coli O157:H7to growth transitions in glucose minimal medium. BMC Microbiol. 7:97.

7. Boos, W., and H. Shuman. 1998. Maltose/maltodextrin system of Escherichiacoli: transport, metabolism, and regulation. Microbiol. Mol. Biol. Rev. 62:204–229.

8. Brandl, M. T. 2008. Plant lesions promote the rapid multiplication of Esch-erichia coli O157:H7 on postharvest lettuce. Appl. Environ. Microbiol. 74:5285–5289.

9. Brandl, M. T., and R. Amundson. 2008. Leaf age as a risk factor in contam-ination of lettuce with Escherichia coli O157:H7 and Salmonella enterica.Appl. Environ. Microbiol. 74:2298–2306.

10. Brandl, M. T., W. G. Miller, A. H. Bates, and R. E. Mandrell. 2005. Pro-duction of autoinducer 2 in Salmonella enterica serovar Thompson contrib-utes to its fitness in chickens but not on cilantro leaf surfaces. Appl. Environ.Microbiol. 71:2653–2662.

11. Cantos, E., J. C. Espin, and F. A. Tomas-Barberan. 2001. Effect of woundingon phenolic enzymes in six minimally processed lettuce cultivars upon stor-age. J. Agric. Food Chem. 49:322–330.

12. CDC. 2006. Ongoing multistate outbreak of Escherichia coli serotypeO157:H7 infections associated with consumption of fresh spinach—UnitedStates, September 2006. MMWR Morb. Mortal. Wkly. Rep. 55:1–2.

13. CDC. 2009. Surveillance for foodborne disease outbreaks—United States,2006. MMWR Morb. Mortal. Wkly. Rep. 58:609–615.

14. Cheong, Y. H., H. S. Chang, R. Gupta, X. Wang, T. Zhu, and S. Luan. 2002.Transcriptional profiling reveals novel interactions between wounding,pathogen, abiotic stress, and hormonal responses in Arabidopsis. PlantPhysiol. 129:661–677.

15. Clements, M. O., S. Eriksson, A. Thompson, S. Lucchini, J. C. Hinton, S.Normark, and M. Rhen. 2002. Polynucleotide phosphorylase is a globalregulator of virulence and persistency in Salmonella enterica. Proc. Natl.Acad. Sci. U. S. A. 99:8784–8789.

16. Cohen, S. P., S. B. Levy, J. Foulds, and J. L. Rosner. 1993. Salicylateinduction of antibiotic resistance in Escherichia coli: activation of the maroperon and a mar-independent pathway. J. Bacteriol. 175:7856–7862.

17. Cornelis, G. R. 2006. The type III secretion injectisome. Nat. Rev. Microbiol.4:811–825.

18. Critzer, F. J., D. H. Dsouza, and D. A. Golden. 2008. Transcription analysisof stx1, marA, and eaeA genes in Escherichia coli O157:H7 treated withsodium benzoate. J. Food. Prot. 71:1469–1474.

19. Crosby, D. G. 1963. The organic constituents of food. I. Lettuce. J. Food Sci.28:347–355.

20. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad.Sci. U. S. A. 97:6640–6645.

21. Delessert, C., I. W. Wilson, D. Van Der Straeten, E. S. Dennis, and R.Dolferus. 2004. Spatial and temporal analysis of the local response to wound-ing in Arabidopsis leaves. Plant Mol. Biol. 55:165–181.

22. Dixon, R. A., and N. L. Paiva. 1995. Stress-induced phenylpropanoid metab-olism. Plant Cell 7:1085–1097.

23. Dixon, W. J. 1950. Analysis of extreme values. Ann. Mathemat. Stat. 21:488–506.

24. D’Orazio, M., R. Scotti, L. Nicolini, L. Cervoni, G. Rotilio, A. Battistoni, andR. Gabbianelli. 2008. Regulatory and structural properties differentiating thechromosomal and the bacteriophage-associated Escherichia coli O157:H7Cu, Zn superoxide dismutases. BMC Microbiol. 8:166.

25. Eriksson, S., S. Lucchini, A. Thompson, M. Rhen, and J. C. Hinton. 2003.Unravelling the biology of macrophage infection by gene expression profilingof intracellular Salmonella enterica. Mol. Microbiol. 47:103–118.

26. Garces, H., D. Durzan, and M. C. Pedroso. 2001. Mechanical stress elicitsnitric oxide formation and DNA fragmentation in Arabidopsis thaliana. Ann.Bot. 87:567–574.

27. Gophna, U., E. Z. Ron, and D. Graur. 2003. Bacterial type III secretionsystems are ancient and evolved by multiple horizontal-transfer events. Gene312:151–163.

28. Herman, K. M., T. L. Ayers, and M. Lynch. 2008. Foodborne disease out-breaks associated with leafy greens, 1973–2006. Abstr. International Confer-ence on Emerging Infectious Diseases, Atlanta, GA.

29. Herring, C. D., and F. R. Blattner. 2004. Global transcriptional effects of asuppressor tRNA and the inactivation of the regulator frmR. J. Bacteriol.186:6714–6720.

30. Hidalgo, E., and B. Demple. 1994. An iron-sulfur center essential for tran-scriptional activation by the redox-sensing SoxR protein. EMBO J. 13:138–146.

31. Howe, G. A., and G. Jander. 2008. Plant immunity to insect herbivores.Annu. Rev. Plant Biol. 59:41–66.

32. Huang, X., K. Stettmaier, C. Michel, P. Hutzler, M. J. Mueller, and J.Durner. 2004. Nitric oxide is induced by wounding and influences jasmonicacid signaling in Arabidopsis thaliana. Planta 218:938–946.

33. Imlay, J. A. 2008. Cellular defenses against superoxide and hydrogen per-oxide. Annu. Rev. Biochem. 77:755–776.

34. Johnson, D. C., D. R. Dean, A. D. Smith, and M. K. Johnson. 2005. Structure,function, and formation of biological iron-sulfur clusters. Annu. Rev. Bio-chem. 74:247–281.

35. Kang, H. M., and M. E. Saltveit. 2002. Antioxidant capacity of lettuce leaftissue increases after wounding. J. Agric. Food Chem. 50:7536–7541.

36. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichiacoli. Nat. Rev. Microbiol. 2:123–140.

37. Keyer, K., and J. A. Imlay. 1996. Superoxide accelerates DNA damage byelevating free-iron levels. Proc. Natl. Acad. Sci. U. S. A. 93:13635–13640.

38. Klessig, D. F., J. Durner, R. Noad, D. A. Navarre, D. Wendehenne, D.Kumar, J. M. Zhou, J. Shah, S. Zhang, P. Kachroo, Y. Trifa, D. Pontier, E.Lam, and H. Silva. 2000. Nitric oxide and salicylic acid signaling in plantdefense. Proc. Natl. Acad. Sci. U. S. A. 97:8849–8855.

39. Leon, J., E. Rojo, and J. J. Sanchez-Serrano. 2001. Wound signalling inplants. J. Exp. Bot. 52:1–9.

40. Low, A. S., N. Holden, T. Rosser, A. J. Roe, C. Constantinidou, J. L. Hob-man, D. G. Smith, J. C. Low, and D. L. Gally. 2006. Analysis of fimbrial geneclusters and their expression in enterohaemorrhagic Escherichia coli O157:H7. Environ. Microbiol. 8:1033–1047.

41. Lucchini, S., H. Liu, Q. Jin, J. C. Hinton, and J. Yu. 2005. Transcriptionaladaptation of Shigella flexneri during infection of macrophages and epithelialcells: insights into the strategies of a cytosolic bacterial pathogen. Infect.Immun. 73:88–102.

42. Maffei, M. E., A. Mithofer, G. Arimura, H. Uchtenhagen, S. Bossi, C. M.Bertea, L. S. Cucuzza, M. Novero, V. Volpe, S. Quadro, and W. Boland. 2006.Effects of feeding Spodoptera littoralis on lima bean leaves. III. Membranedepolarization and involvement of hydrogen peroxide. Plant Physiol. 140:1022–1035.

43. Makino, S., T. Tobe, H. Asakura, M. Watarai, T. Ikeda, K. Takeshi, and C.Sasakawa. 2003. Distribution of the secondary type III secretion systemlocus found in enterohemorrhagic Escherichia coli O157:H7 isolates amongShiga toxin-producing E. coli strains. J. Clin. Microbiol. 41:2341–2347.

44. Mandrell, R. E. 2009. Enteric human pathogens associated with fresh pro-duce: sources, transport and ecology, p. 3–42. In X. Fan, B. Niemira, C. J.Doona, F. Feeherry, and R. B. Gravani (ed.), Microbial safety of freshproduce: challenges, perspectives, and strategies. IFT/Blackwell Publishing,Ames, IA.

45. Mohanty, J. G., J. S. Jaffe, E. S. Schulman, and D. G. Raible. 1997. A highlysensitive fluorescent micro-assay of H2O2 release from activated humanleukocytes using a dihydroxyphenoxazine derivative. J. Immunol. Methods202:133–141.

46. Monje-Casas, F., J. Jurado, M. J. Prieto-Alamo, A. Holmgren, and C. Pueyo.2001. Expression analysis of the nrdHIEF operon from Escherichia coli:conditions that trigger the transcript level in vivo. J. Biol. Chem. 276:18031–18037.

47. Nobre, L. S., F. Al-Shahrour, J. Dopazo, and L. M. Saraiva. 2009. Exploringthe antimicrobial action of a carbon monoxide-releasing compound throughwhole-genome transcription profiling of Escherichia coli. Microbiology 155:813–824.

48. Nordlund, P., and P. Reichard. 2006. Ribonucleotide reductases. Annu. Rev.Biochem. 75:681–706.

49. Orozco-Cardenas, M., and C. A. Ryan. 1999. Hydrogen peroxide is gener-ated systemically in plant leaves by wounding and systemin via the octade-canoid pathway. Proc. Natl. Acad. Sci. U. S. A. 96:6553–6557.

50. Ouyang, Z., and R. Isaacson. 2006. Identification and characterization of anovel ABC iron transport system, fit, in Escherichia coli. Infect. Immun.74:6949–6956.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

51. Ozenberger, B. A., M. S. Nahlik, and M. A. McIntosh. 1987. Genetic orga-nization of multiple fep genes encoding ferric enterobactin transport func-tions in Escherichia coli. J. Bacteriol. 169:3638–3646.

52. Perez, J. M., F. A. Arenas, G. A. Pradenas, J. M. Sandoval, and C. C.Vasquez. 2008. Escherichia coli YqhD exhibits aldehyde reductase activityand protects from the harmful effect of lipid peroxidation-derived aldehydes.J. Biol. Chem. 283:7346–7353.

52a.Pfaffl, M. W. 2001. A new mathematical model for relative quantification inreal-time RT-PCR. Nucleic Acids Res. 29:e45.

53. Pittman, M. S., H. C. Robinson, and R. K. Poole. 2005. A bacterial gluta-thione transporter (Escherichia coli CydDC) exports reductant to theperiplasm. J. Biol. Chem. 280:32254–32261.

54. Pomposiello, P. J., M. H. Bennik, and B. Demple. 2001. Genome-widetranscriptional profiling of the Escherichia coli responses to superoxide stressand sodium salicylate. J. Bacteriol. 183:3890–3902.

55. Pomposiello, P. J., and B. Demple. 2001. Redox-operated genetic switches:the SoxR and OxyR transcription factors. Trends Biotechnol. 19:109–114.

56. Prieto-Alamo, M. J., J. Jurado, R. Gallardo-Madueno, F. Monje-Casas, A.Holmgren, and C. Pueyo. 2000. Transcriptional regulation of glutaredoxinand thioredoxin pathways and related enzymes in response to oxidativestress. J. Biol. Chem. 275:13398–13405.

57. Rangel, J. M., P. H. Sparling, C. Crowe, P. M. Griffin, and D. L. Swerdlow.2005. Epidemiology of Escherichia coli O157:H7 outbreaks, United States,1982–2002. Emerg. Infect. Dis. 11:603–609.

58. Reymond, P., H. Weber, M. Damond, and E. E. Farmer. 2000. Differentialgene expression in response to mechanical wounding and insect feeding inArabidopsis. Plant Cell 12:707–720.

59. Rice, E. W., R. M. Clark, and C. H. Johnson. 1999. Chlorine inactivation ofEscherichia coli O157:H7. Emerg. Infect. Dis. 5:461–463.

60. Shaw, R. K., C. N. Berger, B. Feys, S. Knutton, M. J. Pallen, and G. Frankel.2008. Enterohemorrhagic Escherichia coli exploits EspA filaments for attach-ment to salad leaves. Appl. Environ. Microbiol. 74:2908–2914.

61. Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999.Quorum sensing controls expression of the type III secretion gene transcrip-tion and protein secretion in enterohemorrhagic and enteropathogenic Esch-erichia coli. Proc. Natl. Acad. Sci. U. S. A. 96:15196–15201.

62. Storz, G., L. A. Tartaglia, and B. N. Ames. 1990. Transcriptional regulator ofoxidative stress-inducible genes: direct activation by oxidation. Science 248:189–194.

63. Suthumchai, W., T. Matsui, K. Kawada, and Y. Kosugi. 2006. Changes in

acid invertase activity and sugar contents in lettuce during storage at ambienttemperature. Asian J. Plant Sci. 5:304–310.

64. Tauxe, R. V. 1997. Emerging food-borne diseases: an evolving public healthchallenge. Emerg. Infect. Dis. 3:425–434.

65. Tobe, T., S. A. Beatson, H. Taniguchi, H. Abe, C. M. Bailey, A. Fivian, R.Younis, S. Matthews, O. Marches, G. Frankel, T. Hayashi, and M. J. Pallen.2006. An extensive repertoire of type III secretion effectors in Escherichiacoli O157 and the role of lambdoid phages in their dissemination. Proc. Natl.Acad. Sci. U. S. A. 103:14941–14946.

66. Uhlich, G. A. 2009. KatP contributes to OxyR-regulated hydrogen peroxideresistance in Escherichia coli serotype O157:H7. Microbiology doi:10.1099/mic.0.031435-0.

67. van der Ploeg, J. R., E. Eichhorn, and T. Leisinger. 2001. Sulfonate-sulfurmetabolism and its regulation in Escherichia coli. Arch. Microbiol. 176:1–8.

68. Villanueva-Suarez, M. J., A. Redondo-Cuenca, M. D. Rodriguez-Sevilla, andM. de las Heras Martinez. 2003. Characterization of nonstarch polysaccha-rides content from different edible organs of some vegetables, determined byGC and HPLC: comparative study. J. Agric. Food. Chem. 51:5950–5955.

69. Wang, S., K. Deng, S. Zaremba, X. Deng, C. Lin, Q. Wang, M. L. Tortorello,and W. Zhang. 2009. Transcriptomic response of Escherichia coli O157:H7 tooxidative stress. Appl. Environ. Microbiol. 75:6110–6123.

70. Weise, S. E., A. P. Weber, and T. D. Sharkey. 2004. Maltose is the major formof carbon exported from the chloroplast at night. Planta 218:474–482.

71. Xicohtencatl-Cortes, J., E. Sanchez Chacon, Z. Saldana, E. Freer, and J. A.Giron. 2009. Interaction of Escherichia coli O157:H7 with leafy green pro-duce. J. Food Prot. 72:1531–1537.

72. Ygberg, S. E., M. O. Clements, A. Rytkonen, A. Thompson, D. W. Holden,J. C. Hinton, and M. Rhen. 2006. Polynucleotide phosphorylase negativelycontrols spv virulence gene expression in Salmonella enterica. Infect. Immun.74:1243–1254.

73. Zhang, X. S., R. Garcia-Contreras, and T. K. Wood. 2007. YcfR (BhsA)influences Escherichia coli biofilm formation through stress response andsurface hydrophobicity. J. Bacteriol. 189:3051–3062.

74. Zheng, M., X. Wang, L. J. Templeton, D. R. Smulski, R. A. LaRossa, and G.Storz. 2001. DNA microarray-mediated transcriptional profiling of the Esch-erichia coli response to hydrogen peroxide. J. Bacteriol. 183:4562–4570.

75. Zhou, M., Z. Diwu, N. Panchuk-Voloshina, and R. P. Haugland. 1997. Astable nonfluorescent derivative of resorufin for the fluorometric determi-nation of trace hydrogen peroxide: applications in detecting the activity ofphagocyte NADPH oxidase and other oxidases. Anal. Biochem. 253:162–168.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

transcriptome analysis of escherichia coli o157:h7 exposed ... · transcriptome analysis of...

Documents