transcriptional analysis of the grlra virulence operon ...activates transcription of all the major...

JOURNAL OF BACTERIOLOGY, July 2010, p. 3722–3734 Vol. 192, No. 140021-9193/10/$12.00 doi:10.1128/JB.01540-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Transcriptional Analysis of the grlRA Virulence Operon fromCitrobacter rodentium�

Marija Tauschek,† Ji Yang,† Dianna Hocking, Kristy Azzopardi, Aimee Tan, Emily Hart,Judyta Praszkier, and Roy M. Robins-Browne*

Department of Microbiology and Immunology, the University of Melbourne, Victoria 3010, and Murdoch Children’s Research Institute,Royal Children’s Hospital, Parkville, Victoria 3052, Australia

Received 24 November 2009/Accepted 30 April 2010

The locus for enterocyte effacement (LEE) is the virulence hallmark of the attaching-and-effacing (A/E)intestinal pathogens, namely, enteropathogenic Escherichia coli, enterohemorrhagic E. coli, and Citrobacterrodentium. The LEE carries more than 40 genes that are arranged in several operons, e.g., LEE1 to LEE5.Expression of the various transcriptional units is subject to xenogeneic silencing by the histone-likeprotein H-NS. The LEE1-encoded regulator, Ler, plays a key role in relieving this repression at severalmajor LEE promoters, including LEE2 to LEE5. To achieve appropriate intracellular concentrations ofLer in different environments, A/E pathogens have evolved a sophisticated regulatory network to controller expression. For example, the LEE-encoded GrlA and GrlR proteins work as activator and antiactivator,respectively, of ler transcription. Thus, control of the transcriptional activities of the LEE1 (ler) promoterand the grlRA operon determines the rate of transcription of all of the LEE-encoded virulence factors. Todate, only a single promoter has been identified for the grlRA operon. In this study, we showed that thenon-LEE-encoded AraC-like regulatory protein RegA of C. rodentium directly stimulates transcription ofthe grlRA promoter by binding to an upstream region in the presence of bicarbonate ions. In addition, invivo and in vitro transcription assays revealed a �70 promoter that is specifically responsible for tran-scription of grlA. Expression from this promoter was strongly repressed by H-NS and its paralog StpA butwas activated by Ler. DNase I footprinting demonstrated that Ler binds to a region upstream of the grlApromoter, whereas H-NS interacts specifically with a region extending from the grlA core promoter into itscoding sequence. Together, these findings provide new insights into the environmental regulation anddifferential expressions of the grlR and grlA genes of C. rodentium.

Citrobacter rodentium causes transmissible colonic hyperpla-sia and diarrhea in mice (34). Like the human diarrheagenicpathogens enteropathogenic Escherichia coli (EPEC) and en-terohemorrhagic E. coli (EHEC), C. rodentium induces attach-ing-and-effacing (A/E) lesions in the intestinal epithelium of itshost (40, 49). All three of these enteric pathogens possess apathogenicity island known as the locus for enterocyte efface-ment (LEE), which is responsible for the A/E phenotype (13,18, 27, 36, 43). So far, all of the LEE-encoded virulence factorsinvestigated in C. rodentium play roles in virulence equivalentto the roles played by those from EPEC and EHEC (14).Furthermore, the regulatory networks controlling transcriptionof the LEE are broadly similar in the three pathogens (37, 63).For these reasons, infection of mice with C. rodentium has beenused as a convenient small animal model to investigate themolecular and cellular pathogenesis of EPEC and EHEC andthe regulation of LEE expression by these organisms (14, 40).

The LEE comprises 41 open reading frames, most of whichare clustered into five operons: LEE1, LEE2, LEE3, LEE5,and LEE4 (13, 18). These transcriptional units encode a typeIII secretion system (T3SS), translocator and effector proteins

secreted by this system, intimin (an outer membrane protein),and its type III secreted translocated receptor, Tir (13, 18, 38,48, 54). Transcription of these operons is controlled by a num-ber of general and specific regulators encoded on the chromo-somal backbone and the LEE itself, respectively (6, 17, 20, 21,23, 38, 44, 51, 52, 57). As with many other horizontally ac-quired virulence operons in Gram-negative pathogens, the ex-pression of each of the LEE operons is subject to xenogeneicsilencing by the global regulator H-NS (histone-like nucleoidstructuring protein) (16, 19, 56). This form of repression isachieved through the binding of H-NS to curved AT-rich re-gions located mainly in promoter regions of horizontally ac-quired genes, preventing the formation of promoter open com-plexes or inhibiting the elongation of RNA polymerase (41,50). In the case of the LEE, the Ler protein (the LEE-encodedregulator), which is encoded by the first gene of the LEE1operon, antagonizes H-NS-mediated silencing (6) and thusactivates transcription of all the major promoters from LEE2to LEE5 but not that of LEE1 itself (2, 17, 20, 38, 48, 54).

Expression of the LEE1 promoter, which is an importantcheckpoint of LEE expression overall, is delicately regulated.This promoter is negatively regulated by Hha and H-NS andalso negatively regulated in a concentration-dependent man-ner by Ler (2, 51, 57) but is positively regulated by the inte-gration host factor (IHF) and quorum sensing (20, 55). Inaddition, the LEE1 promoter is activated by the GrlA protein(global regulator of LEE activator), which is encoded on atranscriptional unit located between LEE1 and LEE2 (1, 14,

* Corresponding author. Mailing address: Department of Microbi-ology and Immunology, the University of Melbourne, Parkville, Vic-toria 3010, Australia. Phone: 61 3 8344 8275. Fax: 61 3 8344 8276.E-mail: [email protected].

† These authors contributed equally to this work.� Published ahead of print on 14 May 2010.

3722

on February 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/JB.01540-09&domain=pdf&date_stamp=2010-07-15

http://jb.asm.org/

46). The grlA gene is positioned downstream of an open read-ing frame named grlR (encoding GrlR [global regulator of LEErepressor]) within the same transcriptional unit. In contrast toGrlA, the GrlR protein exerts a negative effect on LEE1 ex-pression (1, 14, 32), by forming heterodimers with GrlA(11, 28).

The grlRA operon is said to be transcribed from a single �70

promoter (designated the grlRA promoter here), whose expres-sion is directly stimulated by Ler (1). In this study, we carriedout in vivo and in vitro transcriptional analysis of the grlA geneand identified a highly regulated �70 promoter (the grlA pro-moter) immediately upstream of the GrlA coding sequence.

We also showed that expression of GrlA is influenced byRegA, an essential virulence-regulating protein of C. roden-tium (25, 31). RegA belongs to the AraC family of transcrip-tional regulators and activates the expression of a number ofputative virulence genes of C. rodentium, encoding varioussurface proteins (25). In addition, RegA inhibits transcriptionof more than 40 housekeeping genes involved in maintainingnormal cellular functions, such as amino acid and carbohydratebiosynthesis and uptake (63). Importantly, RegA requires anenvironmental signal, bicarbonate, that is found in the gut, toexert its regulatory effect on gene expression (61, 62). By usingmicroarray analysis, we previously demonstrated that tran-scription of the grlRA operon of C. rodentium is significantlystimulated by RegA in the presence of bicarbonate (63). In thisstudy, we performed a molecular analysis of grlRA transcrip-tion and showed that RegA directly activates expression of the

grlRA promoter by binding to an upstream region of grlRAwhen bicarbonate is present.

MATERIALS AND METHODS

Strains, plasmids, oligonucleotides, media, and reagents. The bacterial strainsand plasmids used in this work are listed in Table 1. Oligonucleotides used in thisstudy are listed in Table 2. Bacteria were grown at 37°C in Luria-Bertani both(LB) or in M9 minimal medium (47). For solid media, 1.5% (wt/vol) agar wasadded. Where appropriate, media were supplemented with antibiotics at thefollowing concentrations: ampicillin, 100 �g/ml; chloramphenicol, 10 �g/ml; ka-namycin, 50 �g/ml; trimethoprim, 40 �g/ml in LB and 10 �g/ml in M9 minimalmedium. Restriction enzymes and chemicals were purchased commercially. Pu-rified E. coli RNA polymerase holoenzyme was purchased from the USB Cor-poration.

DNA manipulation techniques. Standard recombinant DNA procedures asdescribed by Sambrook and Russell (47) were used. Plasmids were purified usingthe Wizard Plus SV Minipreps DNA purification system (Promega). DNA wassequenced by using a model 377 DNA sequencer and ABI Big Dye terminators(Perkin-Elmer Corporation). PCRs were carried out using PCR master mix fromPromega. A TOPO TA cloning kit (Invitrogen) was routinely used for cloningand sequencing of PCR fragments.

Construction of lacZ transcriptional fusions. The lacZ transcriptional fusionsused in this study were constructed by PCR amplification of DNA fragmentswhich span the regulatory regions of the genes, grlR and grlA, by using C.rodentium ICC169 chromosomal DNA as the template and the primers listed inTable 2. Each of the PCR fragments was cloned into TOPO TA cloning vectorpCR2.1-TOPO and sequenced. The fragments were then excised from theTOPO TA derivatives and cloned into the appropriate sites of the single-copyplasmid pMU2385 to create lacZ transcriptional fusions. The forward primersMT125, MT156, MT155, and MT154 were used with reverse primer MT124 togenerate the fusions grlRA-1, -2, -3, and -4, respectively. Fusions grlA-1 and -2

TABLE 1. Bacterial strains and plasmids used for this study

Strain or plasmid Descriptiona Referenceor source

C. rodentium strainsICC169 Spontaneous Nalr derivative of wild-type C. rodentium biotype 4280 (Nalr) 40EMH1 ICC169 �regA (Nalr) 25EMH8 EMH1 �ler (Nalr, Cmr) This study

E. coli strainsMC4100 F� araD139 �(argF-lac)U169 rpsL150 relA1 flbB5301 deoC1 ptsF25 rbsR thiA 8PD145 MC4100 hns205::Tn10 15BSN29 MC4100 trp::Tn10 �hns stpA60::Kanr 29BL21(DE3) F� ompT hsdSB(rB

� mB�) gal dcm �(DE3) Invitrogen

TOP10 F� mcrA �(mrr-hsdRMS-mcrBC) �80lacZ�M15 �lacX74 nupG recA1 araD139 �(ara-leu)7697galE15 galK16 rpsL (Strr) endA1 ��

Invitrogen

PlasmidspMU2385 Single-copy-no. transcriptional fusion vector (Tmpr) 60pACYC184 Medium-copy-no. cloning vector (Cmr Tetr) 10pEH6 pACYC184 derivative carrying regA (Cmr) 25pBR322 Medium-copy-no. cloning vector (Ampr) 3pCR2.1-TOPO High-copy-no. cloning vector (Ampr Kanr) InvitrogenpMTGrlRA pCR2.1-TOPO containing 1,695 bp of the grlRA operon amplified using primers MT126 and MT123 This studypMTLer pBR322 derivative carrying ler (Ampr) This studypET30b Expression vector (Ampr) NovagenpDH75 pET30b derivative expressing Ler-His (Ampr) This studygrlRA-1 grlRA-lacZ transcriptional fusion from nucleotides �497 to �263 This studygrlRA-2 grlRA-lacZ transcriptional fusion from nucleotides �391 to �263 This studygrlRA-3 grlRA-lacZ transcriptional fusion from nucleotides �222 to �263 This studygrlRA-4 grlRA-lacZ transcriptional fusion from nucleotides �72 to �263 This studygrlA-1 grlA-lacZ transcriptional fusion from nucleotides �399 to �157 This studygrlA-2 grlA-lacZ transcriptional fusion from nucleotides �107 to �157 This study

a The coordinates of lacZ transcriptional fusions are indicated with respect to the grlRA transcriptional start site or the grlA translational start site.

VOL. 192, 2010 CONTROL OF grlRA TRANSCRIPTION 3723


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

were constructed using reverse primer MT158 with forward primers MT143 andMT157, respectively.

�-Galactosidase assay. Cells were grown to mid-log phase (optical density at600 nm [OD600] � 0.6), and -galactosidase activity was assayed as described byMiller (39). Specific activity was expressed in units as described in reference 39.The data shown are the results of at least three independent assays.

Construction of a C. rodentium �ler mutant. Overlapping extension PCR wasused to generate a DNA fragment carrying a chloramphenicol resistance (Cmr)gene flanked by regions upstream and downstream of C. rodentium (ICC169) ler(9). First, primer pairs ler.F/lerCm.R and lerCm.F/ler.R were used to amplifyDNA flanking the region to be deleted from the chromosome of C. rodentium,and primers for priming sites 1 and 2 were used to amplify the Cmr gene fromplasmid pKD3 (12). The products of these three PCRs (100 ng each) served asthe template in overlapping extension PCR using primers ler.F and ler.R togenerate a linear construct, which was cloned into pCR2.1-TOPO, introducedinto E. coli K-12 TOP10 cells and confirmed by sequencing. The pCR2.1-TOPOconstruct was used as a template in a PCR with primer pair ler.F/ler.R to amplifythe linear allelic replacement DNA fragment, which was introduced into the C.rodentium strain EMH1, expressing � Red recombinase from plasmid pKD46(12). The �ler mutation in the generated C. rodentium strain, EMH8, was con-firmed by PCR and sequencing.

Construction of plasmids encoding Ler. A wild-type copy of the ler gene wasamplified from genomic DNA of C. rodentium strain ICC169 by using primersMT137 and MT136. A 0.5-kb fragment encompassing ler and its 100-bp flank-ing sequences was cloned into the NheI and BamHI sites of pBR322 behind thetet promoter to create plasmid pMTLer. For the overexpression and purificationof Ler, the ler coding region was PCR amplified using primers CrlerNdeF andCrlerXhoR and cloned into the NdeI and XhoI sites of pET30b (Novagen) togenerate plasmid pDH275, which expressed Ler as a fusion protein tagged withsix histidine residues at its C terminus (Ler-His).

Expression and purification of H-NS, MBP::RegA, and Ler proteins. Expres-sion and purification of MBP::RegA (RegA fused to the maltose binding protein[MBP]) was performed as described previously (62). To overexpress H-NS, aDNA fragment containing the coding sequence of H-NS was amplified by PCRusing primer pair MT162/MT163 and chromosomal DNA of E. coli strainMC4100 as template. The H-NS fragment was cloned into TOPO TA andsequenced. The NdeI-XhoI H-NS fragment was then excised from the TOPO TAderivative and cloned into the same sites of plasmid pET22b (Novagen), whereH-NS was expressed as a fusion protein with six histidine residues tagged at itsC terminus (H-NS–His). The H-NS–His fusion protein was purified by nickelaffinity chromatography as described by Smyth et al. (53).

For overexpression of Ler-His, E. coli expression strain BL21(DE3) containingplasmid pDH275 was induced for 1 h with 0.1 mM IPTG (isopropyl--D-thioga-lactopyranoside) in 30 ml of Terrific broth (47). Ler-His was purified usingimmobilized metal affinity chromatography (Novagen) according to the manu-facturer’s instructions with minor alterations. Pelleted cultures were resuspendedin 20 ml 1� binding buffer (Novagen) containing lysozyme and Triton X-100 atfinal concentrations of 100 �g/ml and 0.1%, respectively. Cells were then dis-rupted by sonication, and after centrifugation (10,000 � g with an SS34 rotor[Sorvall] at 4°C for 30 min), the clarified supernatant was batch bound with 0.5ml settled Ni-nitrilotriacetic acid (NTA) resin (Qiagen) using a rotating wheel at4°C for 2 h. The slurry was poured into a column and washed with 20 ml of 1�binding buffer containing 0.5% Tween 20, followed by 20 ml of wash buffer(Novagen) containing 0.5% Tween 20, and finally with wash buffer alone. Proteinwas eluted in 1-ml fractions by using 1� elution buffer (Novagen) containing 300mM imidazole. The concentration of purified Ler-His protein was estimated bycomparison with known concentrations of bovine serum albumin (BSA) on aCoomassie blue-stained polyacrylamide gel.

EMSA. 32P-labeled DNA fragments to be used in the electrophoretic mobilityshift assay (EMSA) were generated as follows. Oligonucleotide primers were

TABLE 2. Oligonucleotides used in this study

Oligonucleotide Sequence (5� to 3�) Coordinatesa

CrlerNdeF CCCGGGCATATGAATATGGAAACTAATTCGCCCACCrlerXhoR CCCGGGCTCGAGAATGTTATTCAGAGATGTTACTTCler.F CTGCGTTACGTCATTGAGCATATClerCm.R GAAGCAGCTCCAGCCTACACACCATATTCATAATAATAATCTCCTCATAClerCm.F CTAAGGAGGATATTCATATGGTAACATCTCTGAATAACATTTAACATGler.R CGGAATCATATAATCTTCTCTCTTCACCMT129 GCCGTATAAAGAATAACGGAG 830–850MT130 GTTGGAAGCTAAAATATAACCAG 410–432MT131 GCTTCCAACATAAAATCTAGAG 397–418MT132 GTCTGTACTACAAACTTGGTG 28–48MT136 CGGGATCCTTCCAGTTCAGTTATCGMT137 CGGCTAGCATCCATGTAAGGATGAGMT142 CCAAGCTTGTCAGGAATTACATAGTCAC 1332–1351MT143 CGGGATCCATGGCATCTATAGTATTACC 917–936MT144 CATTTCTCCTGCAATTTACACC 1401–1422MT145 GAGTCAGGAATTACATAGTCAC 1332–1353MT146 TAATGTTACATTACATTGCCACG 1155–1177MT147 GTATTACCTTTATTAGTAATGAAG 929–952MT148 GATAAATCTGACATAAACATCAAC 1201–1224MT154 CGGGATCCTGCGTTAGGATTTAAAGATGG 736–756MT155 CGGGATCCTTGACTCATTCCATGCAATGG 586–606MT156 CGGGATCCGCTAAAATATAACCAGCGACAG 417–438MT157 CGGGATCCTTATGTCAGATTTATCGAACCG 1209–1230MT158 CCAAGCTTCTCTCCTCAGGTTTATACCG 1453–1472MT159 GATCAATGTTATATGCTTTTCCAG 622–645MT160 GGAAAAGCATATAACATTGATCCA 620–643MT161 GAGAAACCAGGATATACAGAGG 1376–1397MT162 CATATGAGCGAAGCACTTAAAATTCTGAACMT163 CTCGAGTTGCTTGATCAGGAAATCGTCGAGGGMT164 GAGTCAGGAATTACATAGTCAC 1332–1353MT165 GTGAGCCTCTGTATATCCTGG 1371–1391MT166 GATCATTTCGTTCCAAATACTCG 1677–1699rpoDForw GCAGTTCCTCGATCTGATTCAGGAAGrpoDRev GATCTTCAGCACCTTACGGATCTTATCTTC

a The coordinates for the oligonucleotides are indicated in Fig. 1.

3724 TAUSCHEK ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

labeled with 32P at their 5� ends by using [ -32P]ATP and T4 polynucleotidekinase (New England Biolabs). The DNA fragments for analysis of RegA bind-ing to the grlRA promoter region were amplified by PCR using primer pairsMT132/MT131 (for fragment A), MT130/MT129 (for fragment B), MT130/MT160 (for fragment C), and MT159/MT129 (for fragment D), with plasmidpMTgrlRA carrying the entire grlRA regulatory region as the template. TheDNA fragments for analysis of RegA binding to the grlA promoter region wereamplified by PCR using primer pairs MT147/MT164 and MT165/MT166 (con-trol). EMSA was carried out as described previously (64). Briefly, end-labeledfragments were incubated with various amounts of purified MBP::RegA proteinand 45 mM NaHCO3 at 37°C for 20 min in the binding buffer [10 mM Tris-HCl(pH 7.4), 50 mM KCl, 1 mM dithiothreitol (DTT), 100 �g/ml BSA, 5 ng/�lpoly(dI-dC)]. Glycerol was added to a final concentration of 6.5% (wt/vol). Thesamples were analyzed by electrophoresis on 5% native polyacrylamide gels.

In vitro transcription. Runoff transcription assays were performed by using amethod based on the standard single-round conditions described by Igarashi andIshihama (26). The reaction mixtures contained linear DNA template (approx-imately 300 ng) and 1 unit of RNA polymerase. The samples were incubated at37°C for 25 min in a total volume of 35 �l of transcription buffer (50 mMTris-HCl [pH 7.8], 50 mM NaCl, 3 mM magnesium acetate, 0.1 mM EDTA, 0.1mM DTT, 25 �g/ml BSA). Following the incubation, 15 �l of start solution(containing 1� transcription buffer with heparin [0.67 mg/ml], ATP, CTP, andGTP [0.53 mM each], UTP [0.053 mM], and [�-32P]UTP [3 �Ci]) was added toinitiate RNA synthesis. Transcription was allowed to proceed for 5 min beforethe reaction was terminated by the addition of phenol. Each sample was precip-itated with ethanol and a portion of the precipitate was analyzed on a 6%sequencing gel next to a GA ladder. The ladder, which served as a molecularweight standard, was made by using the Maxam and Gilbert method (47) tosequence a grlRA fragment that was generated by PCR using primers[32P]MT147 and MT148.

Primer extension. Primer extension was performed as described previously(64). Briefly, total cellular RNA was purified from E. coli BSN29 and BSN29containing the grlA-1 plasmid. Cells were grown to mid-log phase (OD600 � 0.6),and RNA molecules were isolated using the FastRNA Pro kit (Q-Biogene).Primer MT161 was labeled at its 5� end with [ -32P]ATP and T4 polynucleotidekinase and coprecipitated with 10 �g of total RNA. Hybridization was carriedout at 45°C for 15 min in 10 �l of Tris-EDTA (TE) buffer containing 150 mMKCl. Primer extension reactions were started by the addition of 24 �l of exten-sion solution (20 mM Tris-HCl [pH 8.4], 10 mM MgCl2, 10 mM DTT, 2 mMdeoxynucleoside triphosphates [dNTPs], 1 U/ml AMV reverse transcriptase) andwere carried out at 42°C for 60 min. Samples were then precipitated and ana-lyzed on a sequencing gel. A GA ladder was made by using the Maxam andGilbert method (47) to sequence a grlA fragment that was generated by PCRusing primers MT157 and [32P]MT161.

DNase I footprinting. The DNA fragments used for footprinting analysis wereamplified by PCR using primer pairs [32P]MT130/MT160, [32P]MT147/MT148,and MT147/[32P]MT148 (for a Ler-His binding assay) and MT157/[32P]MT161(for an H-NS–His binding assay) with plasmid pMTgrlRA as the template. Forthe Ler-His DNA binding control experiment, primer pair rpoDForw/[32P]rpo-DRev was used to amplify a 304-bp DNA fragment corresponding to nucleotides1200 to 1503 of the coding sequence of rpoD, using C. rodentium genomic DNAas the template. The labeled fragments were then incubated with variousamounts of Ler-His or H-NS–His in 25 �l of binding buffer (10 mM Tris-HCl[pH 8.0], 50 mM NaCl, 2 mM DTT, 5% glycerol, 0.5 mg/ml BSA, 2 mM CaCl2,1 mM MgCl2) for 15 min, after which each sample was treated with 0.5 U ofDNase I (New England Biolabs) at room temperature for 30 s. The reactionswere terminated by the addition of phenol. Samples were precipitated withethanol and analyzed on a sequencing gel.

RESULTS

Activation of grlRA transcription by RegA in the presence ofbicarbonate. Microarray analysis of gene expression by C. ro-dentium has shown that transcription of the grlR and grlA genesis activated 5-fold by RegA in the presence of bicarbonate (63).To determine if the upregulation we observed in the nativehost was due to the direct interaction of RegA with the grlRApromoter, we performed -galactosidase analysis. A series oftranscriptional fusions to the lacZ reporter gene, encompass-ing different lengths of the grlRA regulatory region, were con-

structed using the single-copy plasmid pMU2385 (Table 1).These grlRA-lacZ fusions were designated grlRA-1, -2, -3, and-4, respectively. All four grlRA-lacZ fusions contained a com-mon 3� end at position �263 relative to the start site of grlRAtranscription (1) but carried variable 5� ends at positions �497,�391, �222, and �72, respectively (Fig. 1 and 2A). Each ofthe constructs (grlRA-1, -2, -3, and -4) and the control plasmidpMU2385 was transformed into E. coli K-12 strain MC4100,which carries either plasmid pACYC184 (RegA� control) orpEH6 (pACYC184 expressing RegA). The expression levels of-galactosidase by the various constructs in the RegA� andRegA� backgrounds were assessed by measuring -galactosi-dase activity following the growth of the MC4100 derivatives inLB medium in the absence or presence of 45 mM NaHCO3.

Constructs grlRA-1 and grlRA-2 exhibited similar expres-sion patterns (Fig. 2B). In the RegA� host, approximately 230U of -galactosidase activity was produced by grlRA-lacZ withor without NaHCO3. In the RegA� host, the levels of expres-sion of grlRA-1 and grlRA-2 increased marginally, 1.6-fold,in the absence of NaHCO3, but in the presence of NaHCO3,the grlRA promoter activities from grlRA-1 and grlRA-2showed a more pronounced enhancement (to 600 U of -ga-lactosidase activity), resulting in 3.0- and 3.6-fold-increasedactivations, respectively (Fig. 2B).

Relative to grlRA-1 and grlRA-2, much stronger expression(approximately 2,000 U of -galactosidase activity) fromgrlRA-3 was seen in both the RegA� and RegA� backgroundsregardless of the presence of NaHCO3 (Fig. 2B). Like that ongrlRA-3, the grlRA promoter carried on grlRA-4 was alsohighly expressed (about 2,500 U), and this construct also wasnot activated by RegA. -Galactosidase analysis of the fourconstructs in isogenic native host strains (RegA� and RegA�)of C. rodentium showed patterns of regulation and expressionsimilar to those observed in E. coli MC4100 (Fig. 2C).

Taken together, these results indicate that (i) transcriptionof the grlRA promoter is activated by RegA, (ii) NaHCO3

facilitates the RegA-mediated activation of grlRA transcrip-tion, (iii) the region between positions �497 and �222 con-tains a cis-acting element responsible for RegA activation, and(iv) the region between position �391 and �72 includes acis-acting element involved in transcriptional repression of thegrlRA promoter.

RegA binds to the regulatory region of grlRA. To determineif RegA binds directly to the promoter region of grlRA, anelectrophoretic mobility shift assay (EMSA) was performedusing purified MBP::RegA (62). Initially, two DNA fragmentswhich extended from positions �780 to �390 and from �398to �43 relative to the transcription start site of grlRA (Fig. 1and 3) were amplified by PCR with 32P-labeled primers (seeMaterials and Methods). Following incubation of each frag-ment with various amounts of MBP::RegA and 45 mMNaHCO3 at 37°C for 20 min, the samples were analyzed on anative polyacrylamide gel. At concentrations of 140 and 280nM, MBP::RegA was able to shift and form a stable complexwith the fragment from position �398 to �43 (Fig. 3, panel B)but failed to bind to the fragment from position �780 to �390(Fig. 3, panel A). These results suggested that the binding sitefor RegA was between positions �398 and �43.

To localize the RegA binding region more precisely, twosections from the �398-to-�43 fragment (positions �398 to



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

�165 and �186 to �43) were analyzed separately. EMSAshowed that, in the presence of bicarbonate, MBP::RegA wasable to bind to the �398-to-�165 fragment but not to the�186-to-�43 fragment (Fig. 3, panels C and D, respectively).We also examined the effect of bicarbonate on the binding

affinity of MBP::RegA for fragment �398 to �165. The results(Fig. 3, panel C) showed that, in the presence of bicarbonate,MBP::RegA was able to completely shift the DNA fragmentfrom positions �398 to �165, forming a discrete protein-DNAcomplex at an MBP::RegA concentration of 280 nM. In the

FIG. 1. Sequence of the grlRA fragment described throughout the text. The start site of transcription of the grlRA promoter previously identified(1) and the start site of transcription of the grlA promoter are marked with angled arrows. The gene coding sequences for grlR and grlA arehighlighted in gray. The translational start codons (ATG) of GrlR and GrlA and the stop codons, TAA for GrlR and TAG for GrlA, are boxed.The �10 (GTTAAT) and �35 (TAAATA) regions of the grlA promoter are underlined, and the �10 (TATATT) and �35 (TTGGAA) regionsof the grlRA promoter previously identified (1) are double underlined. TGn motifs are indicated by asterisks. The RegA, Ler, and H-NS bindingsites identified in this study are indicated by dashed, dotted, and solid lines over the sequences, respectively. The numbers on the right side of thesequence represent positions relative to the start site of transcription of grlRA, and the numbers in parentheses represent positions relative to thestart site of transcription of grlA.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

absence of bicarbonate, by contrast, only a small proportion ofthe DNA fragment was bound by MBP::RegA at the sameprotein concentration. The protein-DNA complex that didform appeared to be smeared, indicating weaker DNA bindingby MBP::RegA in the absence of bicarbonate. The require-ment for bicarbonate for efficient RegA binding and the RegAbinding region located by EMSA agreed with the results ob-

tained from the analysis of the various grlRA fragments in the-galactosidase assay (see above).

H-NS and StpA negatively regulate expression of grlRA.-Galactosidase analysis of the grlRA regulatory region indi-cated the presence of a cis-acting element involved in repres-sion of the grlRA promoter (see above). To test if H-NS and itsparalog StpA negatively regulate grlRA transcription, the fourplasmids containing the various grlRA-lacZ transcriptional fu-sions (grlRA-1, -2, -3, and -4) were each transformed into

FIG. 2. Analysis of the effects of RegA and bicarbonate on thetranscription of the grlRA promoter by using a series of grlRA-lacZfusions. (A) A schematic representation of the grlRA regulatory region.The bent arrow indicates the previously reported transcription startsite (1). rorf3 is the divergently transcribed gene upstream of grlR. Thepositions of the 5� and 3� ends of the grlRA regulatory region containedin each fusion, with respect to the transcriptional start site of grlRA, areshown in parentheses to the left of the image. The names of thegrlRA-lacZ fusions, grlRA-1, -2, -3, and -4, are shown at the right of thefigure. The gray rectangle represents the promoterless lacZ structuralgene carried on plasmid pMU2385. Expression of the grlRA-lacZ fu-sions and the control plasmid, pMU2385, was analyzed in E. coli strainMC4100 (B) and C. rodentium strain ICC169 �regA (EMH1) (C),containing either plasmid pEH6 (RegA�) or plasmid pACYC184(RegA�) in the absence or presence of 45 mM NaHCO3. The -ga-lactosidase activities (Miller units) shown are the means of results fromthree independent experiments, with standard deviations shown aserror bars.

FIG. 3. Localization of the RegA binding site on grlRA by EMSA.The top portion of the figure shows a schematic representation of thegrlRA regulatory region and the fragments, A to D, used in the EMSA.The panels, labeled A to D, correspond to the results obtained withfragments A to D. The bent arrow indicates the previously reportedtranscription start site (1). 32P-labeled PCR fragments were eachmixed with various amounts of purified MBP::RegA in the presence orabsence of 45 mM NaHCO3. Following incubation at 37°C for 20 min,the samples were analyzed on native polyacrylamide gels. Fragments A(�780 to �390) and B (�398 to �43) were incubated with 0, 35, 70,140, and 280 nM MBP::RegA (lanes 1 to 5, respectively). Fragments C(�398 to �165) and D (186 to �43) were incubated with 0, 70, 140,and 280 nM MBP::RegA (lanes 1 to 4, respectively) in the presence orabsence of 45 mM NaHCO3. C indicates protein-DNA complexes, andF indicates free DNA fragments.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

isogenic E. coli K-12 strains MC4100 (wild type), PD145 (hns),and BSN29 (hns stpA), after which -galactosidase activity wasdetermined for each of the transformants grown in LB at 37°C.

In the case of grlRA-1, a major difference with regard togrlRA expression in the three different host strains was seen(Fig. 4). In MC4100 (wild type), grlRA-1 expressed 200 units of-galactosidase, which increased 7- and 40-fold, to 1,400 and7,800 U, in PD145 (hns) and BSN29 (hns stpA), respectively.Similar regulatory effects by H-NS and StpA were also ob-served for grlRA-2. By contrast, the difference in grlRA expres-sion in the three hosts was far less for grlRA-3, for which, dueto stronger expression of the grlRA promoter in MC4100 (1,800U), the observed increase in expression was only 1.6-fold inPD145 (2,800 U) and 1.9-fold in BSN29 (3,500 U). As withgrlRA-4, the H-NS- and StpA-mediated effects on grlRA ex-pression were almost negated, as essentially the same levels of-galactosidase were measured in the three different back-grounds. The most likely explanation for the increased tran-scriptional levels of grlRA-3 and -4 in the MC4100 backgroundis the removal of the H-NS- and StpA binding sites.

The data presented here clearly demonstrated the involve-ment of H-NS and StpA in the repression control of the grlRApromoter and agree with the in vitro H-NS binding data re-ported by Barba et al. (1). By using the four grlRA-lacZfusions, we were able to localize the region responsible forH-NS- and StpA-mediated repression to between positions�391 and �72.

Ler can bind to the upstream region of grlRA. To determineif Ler bound directly to the promoter region of grlRA, a DNaseI footprinting assay was performed using purified Ler-His (seeMaterials and Methods). A 234-bp DNA fragment containingthe grlRA fragment, which extended from positions �398 to�165 (relative to the transcription start site of grlRA) (Fig. 1),was labeled at the 5� end of the coding strand. Followingincubation in various concentrations of Ler-His (ranging from125 nM to 1.5 �M), the reaction mixes were treated withDNase I. After ethanol precipitation, the samples were ana-lyzed on a sequencing gel. Weak protection of DNA was seenat the Ler-His concentrations of 125 and 500 nM (Fig. 5A). Ata higher concentration of 1.5 �M, however, the region betweenpositions �367 and �228 (relative to the transcription startsite of grlRA) was strongly protected (Fig. 5A). In contrast,

under the same conditions, Ler-His was unable to bind to theDNA fragment of the C. rodentium housekeeping gene rpoD(Fig. 5B).

Detection of promoter activity for the grlA gene. AlthoughgrlR and grlA have previously been shown to transcribe as asingle unit (1), this operon contains a short intergenic region of67 bp between the stop codon of grlR and the start codon ofgrlA (Fig. 1). To determine if the region upstream of the codingsequence of grlA harbored a promoter(s), we made two con-structs in which the regions between positions �399 and �157(grlA-1) and positions �107 and �157 (grlA-2) relative to thestart site of grlA translation were each fused with the lacZ

FIG. 4. In vivo analysis of the effects of H-NS and StpA on tran-scription of grlRA. The expression of the grlRA-lacZ fusions (grlRA-1to -4) was monitored in E. coli strain MC4100 and its isogenic hns(PD145) and hns stpA (BSN29) mutants. The -galactosidase activities(Miller units) shown are the means of three independent experiments,with standard deviations shown as error bars.

FIG. 5. Binding of Ler to the grlRA regulatory region. (A) A DNaseI footprinting assay was performed on a 234-bp DNA fragment span-ning positions �398 to �165 relative to the transcription start site ofgrlRA (Fig. 1). Samples were incubated with 0, 125, 500, and 1,500 nMLer-His (lanes 2 to 5, respectively). Lane 1 is a GA DNA laddergenerated by Maxam-Gilbert sequencing of the same DNA fragment.The vertical line indicates the region protected by Ler-His. (B) Acontrol experiment was performed using a 304-bp DNA fragment ofthe C. rodentium housekeeping gene rpoD. Samples were incubatedwith 0, 125, 500, and 1,500 nM Ler-His (lanes 2 to 5, respectively).Lane 1 is a GA DNA ladder generated by Maxam-Gilbert sequencingof the same fragment, with the numbers indicating the nucleotidepositions relative to the translational start site.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

structural gene on plasmid pMU2385 (Table 2 and Fig. 6A).Constructs grlA-1 and grlA-2 along with the control plasmid,pMU2385, were each introduced into E. coli strain MC4100. Invivo analysis showed that grlA-1 produced very low levels of-galactosidase (2.3 U), but grlA-2, which contained a shortergrlA fragment, exhibited significant promoter activity (33 U).

To test if Ler was able to activate the putative grlA promoter,we introduced plasmid pMTLer (pBR322 expressing Ler; Ta-ble 2) or the control plasmid pBR322 into the MC4100 deriv-atives containing grlA-1 or grlA-2. While introduction ofpBR322 into these strains had no effect on grlA-1 or grlA-2expression (data not shown), the presence of pMTLer resultedin a 9-fold increase in transcriptional activity (20 U) fromgrlA-1 but not from grlA-2 (Fig. 6B). Analysis of the effect ofLer on grlA expression in isogenic strains (Ler� and Ler�) ofC. rodentium showed regulatory effects of Ler on grlA expres-sion similar to those seen in E. coli (Fig. 6C).

To test if RegA played a role in the control of the putativegrlA promoter, we performed a -galactosidase assay using E.coli MC4100 derivatives, which contained grlA-1 or grlA-2 witheither pEH6 (pACYC184 expressing RegA) or pACYC184(control). Expression of RegA caused a 3-fold increase in tran-scription from grlA-1, but not from grlA-2, and this RegA-mediated stimulation of grlA expression was dependent on thepresence of bicarbonate (45 mM) in the culture medium (datanot shown).

In summary, our results demonstrated the presence of sig-nificant promoter activity specific for the grlA gene, which wasupregulated markedly by Ler and less so by RegA. By usingtwo lacZ fusions, we were able to localize the promoter activityto a region downstream of the �107 position relative to the

start codon of grlA and the Ler binding region to somewherebetween positions �339 and �107. Moreover, the apparentdifference in transcriptional activity between grlA-1 and grlA-2indicated that the putative grlA promoter was subject to neg-ative control by one or more repressors.

Mapping the start site of grlA transcription. A single-roundin vitro transcription experiment was performed to map thestart site of grlA transcription. In this assay, two linear grlAfragments encompassing positions 1155 to 1353 and 1155 to1422, were amplified using primer pairs MT146/MT144 andMT146/MT145, respectively, and used as DNA templates (Fig.1). In the presence of E. coli �70 RNA polymerase, each PCRyielded a single transcript, indicating the presence of only onepromoter in the DNA fragments used (Fig. 7A). Transcriptionfrom the templates from positions 1155 to 1353 and 1155 to1422 produced 61/62-nucleotide and 130/131-nucleotide tran-scripts, respectively. The size difference of the two transcriptsmatched the differences in length of the two DNA templates attheir 3� ends. Based on these data, the start site of transcriptionfor grlA was mapped to either the thymine or the adenineresidue at position 1292 or 1293, which is 24 or 23 bp upstream

FIG. 6. In vivo analysis of Ler-mediated activation of the grlA pro-moter. (A) A schematic representation of the grlA regulatory region.The bent arrow indicates the predicted translational start site. The 5�and 3� ends of the grlA-lacZ fusions (grlA-1 and -2) relative to thetranslational start site of grlA are shown in parentheses to the left ofthe fusion. Expression of the grlA-lacZ fusions and the control plasmid,pMU2385, was analyzed in E. coli strain MC4100 and MC4100 con-taining plasmid pMTLer (Ler�) (B) and C. rodentium strains EMH1(Ler�) and EMH8 (Ler�) (C). The -galactosidase activities (Millerunits) shown are the means of three independent experiments, withstandard deviations shown as error bars.

FIG. 7. Determination of the start site of grlA transcription.(A) Runoff in vitro transcription was performed using linear grlRAtemplates from positions 1155 to 1422 and 1155 to 1353 (for details,see Fig. 1). The 61/62- and 130/131-nucleotide (nt) transcripts pro-duced by the two templates are indicated by arrows. The GA ladder,which served as a molecular weight (MW) standard, was made bysequencing the grlA fragment that was generated by PCR usingprimers [32P]MT147 and MT142. (B) Primer extension analysis wasperformed using total RNA from E. coli strains BSN29 (control)and BSN29 containing plasmid grlA-1. The GA sequence ladderwas prepared using the grlA PCR fragment generated using primersMT157 and [32P]MT161. P indicates a primer, and E indicates theextended product.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

of the putative start codon for the GrlA protein, respectively(Fig. 1).

To confirm this finding, primer extension analysis was car-ried out using total RNA from E. coli BSN29 (control) andBSN29 containing plasmid grlA-1. As the grlA promoter is aweak promoter, BSN29 (hns stpA) was chosen as the hoststrain to maximize transcription under nonrepressive condi-tions (by H-NS and StpA regulation of grlA; see below). Theinitiation of transcription of grlA was probed by using primerMT161, located 60 bp downstream of the translational startsite of grlA (Fig. 7B). This result agreed with that obtainedfrom in vitro runoff transcription assay.

Inspection of the sequence immediately upstream of thestart site of transcription (the adenine residue [A] is designatedposition �1) revealed the presence of a putative �10 (GTTAAT) region and a TGn motif (Fig. 1). Eighteen nucleotidesupstream of the �10 sequence is a potential �35 region(TAAATA).

RegA binds to the regulatory region of grlA. To determine ifRegA bound directly to the promoter region of grlA, an EMSAwas performed using purified MBP::RegA (62). Two DNAfragments, which extended from positions �364 to �61 andfrom positions �79 to �407, relative to the transcription startsite of grlA (Fig. 1), were amplified by PCR with 32P-labeledprimers (see Materials and Methods). At concentrations of 140and 280 nM, MBP::RegA was able to shift the �364-to-�61fragment (Fig. 8, panel A) but not the �79-to-�407 fragment(Fig. 8, panel B). In addition, MBP::RegA formed a stablecomplex with the �364-to-�61 fragment at a concentration of280 nM. These results mapped the binding site for RegA tobetween positions �364 and �61.

Ler can bind to the upstream region of grlA. To provideadditional evidence for the involvement of Ler in grlA activa-

tion, a DNase I footprinting assay was performed using puri-fied Ler-His (see Materials and Methods). A 296-bp DNAfragment containing the grlA fragment, which extended from�364 to �69 (relative to the transcription start site of grlA; Fig.1), was labeled in separate reactions at the 5� ends of both thecoding and noncoding strands. Following incubation in variousconcentrations of Ler-His (from 125 nM to 1.5 �M), the re-action mixes were treated with DNase I. After ethanol precip-itation, the samples were analyzed on a sequencing gel. AtLer-His concentrations of 500 nM and 1.5 �M, the regionbetween �320 and �114 (relative to the transcription start siteof grlA) of the coding strand and the corresponding region onthe noncoding strand (between �127 and �283) were pro-tected, demonstrating that the grlA promoter region containssequences recognized by Ler (Fig. 9). A Ler-dependent DNaseI-hypersensitive site was observed at position �208 on thenoncoding strand, suggesting that the binding of Ler to the grlAregulatory region induced a structural change in the DNA thatresulted in increased cleavage by DNase I.

Transcription of the grlA promoter is repressed by H-NSand StpA. -Galactosidase analysis of grlA-1 and grlA-2 indi-cated that grlA expression was subject to repression control

FIG. 9. Binding of Ler to the grlA regulatory region. DNase I foot-printing assays were performed on the bottom (A) and top (B) strandsof a DNA fragment spanning 294 nucleotides between positions �364and �69 relative to the transcription start site of grlA (Fig. 1), whichwere incubated with 0, 125, 500, and 1,500 nM Ler-His (lanes 1 to 4,respectively). Lane 5 is the GA DNA ladder generated by Maxam-Gilbert sequencing of the same fragment. An arrow marks the positionof a Ler-dependent DNase I-hypersensitive site. The vertical linesindicate the DNA regions protected by Ler-His. The numbering isrelevant to the start site of transcription of grlA.

FIG. 8. Localization of the RegA binding site in grlA by EMSA.32P-labeled PCR fragments were each mixed with various amounts ofpurified MBP::RegA in the presence or absence of 45 mM NaHCO3.Following incubation at 37°C for 20 min, the samples were analyzed onnative polyacrylamide gels. Fragments from �364 to �61 (A) and �79to �407 (B) were incubated with 0, 70, 140, and 280 nM MBP::RegA(lanes 1 to 4, respectively). C indicates protein-DNA complexes, and Findicates free DNA fragments.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

(see above). As the DNA sequence surrounding the grlA pro-moter region is highly AT rich and is predicted by the bend.itprogram (http://hydra.icgeb.trieste.it/dna/index.php) to behighly curved (Fig. 10A), we hypothesized that H-NS and StpAare responsible for the repression. To test this, grlA-1 andgrlA-2, were analyzed in strains MC4100 (wild type), PD145(hns), and BSN29 (hns stpA). Relative to the promoter activ-ities in MC4100 (wild type), both constructs showed enhancedgrlA expression in PD145 (hns) (Fig. 10B). In BSN29 (hnsstpA), further increases in grlA transcription (compared to thepromoter activities in the MC4100) were observed for bothgrlA-1 and grlA-2. These findings confirmed the involvementof H-NS and StpA in the negative regulation of grlA expres-sion. Furthermore, the fact that deletion of the upstream se-quence in the grlA-2 construct resulted in a large increase inpromoter activity in E. coli MC4100 points to the partial re-moval of the H-NS and StpA binding sites.

We next carried out a DNase I footprinting assay to deter-

mine the H-NS binding site for the grlA promoter. A 189-bpDNA fragment, which extended from �84 to �105 (relative tothe transcription start site of grlA; Fig. 1), was labeled at the 5�end of the noncoding strand. The DNA fragment was incu-bated with various amounts of purified H-NS–His (from 100nM to 1.6 �M) and treated with DNase I. Samples were thenanalyzed on a sequencing gel. At H-NS–His concentrations of800 nM and 1.6 �M, the region between positions �48 and�73 (relative to the transcription start site of grlA; Fig. 1) ofthe noncoding strand was protected, demonstrating that H-NSbinds specifically to the grlA promoter region (Fig. 10C). AnH-NS-dependent DNase I-hypersensitive site was observed atposition �54 on the noncoding strand.

DISCUSSION

The regulatory network which controls the expression of thevirulence genes of A/E pathogens is complex. Much of this

FIG. 10. Analysis of the effects of H-NS and StpA on transcription from the grlA promoter. (A) The bend.it program (http://hydra.icgeb.trieste.it/dna/index.php) was used for DNA curvature analysis. Numbering of base positions is relative to the start site of transcription from the grlApromoter. Regions with an arbitrary value of �5 degrees per helical turn of DNA (i.e., above the dashed line) represent curved sequences.(B) Expression levels of the grlA-lacZ fusions (grlA-1 and grlA-2) were monitored in E. coli strain MC4100 and its isogenic hns (PD145) and hnsstpA (BSN29) mutants. The -galactosidase activities (Miller units) shown are the means of three independent experiments, with standarddeviations shown as error bars. (C) Binding of H-NS–His to the grlA regulatory region. A DNase I footprinting assay was performed on a DNAfragment, spanning 189 nucleotides between positions �84 and �105 relative to the transcription start site of grlA, incubated with 0, 100, 200, 400,800, 1,600, and 0 nM H-NS–His (lanes 1 to 7, respectively). The corresponding GA DNA ladder was generated by Maxam-Gilbert sequencing ofthe same fragment. An arrow marks the position of an H-NS-dependent DNase I-hypersensitive site. The vertical line indicates the DNA regionprotected by H-NS–His. The numbering is relevant to the start site of transcription of grlA.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

regulation centers on controlling the expression of ler (fromthe LEE1 promoter), which encodes the master regulator ofthe LEE. In C. rodentium, the expression of the LEE1 pro-moter can be repressed by H-NS and Ler but is activated byGrlA (Fig. 11) (1, 14). In contrast to how it affects LEE1, Leris responsible for the positive control of the LEE2 to LEE5operons and activation of transcription of the grlRA operon.The reciprocal stimulation of transcription of the LEE1 andgrlRA operons by GrlA and Ler, respectively, leads to theformation of a positive feedback regulatory loop (1).

Three lines of evidence indicate that RegA activates tran-scription of the grlRA promoter: (i) microarray analysis showedthat a RegA� C. rodentium strain produced five times moregrlRA mRNA than an isogenic regA mutant (63), (ii) -galac-tosidase assays using grlRA-lacZ transcriptional fusions dem-onstrated bicarbonate-mediated activation by RegA in E. coliK-12 and C. rodentium, and (iii) purified RegA::MBP fusionprotein was able to shift a DNA fragment containing the grlRApromoter and its immediate upstream region. It appears thatthe binding sites for RegA, Ler, H-NS, and StpA overlapwithin this region in both C. rodentium (this study) and E. coli(1). Like Ler and other AraC-like virulence regulators, such asPerA (from EPEC) (22), Rns (from enterotoxigenic E. coli)(7), ToxT (from Vibrio cholerae) (4), and AggR (from entero-aggregative E. coli) (42), RegA acts as an antirepressor toovercome H-NS-mediated gene silencing (19, 56). However,the degree of RegA-mediated activation of different operonsvaries considerably (25). For example, RegA can stimulatetranscription of the adcA and kfc operons by more than 50-foldand activate the expression of the gene encoding a dispersin-like factor by about 130-fold (25). By contrast, activation byRegA at the grlRA promoter is only 3- to 5-fold. Although wehave not yet been able to identify a consensus sequence forRegA binding, data from DNase I footprinting experiments ofthe adcA and kfcC promoter regions demonstrated that RegA

binds to AT-rich sequences and that the interaction of RegAwith this region causes structural distortion of DNA (62). Inthe case of the grlRA promoter, although MBP::RegA boundspecifically to a region between positions �398 and �165 rel-ative to the start site of transcription of the grlRA promoter inthe presence of bicarbonate (Fig. 3C), a DNase I protectionassay did not reveal a clear RegA footprint (data not shown),probably due to relatively weak binding of RegA to this region.Notwithstanding the moderate degree of RegA-mediated ac-tivation of the grlRA promoter itself, the contribution of RegAto the grlRA-ler regulatory circuit allows the LEE to respond tothe gut-associated environmental factor bicarbonate.

Prior to this study, only a single promoter located upstreamof the grlR structural gene had been identified for the expres-sion of the entire grlRA operon. Transcription of this promoteris activated by Ler via binding to its upstream region (1). If thetwo proteins are synthesized from the same mRNA transcript,we would expect to find a fixed ratio between the activator(GrlA) and antiactivator (GrlR). In this work, however, wedemonstrated the presence of a separate �70 promoter specif-ically responsible for grlA transcription. The transcriptionalstart site of grlA was mapped to 23 bp upstream of the grlAtranslational start site (Fig. 1). The short intergenic regionbetween the coding sequences of grlR and grlA (67 bp) is justlong enough to harbor the components of the grlA promoter.The deduced grlA core promoter contains a putative �10 hex-amer (GTTAAT) and �35 hexamer (TAAATA) and an 18-bpspacer. However, this promoter also possesses an extended�10 (TGn) motif, and its spacer is extremely AT rich (AT/GCratio of 8:1). The TGn motif probably compensates for a poor�35 region, while the AT richness contributes to the promoterstrength (5, 30, 33). As for grlRA, a number of other bacterialoperons possess internal promoters for supplementary expres-sion of downstream genes (35, 58, 59). For example, the E. colirplKAJL-rpoBC operon, which codes for ribosomal proteinsL11, L1, L10, and L7/L12, as well as the and � subunits ofRNA polymerase, contains two major upstream promoters,rplKp and rplJp, and two minor downstream promoters, rplLpand rpoBp (45). These internal promoters permit differentialexpressions of the various genes within the operon.

In an E. coli background, BSN29 (hns stpA), the grlA pro-moter exhibited moderately strong activity (Fig. 10B). In thewild-type E. coli strain, MC4100, however, expression of thegrlA promoter was repressed more than 70-fold by H-NS andStpA. The region surrounding the grlA promoter is AT rich(68%) and highly curved (Fig. 10A) and was shown to interactspecifically with H-NS in vitro. In vivo analysis showed thatboth H-NS and StpA proteins inhibited transcription from thegrlA promoter. In E. coli MC4100, H-NS- and StpA-mediatedtranscriptional silencing of the grlA promoter was partiallyreversed by Ler. Although the transcriptional activity of thegrlA promoter is relatively moderate, even when activated, itcould nevertheless play a role in adjusting the ratio of GrlA toGrlR under different growth or environmental conditions. Thisis likely to be a factor in LEE regulation, as the ratio ofintracellular levels of the activator and antiactivator will influ-ence the dynamic operations of the Ler-GrlA regulatory loop.

Ler, a homolog of H-NS, has previously been shown to bindcooperatively to extended regions of several LEE promoters(1, 2, 24, 54). Like H-NS, Ler does not recognize a specific

FIG. 11. A model for induction of the GrlA-Ler regulatory cascadein C. rodentium by RegA and bicarbonate ions. When C. rodentium isgrowing outside its host, transcription of the LEE1, grlRA, and grlApromoters is silenced by H-NS and StpA. Upon entering the intestinallumen, C. rodentium encounters bicarbonate, which enhances theDNA binding capacity of RegA (A), leading to the expression of GrlAthrough RegA-mediated activation of the grlRA and grlA promoters(B). (C) GrlA then activates transcription of the LEE1 promoter,resulting in enhanced synthesis of Ler. Ler further induces GrlA pro-duction, accelerating the rate of the synthesis of both Ler and GrlA,and activates the transcription of other promoters (LEE2-LEE5) onthe LEE pathogenicity island.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

DNA sequence (e.g., DNA palindromes), as is the case withother classical regulators (e.g., cyclic AMP receptor protein[CRP] and AraC) but binds to AT-rich regions around itstarget promoters. Our DNase I protection assay (Fig. 9)showed that Ler bound to a large section of the grlA promoterregion spanning about 200 nucleotides between positions �320and �114 in the coding strand and �283 and �127 in thenoncoding strand. These results agree with those observed inan EMSA in which Ler was shown to bind to the same grlAfragment (1). This region has been proposed as a downstreambinding site for Ler-mediated activation of the grlRA promoter(1). Given that the newly identified grlA promoter is located ashort distance downstream of this sequence, it is likely that it isalso directly responsible for Ler-mediated expression of grlA.Expression of the grlA promoter was also upregulated by RegAin the presence of bicarbonate. Both in vivo deletion analysisand EMSA demonstrated a direct role of RegA in grlA acti-vation.

A DNase I protection assay showed that Ler bound to thesame grlRA promoter region as that determined for RegA byEMSA (Fig. 1). Further analysis indicated that RegA and Leracted independently rather than synergistically to activate tran-scription of the grlRA promoter (data not shown). The findingsof this study together with published data have allowed us todevelop a model for the induction of the LEE positive regu-latory loop of C. rodentium (Fig. 11). When C. rodentium isgrowing in environments outside its host where the tempera-ture is generally lower than 37°C, transcription of the LEE1,grlRA, and grlA promoters is silenced by H-NS and StpA. Uponentering the intestinal lumen, C. rodentium encounters bicar-bonate, which enhances RegA binding to DNA, leading to theexpression of GrlA through RegA-mediated activation of thegrlRA and grlA promoters. GrlA then activates transcription ofthe LEE1 promoter, resulting in enhanced expression of theLer protein. Ler further induces GrlA production, acceleratingthe rate of the synthesis of both Ler and GrlA, and activatesthe transcription of other promoters (LEE2-LEE5) on theLEE pathogenicity island that are essential for efficient assem-bly of the T3SS and virulence. Once optimal levels of Ler andGrlA are reached, Ler negatively regulates its own expressionand, hence, that of GrlA by repressing the LEE1 operon.Elucidation of the mechanics of this finely tuned system pro-vides fascinating new insights into the subtle elegance andcomplexity of virulence gene regulation in A/E enterobacteria.

ACKNOWLEDGMENTS

Work in our laboratory is supported by research grants from theAustralian National Health and Medical Research Council and theAustralian Research Council. M. Tauschek is supported by a PeterDoherty Fellowship of the Australian National Health and MedicalResearch Council, D. Hocking is the recipient of a Melbourne Re-search Scholarship, and A. Tan is the recipient of an Australian Post-graduate Award.

REFERENCES

1. Barba, J., V. H. Bustamante, M. A. Flores-Valdez, W. Deng, B. B. Finlay, andJ. L. Puente. 2005. A positive regulatory loop controls expression of the locusof enterocyte effacement-encoded regulators Ler and GrlA. J. Bacteriol.187:7918–7930.

2. Berdichevsky, T., D. Friedberg, C. Nadler, A. Rokney, A. Oppenheim, and I.Rosenshine. 2005. Ler is a negative autoregulator of the LEE1 operon inenteropathogenic Escherichia coli. J. Bacteriol. 187:349–357.

3. Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L. Heyneker,

H. W. Boyer, J. H. Crosa, and S. Falkow. 1977. Construction and character-ization of new cloning vehicles. II. A multipurpose cloning system. Gene2:95–113.

4. Brown, R. C., and R. K. Taylor. 1995. Organization of tcp, acf, and toxT geneswithin a ToxT-dependent operon. Mol. Microbiol. 16:425–439.

5. Burr, T., J. Mitchell, A. Kolb, S. Minchin, and S. Busby. 2000. DNA se-quence elements located immediately upstream of the �10 hexamer inEscherichia coli promoters: a systematic study. Nucleic Acids Res. 28:1864–1870.

6. Bustamante, V. H., F. J. Santana, E. Calva, and J. L. Puente. 2001. Tran-scriptional regulation of type III secretion genes in enteropathogenic Esch-erichia coli: Ler antagonizes H-NS-dependent repression. Mol. Microbiol.39:664–678.

7. Caron, J., L. M. Coffield, and J. R. Scott. 1989. A plasmid-encoded regula-tory gene, rns, required for expression of the CS1 and CS2 adhesins ofenterotoxigenic Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 86:963–967.

8. Casadaban, M. J. 1976. Transposition and fusion of the lac genes to selectedpromoters in Escherichia coli using bacteriophage lambda and mu. J. Mol.Biol. 104:541–555.

9. Chalker, A. F., H. W. Minehart, N. J. Hughes, K. K. Koretke, M. A. Lonetto,K. K. Brinkman, P. V. Warren, A. Lupas, M. J. Stanhope, J. R. Brown, andP. S. Hoffman. 2001. Systematic identification of selective essential genes inHelicobacter pylori by genome prioritization and allelic replacement mu-tagenesis. J. Bacteriol. 183:1259–1268.

10. Chang, A. C., and S. N. Cohen. 1978. Construction and characterization ofamplifiable multicopy DNA cloning vehicles derived from the P15A crypticminiplasmid. J. Bacteriol. 134:1141–1156.

11. Creasey, E. A., R. M. Delahay, S. J. Daniell, and G. Frankel. 2003. Yeasttwo-hybrid system survey of interactions between LEE-encoded proteins ofenteropathogenic Escherichia coli. Microbiology 149:2093–2106.

12. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad.Sci. U. S. A. 97:6640–6645.

13. Deng, W., Y. Li, B. A. Vallance, and B. B. Finlay. 2001. Locus of enterocyteeffacement from Citrobacter rodentium: sequence analysis and evidence forhorizontal transfer among attaching and effacing pathogens. Infect. Immun.69:6323–6335.

14. Deng, W., J. L. Puente, S. Gruenheid, Y. Li, B. A. Vallance, A. Vazquez, J.Barba, J. A. Ibarra, P. O’Donnell, P. Metalnikov, K. Ashman, S. Lee, D.Goode, T. Pawson, and B. B. Finlay. 2004. Dissecting virulence: systematicand functional analyses of a pathogenicity island. Proc. Natl. Acad. Sci.U. S. A. 101:3597–3602.

15. Dersch, P., S. Kneip, and E. Bremer. 1994. The nucleoid-associated DNA-binding protein H-NS is required for the efficient adaptation of Escherichiacoli K-12 to a cold environment. Mol. Gen. Genet. 245:255–259.

16. Dorman, C. J. 2004. H-NS: a universal regulator for a dynamic genome. Nat.Rev. Microbiol. 2:391–400.

17. Elliott, S. J., V. Sperandio, J. A. Giron, S. Shin, J. L. Mellies, L. Wainwright,S. W. Hutcheson, T. K. McDaniel, and J. B. Kaper. 2000. The locus ofenterocyte effacement (LEE)-encoded regulator controls expression of bothLEE- and non-LEE-encoded virulence factors in enteropathogenic and en-terohemorrhagic Escherichia coli. Infect. Immun. 68:6115–6126.

18. Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. K. Deng,L. C. Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 1998. Thecomplete sequence of the locus of enterocyte effacement (LEE) from en-teropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28:1–4.

19. Fang, F. C., and S. Rimsky. 2008. New insights into transcriptional regulationby H-NS. Curr. Opin. Microbiol. 11:113–120.

20. Friedberg, D., T. Umanski, Y. Fang, and I. Rosenshine. 1999. Hierarchy inthe expression of the locus of enterocyte effacement genes of enteropatho-genic Escherichia coli. Mol. Microbiol. 34:941–952.

21. Goldberg, M. D., M. Johnson, J. C. Hinton, and P. H. Williams. 2001. Roleof the nucleoid-associated protein Fis in the regulation of virulence proper-ties of enteropathogenic Escherichia coli. Mol. Microbiol. 41:549–559.

22. Gomez-Duarte, O. G., and J. B. Kaper. 1995. A plasmid-encoded regulatoryregion activates chromosomal eaeA expression in enteropathogenic Esche-richia coli. Infect. Immun. 63:1767–1776.

23. Grant, A. J., M. Farris, P. Alefounder, P. H. Williams, M. J. Woodward, andC. D. O’Connor. 2003. Co-ordination of pathogenicity island expression bythe BipA GTPase in enteropathogenic Escherichia coli (EPEC). Mol. Mi-crobiol. 48:507–521.

24. Haack, K. R., C. L. Robinson, K. J. Miller, J. W. Fowlkes, and J. L. Mellies.2003. Interaction of Ler at the LEE5 (tir) operon of enteropathogenicEscherichia coli. Infect. Immun. 71:384–392.

25. Hart, E., J. Yang, M. Tauschek, M. Kelly, M. J. Wakefield, G. Frankel, E. L.Hartland, and R. M. Robins-Browne. 2008. RegA, an AraC-like protein, is aglobal transcriptional regulator that controls virulence gene expression inCitrobacter rodentium. Infect. Immun. 76:5247–5256.

26. Igarashi, K., and A. Ishihama. 1991. Bipartite functional map of the E. coliRNA polymerase alpha subunit: involvement of the C-terminal region intranscription activation by cAMP-CRP. Cell 65:1015–1022.

27. Jerse, A. E., J. Yu, B. D. Tall, and J. B. Kaper. 1990. A genetic locus of



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

enteropathogenic Escherichia coli necessary for the production of attachingand effacing lesions on tissue culture cells. Proc. Natl. Acad. Sci. U. S. A.87:7839–7843.

28. Jobichen, C., M. Li, G. Yerushalmi, Y. W. Tan, Y. K. Mok, I. Rosenshine,K. Y. Leung, and J. Sivaraman. 2007. Structure of GrlR and the implicationof its EDED motif in mediating the regulation of type III secretion system inEHEC. PLoS Pathog. 3:e69.

29. Johansson, J., B. Dagberg, E. Richet, and B. E. Uhlin. 1998. H-NS and StpAproteins stimulate expression of the maltose regulon in Escherichia coli. J.Bacteriol. 180:6117–6125.

30. Keilty, S., and M. Rosenberg. 1987. Constitutive function of a positivelyregulated promoter reveals new sequences essential for activity. J. Biol.Chem. 262:6389–6395.

31. Kelly, M., E. Hart, R. Mundy, O. Marches, S. Wiles, L. Badea, S. Luck, M.Tauschek, G. Frankel, and R. M. Robins-Browne. 2006. Essential role of thetype III secretion system effector NleB in colonization of mice by Citrobacterrodentium. Infect. Immun. 74:2328–2337.

32. Lio, J. C., and W. J. Syu. 2004. Identification of a negative regulator for thepathogenicity island of enterohemorrhagic Escherichia coli O157:H7.J. Biomed. Sci. 11:855–863.

33. Liu, M., M. Tolstorukov, V. Zhurkin, S. Garges, and S. Adhya. 2004. Amutant spacer sequence between �35 and �10 elements makes the Placpromoter hyperactive and cAMP receptor protein-independent. Proc. Natl.Acad. Sci. U. S. A. 101:6911–6916.

34. Luperchio, S. A., and D. B. Schauer. 2001. Molecular pathogenesis ofCitrobacter rodentium and transmissible murine colonic hyperplasia. Mi-crobes Infect. 3:333–340.

35. Ma, J. C., A. J. Newman, and R. S. Hayward. 1981. Internal promoters of therpoBC operon of Escherichia coli. Mol. Gen. Genet. 184:548–550.

36. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. Agenetic locus of enterocyte effacement conserved among diverse enterobac-terial pathogens. Proc. Natl. Acad. Sci. U. S. A. 92:1664–1668.

37. Mellies, J. L., A. M. Barron, and A. M. Carmona. 2007. Enteropathogenicand enterohemorrhagic Escherichia coli virulence gene regulation. Infect.Immun. 75:4199–4210.

38. Mellies, J. L., S. J. Elliott, V. Sperandio, M. S. Donnenberg, and J. B. Kaper.1999. The Per regulon of enteropathogenic Escherichia coli: identification ofa regulatory cascade and a novel transcriptional activator, the locus of en-terocyte effacement (LEE)-encoded regulator (Ler). Mol. Microbiol. 33:296–306.

39. Miller, J. H. 1974. Experiments in molecular genetics. Cold Spring HarborLaboratory, Cold Spring Harbor, NY.

40. Mundy, R., T. T. MacDonald, G. Dougan, G. Frankel, and S. Wiles. 2005.Citrobacter rodentium of mice and man. Cell. Microbiol. 7:1697–1706.

41. Nagarajavel, V., S. Madhusudan, S. Dole, A. R. Rahmouni, and K. Schnetz.2007. Repression by binding of H-NS within the transcription unit. J. Biol.Chem. 282:23622–23630.

42. Nataro, J. P., D. Yikang, D. Yingkang, and K. Walker. 1994. AggR, atranscriptional activator of aggregative adherence fimbria I expression inenteroaggregative Escherichia coli. J. Bacteriol. 176:4691–4699.

43. Perna, N. T., G. F. Mayhew, G. Posfai, S. Elliott, M. S. Donnenberg, J. B.Kaper, and F. R. Blattner. 1998. Molecular evolution of a pathogenicityisland from enterohemorrhagic Escherichia coli O157:H7. Infect. Immun.66:3810–3817.

44. Porter, M. E., P. Mitchell, A. Free, D. G. Smith, and D. L. Gally. 2005. TheLEE1 promoters from both enteropathogenic and enterohemorrhagic Esch-erichia coli can be activated by PerC-like proteins from either organism. J.Bacteriol. 187:458–472.

45. Ralling, G., and T. Linn. 1984. Relative activities of the transcriptionalregulatory sites in the rplKAJLrpoBC gene cluster of Escherichia coli. J.Bacteriol. 158:279–285.

46. Russell, R. M., F. C. Sharp, D. A. Rasko, and V. Sperandio. 2007. QseA and

GrlR/GrlA regulation of the locus of enterocyte effacement genes in entero-hemorrhagic Escherichia coli. J. Bacteriol. 189:5387–5392.

47. Sambrook, J., and D. W. Russell. 2001. Molecular cloning, a laboratorymanual, 3rd ed. Cold Spring Harbor Press, Cold Spring Harbor, NY.

48. Sanchez-SanMartín, C., V. H. Bustamante, E. Calva, and J. L. Puente. 2001.Transcriptional regulation of the orf19 gene and the tir-cesT-eae operon ofenteropathogenic Escherichia coli. J. Bacteriol. 183:2823–2833.

49. Schauer, D. B., and S. Falkow. 1993. Attaching and effacing locus of aCitrobacter freundii biotype that causes transmissible murine colonic hyper-plasia. Infect. Immun. 61:2486–2492.

50. Schroder, O., and R. Wagner. 2000. The bacterial DNA-binding proteinH-NS represses ribosomal RNA transcription by trapping RNA polymerasein the initiation complex. J. Mol. Biol. 298:737–748.

51. Sharma, V. K., and R. L. Zuerner. 2004. Role of hha and ler in transcrip-tional regulation of the esp operon of enterohemorrhagic Escherichia coliO157:H7. J. Bacteriol. 186:7290–7301.

52. Sircili, M. P., M. Walters, L. R. Trabulsi, and V. Sperandio. 2004. Modula-tion of enteropathogenic Escherichia coli virulence by quorum sensing. In-fect. Immun. 72:2329–2337.

53. Smyth, C. P., T. Lundback, D. Renzoni, G. Siligardi, R. Beavil, M. Layton,J. M. Sidebotham, J. C. Hinton, P. C. Driscoll, C. F. Higgins, and J. E.Ladbury. 2000. Oligomerization of the chromatin-structuring protein H-NS.Mol. Microbiol. 36:962–972.

54. Sperandio, V., J. L. Mellies, R. M. Delahay, G. Frankel, J. A. Crawford, W.Nguyen, and J. B. Kaper. 2000. Activation of enteropathogenic Escherichiacoli (EPEC) LEE2 and LEE3 operons by Ler. Mol. Microbiol. 38:781–793.

55. Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999.Quorum sensing controls expression of the type III secretion gene transcrip-tion and protein secretion in enterohemorrhagic and enteropathogenic Esch-erichia coli. Proc. Natl. Acad. Sci. U. S. A. 96:15196–15201.

56. Stoebel, D. M., A. Free, and C. J. Dorman. 2008. Anti-silencing: overcomingH-NS-mediated repression of transcription in Gram-negative enteric bacte-ria. Microbiology 154:2533–2545.

57. Umanski, T., I. Rosenshine, and D. Friedberg. 2002. Thermoregulated ex-pression of virulence genes in enteropathogenic Escherichia coli. Microbiol-ogy 148:2735–2744.

58. Unniraman, S., M. Chatterji, and V. Nagaraja. 2002. DNA gyrase genes inMycobacterium tuberculosis: a single operon driven by multiple promoters. J.Bacteriol. 184:5449–5456.

59. Yang, B., and T. J. Larson. 1998. Multiple promoters are responsible fortranscription of the glpEGR operon of Escherichia coli K-12. Biochim. Bio-phys. Acta 1396:114–126.

60. Yang, J., D. L. Baldi, M. Tauschek, R. A. Strugnell, and R. M. Robins-Browne. 2007. Transcriptional regulation of the yghJ-pppA-yghG-gsp-CDEFGHIJKLM cluster, encoding the type II secretion pathway in en-terotoxigenic Escherichia coli. J. Bacteriol. 189:142–150.

61. Yang, J., C. Dogovski, D. Hocking, M. Tauschek, M. Perugini, and R. M.Robins-Browne. 2009. Bicarbonate-mediated stimulation of RegA, theglobal virulence regulator from Citrobacter rodentium. J. Mol. Biol. 394:591–599.

62. Yang, J., E. Hart, M. Tauschek, G. D. Price, E. L. Hartland, R. A. Strugnell,and R. M. Robins-Browne. 2008. Bicarbonate-mediated transcriptional ac-tivation of divergent operons by the virulence regulatory protein, RegA,from Citrobacter rodentium. Mol. Microbiol. 68:314–327.

63. Yang, J., M. Tauschek, E. Hart, E. L. Hartland, and R. M. Robins-Browne.2010. Virulence regulation in Citrobacter rodentium: the art of timing. Mi-crob. Biotechnol. 3:259–268.

64. Yang, J., M. Tauschek, R. Strugnell, and R. M. Robins-Browne. 2005. TheH-NS protein represses transcription of the eltAB operon, which encodesheat-labile enterotoxin in enterotoxigenic Escherichia coli, by binding toregions downstream of the promoter. Microbiology 151:1199–1208.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

transcriptional analysis of the grlra virulence operon ...activates transcription of all the major...

Documents